Paint Supply Tenders from India

262 Paint Supply tenders are published by various Tendering Authorities & Private companies. 262 live Tender for Paint Supply are available in Paint Supply Tender section You can further filter Paint Supply tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Local Bodies - Kolkata - West Bengal

50052218 tender for rust removal, chemical washing, primer application and painting with other allied works of top surface of administrative building adjoining portion of machine shop shed at ews

Due Date : Jul 16, 2025

Tender Value :

2.99 Lakhs

View Notice

Government Departments - jhansi - Uttar Pradesh

50051827 supply of paint enamel synthetic

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kanpur - Uttar Pradesh

50051476 supply of paint enamel synthetic

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jodhpur - Rajasthan

50051360 supply of full gloss polyurethane enamel two pack exterior finishing to rdso m&c/pcn/100/2024, color silver grey-to ral-7001.

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kharagpur - West Bengal

50050658 supply of supply of full gloss pu enamel (two pack) exterior finishing top coat paint.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Nagpur - Maharashtra

50050191 supply of paint enamel synthetic exterior white finishing to is: 8662/2004

Due Date : Aug 6, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jodhpur - Rajasthan

50050100 supply of paint enamel synthetic brushing finishing exterior golden yellow to isc-356 of is:5/2007 , to is:8662-2024 , with additional requirement stipulated in icf specification icf/md/spec.-045, status 02, rev. 03.

Due Date : Jul 29, 2025

Tender Value : Ref. Document

View Notice

Government Departments - perambalur - Tamil Nadu

50049548 supply of paint black japan type b

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - wazirabad - Delhi

50048245 supply and application of paint for various equipments of 2nd 40mgd plant at wazirabad water works. (re-invite)

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - samba - Jammu And Kashmir

50047671 tender for maintenance and repair works at samba and kathua district for the financial year2025-26

Due Date : Jul 17, 2025

Tender Value :

10 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kanpur - Uttar Pradesh

50046420 bids are invited for paint deep orange , pu paint blood red , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 36

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhavnagar - Gujarat

50046014 supply of paint remover.

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Sangareddy - Telangana

50044631 bids are invited for spirit based zircon paint ready mixed total quantity : 12000

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Imphal West - Manipur

50044473 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932,enamel total quantity : 1636

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

50044374 bids are invited for stainless steel foil , zinc chromate primer , lacing chord black , felt , woolen yarn total quantity : 605

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Bokaro - Jharkhand

50042945 bids are invited for paint black bituminready mixed branded , paint s e azure blue branded , paint s e sea green branded , paint s e bus greenbranded , paint s e smoke grey branded , paint s e p ored branded , paintsynthetic enamel whitebranded , pai

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ganjam - Odisha

50042899 bids are invited for enamel paint smoke gray pack size- 4 ltr as per technical specification , enamel paint golden yellow pack size- 1 ltr as per technical specification , enamel paint cheery red pack size- 1 ltr as per technical specification , enam

Due Date : Jul 28, 2025

Tender Value :

46000.0

View Notice

Statutory Bodies & Commissions/Committees - Kanpur - Uttar Pradesh

50042844 bids are invited for pu paint black , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 50

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur - Uttar Pradesh

50042830 bids are invited for primer , etch primer total quantity : 100

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Koraput - Odisha

50042371 bids are invited for enamel ep-140(yellow) , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 6

Due Date : Jul 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Gujarat

50040428 tender for procurement and application of zinc rich paint for esp structure & coal mill structures of boiler unit no. 3 & 4 at sikka tps.

Due Date : Jul 21, 2025

Tender Value :

38.05 Lakhs

View Notice

Government Departments - chennai - Tamil Nadu

50038540 supply of full gloss polyurethane enamel two pack exterior finishing

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jamnagar - Gujarat

50033893 supply and application of zinc rich paint for flue gas duct structure from air preheater out to chimney inlet in boiler unit no. 3 at sikka tps.

Due Date : Jul 28, 2025

Tender Value :

49.45 Lakhs

View Notice

Cooperative - Kolar - Karnataka

50033244 tender for branding of shops

Due Date : Aug 6, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Nagpur - Maharashtra

50032406 supply of paint alkyd modified synthetic enamel etc

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - hubbali - Karnataka

50031958 supply of paint pu-based top coat

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Mumbai - Maharashtra

50028011 supply of ecofriendly paint for idol makers (murtikars) of ganapati idols on pilot basis for ganesh festival 2025

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Gujarat

50027734 corrigendum : supply of supply, installation and commissioning of airless spray-painting machine.

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50027606 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) (( 3 3 2 lakh (s) )) total quantity : 214

Due Date : Jul 16, 2025

Tender Value :

50000.0

View Notice

Government Departments - Harnaut - Bihar

50026996 supply of paint remover solvent type non flammable is: 430 1972 (re-affirmed 2009).

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

50025480 supply of paint enamel synthetic exterior- post office red finishing(isc no-538), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requireme

Due Date : Jul 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

50021962 bids are invited for chlorinated rubber based primer,chlorinated rubber based finish paint total quantity : 640

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mumbai - Maharashtra

50021915 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) , ready mixed paint, air drying, red oxide - zinc phosphate, priming as per is 12744 (q3) total quantity : 709980

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - udaipur - Rajasthan

50019022 tender for supply of paint material for msrgy (mukhyamantri shehri rojgaar guarantee yojana) work (municipal corporation udaipur) (e_14 / nirman_02) - supply of sandpaper( at nagar nigam msrgy store including loading , unloading , transportation in all re

Due Date : Jul 14, 2025

Tender Value :

30 Lakhs

View Notice

Government Departments - Jhansi - Uttar Pradesh

50017262 bids are invited for pu paint to shade 697 of is: 5 as per spec. tre-165 rev. 01 in packing size of 20 litre,matching th total quantity : 320

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhubaneswar - Odisha

50015853 supply of phiroza blue paint.

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jamshedpur - Jharkhand

50015778 supply of alkyd modified synthetic enamel, uv resistant, high gloss and colour retention, grass gr een (isc no. 218),

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Harnaut - Bihar

50015704 supply of paint black japan ...............

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mysore - Karnataka

50015518 corrigendum : supply of paint enamel, synthetic exterior finishing to is: 8662: 2024 with rdso amendment no. 1 (rev.0) for pigment content as an additional requirement to is: 8662-2024. colour shade to ral 070 80 40 (apricot yellow) with additional r

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Alwar - Rajasthan

50011198 bids are invited for fig 11 tin sheet , paint og , paint blue , paint yellow , chuna total quantity : 690

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chandigarh - Chandigarh

50011173 bids are invited for paint deep orange , putty c base , thinner ac antichell , pu paint black , pu paint mint green , epoxy grey paint , thinner for epoxy paints (bhel) total quantity : 118

Due Date : Jul 29, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Amreli - Gujarat

50011144 bids are invited for paint roller 4 inch , paint roller 12 inch , distemper white , paint roller 6 inch , paint brush 4 inch , paint roller 7 inch 177 8 mm c w artificial fur and handle , paint roller 9 inch , spray hand liquid insecticide , paint br

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jhansi - Uttar Pradesh

50010519 bids are invited for epoxy orange brown paint - refer attached document for detailed reference , epoxy light biscuit paint - refer attached document for detailed reference , epoxy yellow golden paint - refer attached document for detailed reference ,

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jhansi - Uttar Pradesh

50009626 supply of paint enamel synthetic exterior signal red finishing to is : 8662/2004 with additional requirements to spec icf/md/spec-045,issue status 02 revision 03

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Chamba - Himachal Pradesh

50008459 tender for supply of rod, gi sheet, tiles, angle, pvc pipe, cement,brick,gravel, ceiling sheet, electrical wiring items, jcb cutting, sanitary hardware, paint.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mancheswar - Odisha

50008435 supply of exterior paint finishing - grass green (isc no.218), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requirements of icf/md/spec-

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

50007353 bids are invited for paint readymixed air drying white semiglossy finish for generalpurpose brushing to specn. is: 168-1993 paint ready mixed air drying white semiglossy finish for , paint ready mixed air drying white total quantity : 830

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

50007280 bids are invited for bs2x34 light grey gloss , bs381c-103 , electrical insulating paint total quantity : 60

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025

Tender Value :

38 Lakhs

View Notice

Government Departments - ajmer - Rajasthan

50006895 supply of paint ready mixed white finish to is:13607/1992 with amndt. 2, packing in 20 litres non returnable new ms drum.

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50003709 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) (( 3 3 2 lakh (s) )) total quantity : 214

Due Date : Jul 16, 2025

Tender Value :

50000.0

View Notice

Statutory Bodies & Commissions/Committees - Jhansi - Uttar Pradesh

50002294 bids are invited for paint finishing matt rfu air drying sand , paint rfu syn spr white , paint rfu green for armoured vehicles , paint air dry br spr syn ena dark grey , paint rfu blue for armoured vehicles , zink paste for armoured vehicles , paint

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

50002092 bids are invited for paint red , paint black , paint white , paint blue , paint yellow , terracotta , lime , geru total quantity : 21700

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Palghar - Maharashtra

50001719 bids are invited for intrguard 263 faj 034 a light grey , interguard 403 red aluminium , interthane 990 signal green phl 549a , interguard 262 red kha 304a , intertuf 262 kha 303a red as a tie coat , interswift 6800 black , interswift 6800 hs bma 684

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

50001316 bids are invited for paint signal red , paint navy blue , paint rfu finishing exterior synthetic dark grey , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 80

Due Date : Jul 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Chhattisgarh

49999611 wooden court and artistic paint in indoor hall at distirct sports complex,seepat road,bilaspur c.g

Due Date : Jul 16, 2025

Tender Value :

22.31 Lakhs

View Notice

Cooperative - baghpat - Uttar Pradesh

49999460 tender for supply of industrial and decorative burger/universal make paints for year, 2025-26 supply of industrial and decorative burger/universal make paints for year, 2025-26 , synthetic enamelled smoke gray , bus green , black , azure blue , golden yel

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - mumbai - Maharashtra

49998331 tender for supply of eco-friendly paint for idol makers (murtikars) of ganapati idols on pilot basis for ganesh festival 2025 tender id 2025_mcgm_1197133_1

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - gwalior - Madhya Pradesh

49994802 supply of ready mixed paint

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kalyan - Maharashtra

49992769 supply of spray paint aerosol can

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989769 supply of pu paint black (two packs)

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989682 supply of pu paint pale cream

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Valsad - Gujarat

49989541 supply of pu paint signal white ral-9003 as per rdso

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989529 supply of pu post office red paint

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989393 supply of pu white paint to ral-9010

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kharagpur - West Bengal

49989379 supply of paint gentian blue (ral-5010) pu based. matl.& specn : rdso specification no. m&c pc n/109/2020 with amendment no. 1b (rev. 2.0) as an additional requirement.

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - cuttack - Odisha

49988501 supply of paint red oxide zinc chrome primer, to drawing / specification is:2074/(part-1)/2015, along with icf spec. icf/m/d spec.045, issue status 02, rev.03 dated 14.06.2007 and rdso amendment no. 1a as an additional requirement.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

49988442 supply of paint enamel synthetic exterior - white finishing, to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requirements of icf/md/spec-04

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - raiwala - Uttarakhand

49988056 tender for periodical services in zone a under age (i) raiwala

Due Date : Jul 26, 2025

Tender Value :

10 Lakhs

View Notice

Government Departments - Chamoli - Uttarakhand

49986101 bids are invited for supply of paints & primer to vishnugad project in , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 1

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Amritsar - Punjab

49985833 bids are invited for paint - duco paint olive green , paint - duco paint black , paint - duco paint red oxide metal primer , paint - duco thinner , paint - asian bus green , paint - asian black , paint - asian paint golden brown , paint - asian paint

Due Date : Jul 22, 2025

Tender Value :

5 Lakhs

View Notice

Government Departments - Visakhapatnam - Andhra Pradesh

49985503 bids are invited for steel polish liquid , acrylic liquid , glossy polish , shoe polish liquid as per is 12010 total quantity : 930

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

49982256 bids are invited for paint rfu finishing stoving amnsc finish spraying , ready mixed paint, finishing, interior for general purposes - is 3537 total quantity : 1383

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - GARHARA - Bihar

49981704 supply of paint enamel synthetic exterior finishing signal red.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bilaspur - Uttar Pradesh

49981475 tender for supply of industrial and decorative paints for season 2025-26 - supply of industrial and decorative paints 2 primmer (red oxide) 3 thinner 4 aluminium (paste+ thinner) 5 black head resistance paint 6 bus green 7 post office red 8

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Cooperative - Palakkad - Kerala

49978546 tender for construction of a partitioning room in fpg for storage of milmamin packets and ksheeravardhini buckets

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jagadhri - Haryana

49974589 supply of synthetic enamel finish coat shade

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Harnaut - Bihar

49974515 supply of paint enamel synthetic golden yellow.........

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Medinipur East - West Bengal

49973750 bids are invited for interthane 990 grey light grey , turpentine oil solvent , paint signal red , paint red oxide , paint yellow zinc chromate , paint golden yellow , paint dark grey , paint black enamel , paint azure blue , distemper white total qua

Due Date : Jul 14, 2025

Tender Value :

1.83 Lakhs

View Notice

Government Departments - Mancheswar - Odisha

49972314 supply of paint synthetic enamel brushing exterior, signal red finishing (isc no-537), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requ

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - secUNDERABAD - Telangana

49971216 supply of insulation paint-42kv high insulation paint for insulation purpose. as per rdso specification-ti0lko/78/2020. :make:- insulect sk-03/ casewell or similar

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ponmalai - Tamil Nadu

49969046 supply of paint enamel synthetic exterior

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - ajmer - Rajasthan

49966627 supply of pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/2018 & amendment no. 1b as an additional requirement . colour shade cream ral 9001.

Due Date : Sep 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jabalpur - Madhya Pradesh

49965972 bids are invited for paint ready mixed ammunation stoving semi-glossy , ready mixed paint, finishing, interior for general total quantity : 553

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Rupnagar - Punjab

49965856 bids are invited for washable distemper-is:428 (q3) , white cement based polymeric putty as per is 17545 (q3) , bitumen primer for use in waterproofing and damp - proofing as per is 3384 (q3) mse total quantity : 55

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Indore - Madhya Pradesh

49965580 bids are invited for ready mixed paint, air drying, red oxide zinc chrome, priming (v2) as per is 2074 (q3) , emery cloth (q3) mse total quantity : 135

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jodhpur - Rajasthan

49964859 supply of paint enamel synthetic exterior brushing undercoat colour blood red/maroon ral shade card no. 0303045 to is -8662/2024 , with additional requirements stipulated in icf spec. icf/md/spec.-045, status 02 rev.-03

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhavnagar - Gujarat

49964021 supply of paint alluminium

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pithoragarh - Uttarakhand

49963016 bids are invited for supply of 3d printed reinforced concrete panels along with steel lintels - supply of 3d printed reinforced concrete panels along with steel lintels as per specifications and drawings mentioned in technical specification document

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chennai - Tamil Nadu

49963013 bids are invited for interthane 990 (phb 000pha 046) white , paint interguard , marine paints total quantity : 180

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jalgaon - Maharashtra

49963010 bids are invited for , washable distemper-is:428 total quantity : 1000

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962939 bids are invited for epoxy based anti corr paint for application in ballast tank(n8010-p009679) , intumescent fire retardant paint(n8010-p009745) , penguard , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 293

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962905 bids are invited for paint, rfu, priming aluminium, water resistant, brushingspray(n8010-000114) , varnish black japan(n8010-000270) , epoxy red oxide primer(n8010- 001009) , paint rfu finishing gen. ser. synth. semi , epoxy grout total quantity : 39

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962900 bids are invited for paint non slip epoxy d. a grey with hardner (n8010- , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 24060

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

49955108 supply of (for vande bharat trainset) supply of pr [(for vande bharat trainset) supply of primer for vb coaches (suitable between 5 to 48 deg.celcius temp) in packing of 1000ml make brand sika primer 210 of m/s sika or teroson pu 8517h of m/s henkel

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Prayagraj - Uttar Pradesh

49954272 bids are invited for h1 a8010-007494 paint rfu fin syn ena br spr gold yellow - paint rfu fin syn ena br/spr gold yellow , g1 5340-003617 seals metallic lead 10mm - seals metallic lead 10mm , g2 9520-000004 steel angles 30x30x3 mm - steel angles 30x3

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

49952607 bids are invited for r600159200 - epoxy primer , r605111408 - hardener for epoxy primer , r600136700 - epoxy thinner for primer , r605159500 - pu finish paint , r605111410 - hardener for finish paint , r605112800 - polyurethane thinner , r608009000 -

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Durg - Chhattisgarh

49952462 bids are invited for yellow paint 4 letre pack , red paint 4 letre pack , smoke grey paint 4 letre pack , black paint 4 letre pack , aluminium paint 4 letre pack , blue paint 4 letre pack , red oxide primer 20 letre pack total quantity : 24

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Vijayawada - Andhra Pradesh

49950790 supply of 1) salmon pink paint isc-443 to is :8662/2001 or latest. & 2) sky blue paint isc-101 to is:8662/2004 or latest.

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

100

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

49949919 bids are invited for paint white , paint gray , paint red , paint epoxy , paint black , paint yellow , paint blue , mek , glycerin , window shield was liquid , teflon tape , paint remover , araldite , corrosion prevention spray , white sprit , thinne

Due Date : Jul 9, 2025

Tender Value :

80240.0

View Notice

Top