Chemical Oil And Gas Tenders from India

3437 Chemical Oil And Gas tenders are published by various Tendering Authorities & Private companies. 3437 live Tender for Chemical Oil And Gas are available in Chemical Oil And Gas Tender section You can further filter Chemical Oil And Gas tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Government Departments - jhansi - Uttar Pradesh

50009626 supply of paint enamel synthetic exterior signal red finishing to is : 8662/2004 with additional requirements to spec icf/md/spec-045,issue status 02 revision 03

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Bokaro Steel City - Jharkhand

50009505 tender for chemical dosing system installation, operation, and maintenance .

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Bokaro Steel City - Jharkhand

50009463 tender for operation, inspection and routine maint. of pas4, oil cellar 3, emulsion .

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Guntur - Andhra Pradesh

50009393 tender for t178: procurement and supply of medicines t179: procurement and supply of surgical consumables & t180: procurement and supply of reagents & consumables

Due Date : Jul 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - lallaguda - Telangana

50009227 supply of petroleum hydrocarbon solvent (thinner), grade - solvent 145/205

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - MUMBai - Maharashtra

50009206 eoi for calling offers from reputed agencies for the work of availing carbon credits on behalf of mahagenco & trading it at an international/national platform to earn revenue for mahagenco.

Due Date : Jul 31, 2025

Tender Value : Ref. Document

View Notice

Government Departments - north 24 Parganas - West Bengal

50009178 tender for supply and delivery of residual chlorine testing kits for testing of residual chlorine at different ground water based piped w/s scheme within hasnabad and minakhan block in the district of north 24 pgs. under eastern mechanical sub division

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - north 24 Parganas - West Bengal

50009171 tender for supply and delivery of residual chlorine testing kits for testing of residual chlorine at different ground water based piped wis scheme within sandeshkhali-i& ll block in the district of north 24 pgs. under eastern lvlechanical sub division-

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

50009139 tender for repair and return of helium liquefier

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - delhi - Delhi

50009105 tender for invitation of bids for the supply of flare 2x1x8 mtv, flare 2x1x8 ms and flare 26 mm

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - agartala - Tripura

50009051 tender for procurement & installation of 03 nos. of medium liquid nitrogen plant along with 125kva voltage stabilizer for west tripura to strengthen ai network in tripura during the year 2025-26 i.e. till the procurement & installation of 3 nos., ln2 pla

Due Date : Jul 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - sriharikota - Andhra Pradesh

50009040 tender for for supply of refrigerated helium liquid(lhe)

Due Date : Jul 28, 2025

Tender Value :

8.88 Crore

View Notice

Boards / Undertakings / PSU - New Delhi - Delhi

50009021 supply of mag pea & mag powder

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Bikaner - Rajasthan

50009007 tender for nit-13 for supply of general items 2025-26

Due Date : Jul 15, 2025

Tender Value :

9.50 Lakhs

View Notice

Government Departments - noida - Uttar Pradesh

50009005 tender enquiry for chemical/reagent/kits

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Cooperative - Kolhapur - Maharashtra

50008942 tender for supply of 51 m.t. of caustic soda (flakes) and 20 m.t of washing soda

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jaipur - Rajasthan

50008931 rate contract for one year for the purchase of reagents and other consumable items of snibe used in maglumi 800 machine, tender year 2025-26

Due Date : Jul 14, 2025

Tender Value :

30 Lakhs

View Notice

Boards / Undertakings / PSU - Gurgaon - Haryana

50008924 supply of coke drum replacement, allied modernization and piping works in delayed coker unit of panipat refinery at iocl, panipat coke drum replacement, allied modernization and piping works in delayed coker unit of panipat refinery at iocl, panipat

Due Date : Aug 8, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kochi - Kerala

50008840 tender for supply of chemicals

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Chamba - Himachal Pradesh

50008459 tender for supply of rod, gi sheet, tiles, angle, pvc pipe, cement,brick,gravel, ceiling sheet, electrical wiring items, jcb cutting, sanitary hardware, paint.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mancheswar - Odisha

50008435 supply of exterior paint finishing - grass green (isc no.218), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requirements of icf/md/spec-

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kolkata - West Bengal

50008131 supply of boron free coolant for diesel

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kota - Rajasthan

50008065 supply of supply of argon gas (consisting of 98% argon + 2% oxygen gas at n.t.p.) in firms returnable cylinders of 7cum capacity. note: - 1. firm should make delivery of gas cylinders at consignees premise as and when required. 2. number of cylinders

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Sabarmati - Gujarat

50007993 supply of oil level glass

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mancheswar - Odisha

50007992 supply of internal combustion engine crankcase oil, grade - 20w/40.

Due Date : Jul 29, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - morbi - Gujarat

50007923 tender for bi-annual rate contract for purchase of petrol, diesel and oil at retail rate for vehicles owned by morbi.

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhusawal - Maharashtra

50007922 supply of liq salicylic acid 16.7% + lactic acid 16.7%

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - uppal - Telangana

50007884 tender for procurement of chemical products

Due Date : Jul 11, 2025

Tender Value :

4.50 Lakhs

View Notice

Government Departments - kolkata - West Bengal

50007760 supply of running contract for light liquid paraffin 100 ml bottle.

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - uppal - Telangana

50007690 tender for procurement of chemical products

Due Date : Jul 11, 2025

Tender Value :

3 Lakhs

View Notice

Government Departments - izzatnagar - Uttar Pradesh

50007681 supply of argon gas

Due Date : Aug 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

50007651 bids are invited for 4393-4881 - l143 - hocut 795 h oil - qty 1881 liters total quantity : 1881

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Government Departments - 24 Paraganas South - West Bengal

50007607 bids are invited for soda lime (as carbon dioxide absorbent) as per is 5321 (q3) mse total quantity : 10

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

50007605 bids are invited for liquid nitrogen storage equipment (q3) total quantity : 1

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

50007552 bids are invited for 1 h-2 8305-000165-casd cloth hessain light 100 cm wide 2 k-5 7920-000016-casd broom sweeping 3 g2 9505-000058 wire steel mild annealed 5.00mm 4 g1 5315-000824 nails steel wire round 75 mm x 2.8 mm 5 h1 c 8030-000047 dubbing o

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Palghar - Maharashtra

50007533 bids are invited for sodium hypochlorite (industrial grade) - ongc (q3) mse total quantity : 700

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur - Uttar Pradesh

50007512 bids are invited for oil antiwear type, hydrol 32oil servo system- 32-enclo-32 make- ioc-hpc-bpc , case (defence) total quantity : 11337

Due Date : Jul 19, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Koraput - Odisha

50007487 bids are invited for 1 al oil stone 150x6xtri a150l9v 2 al oxide oil stone 150x13xtri 3 al oxide cloth roll 20x50 grit-80 4 al oxide cloth roll 55x50 grit-220 5 silicon carbide oil stone 100x6xtri 6 silicon carbide oil stone 100x8xtri total

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Shivamogga - Karnataka

50007485 bids are invited for poly aluminium chloride , poly aluminium chloride (ongc) total quantity : 10000

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Cuddalore - Tamil Nadu

50007483 bids are invited for furnace oil conforming to is: 15931982 total quantity : 26120

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nalanda - Bihar

50007439 bids are invited for soda ash, technical for bulk purchase - is 251 total quantity : 8

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Tiruchirappalli - Tamil Nadu

50007431 bids are invited for r-410a refrigerant gas with cylin- der[ di- fluro methane[ r32] 50% , penta fluoro ethane[ r12 r-410a refrigerant gas with cylin- der [ di- fluro , refrigeration gas chlorodifluoro methane type cfm 22 (r total quantity : 300

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bastar - Chhattisgarh

50007402 bids are invited for sweeping broom (v3) (q4) , stable bleaching powder (v2) for household and industrial use conforming to is 1065 (part 1) (q3) , dust pans (q4) , scrubbing brush (q3) mse total quantity : 290

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

50007400 bids are invited for argon gas 99.998% purity with h2o less than 4 ppm, o2 less than 5 ppm, h2 less than 2 ppm. , refrigerant gas total quantity : 1001

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Meerut - Uttar Pradesh

50007394 bids are invited for rangoli colours total quantity : 50000

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

50007393 bids are invited for 2ii armour steel plate size: 4mm thick x 1100mm width x 2600mm length, specification tempered & hard 2ii armour steel plate size: 4mm thick x 1100mm width x 2600mm length, specification tempered & , universal indicator total quan

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

50007353 bids are invited for paint readymixed air drying white semiglossy finish for generalpurpose brushing to specn. is: 168-1993 paint ready mixed air drying white semiglossy finish for , paint ready mixed air drying white total quantity : 830

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Thanjavur - Tamil Nadu

50007343 bids are invited for summer headset system (leather helmet) , riot control helmet with accessories (mha) caution / crime scene tape (v2) total quantity : 2

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Thane - Maharashtra

50007328 bids are invited for pressure disc of tgu. drg. no. - 175-47-024 , antimicrobial susceptibility testing discs pressure sensitive adhesive tapes plastic base as per is: total quantity : 141

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Delhi - Delhi

50007312 supply of sodium hypo chlorite solution for various tubewells under ae(e and m)-iv.

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

50007280 bids are invited for bs2x34 light grey gloss , bs381c-103 , electrical insulating paint total quantity : 60

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jodhpur - Rajasthan

50007275 bids are invited for sulphuric acid (v2) conforming to is 266 (q3) mse total quantity : 425

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nalanda - Bihar

50007269 bids are invited for hard ptfe sheet size: 1500 x 1500 x 8 mm thick , expanded ptfe sheet size: 1000x1000x1mm thick , expanded ptfe sheet size: 1000x1000x2 mm thick , expanded ptfe sheet size: 1000x1000x3 mm thick , hard ptfe sheet, size- 1500x1500x3

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

50007255 bids are invited for capcell with adhesive size 215 mm x 178 mm x 12 mm thick. also having spec. indme1023 (prov) lat , capcell with adhesive size 215 mm x 178 mm x 4 mm thick, also having spec. ind-me-1023 (prove) lat capcell with adhesive size 215

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bathinda - Punjab

50007216 bids are invited for tender for sanitation items.- toilet cleaner harpic (in 500ml packing) , sta v vim dish wash powder, t0ilet soap, liquid soap (in 1lt plastic can packing , sta n nails, 2 inch, black liquid phenyl 5 ltr packing total quantity : 255

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Shivamogga - Karnataka

50007202 bids are invited for caustic soda , caustic soda - (solid and lye) for ongc as per is 252 total quantity : 3775

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Thiruvallur - Tamil Nadu

50007194 bids are invited for packing cover drg no 172 43 024 , carbon steel forgings for general engineering purposes- is:2004 total quantity : 400

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jhansi - Uttar Pradesh

50007187 bids are invited for hydrochloric acid (hcl) as per is: 265 in packing size of 50 kgs. , hydrochloric acid in tankers (v2) as per is 265 total quantity : 25000

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Haridwar - Uttarakhand

50007185 bids are invited for ferro vanadium , ferro vanadium for sail total quantity : 25000

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025

Tender Value :

38 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Tiruchirappalli - Tamil Nadu

50007142 bids are invited for ptfe coating material ( weapon grade) as per the specification enclosed in the annexure , paint (v3) confirming to is 2932 total quantity : 1120

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50007140 bids are invited for oil servo mesh sp 220 (nsn9150-720500390) , gear lubricants for enclosed industrial gear drives conforming to is 8406 total quantity : 7140

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Medinipur West - West Bengal

50007115 bids are invited for isopropyl alcohol (2 - propanol) (q3) mse total quantity : 60

Due Date : Jul 22, 2025

Tender Value :

1.35 Lakhs

View Notice

Government Departments - Chittorgarh - Rajasthan

50007114 bids are invited for unused mineral insulating oils for transformers and switch gear (q2) mse total quantity : 25080

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - kameng - Arunachal Pradesh

50007100 bids are invited for kerosene oil fired bukhari complete with exhaust pipes (mha) (q3) total quantity : 34

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Dhanbad - Jharkhand

50007093 bids are invited for rate contract for procurement of liquid nitrogen at hurl, sindri on gem portal. , nitrogen gas as per is 1747 liquid nitrogen storage equipment total quantity : 380

Due Date : Jul 26, 2025

Tender Value :

55 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - 24 Paraganas North - West Bengal

50007091 bids are invited for dissolve acetylene gas as per is 308 (q3) total quantity : 3000

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - goa - Goa

50007073 bids are invited for lab reagent 1 - centaur t3 80t , lab reagent 2 - centaur t4 100t , lab reagent 3 - centaur tsh 100t , lab reagent 4 - kit samples tips , lab reagent 5 - kit, cuvettes 3000 pack , lab reagent 6 - kit, sample cup 1500 pa , lab reag

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - ajmer - Rajasthan

50006895 supply of paint ready mixed white finish to is:13607/1992 with amndt. 2, packing in 20 litres non returnable new ms drum.

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kharagpur - West Bengal

50006886 supply of grease for traction motor roller suspension bearing.

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jaipur - Rajasthan

50006832 supply of root canal lubricant - glyde - edta 15 % with carbamide peroxide 10 % (pfs - 03 ml each)

Due Date : Aug 6, 2025

Tender Value : Ref. Document

View Notice

Government Departments - ratlam - Madhya Pradesh

50006639 providing and fixing side pathway and epoxy painting on various major/important track bridges in jurisdiction of sse/br/ujn and sse/br/rtm & strengthening of br- no 232 dn (4x30.5m)under sse br rtm.

Due Date : Aug 8, 2025

Tender Value :

8.28 Crore

View Notice

Local Bodies - Bhilwara - Rajasthan

50006592 tender for black phenyl pesticides powder and chemical supply work

Due Date : Jul 11, 2025

Tender Value :

5 Lakhs

View Notice

Boards / Undertakings / PSU - Jaipur - Rajasthan

50006458 tender for 1. chemical for ultra low volume cold aerosol with mist applicator 2. sodium hypochlorite 3. soda lime medical grade 4. enzymatic detergent with four 5. enzymes for instrument cleaning

Due Date : Jul 28, 2025

Tender Value :

1 Crore

View Notice

Government Departments - Jaipur - Rajasthan

50006394 running of existing c scheme, gopalbadi pumphouses, which includes complete operation of pump motor, maintenance of log-books as directed by engineer-in-charge, general upkeeping of premises, security arrangements, regular chemical dosing in cwr, cleaning

Due Date : Jul 14, 2025

Tender Value :

10.98 Lakhs

View Notice

Government Departments - faizabad - Haryana

50006274 tender for comprehensive maintenance of gaseous type full vacuum chlorination system and refilling of chlorine gas cylinders installed

Due Date : Jul 11, 2025

Tender Value :

8.78 Lakhs

View Notice

Government Departments - lallaguda - Telangana

50005924 supply of hq_med_(ph no.:30010) co-enzyme q cap 100 mg.

Due Date : Aug 5, 2025

Tender Value : Ref. Document

View Notice

Cooperative - karnal - Haryana

50005181 tender for oxygen gas cylinder , refilling of oxygen gas cylinder (water cap. should be 46.7 ltrs) pressure 120-140 kg/cm2

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Tiruvallur - Tamil Nadu

50004819 bids are invited for rh middle engaging ring forging 172.40. 329-f , carbon steel forgings for general engineering purposes- is:2004 total quantity : 129

Due Date : Jul 29, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Hoshangabad - Madhya Pradesh

50004809 bids are invited for potassium nitrate gr-i size 125 micron total quantity : 9717

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Sangareddy - Telangana

50004765 bids are invited for b7k1y64725 cables for kutch chemicals maa1032 project , signal/ triad cable total quantity : 1

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thane - Maharashtra

50004743 bids are invited for am-241 radioactive liquid standard solution , fluoride standard solution total quantity : 1

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Tiruvallur - Tamil Nadu

50004736 bids are invited for booster 175.40. 027-2-f , carbon steel forgings for general engineering purposes- is:2004 total quantity : 377

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Allahabad - Uttar Pradesh

50004735 bids are invited for dafc 60% (indigenous) total quantity : 1890

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - palakkad - Kerala

50004715 bids are invited for loctite-270 total quantity : 1542

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Sangareddy - Telangana

50004698 bids are invited for fully machined forging hub to drg no: 765-34-41 , universal indicator total quantity : 935

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Ganjam - Odisha

50004687 bids are invited for oil alpha syn ep 320 , gr castrol pd00 , gr castrol lzv ep energrease mobile gear ogl 461 shall malleus ohg , oil aeroshell flud 5m or aerosheel fluid5 l oil nycolube 3525 , pd semi fluid gr , castrol opt gear synthetic 150 gear

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Ganjam - Odisha

50004686 bids are invited for n 52 oil kluber isoflex topas (isoflex (r) topas nb 52 isoflex (r) topas nb 152) , oil ox-52-defence (v2) total quantity : 57

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Krishna - Andhra Pradesh

50004665 bids are invited for ptfe teflon tape used in self closing valves of lpg cylinders (q3) total quantity : 20000

Due Date : Jul 26, 2025

Tender Value :

8.26 Lakhs

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

50004664 bids are invited for internal combustion engine crankcase oils for automotive application (diesel and gasoline) as per is: 13656 , hydraulic oil 68 conforming to is-10522-1983 or latest amendment , engine oil -15w40(ci-4) conforming to is 13656- 02 o

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

50004634 bids are invited for chemical resistant epoxide finishing paint , epoxy based zinc rich primer paint , micaceous iron oxide paint , ready mixed paint, air drying, red oxide - zinc phosphate, priming as per is 12744 total quantity : 2220

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhadradri Kothagudem - Telangana

50004626 bids are invited for supply zinc sulphate powder (hepta hydrate grade) shall conform to is-1880-1977 supply zinc sulphate powder (hepta hydrate grade) shall , zinc sulphate heptahydrate, industrial grade as per is 1880 total quantity : 4000

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - kochi - Kerala

50004280 procurement of suit tychem 4000s chemical resistance

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - delhi - Delhi

50004103 tender for procurement of oil om 150

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Cooperative - kolhapur - Maharashtra

50003879 tender for supply of 51mt of caustic soda(flakes) and 20 mt of washing soda.

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Tiruppur - Tamil Nadu

50003746 bids are invited for 24 di nitro phenyl hydrazine , acetone , ammonium hydroxide solution , ammonium sulphate , bromine water , d glucose , ethyl alcohol , ferrous sulphate , nesslers reagent , hydrochloric acid , nitric acid , magneson reagent , sul

Due Date : Jul 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50003709 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) (( 3 3 2 lakh (s) )) total quantity : 214

Due Date : Jul 16, 2025

Tender Value :

50000.0

View Notice

Boards / Undertakings / PSU - Mumbai Suburban - Maharashtra

50003630 bids are invited for refrigerant gas r 22 , refrigerant gas total quantity : 5

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

50003624 bids are invited for automatic transformer oil breakdown voltage test kit , live remote temperature and humidity monitoring and alert system total quantity : 1

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

100

Government Departments - Sonbhadra - Uttar Pradesh

50003582 bids are invited for empty hydrogen cylinder , empty carbon dioxide cylinder , empty n2 cylinder , refillable seamless steel gas cylinder - is 7285 total quantity : 698

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Top