Paints And Primers Tenders from India

764 Paints And Primers tenders are published by various Tendering Authorities & Private companies. 764 live Tender for Paints And Primers are available in Paints And Primers Tender section You can further filter Paints And Primers tenders by Tender Value, Tender Submission Date or Project Location.

1

Statutory Bodies & Commissions/Committees - South Goa - Goa

34997988 bids are invited for sofa set 5 seater as per specification as per specification , supply and fixing good quality fabric polyester vertical binds with slat width 114mm and slat thickness 2mm window cover , decorative coir mat 85 cm x 50 cm , supply and install work station cubical made out of powder coated aluminium section minimum thickness of powder coating 50 micron approx surface area of 25 sqm as per specification , supply and install work station cubical made out of powder co...

Due Date : Dec 14, 2022
Tender Value : Ref. Document
2

Boards / Undertakings / PSU - agra - Uttar Pradesh

34997854 annual maintenance contract for fire fighting system / equipment at 100 beded mch block abd surgery block and allied specilities building in s n medical college agra-2 fire extinguishers 3 refilling of 6 kg capacity abc type fire extinguisher 4 refilling of 9 kg capacity abc type fire extinguisher 5 refilling of 4.5 kg capacity co2 type fire extinguisher 6 refilling of 9 kg capacity co2 type fire extinguisher 7 refilling of 25 kg capacity abc type fire extinguisher 8 refilling o...

Due Date : Dec 5, 2022
Tender Value : Ref. Document
3

Statutory Bodies & Commissions/Committees - Jammu - Jammu And Kashmir

34997538 invitation of online bids for supply of drugs / disposables / consumables -buy medicines , medical consumables / non expendable stores: , clobetasol propionate lotion 0.05% bott of 25 ml , cream clobetasol 0.05%, salicylic acid 3.0%, urea 10.0%, lactic acid 3.0% , cream eberconazole 1 % tube of 10 gm , cream eflomithine hydrochloride 13.9% , cream tacrolimus0.03%tube of 10gm , cream. glycolic acid 12 % tube of 15 gm , dermoys white soft paraffin 13.2% liquid paraffin 10.2% creambas...

Due Date : Dec 9, 2022
Tender Value : rupee 5.59 Lakhs
4

Government Departments - Agra - Uttar Pradesh

34997378 bids are invited for pole and mast -- 1 supply & fixing of 8 mtr gi octagonal pole of approved make ( top dia 70mm, bottom dia 155 mm and base plate 12mm thik ) having 3mm thikness with single arm bracket ( 1 mtr length ) on rcc foundationincluding the cost of foundation, foundation bolts, excavation & back filling and required t&p completee in all respect..pwd sor no. 645 2 s / f of angle iron fram fabricated as per design approved of angle iron size 40mmx40mmxfor fixing 4 to 6 floo...

Due Date : Dec 5, 2022
Tender Value : Ref. Document
5

Government Departments - Jamnagar - Gujarat

34997242 bids are invited for procurement of paints for 19th narmada and 43nd salaya channel annual buoy maintenance- epoxy golden yellow , epoxy black paint , epoxy white paint , synthetic white enamel , epoxy green paint , epoxy red paint , primer red oxide , antifouling red procurement of paints for 19th narmada and 43nd salaya total quantity : 750

Due Date : Dec 9, 2022
Tender Value : rupee 5.23 Lakhs
6

Statutory Bodies & Commissions/Committees - bhaderwah - Jammu And Kashmir

34997165 repair / maintenance of pumps, motors, starters, control panel, relay, filteration plant and misc items at bhalra under ge ( i ) 873 ews-material and labour for taking out centrifugal pump of capacity40 hp, transportation of same from site to workshop and back, dismantling of cable / pipe connection and reinstallation of pump set after repair on the existing foundation and making electrical connections complete all as specified and directed.note : all spares parts require...

Due Date : Dec 19, 2022
Tender Value : rupee 10 Lakhs
7

Government Departments - Shillong - Meghalaya

34997097 bids are invited for primers sle project microbiology fcn1 rs299727 minus 191g greater than a fcn1 191af cccatgagcctggttatca , fcn1 rs299727 minus 191g greater than a fcn1 191gf cccatgagcctggttatcg , fcn2rs 765453 minus 64a greater than c fcn2 64ac common fwd , dash cacaagcaagtcagcctgtt , fcn2 rs17549193 6359c greater than t fcn2 6359cf ttgcacttcttggattgtgc , fcn2 rs17549193 6359c greater thant fcn2 6359tf cctgcacaggagattcccggat , fcn2 rs7851696 6424g greater thant p6424 under...

Due Date : Dec 6, 2022
Tender Value : rupee 5 Lakhs
8

Statutory Bodies & Commissions/Committees - paradip - Odisha

34996792 repair and replacement of misc b / r items at dhq-7 and cgra complex at paradip under ge ( i ) ( cg ) bhubaneswar-dismantling floor, hearth or wall tiling including cement mortar bedding ( but not backing ) , removing serviceable tiles to store and rubbish off the premises complete all as specified and directed. 2 material and labour vitrified ceramic tiles 10 mm thick dark shade ( square / rectangular ) polished, area of each tilesnot exceeding 0.36 sqm, in floors etc. ...

Due Date : Dec 17, 2022
Tender Value : rupee 25.78 Lakhs
9

Government Departments - DAVAnagere - Karnataka

34996610 supply of materials for construction of compound at durgamabika camp mudahadadi gram panchayath , mixer concrete 1 cum capacity, add formwork and staging @ 20% for height upto 5 m, ready mix primer paint ( ready mix red lead paint ) , broken stone aggregate 12 mm to 10 mm size, name board, solid concrete blocks, mason class i with tools, ms flat, mixer concrete small used in culvert, hom of vibrator 0.71 days, broken stone aggregate 20 mm size, fitter class i, coarse sand zone iii, add provid...

Due Date : Dec 2, 2022
Tender Value : Ref. Document
10

Statutory Bodies & Commissions/Committees - kirkee - Maharashtra

34995386 tender for repair and maintenance of certain internal electrical fittings and fixtures of kwh meters, solar water heaters and repair / replacement of wall mounted lt dbs metering cubicals, submain wirings and other connected items at cme- m & l for servicing solar water heater of 100 / 200 / 400 / 500 lpd capacity ( flat plate collector / tube collector ) by removing the flange plates, cleaning the collectors internally& externally by using descaling solution, removing the blockages ...

Due Date : Dec 15, 2022
Tender Value : rupee 49.99 Lakhs
11

Government Departments - Jaipur - Rajasthan

34995200 tender for supply of thin wall bearing

Due Date : Dec 20, 2022
Tender Value : rupee 20 Lakhs
12

Government Departments - Udupi - Karnataka

34995085 material requirement for construction of nrlm sanjeevini shed in padubidri gp limit, kaup tp. , cleat angles, coarse sand ( zone iii ) , polyenthylene water storage tank of specified capacity l, mason class i ( with tools ) , binding wire, m.s rods, formwork, centering & scaffolding for beams & lintels of building - 20%, broken stone aggregate 20 mm size, broken stone aggregate 12 mm to 10 mm size, add over head charges 10%, unit cost as per the specification, allumin...

Due Date : Dec 2, 2022
Tender Value : rupee 12.57 Lakhs
13

Statutory Bodies & Commissions/Committees - KORAPUT - Odisha

34995016 bids are invited for epoxy varnish ap-074, thinner for epoxy varnish ap-074 total quantity : 15

Due Date : Nov 28, 2022
Tender Value : Ref. Document
14

Government Departments - Osmanabad - Maharashtra

34994817 tender for supply of materials - capacitor ceramic, led, potentiometer, screw driver set, tester, wire cutter, extension electrical board 6 ampere, single strand wire, battery nippo, long life battries, inductor, copper clad pcb sheet, soldering gun small and medium, cro probes - bnc to crocodile, electronic component cleaning oil, feviquick, desolding wire, plastic tray, thinner, crocodile pins, both side male probe wire connector, breadboard.

Due Date : Nov 29, 2022
Tender Value : Ref. Document
15

Statutory Bodies & Commissions/Committees - Bathinda - Punjab

34994565 bids are invited for training equipment silicon sealent tube , 10mm metal plates of size 3 inch x 6 inch , buffing blades , high density rubber gaskets 530 cm , primer , enamel paint green , enamel paint brown , triangular brackets 75 x 55 cm with 93 cm made of 5 mm thick , drill bit 10 mm , drill bit 12 mm total quantity : 324

Due Date : Nov 28, 2022
Tender Value : Ref. Document
16

Statutory Bodies & Commissions/Committees - Jalandhar - Punjab

34994547 bids are invited for chain link ms dia 4 mm size of 50x50mm best quality , mild steel screw bolts 10mm dia hexagonal or square heads best quality , steel barbed wire 2.24 mm dia barbed with 2 mm as per description , dismantling fencing wire mesh any type chain link mesh and barbed wire mesh , dismantling wrought iron or mild steel work of any description not otherwise provided , mild steel work for posts and struts in fencing includings cutting tops to shaps , fixing only mild steel galvanized ...

Due Date : Nov 28, 2022
Tender Value : Ref. Document
17

Statutory Bodies & Commissions/Committees - Jalandhar - Punjab

34994491 bids are invited for primer make. asian nerolac berger as per mentioned makes only , acrylic emulsion water based primer make. asian nerolac berger only mentioned makes all as per description. , forming 25 mm thick expansion joints all as per description. , m and l for forming contraction dummy joints 1.3 of depth of slab 110x 8mm and top 25x8mm , m and l for forming construction joints 25 mm deep x8 mm wide providing polythene backup rod 10 mm dia , demolition of un reinforced cement concrete ...

Due Date : Nov 28, 2022
Tender Value : Ref. Document
18

Boards / Undertakings / PSU - varanasi - Uttar Pradesh

34994153 outer painting work with enamel paint of doors and windows of guest house at rgsc, barkachha, bhu => limited

Due Date : Nov 29, 2022
Tender Value : rupee 99756.0
19

Statutory Bodies & Commissions/Committees - lucknow - Uttar Pradesh

34993822 tender for repair / replacement of u / s parts of vehicle ba no 10d183214y eicher of cecc under ge e / m lucknow - oil filter 3 hand primer 4 back light assy 5 horn assy 6 wiper relay 7 self armature 8 carbon plate with brush 9 bendix drive 10 wiper blade 11 fly wheel ring 12 sleeve cyl assy => limited

Due Date : Dec 1, 2022
Tender Value : rupee 25606.0
20

Local Bodies - Jalore - Rajasthan

34993743 supply of materials and providing equipments in all scheme at gram panchayat siwara- ghadhla kankar jhajhrha mud masala , lime , cement , fine aggregate , fly ash , sand gravel , grit stone brick , stone pattiya , precast tiles , vitrified , cement interlocking wood with fitting , iron , structural steel , winding wire , iron girder , barbed wire , iron net , glass color paint , modular socket outlet , enamel paint ., bitumen tax board , g i sheet , sheet , pipe , r...

Due Date : Dec 5, 2022
Tender Value : rupee 49 Lakhs
21

Government Departments - rajapur - Maharashtra

34993645 supply various material for grampanchayat rajapur tal yeola dist nashik2020-21-ballast , murum , sand , cement , iron , vita , bituminous pad , cement pipe , plastic polythene sheet , paver block , mixture machine , vibrator , roller , jcb , prc pipe , table chair , window , door , iron gate , water tanker , pocklan machine , pvc pipe , socket , bend , reducer , elbow , tee , tap seal , starter , elbow , stm pipe , solution , asian paint , asian primer , tractor...

Due Date : Nov 30, 2022
Tender Value : Ref. Document
22

Statutory Bodies & Commissions/Committees - hasimara - West Bengal

34993581 tender for repair / maintenance of dg sets at various locations and comprehensive maint of misc e / m equipments in technical area at af stn hasimara under ge ( af ) hasimara - material and labour for conducting ‘b’ check ofdg set capacity 15 kvato carry out the following maintenance / servicing, complete all as specified and as directed :- ( i ) change of diesel filter / oil filter, top up / replacement of engine oil, coolent if required. ( ii ) check and clean engine, alternat...

Due Date : Dec 23, 2022
Tender Value : Ref. Document
23

Cooperative - Jaipur - Rajasthan

34993354 invitation for quotation for 100 parcentage acrylic exterior paint and primer , putty, etc. at rdfc saras parlour no.186 jaipur-302015

Due Date : Nov 29, 2022
Tender Value : rupee 1.95 Lakhs
24

Government Departments - Aurangabad - Maharashtra

34993056 purchase of various materials for community programs for the backward class citizens of the village nayagavhan tq. and dist. aurangabad. under scheme - 15 th f. c. fund-ballast , murum , sand , cement , iron , vita , bituminous pad , cement pipe , plastic polythene sheet , paver block , mixture machine , vibrator , roller , jcb , prc pipe , table chair , window , door , iron gate , water tanker , pocklan machine , pvc pipe ,socket , bend , reducer , elbow , tee , tap seal , starter , elbow , st...

Due Date : Nov 30, 2022
Tender Value : Ref. Document
25

Government Departments - davanagere - Karnataka

34992951 supply of furnitures for amrutha schools davanagere dist , teak wood table ( size3x2 ) : with teak wood beading made out of teak wood leg size 2x2 table upper side patti 4 x1.25 lower side h shape middle 2 patti with small drawer the table shall be neatly finished and polished, teak wood table ( size3x2 ) : with teak wood beading made out of teak wood leg size 2x2 table upper side patti 4 x1.25 lower side h shape middle 2 patti with small drawer the table shall be neatly finished and polishe...

Due Date : Dec 3, 2022
Tender Value : Ref. Document
26

Government Departments - chennai - Tamil Nadu

34992673 supply of enamel paints - supply & safe delivery of synthetic enamel bitumen paints in 4ltr metal container as per the detailed specifications in the attached annexure , supply & safe delivery of synthetic enamel two pack, air drying, synthetic resin based aluminum paint bright metallic finish – aluminum shade in 4ltr metal container as per the detailed specifications in the attached annexure , supply & safe delivery of synthetic enamel single pack, silicone resin based, heat resi...

Due Date : Dec 15, 2022
Tender Value : Ref. Document
27

Local Bodies - Pune - Maharashtra

34992652 to purchase and provide mbbs second year equipment for pune municipal corporation medical education trusts bharatratna atal bihari vajpayee medical college pune-2 microscopes 3 facility for heating slides 4 anaerobic apparatus 5 autoclave 6 balance electronic digital 7 bio-safety cabinet type - 2a 8 bod incubator 9 centrifuge 10 co2 incubator 11 candle jar 12 distilled water plant 13 elisa reader 14 elisa washer 15 hot air oven 16 incubator 17 laminar flow cabnet ...

Due Date : Dec 20, 2022
Tender Value : Ref. Document
28

Boards / Undertakings / PSU - panipat - Haryana

34992518 supply of fabricated structure with surface preparation and primer painting material grade e350br / e350b0 ( conforming to is:2062 ) & yst310 ( conforming to is: 4293 ) in connection with “piling, ug & civil / structural works u&o-p25 area part-b for panipat refinery expansion project ( p25 )

Due Date : Dec 15, 2022
Tender Value : Ref. Document
29

Government Departments - dhamangaon - Maharashtra

34992487 supply of material at gp dhamangaon 2nd call ballast , murum , sand , cement , iron , vita , bituminous pad , cement pipe , plastic polythene sheet , paver block , mixture machine , vibrator , roller , jcb , prc pipe , table chair , window , door , iron gate , water tanker , pocklan machine , pvc pipe , socket , bend , reducer , elbow , tee , tap seal , starter , elbow , stm pipe , solution , asian paint , asian primer , tractor distemper , centering material e...

Due Date : Dec 1, 2022
Tender Value : Ref. Document
30

Government Departments - Chandrapur - Maharashtra

34992486 supply of material at gp supgoan -ballast , murum , sand , cement , iron , vita , bituminous pad , cement pipe , plastic polythene sheet , paver block , mixture machine , vibrator , roller , jcb , prc pipe , table chair , window , door , iron gate , water tanker , pocklan machine , pvc pipe , socket , bend , reducer , elbow , tee , tap seal , starter , elbow , stm pipe , solution , asian paint , asian primer , tractor distemper , centering material etc

Due Date : Dec 1, 2022
Tender Value : Ref. Document
31

Local Bodies - Mumbai - Maharashtra

34992476 supply of acrylic distemper washable ( white colour ) , items : , acrylic distemper washable ( white colour )

Due Date : Dec 12, 2022
Tender Value : Ref. Document
32

Government Departments - chandrapur - Maharashtra

34992268 tender for construction material supply for year 2022-23-ballast , murum , sand , cement , iron , vita , bituminous pad , cement pipe , plastic polythene sheet , paver block , mixture machine , vibrator , roller , jcb , prc pipe , table chair , window , door , iron gate , water tanker , pocklan machine , pvc pipe ,socket , bend , reducer , elbow , tee , tap seal , starter , elbow , stm pipe , solution , asian paint , asian primer , tractor distemper , centering material etc

Due Date : Dec 1, 2022
Tender Value : Ref. Document
33

Boards / Undertakings / PSU - Talwara - Punjab

34992169 tender for providing roof leakage treatment, vitrified glazed tiles on existing cement concrete floors, replacement of damaged doors and change of electrical fittings/wiring of different police barracks

Due Date : Dec 13, 2022
Tender Value : rupee 10.46 Lakhs
34

Boards / Undertakings / PSU - kolkata - West Bengal

34992079 repainting of basket ball and tennis courts with acrylic paint including a levelling course of bitumen concrete of 50mm thick beneath the paint

Due Date : Dec 16, 2022
Tender Value : rupee 18.20 Lakhs
35

Statutory Bodies & Commissions/Committees - Ganjam - Odisha

34991330 bids are invited for it hadware items i5 desktop computer , li ups 1.0kva , video projection system with ceiling mount , ink jet colour printer , laser jet printer , desktop thin client , battery 12v 30ah total quantity : 81

Due Date : Dec 6, 2022
Tender Value : rupee 23.79 Lakhs
36

Government Departments - South Andamans - Andaman And Nicobar Islands

34991307 bids are invited for repair works of marcopolo bus 712 overhauling of power steering gear box with replacement of defective components with new one , replacement of tyre with tube and flap , diesel main pipe ,injector return line, injector return line washer , defective center bearing rubber, centre bearing, cross bearing to be replaced , front axle overhauling with replacement of king pin, bushes, thrust bearing and cotterkit , all wheel hub overhauling with replacement of defective bearings, ...

Due Date : Dec 6, 2022
Tender Value : Ref. Document
37

Statutory Bodies & Commissions/Committees - Udhampur - Jammu And Kashmir

34991282 bids are invited for paint red , paint white , paint yellow , paint black , paint silver , thinner , brush 4 inch total quantity : 17

Due Date : Nov 30, 2022
Tender Value : Ref. Document
38

Statutory Bodies & Commissions/Committees - Udhampur - Jammu And Kashmir

34991260 bids are invited for chuna , terrikota , paint blue , paint red , paint yellow , paint white , paint green total quantity : 456

Due Date : Nov 29, 2022
Tender Value : Ref. Document
39

Government Departments - Pune - Maharashtra

34991239 bids are invited for 250 mh regulator , plywood glass 18mm , window glass , cement , ace spark , bolder 1,2 , bolder 3,4 , brick , aluminium sheet , asian oil paint , terpenitine oil , painting rollar 4 , m.s.sheet , ball cock , leaping patty , krush sand , primer , pop , glass lambi , sand paper , reddy putty , window glass clip , water tap , fevicol , arenco sheet , asbestos sheet , grenitte , tiles , flush tank , oil bond total quantity : 11960

Due Date : Dec 6, 2022
Tender Value : Ref. Document
40

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

34991060 bids are invited for it hardware desktop pc with os , desktop pc without os , thin client , vps , server , laser printer , ink tank printer total quantity : 166

Due Date : Dec 8, 2022
Tender Value : Ref. Document
41

Local Bodies - Dungarpur - Rajasthan

34990685 tender for material supply and equipment supply for construction work in g.p.piplada panchayat samiti dungarpur- ghadhla kankar jhajhrha mud masala , lime , cement , fine aggregate , fly ash , sand gravel , grit stone brick , stone pattiya , precast tiles , vitrified , cement interlocking wood with fitting , iron , structural steel , winding wire , iron girder , barbed wire , iron net , glass color paint , modular socket outlet , enamel paint ., bitumen tax board , g i...

Due Date : Dec 12, 2022
Tender Value : rupee 50 Lakhs
42

Government Departments - Bilaspur - Chhattisgarh

34990459 chain link fencing gate construction, compound construction work at glazing unit ( matikala center ) sonpur

Due Date : Dec 8, 2022
Tender Value : Ref. Document
43

Government Departments - guwahati - Assam

34989848 supply of pu aluminium paint in 3 pack in 20 literpu aluminium paint in 3 pack in 20 liter, pu aluminium paint in 3 pack in 20 liters packing specn: m&c / pcn / 110 / 2006 => limited

Due Date : Dec 5, 2022
Tender Value : Ref. Document
44

Government Departments - harnaut - Bihar

34989726 supply of cellulose thinner solventcellulose thinner solvent, cellulose thinner solvent as per dgs & d specification g.p. 307 / 262, to is:1873 or latest.

Due Date : Nov 29, 2022
Tender Value : Ref. Document
45

Local Bodies - Bikaner - Rajasthan

34988820 supply of construction material - ghadhla kankar jhajhrha mud masala , lime , cement , fine aggregate , fly ash , sand gravel , grit stone brick , stone pattiya , precast tiles , vitrified , cement interlocking wood with fitting , iron , structural steel , winding wire , iron girder , barbed wire , iron net , glass color paint , modular socket outlet , enamel paint ., bitumen tax board , g i sheet , sheet , pipe , road roller , truck , vehicle hiring , compressor...

Due Date : Dec 7, 2022
Tender Value : rupee 70.82 Lakhs
46

Government Departments - Gorakhpur - Uttar Pradesh

34988635 supply of abs-supply, installation, wiring, testing & commissioning of dual redundant arrangement of ufsbi electronics for exchange of vital relay state information between two different signalling installations pertaining to abs / ib signalling application working on ofc / quad mediaabs-supply, installation, wiring, testing & commissioning of dual redundant arrangement of ufsbi electronics for exchange of vital relay state information between two different signalling installations pert...

Due Date : Dec 19, 2022
Tender Value : Ref. Document
47

Government Departments - harnaut - Bihar

34988523 supply of paint enamel synthetic exterior finishingpaint enamel synthetic exterior finishing, paint enamel synthetic exterior finishing air craft blue [ shade no.108 of is: 5 / 94 ] is:8662 / 2004 ( rev-02 ) along with addl. requirments as laid down in icf. str no. icf / md spec.045 issue status-02, rev.03.

Due Date : Nov 29, 2022
Tender Value : Ref. Document
48

Government Departments - mumbai - Maharashtra

34988107 tender for advertisement at railway stations through advertisement boards, hoardings, led thin boards, kiosk, nlit, glow sign.

Due Date : Dec 13, 2022
Tender Value : Ref. Document
49

Government Departments - Kamrup - Assam

34987996 bids are invited for various types of paints red paint , black paint , smoke gray paint , white colour - brilliant white total quantity : 290

Due Date : Dec 5, 2022
Tender Value : Ref. Document
50

Government Departments - nagpur - Maharashtra

34987807 supply of supply & installation of multi combo pl [ supply & installation of multi combo play item at narrow gauge rail museum, motibagh. play items combination of i ) spiral slide 8 feet height - 1 no. ii ) big wave slide 12 feet length - 1 no. iii ) wave slide 12 feet length - 2 nos. iv ) frp bunker 5 feet length - 1 no. v ) swing two seater - 1 no. vi ) climber hanging bar 8 feet long - 1 no. spec.- bridge, climber & ladders slide chute - 04 mm frp. main frame mde by...

Due Date : Nov 29, 2022
Tender Value : Ref. Document
51

Government Departments - chennai - Tamil Nadu

34987675 supply of supply and fitment of ready to fit complete coach setsupply and fitment of ready to fit complete coach set, supply and fitment of ready to fit complete coach set of seats and berths for lwaccn coaches as per drawing no.le61002, alt-k or latest with cushioning material - pu foam with fst properties confirming to en-45545 part-2, hl-3 as per specification mmdts19020 rev-3, amnd-1 or latest with fire barrier cloth compliant to en-45545, hl-3 to be used between pu foam and upholstery as ...

Due Date : Dec 23, 2022
Tender Value : Ref. Document
52

Local Bodies - Jalpaiguri - West Bengal

34987482 supply of materials of mgnregs works for vivekanada-ii gram panchayat , brick aggregate (single size):40 mm nominal size , tor steel rods/hysd bars/tmt bars(sail/tata/rinl) (fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars(jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars (other than sail/tata/rinl/jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , 1st class picke...

Due Date : Dec 9, 2022
Tender Value : rupee 22.48 Lakhs
53

Government Departments - guindy - Tamil Nadu

34987479 2039 labour charges for fabrication of student steel dual desk of size 1830mm ( l ) x 915 mm ( w ) made out of 18g cr sheet and erw steel pipe of 18g with powder coating charges labour charges for fabrication of student steel dual desk of size 1830mm ( l ) x 915 mm ( w ) made out of 18g cr sheet and erw steel pipe of 18g with powder coating charges

Due Date : Dec 27, 2022
Tender Value : Ref. Document
54

Government Departments - guindy - Tamil Nadu

34987459 tender for transport charges for steel dual desk for various places in tamil nadu as per annexure-i - transport charges for delivery of steel dual desk of size 1830mm ( l ) x 915mm ( w ) with 18g cr sheet with powder coating – made our of 18g cr sheet 25 x 25 18g erw pipe 50x25 18g erw pipe for various places in tamil nadu including loading and unloading for the delivery either in groundfloor or upstairs as per annexure-i

Due Date : Dec 27, 2022
Tender Value : Ref. Document
55

Government Departments - chennai - Tamil Nadu

34987344 supply of supply and fitment of ready to fit complete coach set of seats and berthssupply and fitment of ready to fit complete coach set of seats and berths, supply and fitment of ready to fit complete coach set of seats and berths for lwaccw coaches with as per drawing no. lwscwac / eog-6-1-001 alt- g , col - i cushioning material - pu foam with fst properties confirming to en-45545 part-2, hl-3 as per specification mmdts19020 rev-3, amnd-1 or latest with fire barrier cloth compliant to en-45...

Due Date : Dec 27, 2022
Tender Value : Ref. Document
56

Statutory Bodies & Commissions/Committees - JALGAON - Maharashtra

34987285 bids are invited for anvil punch drg. no. vpft/016 b. (q3) , lacquer pin to drg no: vpft-017 b (q3) , punch foil drg. no. vpft/004 a. (q3) , die foil & tamp to drg. no. vpft/005 c. (q3) , knock out plate assembly drg. no. vpft/002 c sheet no. 1 & 2. (q3) , cup plate assembly consist of drg. no. vpft-006 b, vpft- 007 c & vpft- 008 a. (q3) , plate assembly anvil seating charge drg. no. vpft/014 a consist of drg. no. vpft-009b, 010a, 01 (q3) total quantity : 4592

Due Date : Dec 17, 2022
Tender Value : Ref. Document
57

Local Bodies - purba - West Bengal

34987274 supply of materials of mgnregs works for purba kanthalbari gram panchayat , brick aggregate (single size):40 mm nominal size , tor steel rods/hysd bars/tmt bars(sail/tata/rinl) (fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars(jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars (other than sail/tata/rinl/jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , 1st class p...

Due Date : Dec 9, 2022
Tender Value : rupee 79.64 Lakhs
58

Local Bodies - Jalpaiguri - West Bengal

34987053 supply of materials of mgnregs works for salkumar-ii gram panchayat , brick aggregate (single size):40 mm nominal size , tor steel rods/hysd bars/tmt bars(sail/tata/rinl) (fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars(jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars (other than sail/tata/rinl/jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , 1st class picked ...

Due Date : Dec 9, 2022
Tender Value : rupee 1.28 Crore
59

Government Departments - rourkela - Odisha

34987040 supply of brushes for paints and varnishes.brushes for paints and varnishes., brushes for paints and varnishes, flat, size: - 25 mm. ( ser in 3 / 16 inch. letter to be stamped on the ferrule ) . material and specification -- is: 384 ( pt. 1 ) / 2012 with amendment 1 / sept. 2014 and amend. 2 / sept. 2020 and bristle to is: 1844 / 1993 with amendment 1 / dec. 2021 ( as per approved sample ) . page 1 of 6 run date / time: 25 / 11 / 2022 15:27:53sto...

Due Date : Jan 2, 2023
Tender Value : Ref. Document
60

Local Bodies - Jalpaiguri - West Bengal

34987036 supply of materials of mgnregs works for parorpar gram panchayat , brick aggregate (single size):40 mm nominal size , tor steel rods/hysd bars/tmt bars(sail/tata/rinl) (fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars(jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars (other than sail/tata/rinl/jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , 1st class picked jha...

Due Date : Dec 9, 2022
Tender Value : rupee 28.93 Lakhs
61

Local Bodies - Jalpaiguri - West Bengal

34987035 supply of materials of mgnregs works for chakowakheti gram panchayat , brick aggregate (single size):40 mm nominal size , tor steel rods/hysd bars/tmt bars(sail/tata/rinl) (fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars(jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars (other than sail/tata/rinl/jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , 1st class picked...

Due Date : Dec 9, 2022
Tender Value : rupee 29.69 Lakhs
62

Local Bodies - Bikaner - Rajasthan

34987013 supply of construction material- ghadhla kankar jhajhrha mud masala , lime , cement , fine aggregate , fly ash , sand gravel , grit stone brick , stone pattiya , precast tiles , vitrified , cement interlocking wood with fitting , iron , structural steel , winding wire , iron girder , barbed wire , iron net , glass color paint , modular socket outlet , enamel paint ., bitumen tax board , g i sheet , sheet , pipe , road roller , truck , vehicle hiring , compressor ...

Due Date : Dec 5, 2022
Tender Value : rupee 75.97 Lakhs
63

Local Bodies - Jalpaiguri - West Bengal

34987010 supply of materials of mgnregs works for banchukamari gram panchayat , brick aggregate ( single size ) :40 mm nominal size , tor steel rods / hysd bars / tmt bars ( sail / tata / rinl ) ( fe415 / fe500 / fe500d conforms to is: 1786 ) , tor steel rods / hysd bars / tmt bars ( jsw / jspl / shyam / srmb / bmasl / elecrosteel / ssl ) ( fe415 / fe500 / fe500d conforms to is: 1786 ) , tor steel rods / hysd bars / tmt bars ( other than sail / tata / rinl / jsw / jspl / shyam / srmb / bmasl ...

Due Date : Dec 9, 2022
Tender Value : rupee 23.95 Lakhs
64

Local Bodies - Jalpaiguri - West Bengal

34987005 supply of materials of mgnregs works for salkumar-i gram panchayat , brick aggregate (single size):40 mm nominal size , tor steel rods/hysd bars/tmt bars(sail/tata/rinl) (fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars(jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars (other than sail/tata/rinl/jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , 1st class picked j...

Due Date : Dec 9, 2022
Tender Value : rupee 48.21 Lakhs
65

Local Bodies - Jalpaiguri - West Bengal

34986996 supply of materials of mgnregs works for vivekanada-i gram panchayat , brick aggregate (single size):40 mm nominal size , tor steel rods/hysd bars/tmt bars(sail/tata/rinl) (fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars(jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , tor steel rods/hysd bars/tmt bars (other than sail/tata/rinl/jsw/jspl/shyam/srmb/bmasl/elecrosteel/ssl)(fe415/fe500/fe500d conforms to is: 1786) , 1st class picked...

Due Date : Dec 9, 2022
Tender Value : rupee 22.87 Lakhs
66

Statutory Bodies & Commissions/Committees - Ahmednagar - Maharashtra

34986952 bids are invited for metal polish, liquid as per is:5487 ( q3 ) total quantity : 427

Due Date : Dec 1, 2022
Tender Value : Ref. Document
67

Local Bodies - Sikar - Rajasthan

34986939 rate contract for supply of construction material in g.p.bhadala ki dhani for the financial year 2022-23- ghadhla kankar jhajhrha mud masala , lime , cement , fine aggregate , fly ash , sand gravel , grit stone brick , stone pattiya , precast tiles , vitrified , cement interlocking wood with fitting , iron , structural steel , winding wire , iron girder , barbed wire , iron net , glass color paint , modular socket outlet , enamel paint ., bitumen tax board , g i sheet ...

Due Date : Dec 5, 2022
Tender Value : rupee 30 Lakhs
68

Government Departments - lallaguda - Telangana

34986848 supply of thinner compatible for epoxy based zinc phosphate primer conforming to rdso spec.no.m&c / pcn / 100 / 2018, chapter - ii with rdsos amendment no. 1b as an additional requirement.thinner compatible for epoxy based zinc phosphate primer conforming to rdso spec.no.m&c / pcn / 100 / 2018, chapter - ii with rdsos amendment no. 1b as an additional requirement., thinner compatible for epoxy based zinc phosphate primer conforming to rdso spec.no.m&c / pcn / 100 / 2018, chapter - ii with rd...

Due Date : Dec 29, 2022
Tender Value : Ref. Document
69

Government Departments - Bikaner - Rajasthan

34986834 supply of amorolfin 5% nail lacquer - 2.5ml. phial with applicator sticksamorolfin 5% nail lacquer - 2.5ml. phial with applicator sticks, amorolfin 5% nail lacquer - 2.5ml. phial with applicator sticks => limited

Due Date : Dec 6, 2022
Tender Value : Ref. Document
70

Government Departments - Multi State

34986710 ar and mo films division complex, pedder road, mumbai-26 - sh - providing and fixing kota stone flooring near amphi theatre, plumbing and carpentry and painting works, tree guard painting, varnishing to rr masonry etc.

Due Date : Nov 29, 2022
Tender Value : Ref. Document
71

Government Departments - Kanpur - Uttar Pradesh

34986589 supply of paint enamel synthetic exterior.paint enamel synthetic exterior., paint enamel synthetic exterior finishing, air craft grey isc:693 to is: 8662 / 2004 [ iind revision ] , wet opacity 30 sq. mtrs per ltrs. packing in 20 ltrs. non-returnable new m.s. drums to is: 2552 / 89, gr. b-ii. => limited

Due Date : Dec 1, 2022
Tender Value : Ref. Document
72

Government Departments - guntakal - Andhra Pradesh

34986573 supply of paint black japan type-b to is: 341paint black japan type-b to is: 341, paint black japan type-b to is: 341 with rdso amendment no. 1a rev-1.0 & str no. m&c / pcn / 053 / 2020 ( rev.2.0 ) carr. repair andhra pradesh 12000.00 litre

Due Date : Dec 5, 2022
Tender Value : Ref. Document
73

Government Departments - Tirupati - Andhra Pradesh

34986567 supply of full gloss polyurethane enamel ( two pack ) top coat, colour: bluefull gloss polyurethane enamel ( two pack ) top coat, colour: blue, full gloss polyurethane enamel ( two pack ) top coat, colour: blue to ral ds 260 6035 conforming to rdso spec.no.m&c / pcn / 100 / 2018, chapter-v with rdsos amendment no. 1b as an additional requirement. carr. repair andhra pradesh 250.00 litre

Due Date : Dec 19, 2022
Tender Value : Ref. Document
74

Government Departments - Adra - West Bengal

34986566 supply of brushes for paints and varnishes, flat, brushes for paints and varnishes, flat, , brushes for paints and varnishes, flat, size: - 75 mm. ( ser in 3 / 16 inch. letter to be stamped on the ferrule ) . material and specification - is: 384 ( pt. 1 ) / 2012 with amendment 1 / sept. 2014 and amend. 2 / sept. 2020 and bristle to is: 1844 / 1993 with amendment 1 / dec. 2021 ( as per approved sample ) . page 1 of 6 run date / time: 25 / 11 / 2022 14:31:43stores-pcmm / s...

Due Date : Jan 2, 2023
Tender Value : Ref. Document
75

Boards / Undertakings / PSU - ambad - Maharashtra

34986379 supply of paint as per tender specs terms and conditions , f-16 - as per spec no.- b390-000-79-41-pls-01 rev0 , thinner for f-16 -as per spec no.- b390-000-79-41-pls-01 rev0 , f-9 -as per spec no.- b390-000-79-41-pls-01 rev0 , thinner for f-9 - as per spec no.- b390-000-79-41-pls-01 rev0 , f-12, shade- ral 9006 - as per spec no.- b390-000-79-41-pls-01 rev0 , thinner for f-12 - as per spec no.- b390-000-79-41-pls-01 rev0 , p-6 - as per spec no.- b390-000-79-41-pls-01 rev0 , thinner for p-6 - as ...

Due Date : Dec 3, 2022
Tender Value : Ref. Document
76

Government Departments - 24 Paraganas North - West Bengal

34986016 supply of paint enamel synthetic exterior etc.paint enamel synthetic exterior etc., paint enamel synthetic exterior finishing black for railway coaches to is: 8662 / 2004 ( 2nd revision ) ( reaffirmed2019 ) with rdso amendment no.1 ( rev.0 ) for pigment contnt as an additional requirement to is:8662 / 2004 w.e.f 01 / 08 / 2016 with additional requirement of i icf / md / spec.-045 issue status 02, rev.03. dated 14-06-2007 & amendment no.1 ( rev.1.0 effective from june 2020 ) as an additio...

Due Date : Dec 1, 2022
Tender Value : Ref. Document
77

Government Departments - Vijayawada - Andhra Pradesh

34985928 supply of supply and commissioning of heavy duty airless spray painting equipment as per the enclosed specification.supply and commissioning of heavy duty airless spray painting equipment as per the enclosed specification., supply and commissioning of heavy duty airless spray painting equipment as per the enclosed specification.

Due Date : Dec 20, 2022
Tender Value : Ref. Document
78

Local Bodies - Sikar - Rajasthan

34985854 rate contract for supply of construction material for the financial year 2022-23 in gram panchayat rajpura nausal- ghadhla kankar jhajhrha mud masala , lime , cement , fine aggregate , fly ash , sand gravel , grit stone brick , stone pattiya , precast tiles , vitrified , cement interlocking wood with fitting , iron , structural steel , winding wire , iron girder , barbed wire , iron net , glass color paint , modular socket outlet , enamel paint ., bitumen tax board , g...

Due Date : Dec 5, 2022
Tender Value : rupee 90 Lakhs
79

Government Departments - Multi State

34985555 supply of ac - 2 tr supply of 02 tr capacity, minimum bee 3-star rating, inverter type cassette ac unit with cordless remote, suitable plug top etc. as per the technical specifications given in the tender. 2 2 supply of ac - 3 tr supply of 03 tr capacity, inverter type cassette ac unit with cordless remote, suitable plug top etc. as per the technical specifications given in the tender. 3 3a itc of ac unit installation, testing and commissioning of above cassette air conditioner ...

Due Date : Dec 15, 2022
Tender Value : Ref. Document
80

Boards / Undertakings / PSU - mumbai - Maharashtra

34985479 procurement f additinal paints, primers and thinners on single tender for y-12652 as per tender , supply of following items , penguard primer , jotacote universal n10 aluminium , jotacote universal n10 grey , thinner-17 , penguard top coat , jotamastic 80 grey , hardtop xp ( ral 6028 green ) , anti-corrosive balloxy hb light , safeguard universal es , seaquantum pro u antifouling light red , seaquantum spectrum ( black ) , thinner 07

Due Date : Dec 2, 2022
Tender Value : Ref. Document
81

Government Departments - erode - Tamil Nadu

34985192 supply of anti-tracking varnishanti-tracking varnish, anti tracking varnish for class 130 degree as per rdso smi no elrs / smi / 200 revised or as per rdso mpmi no 153 / 92 rev 04 of sep 2014 for use in field coil and auxiliary machines ie., becktol red of m / s elantas beck co, pune or similar. the test certificate shoud contain parameters mentioned in annexure to mpmi 153 / 92 rev 04 of sep 2014. note only varnish is required. firm should quote only for varnish. amm / dsd / ed , sr tamil n...

Due Date : Dec 9, 2022
Tender Value : Ref. Document
82

Government Departments - kakkanad - Kerala

34985126 supply of fluorescent inks

Due Date : Dec 8, 2022
Tender Value : Ref. Document
83

Local Bodies - Nashik - Maharashtra

34984834 bids are invited for 500mm*600mm*3.0mm thk appox, minimax dosing pumps, minimax, frame shall be painted with 2 coats of epoxy primer and 2 coats of epoxy paint colour eluq std, 18 months supply or 12 months after commissioning total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
84

Statutory Bodies & Commissions/Committees - Kavaratti - Lakshadweep

34984426 bids are invited for maint stores syphone repair kit for flush tank , doom for curtain rods decorative type , helical door spring ms 200mm , float valve 15mm with complete set , ewc seat cover white , cotton waste , pvc bib taps 15mm , cabinet mirror 2ft x1point5ftx5mmth , pvc flushing cistern 10ltr , pvc connection pipe 600mm , waste coupling 40mm , spindle for pillar tap 15mm , cpvc pipe 20mm , cpvc t bend 25mm , cpvc l bend 25mm , wash hand basin 550x 440mm , ...

Due Date : Dec 6, 2022
Tender Value : Ref. Document
85

Government Departments - Tirupati - Andhra Pradesh

34984424 supply of full gloss polyurethane enamel ( two pack ) for the exterior finishing paint of railway coaches conforming to rdso spec.no.m&c / pcn / 100 / 2018, chapter - v, colour shade signal red to isc no.537 of is 5:2007 with rdso amendment 1b ( rev-2.0 ) & str:m&c / pcn / 040 / 2020 ( rev 2.0 ) .full gloss polyurethane enamel ( two pack ) for the exterior finishing paint of railway coaches conforming to rdso spec.no.m&c / pcn / 100 / 2018, chapter - v, colour shade signal red to isc ...

Due Date : Dec 28, 2022
Tender Value : Ref. Document
86

Government Departments - kochi - Kerala

34984245 electrification of the capacity stabilisation project , l.t. panels :supply, installation, testing and commissioning of following l.t. panel boards compartmental cubicle type, freestanding with appropriate cable entries, with aluminium busbars & manufactured based on is 8623, unloading, shifting, unpacking, section assembly from storage place to desired installation.all required protections will be as per tender technical specification & tender electricalsld. including all labou...

Due Date : Dec 12, 2022
Tender Value : Ref. Document
87

Local Bodies - peruvanthanam - Kerala

34984242 purchase of bailing machine purchase of bailing machine , purchase of baling machine , 1. automation grade- automatic 2. capacity-25 tonnes 3.cylinder- single cylinder 140x 80 mm @ 3000 psi 4.oil tank capacity-250 litres 5. bale size-600 mm x 600 mm x 600-900 mm 6. chamber size-600 mm x 600 mm x 1500 mm 7. bale weight-50 - 75 kg 8. cycle time-15 - 20 min per bale 9. power-5 - 10 hp 10. controls- push button operated, electrically controlled 11. production capacity-1000 - 1500 kg / 8 hr. shift 1...

Due Date : Dec 8, 2022
Tender Value : rupee 5.50 Lakhs
88

Government Departments - Erode - Kerala

34983930 supply of enamel paint ( apricot yellow ) enamel paint ( apricot yellow ) , enamel, synthetic, exterior, finishing colour shade ral 070 80 40 ( apricot yellow ) paint to specification is 8662 / 2004 and icf / md / spec-045, issue status 2, rev.03 with amendment dated 22 / 4 / 2018 or the latest. the pigment content shall be 6% minimum ( by mass ) as per rdso lr.no. m&c / pcn / i / 64 / i / vol.ii dated 12 / 5 / 2016 as rdso amendment no.1 packing in 20 liters new, sound and returnabl...

Due Date : Dec 22, 2022
Tender Value : Ref. Document
89

Government Departments - Hazira - Gujarat

34980780 tender for supply of paints

Due Date : Dec 1, 2022
Tender Value : Ref. Document
90

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

34980025 bids are invited for miniature circuit breaker 2 pole 63 a , amp meter , automatic voltage regulator , voltmeter , fule filter primer , pipe filter to pump , swicth assy solenoid , oil filter , hose air cleaner , fule feed pump total quantity : 15

Due Date : Nov 28, 2022
Tender Value : Ref. Document
91

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

34979990 bids are invited for glass tableware (q3) , brush cutter wire , oil filted heater , salon chair reclining and adjustable , enamel paint white 1 ltr , car rubbing polish , enamel paint black 1 ltr , enamel paint blue 1 ltr , distilled water , spanner set of 12 pcs , engine oil 20w40 , engine oil 50w40 , mechanical professional tool kit , air filter and oil filter for maruti omni van , air filter and oil filter for maruti gypsy , diesel filter for eicher , wheel range for maruti omni gypsy eicher...

Due Date : Nov 28, 2022
Tender Value : Ref. Document
92

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

34979966 bids are invited for paint , rfu,finishing,air drying brushing /sprying (q3) total quantity : 500

Due Date : Dec 6, 2022
Tender Value : Ref. Document
93

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

34979927 bids are invited for copper alloy fancy taps for bathroom - as per is:8931 latest (q3) , top for table office clk steel , plywood 8ft x 4 ft x 12 mm ost , gi nipple 15 x 50 mm , plywood 2100 x 900 x 12 mm commercial , coupling 32 mm for whb stainless steel , plywood 8ft x 4ft x 12 mm commercial , peg set , sunmica plywood 8ft x 4ft , touch wood , plywood 8ft x 4ft x 4 mm ost , ptmt bib tap 15 mm , lubrication oil uni vgf 22 , tee reducer gi 15 x 20 mm , pvc connection 15 x 300 mm , float valve ...

Due Date : Nov 28, 2022
Tender Value : Ref. Document
94

Statutory Bodies & Commissions/Committees - Nilgiris - Tamil Nadu

34979905 bids are invited for v-cloudpoint s100 thin client 3 years replacement warranty total quantity : 9

Due Date : Nov 28, 2022
Tender Value : Ref. Document
95

Statutory Bodies & Commissions/Committees - Rajauri - Jammu And Kashmir

34979826 bids are invited for knuckle bearing knuckle bearing , master cyl asy , speedometer cable rear , propler shaft bolt , propler shaft nut , oil filter element big , oil filter element small , fuel filter paper , oil filter , fuel filter with primer , wheel nut crome , wheel stud , air filter , wiper blade with arms , sun visor total quantity : 64

Due Date : Nov 28, 2022
Tender Value : rupee 15240.0
96

Statutory Bodies & Commissions/Committees - New Delhi - Delhi

34979801 bids are invited for ready mixed paint for road marking-is:164 (q3) total quantity : 325

Due Date : Dec 6, 2022
Tender Value : rupee 10.15 Lakhs
97

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

34979781 bids are invited for disc clutch , cover assy clutch , pipe exhaust centre , crown wheel , feed pump with hand primer total quantity : 5

Due Date : Nov 28, 2022
Tender Value : Ref. Document
98

Government Departments - Mumbai Suburban - Maharashtra

34979741 bids are invited for thin client computers (version 2.0) (q2) total quantity : 41

Due Date : Dec 5, 2022
Tender Value : Ref. Document