Paint Supply Tenders from India

201 Paint Supply tenders are published by various Tendering Authorities & Private companies. 201 live Tender for Paint Supply are available in Paint Supply Tender section You can further filter Paint Supply tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Government Departments - Dahod - Gujarat

52096164 supply of r/m paint synthetic

Due Date : Nov 21, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - meerut - Uttar Pradesh

52089480 tender for certain b/r repair in rajesh enclave under age b/r-iv of ge (south) meerut cantt

Due Date : Nov 21, 2025

Tender Value :

14.97 Lakhs

View Notice

Government Departments - mumbai - Maharashtra

52087950 supply of paint enamel synthetic exterior finishing, gentian blue to ral-5010 conforming to is 8662 : 2024 and rdso amendment no 1 (revision 0) for pigment content as an additional requirement to is 8662 : 2024 w.e.f. 01.08.2016 with additional requi

Due Date : Nov 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mancheswar - Odisha

52087874 supply of pu paint top coat (two pack system), colour-apricot yellow, colour shade-ral 0708040, to drawing / specification no. m&c/pcn/100/2018, along with rdso amendment no. 1b, rev-2.0 as additional requirement.

Due Date : Nov 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pithoragarh - Uttarakhand

52077981 bids are invited for metal polish, liquid (v2) conforming to is 5487 total quantity : 50

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Amritsar - Punjab

52077799 bids are invited for black paint - asian paint , yellow paint - asianpaint , orange paint - asianpaint , white paint - asianpaint , red paint - asianpaint , turpentine paint - asianpaint , paint brush bracket 3p - acrylic , paint brush bracket 2p - a

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pithoragarh - Uttarakhand

52077710 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 total quantity : 40

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Sukma - Chhattisgarh

52077257 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) total quantity : 940

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

52077147 bids are invited for paint green , paint priming coal tar epoxy black , paint black heat resistant , paint black enamel , paint azure blue , paint alluminium heat resistant , epoxy red oxide primer total quantity : 400

Due Date : Nov 11, 2025

Tender Value :

1.96 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Thane - Maharashtra

52077086 bids are invited for aliphatic polyurethane paint per mil-prf-85285 or mil-c83286 ral 9016 matt. { 1 set= 4 lt base+ 2 total quantity : 5

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Indore - Madhya Pradesh

52074168 bids are invited for metal polish, liquid (v2) conforming to is 5487 total quantity : 200

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Byculla - Maharashtra

52073688 supply of paints apcolite premium enamal glass

Due Date : Nov 25, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - hisar - Haryana

52073573 tender for supply of paint and allied materials in ccs hau, hisar

Due Date : Nov 10, 2025

Tender Value :

13.23 Lakhs

View Notice

Government Departments - kolkata - West Bengal

52072628 supply of high gloss and colour retention sation blue

Due Date : Nov 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jamnagar - Gujarat

52070881 bids are invited for interguard 262 red , interguard 263 faj 034/a light grey , intertuf 262 kha 303/a red as a tie coat , interguard 269 epoxy primer ega 088/ a red total quantity : 140

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Doda - Jammu And Kashmir

52070652 bids are invited for supply of furniture repair items - description alongwith complete specification of item mentioned in store list attach at ser no 01 to 05 , supply of painting items - description alongwith complete specification of item mentioned

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Chandrapur - Maharashtra

52069027 tender for cup 41 for ignition primer; cup 41-3 for igniting primer mg-08 to drg. no. ост-84-407-77 and cap k 3-2 for igniting primer mg-08

Due Date : Nov 12, 2025

Tender Value :

39.67 Lakhs

View Notice

Boards / Undertakings / PSU - Saraikela Kharsawan - Jharkhand

52067860 bids are invited for synthetic enamel, black paints in 20 ltr pack , synthetic enamel, oxford blue paints in 04 ltr pack , synthetic enamel, bus green paints in 04 ltr pack , synthetic enamel, smoke gray paints in 20 ltr pack , synthetic enamel, ligh

Due Date : Nov 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - izatnagar - Uttar Pradesh

52067188 supply of paint enamel interior finishing smoke grey isc no. 692 as per is:5/07 (reviewed in 2018) to rdso specn no. m&cpcn/120/2020(rev.1) with rdso amndt. no. 1b as an additional requirement, packed in 20 ltrs. new & sound non returnable m. s. drum

Due Date : Dec 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - hubbali - Karnataka

52066464 supply of paint enamel synthetic exterior white.

Due Date : Dec 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jaipur - Rajasthan

52065560 tender for putty plastic paint dismemper sprit polish, exterior paint enamel paint in dipr building at rajasthan sectt jaipur

Due Date : Nov 10, 2025

Tender Value :

8.45 Lakhs

View Notice

Government Departments - hubbali - Karnataka

52065496 supply of paint enamel white interior finishing.

Due Date : Dec 2, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - sangam - Delhi

52065138 tender for renovation work in m.c primary school f-2 block by pdg. new window panes, enamel paint on doors, windows and grills, water proofing, prayer area flooring, installing wire mesh grills, fencing etc. in sangam vihar-c, ward no. 168/cnz.

Due Date : Nov 6, 2025

Tender Value :

23.08 Lakhs

View Notice

Government Departments - Agartala - Tripura

52058375 tender for supply and laying of 24 mm pvc conduit along with requird suttle, gutka, screwws etc. complete supply and laying of 4 run 10 sqmm pvc inbsulated flexible copper wire through existing conduit supply and laying 1 run 2.5 sqmm pvc copper wire for

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - palakkad - Kerala

52054974 tender for supply of primer grey zinc silicate

Due Date : Nov 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Manmad - Maharashtra

52053662 supply of paint zinc chromate primer confirming

Due Date : Nov 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ramanathapuram - Tamil Nadu

52052533 bids are invited for paint navy blue - n 8010 000151 , paint fluorescent yellow - n 8010 000139 , paint fluorescent red - n 8010 000140 , epoxy red oxide primer - 8010 001009 , paint black enamel - n 8010 000150 , paint red signal - n 8010 000146 , t

Due Date : Nov 11, 2025

Tender Value :

1.88 Lakhs

View Notice

Government Departments - Bongaigaon - Assam

52052307 bids are invited for supply of paint to ral-5010, spec- is: 8662/2004 with requirement of icf/md/spec-045 , electrical insulating paint total quantity : 20000

Due Date : Nov 20, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Siliguri - West Bengal

52052285 bids are invited for h1 7930-000302 - h1 7930-000302 super bright hd ultra , h1 8010-000132 - h1 8010-000132 turpentine , h1 8040-000147 - h1 8040-000147 fevicol sr-998 , h1 a 8010-007499 - h1 a 8010-007499 paint rfu olive green , h1 a 8010-000240 -

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - wardha - Maharashtra

52051199 tender for in municipal council wardha supply of oil paint other colours and with labours

Due Date : Nov 5, 2025

Tender Value : Ref. Document

View Notice

Cooperative - FAZILKA - Punjab

52050843 tender for industrial paints and varnish for final molasses storage tanks

Due Date : Nov 14, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - New Delhi - Delhi

52050560 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) total quantity : 500

Due Date : Nov 10, 2025

Tender Value :

22.85 Lakhs

View Notice

Local Bodies - New Delhi - Delhi

52050559 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) total quantity : 500

Due Date : Nov 10, 2025

Tender Value :

22.60 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

52050438 bids are invited for technical grade epoxy in hdpe , thinner for epoxy paints (bhel) total quantity : 1

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Hisar - Haryana

52050394 bids are invited for zinc white paste , thinner antichill , paint rfu enamel interior brushing black , paint rfu enamel interior brushing azure blue , paint rfu enamel interior brushing iddle brunswick green , paint rfu enamel interior brushing dark

Due Date : Nov 11, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Yavatmal - Maharashtra

52050362 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) , thinner for epoxy paints (bhel) (q3) total quantity : 1049

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kondagaon - Chhattisgarh

52050208 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) total quantity : 85

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kolkata - West Bengal

52049928 supply of high gloss and colour retention sation blue

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Medak - Telangana

52046414 bids are invited for enamel new phiroja blue, color shade isc no. 176 of is: 5 to jss: 8010-1/cqa(m) /ss/98(b) (eqv. is: 113- , enamel signal redcolor shade37, correspond tojss: 8010-1 cat no. h1(a) 8010-000157 or cqa(m) /ss/98(b) , aluminium/silver

Due Date : Nov 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pune - Maharashtra

52042647 bids are invited for primer m191 a2 , housing(ofb-defence) total quantity : 115

Due Date : Nov 20, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Koraput - Odisha

52042610 bids are invited for enamel ko-818 black (3 s heat resistant paint - 700-a) , as per attached specifications , 3s synthetic black enamel pf-223 to gost 14923-78 in one litre tin, as per attached specifications , enamel, synthetic, exterior (a) underc

Due Date : Nov 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Palakkad - Kerala

52042390 bids are invited for primer grey zinc silicate oil type only. test certificate required. make as per the tender enquiry , zinc ethyl silicate primer (main coat) - is 14946 total quantity : 100

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kanpur - Uttar Pradesh

52041963 supply of enamel synthetic exterior finishing black

Due Date : Nov 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - secUNDERABAD - Telangana

52041600 supply of paint synthetic enamel traffic blue exterior brushing finishing

Due Date : Nov 6, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jamnagar - Gujarat

52041480 tender for supply and application of zinc rich paint for flue gas duct structure from air preheater out to chimney inlet in boiler unit no. 3 at sikka tps.

Due Date : Nov 21, 2025

Tender Value :

49.45 Lakhs

View Notice

Government Departments - bhusawal - Maharashtra

52040417 supply of paint, ready mixed red oxide (isc : 446) brushing, finishing glossy for general purposes

Due Date : Nov 28, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Nagarjunasagar - Telangana

52039198 tggenco - nshes - supply of various types of paints at nshes, nagarjunasagar.

Due Date : Nov 13, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jamalpur - Bihar

52034447 supply of procurement of paint enamel synthetic exterior finishing white to is:8662/2004 (2nd revn.) along with additional requirements as laid down in icf str no. icf/md/spec.045 issue status 02 revn.03.shelf life 12 months.

Due Date : Nov 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Chennai - Tamil Nadu

52034339 supply of paint ready mixed synthetic enamel green

Due Date : Nov 5, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chandrapur - Maharashtra

52025982 bids are invited for cup 41-3 for igniting primer mg-08 to drg. no. oct- 84-407-77 and cap k 3-2 for igniting primer mg-08 , case carrying - (defence) total quantity : 280161

Due Date : Nov 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Madurai - Tamil Nadu

52025968 bids are invited for ready mixed paint, brushing, bituminous, black, lead - free, acid, alkali, water and chlorine resisting as per is 9862 (q3) total quantity : 12280

Due Date : Nov 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

52025033 tender for ct scanner 128 slice (rate offered shall include all items mentioned in the specifications except those items for which seperate price is requested below) , dual head pressure injector with 200 syringes , digital dry imager , client server work

Due Date : Nov 20, 2025

Tender Value :

4.65 Crore

View Notice

Government Departments - Thiruvananthapuram - Kerala

52025032 tender for ct saccner inclusive of all accessories and other items mentioned in the specification which are not specifically mentioned below , additional workstation as per spec , pressure injector dual head , full system ups , dry imager , desktop comput

Due Date : Nov 20, 2025

Tender Value :

3.99 Crore

View Notice

Government Departments - Perambur - Tamil Nadu

52024843 supply of paint air craft blue

Due Date : Nov 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Avadi - Tamil Nadu

52024807 supply of paint mid burnswick green

Due Date : Nov 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - hubbali - Karnataka

52024764 supply of paint enamel synthetic exterior oxford blue finishing.

Due Date : Nov 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kharagpur - West Bengal

52024368 supply of supply of gentian blue (ral 5010) paint, with rdso amendment no.1a.

Due Date : Nov 19, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Rupnagar - Punjab

52023530 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) total quantity : 249

Due Date : Nov 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - gorakhpur - Uttar Pradesh

52023276 supply of paint ready mixed black finishing general purpose synthetic black to is: 13607/1992 (reviewed in 2024) with amndt. no. 2 of july 2013, packed in 20 ltrs. new and sound non-returnable m.s. drum to is : 2552/1989 (reaffirmed in 2018) with amn

Due Date : Nov 27, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Thane - Maharashtra

52023202 bids are invited for high solid epoxy polyamide paint per mil-prf-22750 typeii class h ( 1 set= 3 lt base+ 1 lt hardner , thinner for epoxy paints (bhel) epoxide finishing paint (bhel) high build intermediate epoxy paint (bhel) total quantity : 5

Due Date : Nov 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ratnagiri - Maharashtra

52020090 bids are invited for paint ready mix brushing finishing interior semi gloss for general purpose-red , paint ready mixed brushing and furnishing semi gloss for general purpose - alluminium oxide , electrical insulating paint total quantity : 80

Due Date : Nov 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Gandhi Nagar - Gujarat

52019848 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) total quantity : 235

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kamrup - Assam

52018636 bids are invited for cement make ambuja or dalmia or ultrateck , guirder ismb 20 feet long , srt of size 8 feet long , screw normal 1 point 5 inch - screw normal 1.5 inch , screw normal 2 inch , cassing capping 6 feet long , ceilling rose make syska

Due Date : Nov 7, 2025

Tender Value : Ref. Document

View Notice

Government Departments - erode - Tamil Nadu

52016969 supply of set of paints , set consists of 02 items as follows.(1) : enamel, synthetic, exterior, finishing white

Due Date : Nov 7, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kanpur - Uttar Pradesh

52016892 supply of .primer paint as per clw specification no. 4tms.096.019, rev.1. warranty period: 12 month(s) f

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - erode - Tamil Nadu

52016772 supply of enamel gloss brill white paint for locos exterior

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - erode - Tamil Nadu

52016754 supply of pebble grey -ral - 7032 paint enamel synthetic exterior finishing

Due Date : Nov 10, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - tandur - Telangana

52014463 tender for supply of acrylic washable distemper

Due Date : Nov 18, 2025

Tender Value :

17980.0

View Notice

Government Departments - amravati - Maharashtra

52011809 tender for maintenance and repair to amravati hpo under amravati division

Due Date : Nov 10, 2025

Tender Value :

76.94 Lakhs

View Notice

Government Departments - Parel - Maharashtra

52008050 supply of full gloss polyurethane enamel paint (two pack system), colour shade: sky blue

Due Date : Nov 7, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - assandh - Haryana

52007982 tender for construction of misc work in ward no 3 assandh

Due Date : Nov 5, 2025

Tender Value :

21.08 Lakhs

View Notice

Local Bodies - assandh - Haryana

52007901 tender for construction of misc work in ward no 16 assandh

Due Date : Nov 5, 2025

Tender Value :

21.20 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Chandigarh - Chandigarh

52007123 bids are invited for paint red , paint olive green , paint brushes total quantity : 180

Due Date : Nov 11, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Ghaziabad - Uttar Pradesh

52006792 bids are invited for enamel, synthetic, exterior (a) undercoating (b) finishing (v4) confirming to is 2932 (q3) , ready mixed paint, air drying, red oxide zinc chrome, priming (v2) as per is 2074 (q3) , thinner for epoxy paints (bhel) (q3) total quan

Due Date : Nov 8, 2025

Tender Value :

46.65 Lakhs

View Notice

Government Departments - Chennai - Tamil Nadu

52006683 bids are invited for ready mixed paint, brushing, bituminous, black, lead free, acid, alkali and heat resisting as per is 158 (q3) total quantity : 2757

Due Date : Dec 12, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Lucknow - Uttar Pradesh

52006159 bids are invited for semi-automatic gyroscopic paint mixer / shaker , paint brushes total quantity : 2

Due Date : Nov 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

52003992 bids are invited for 1 primers - forward cccctagatgggggaacaga 20bp , 2 primers - reverse gcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga 22bp , 4 primers - reverse tggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacat

Due Date : Nov 18, 2025

Tender Value :

20 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Coimbatore - Tamil Nadu

52003953 bids are invited for yellow epoxy primer , paint acrylic dark green , thinner for pv top coat , pv golden yellow , paint pu white , paint hardner , paint pu saffron , pu paint blood red , pu paint mint green , enamel, synthetic, exterior (a) undercoa

Due Date : Nov 7, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Raigad - Maharashtra

52001738 bids are invited for paint ready mixed air drying matt finish for gp golden yellow isc 356 is 168/93en yellow isc 356 is , paint ready mixed finishing brushing dark admiralty grey isc 632 is168/93 , ready mixed paint, air drying, for general purpose

Due Date : Nov 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

52001373 bids are invited for static aeromodeles - for aeromodelles kit , chuck gliders - for aeromodelles kit , spray paints - for aeromodelles kit , check putty tubes - for aeromodelles kit , priper spray - for aeromodelles kit , sand paper - for aeromodell

Due Date : Nov 8, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Chamba - Himachal Pradesh

52001363 bids are invited for flush door shutter 35 mm , acrylic emulsion paint interior 20 liter drum , turpentine oil , synthetic enamel paint golden brown , stainless steel screw, size- 35mm length, 8 mm dia , enamel paint yellow , synthetic enamel paint b

Due Date : Nov 18, 2025

Tender Value :

2.95 Lakhs

View Notice

Government Departments - katni - Madhya Pradesh

52000177 supply of gum paint containing tannic acid with potassium iodide/zinc chloride along with other soothing agents atleast 15 ml

Due Date : Nov 28, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Nashik - Maharashtra

51998531 bids are invited for red oxide primer with hardener - refer item 1 of sor in atc , surfacer with hardener - refer item 2 of sor in atc , epoxy thinner - refer item 3 of sor in atc , brilliant white paint with hardener - refer item 4 of sor in atc , p

Due Date : Nov 7, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Hyderabad - Telangana

51998530 bids are invited for intergard 269 red primer , interthane 990 grey ral 7040 , galaxy epoxy thinner , interlac 665 white paint , interswift 6600 black paint boot top , black synthetic paint , deck paint interthane 990 storm grey , interlac 665 red pa

Due Date : Nov 12, 2025

Tender Value :

12 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - KUTCH - Gujarat

51995935 bids are invited for ceiling cement bonded board 2x2 feet , t grid false ceiling 10 feet , ceiling aluminium grid 2 feet , ppgi sheet 0.50mm thick 16x4 feet , rcc cover slab 6x2 feet , interlocking tile , kerb block 300x300x125mm , non skid cermic ti

Due Date : Nov 6, 2025

Tender Value : Ref. Document

View Notice

Government Departments - tiruchirappalli - Tamil Nadu

51993351 tender for setting up e-studios at iim tiruchirappalli

Due Date : Nov 17, 2025

Tender Value :

3.40 Lakhs

View Notice

Government Departments - Thiruvananthapuram - Kerala

51991479 tender for annual plan-pulimath gp 2025-26 p.no-195/26-maintanance of various assets of panchayath-general civil work

Due Date : Nov 3, 2025

Tender Value :

2.54 Lakhs

View Notice

Government Departments - hubbali - Karnataka

51989592 supply of paint enamel, synthetic exterior apricot yellow

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kazipet - Telangana

51989545 supply of medium duty airless spray painting equipment for pu

Due Date : Nov 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bangalore - Karnataka

51989312 supply of pu glossy signal red paint

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Anugul - Odisha

51987652 bids are invited for hydrophobic insulating paint , electrical insulating paint total quantity : 3000

Due Date : Nov 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bangalore - Karnataka

51982716 supply of pu glossy white paint

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Tirupati - Andhra Pradesh

51982056 supply and application of pu paint in vande bharat coaches

Due Date : Nov 17, 2025

Tender Value :

44.94 Lakhs

View Notice

Government Departments - mysore - Karnataka

51977094 supply of fluoropolymer (polyfluoroethylene) paint intermediate coat as per japanese industrial standard jis k - 5659/2008 (long durable paints for steel structures) shade ral- 7012 to be packed/supplied in 20/10 litres net capacity new and sound, no

Due Date : Nov 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mysore - Karnataka

51971741 supply of high build epoxy paint black (two pack) protective anti corrosive for battery box to rdso specn: m&c/pcn/111/2018 (the mixing ratio of pack a and pack b should be clearly mentioned in the offer and marked on the containers by the supplier).

Due Date : Nov 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kharagpur - West Bengal

51971662 supply of paint, alkyd modified synthetic enamel uv resistant high gloss and colour retention satin blue etc.

Due Date : Nov 4, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Leh - Ladakh

51965195 bids are invited for paint - asian paints (black, white, red & brown) , sunmica - 1mm sheet , hitox 5 ltr for sunmica paste - liquid solution for sunmica pasting , regimental flag - high quality materials , iron pole - jindal iron20 feet pole , cloth

Due Date : Nov 5, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Porbandar - Gujarat

51965192 bids are invited for lp of paints , paint , fabric paint total quantity : 300

Due Date : Nov 6, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

51965172 bids are invited for painr rfu fin syn ena br spr red oxide , paint rfu black , paint rfu fin airdrying br spr syn enam , pait rfu g yellow , paint oilve green , plywood for general purpose , putty , sheet cellular 2x1m , sheet cellular 6mm , steel a

Due Date : Nov 5, 2025

Tender Value :

29990.0

View Notice

100

Government Departments - Nadia - West Bengal

51965058 bids are invited for paint golden broun apcolite , paint black apcolite , paint white apcolite , paint sky blue apcolite , paint red apcolite , paint yellow apcolite , paint silver , paint golden apcolite , paint duco black , paint duco og , thinner

Due Date : Nov 17, 2025

Tender Value : Ref. Document

View Notice

Top