}
  • Home   ›
  •   Indian Tenders   › Tender Notice : 51867736

    • Tender For Primers And Probes Make- Eurofine, Pune-Maharashtra

    Tender Notice

    51867736
    Tender For Primers And Probes Make- Eurofine
    Tender
    Indian
    Maharashtra
    Pune
    25-10-2025

    Tender Details

    Tender For Primers And Probes Make- Eurofine; 1. Primer Name: Zaire ZEBOV FWD_ Sequence TGGAAAAAACATTAAGAGAACACTTGC, No. of bases: 27, Scale of synthesis: 50 nm DNA oligo. 6 Eurofins 2. Primer Name: Zaire ZEBOV REV_Sequence: AGGAGAGAAACTGACCGGCAT, No. of bases: 21, Scale of synthesis: 50 nm DNA oligo. 6 Eurofins 3. Primer Name: Zaire ZEBOV Probe_Sequence: FAM-CATGCCGGAAGAGGAGACAACTGAAGC-BHQ1. No. of bases: 27,Scale of synthesis: 50nm DNA oligo make: Eurofine 9 Eurofins

    Key Value

    Document Fees
    Refer document
    EMD
    Refer document
    Need a Bussiness Loan? Apply Now!
    Tender Value
    INR 2.41 Lakhs /-

    Attachment

    FileName File Description File Size
    Click here to download tender document Tender Documents 0 KB
    Click here to download tender document Tender Documents 0 KB
    Click here to download tender document Tender Documents 0 KB
    Disclaimer :
    We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
    Tell us about your Product / Services,
    We will Find Tenders for you
    RBTendersdetails2
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail