}

Bids Are invited for 1 Primers - Forward Cccctagatgggggaacaga20bp , 2 Primers - Reversegcattgttctcgggtgcaag 20Bp , 3 Primers - Forward Aggcagatggacctggatttga22bp , 4 Primers - Reversetggcttgcaaatagactcatctcc 24Bp , 5 Primers - Forward Gcctggcacatagta, Delhi-Delhi

Department Of Health And Family Welfare has published Bids Are invited for 1 Primers - Forward Cccctagatgggggaacaga20bp , 2 Primers - Reversegcattgttctcgggtgcaag 20Bp , 3 Primers - Forward Aggcagatggacctggatttga22bp , 4 Primers - Reversetggcttgcaaatagactcatctcc 24Bp , 5 Primers - Forward Gcctggcacatagta. Submission Date for this Tender is 26-07-2025. Paint Supply Tenders in Delhi Delhi. Bidders can get complete Tender details and download the document.




Tender Notice

50007164
Bids Are invited for 1 Primers - Forward Cccctagatgggggaacaga20bp , 2 Primers - Reversegcattgttctcgggtgcaag 20Bp , 3 Primers - Forward Aggcagatggacctggatttga22bp , 4 Primers - Reversetggcttgcaaatagactcatctcc 24Bp , 5 Primers - Forward Gcctggcacatagta
Tender
Indian
Delhi
Delhi
26-07-2025

Tender Details

Bids Are invited for 1 Primers - Forward Cccctagatgggggaacaga20bp , 2 Primers - Reversegcattgttctcgggtgcaag 20Bp , 3 Primers - Forward Aggcagatggacctggatttga22bp , 4 Primers - Reversetggcttgcaaatagactcatctcc 24Bp , 5 Primers - Forward Gcctggcacatagtaggccc , 6 Primers - Reverse Cttcctagccagccggcatc , 7 Primers - Forward Ctcctggaagctgatcttagg 21Bp , 8 Primers - Reverse Cctctctctatctagctccagcc 21Bp , 9 Primers - Forward Control Gccaaacacttcgagcac 18Bp , 10 Primers - Reverse Control Cggctcctggatggcctca 18Bp , 11 Primers - Forward Specific Cagagcatggacagggagcaag 22Bp , 12 Primers - Reverse Specific Tgcaggacgccgcgctgatc 20Bp , 13 Primers - Forward Acaaggggcgttagcttcat 20Bp , 14 Primers - Reverse Ggtatcaccggtcagcagtc 20Bp , A Restriction Enzymes - Restriction Enzymes Catalog R0585l Blp 1 2500Units , B Restriction Enzymes - Restriction Enzymes Catalog R0149s Fast Digest Taq 1 4000 Units , C Restriction Enzymes - Restriction Enzyme Catalog R3505l Eag 1 High Fidelity 2500 Units , D Restriction Enzymes - Restricted Enzymes Catalog R3505l Drd 1 1500 Units , Dna Extraction Kit - Dna Extraction Kit For Human Blood Samples Spin Column Based250 Prep , Dream Taq Green Pcr Master Mix - Dream Taq Green Pcr Master Mix2x100 Rxn , 100Bp Dna Ladder - Dna Ladder 100Bp1x50ugwith Loading Dyeready To Use , 50Bpdna Ladder - Dna Ladder 50Bp1x50ugwith Loading Dyeready To Use Total Quantity : 64

Key Value

Document Fees
Refer document
EMD
INR 38000.0 /-
Tender Value
INR 38 Lakhs /-
Disclaimer :
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tell us about your Product / Services,
We will Find Tenders for you

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail