32 Tccs tenders in Jammu And Kashmir 2025

Get latest Tccs related Tenders, online published by Government Of Jammu And Kashmir, Governor Of Jammu And Kashmir, Jammu And Kashmir Academy Of Art Culture And Languages from Jammu And Kashmir state. Participate online through e-Procurement website for Tccs tenders in Jammu And Kashmir. Download Tender Documents, BOQ, Technical Bids for Tccs related Tenders from Jammu And Kashmir. Get Bidding support for etenders related to Tccs Tenders in Jammu And Kashmir. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Tccs tenders published from Jammu And Kashmir. Also get daily email alerts for Tccs related tender notices published by Government of Jammu And Kashmir.

1

Government Departments - Reasi - Jammu And Kashmir

47201178 tender for operation & manning and maintenance of tunnel ventilation, tunnel lighting, cctv, pa, sos/ip phones, scada, and fire fighting system etc. in between katra reasi section i.e. t 31, t 32, t 33, t 34 t 35 and tcc reasi & t 32 p2

Due Date : Jan 24, 2025
Tender Value : rupee 6.58 Crore
View Notice
2

Government Departments - kargil - Jammu And Kashmir

45775382 tender for supply of archery equipment required by dysso kargil for 2024 25

Due Date : Oct 25, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - srinagar - Jammu And Kashmir

38845045 tender for upgradation of yamberzal guest house at tcc sgr. ( by way of civil works including hut and boundary wall)

Due Date : Aug 4, 2023
Tender Value : rupee 7.08 Lakhs
View Notice
4

Government Departments - srinagar - Jammu And Kashmir

38792304 tender for completion of tcc by way of ceiling,walkways,electrical works and conpy for dg set, grill fencing including gate on jktdc side ski hire shop and sokage pit etc.( balance civil work only)

Due Date : Aug 1, 2023
Tender Value : rupee 11.05 Lakhs
View Notice
5

Government Departments - srinagar - Jammu And Kashmir

36470375 Corrigendum : tender for completion of tcc by way of ceiling, walkway and canopy for dg set grill including gate on jktdc side ski hire shop and soakage pit etc

Due Date : Mar 3, 2023
Tender Value : rupee 24.60 Lakhs
View Notice
6

Government Departments - srinagar - Jammu And Kashmir

34228972 repairs renovation and construction of storage cabin mini pantry of store office at tcc srinagar

Due Date : Oct 12, 2022
Tender Value : rupee 2.09 Lakhs
View Notice
7

Government Departments - srinagar - Jammu And Kashmir

34037102 repairs renovation and construction of storage cabin mini pantry of store office at tcc srinagar

Due Date : Sep 29, 2022
Tender Value : rupee 2.09 Lakhs
View Notice
8

Government Departments - srinagar - Jammu And Kashmir

33812316 repairs renovation and construction of storage cabin mini pantry of store office at tcc srinagar

Due Date : Sep 16, 2022
Tender Value : rupee 2.09 Lakhs
View Notice
9

Government Departments - kargil - Jammu And Kashmir

33808195 supply of games items supply of games items , games and sports , archery sets : 1 ) bow handle with bow stand ( kinetic / heat / hoyt / bear ) .2 ) limbs ( active korea accrete ) . 3 ) bow string 3d. 4 ) clicker ( strak ) . 5 ) sighter

Due Date : Sep 16, 2022
Tender Value : Ref. Document
View Notice
10

Government Departments - srinagar - Jammu And Kashmir

33543597 repairs renovation and construction of storage cabin mini pantry of store office at tcc srinagar

Due Date : Aug 30, 2022
Tender Value : rupee 2.09 Lakhs
View Notice
11

Government Departments - Srinagar - Jammu And Kashmir

32560610 completion of tcc by way of ceiling, walkway and canopy for d.g. set, grill including gate on jktdc side ski hire shop and soakage pit etc.

Due Date : Jun 14, 2022
Tender Value : rupee 24.71 Lakhs
View Notice
12

Government Departments - Up gradation of TCC Division office washroom, sub - Jammu And Kashmir

29578703 up gradation of tcc division office washroom, sub division wash room and direction office washroom of rtic department jammu

Due Date : Oct 29, 2021
Tender Value : rupee 39200.0
View Notice
13

Government Departments - Jammu And Kashmir

29567914 bids are invited for pdv primer 1 pdv f 5 agtttccgctgaagattgg 3 pdv r 5 acagactcggcttccttga 3 , pdv primer 2 pdv f 5 aaa gaa gag aag tcc gac aag 3’pdv r 5 aag cag cat ttc caa cta cga 3 , ppv primer 1 ppv f (5 acatagcagagacaggattg 3ppv r 5

Due Date : Oct 26, 2021
Tender Value : Ref. Document
View Notice
14

Government Departments - Improvement and modification of balance work of D1 - Jammu And Kashmir

29521615 Corrigendum : improvement and modification of balance work of d16 and renovation of d9 quarters of rtic department and improvement of electrification of tcc division jammu

Due Date : Nov 5, 2021
Tender Value : rupee 23.04 Lakhs
View Notice
15

Government Departments - KARGIL - Jammu And Kashmir

28633154 supply of games and sports items supply of games and sports items , games and sports items , archery sets : 1 ) bow handle with bow stand ( kinetic / heat / hoyt / bear ) .2 ) limbs ( active korea accrete ) . 3 ) bow string 3d. 4 ) clicke

Due Date : Aug 10, 2021
Tender Value : Ref. Document
View Notice
16

Government Departments - TRC Srinagar - Jammu And Kashmir

27323553 providing of all in one computer , laptops and refrigerator for directorate office at tcc srinagar .

Due Date : Mar 17, 2021
Tender Value : Ref. Document
View Notice
17

Government Departments - TCC Srinagar - Jammu And Kashmir

27323552 providing additional delegate units already existing conference system in the meeting hall at tcc srinagar and providing of inverter system to the video conference system .

Due Date : Mar 17, 2021
Tender Value : Ref. Document
View Notice
18

Government Departments - TCC Srinagar - Jammu And Kashmir

27323550 restoration repairing of damaged 100 kva three phase servo controlled voltage stabilizer at tcc srinagar .

Due Date : Mar 17, 2021
Tender Value : Ref. Document
View Notice
19

Government Departments - TCC Srinagar - Jammu And Kashmir

27323549 supply and installation of fire extinguishing equipments at tcc srinagar .

Due Date : Mar 17, 2021
Tender Value : Ref. Document
View Notice
20

Government Departments - SRINAGAR - Jammu And Kashmir

27215945 construction of main entry doors / gate to main block at tcc srinagar

Due Date : Mar 9, 2021
Tender Value : Ref. Document
View Notice
21

Government Departments - SRINAGAR - Jammu And Kashmir

27215127 providing water supply to tcc at srinagar

Due Date : Mar 9, 2021
Tender Value : Ref. Document
View Notice
22

Government Departments - SRINAGAR - Jammu And Kashmir

27215125 repairs / renovation of main block at tcc srinagar . ( by way of repairs to damaged walls and construction of notice board )

Due Date : Mar 9, 2021
Tender Value : Ref. Document
View Notice
23

Government Departments - TCC - Jammu And Kashmir

24851255 supply and installation of desert cooler in tcc division jammu of make symphony/ bajaj or equivalent ( complete job )

Due Date : Jul 17, 2020
Tender Value : rupee 10000.0
View Notice
24

Government Departments - TCC Srinagar - Jammu And Kashmir

22570172 supply , installation , testing and commissioning of 125 kva diesel generator set at tcc srinagar

Due Date : Nov 26, 2019
Tender Value : rupee 13 Lakhs
View Notice
25

Government Departments - TCC Div - Jammu And Kashmir

20936431 construction, building construction, building repair

Due Date : Jul 17, 2019
Tender Value : rupee 42000.0
View Notice
26

Government Departments - TCC Div - Jammu And Kashmir

19565391 construction, civil construction, toilet bathroom

Due Date : Mar 4, 2019
Tender Value : rupee 32500.0
View Notice
27

Government Departments - Satwari - Jammu And Kashmir

18620845 auction, scraps, scrap

Due Date : Jan 10, 2019
Tender Value : Ref. Document
View Notice
28

Government Departments - Tourist City Centre - Jammu And Kashmir

18503420 construction, building material, composite panel, fencing work, wall construction

Due Date : Dec 21, 2018
Tender Value : rupee 19 Lakhs
View Notice
29

Government Departments - Satwari - Jammu And Kashmir

17835333 auction, electronics scrap, e waste, scraps, scrap

Due Date : Nov 5, 2018
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - CSIR-IIIM, Jammu - Jammu And Kashmir

16064097 distribution and conditioning, pumps, pump supply

Due Date : May 24, 2018
Tender Value : rupee 1.0
View Notice
31

Government Departments - Guard Room TCC Srinagar - Jammu And Kashmir

15371359 construction, civil construction, civil work, building construction, building work

Due Date : Mar 9, 2018
Tender Value : rupee 33 Lakhs
View Notice
32

Government Departments - Satwari Store Tcc Division, Jammu - Jammu And Kashmir

13627616 auction, scraps, scrap

Due Date : Sep 28, 2017
Tender Value : rupee 2.64 Lakhs
View Notice
Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail