}
  • Home   ›
  •   Indian Tenders   › Tender Notice : 44621888

    • Tender For Custom Primers And Probes., Pune-Maharashtra

    NATIONAL INSTITUTE OF VIROLOGY has published Tender For Custom Primers And Probes.. Submission Date for this Tender is 13-08-2024. Paint Supply Tenders in Pune Maharashtra. Bidders can get complete Tender details and download the document.




    Tender Notice

    44621888
    Tender For Custom Primers And Probes.
    Tender
    Indian
    Maharashtra
    Pune
    13-08-2024

    Tender Details

    Tender For Custom Primers And Probes. I-0000637 SPC_052071 Pimer and Probe Primer Name:SEBOV P(1870–1894): 5HEX-CTACGAGGATTCGGCTGAAGGCACC-BHQ13Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:25 1 vial 25 I-0000637 SPC_052072 Pimer and Probe Primer Name:CEBOV F(2030–2051): 5CGAAACCCGACTAATATGCCAA3Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:22 1 vial 22 I-0000637 SPC_052073 Pimer and Probe Primer Name:CEBOV R(2095–2117):5TGTTATCCCTGGCGTATTCTTGA3Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:23 1 vial 23 I-0000637 SPC_052074 Pimer and Probe Primer Name:CEBOVP(2055–2085):5 Texas Red -AAGACTCCACACAAAACAATGACAATCCTGCBHQ23 Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:31 1 vial 31 I-0000637 SPC_052075 Pimer and Probe Primer Name:JUNV F(1135–1158): 5TGATGAGTGTCCCYTACTGCAATT3Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:24 1 vial 24 I-0000637 SPC_052076 Pimer and Probe Primer Name:JUNVR(1251–1276):5AATATCCAGTCATTACGGAAGTCAGA3Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:26 1 vial 26 I-0000637 SPC_052077 Pimer and Probe Primer Name:JUNV P(1192–1220):5FAM-CAGGACAACACTCATTRCCAAGGTGCTGG-BHQ13Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:29 1 vial 29 I-0000637 SPC_052078 Pimer and Probe Primer Name:MACV F(1388–1411): 5GTTGAYATTTGTTTCTGGAGCACA3Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:24 1 vial 24 I-0000637 SPC_052079 Pimer and Probe Primer Name:MACVR(1478–1497):5 TGAGGCAAAGGACAGGCTTC3Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:20 1 vial 20 I-0000637 SPC_052080 Pimer and Probe Primer Name:MACV P(1456–1479):5 HEX-CACCCATCGACACCTCAAAGGCGA-BHQ13Scale of synthesis: 50nm DNA oligo Make: Eurofine, No of bases:24 1 vial 24

    Key Value

    Document Fees
    Refer document
    EMD
    Refer document
    Tender Value
    Refer document
    Disclaimer :
    We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
    Tell us about your Product / Services,
    We will Find Tenders for you
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail