}

Quotation For Consumables And Non-Consumables -, Jodhpur-Rajasthan

All India Institute Of Medical Sciences-AIIMS has published Quotation For Consumables And Non-Consumables -. Submission Date for this Tender is 23-04-2024. Paint Supply Tenders in Jodhpur Rajasthan. Bidders can get complete Tender details and download the document.




Tender Notice

43188588
Quotation For Consumables And Non-Consumables -
Open Tender
Indian
Rajasthan
Jodhpur
23-04-2024

Tender Details

Quotation For Consumables And Non-Consumables -1. Primer KRAS Exon 2F (GTGTGACATGTTCTAATATAGTCA) 2. Primer KRAS Exon 2R (GAATGGTCCTGCACCAGTAA) 3. Primer KRAS Exon 3F (TCAAGTCCTTTGCCCATTTT) 4. Primer KRAS Exon 3R (TACACAAAGAAAGCCCTCCCC) 5. Primer KRAS Exon 4F (TTGTGGACAGGTTTTGAAAGA) 6. Primer KRAS Exon 4R (AGAAGCAATGCCCTCTCAAG) 7. 2X Platinum SuperFi PCR PCR Master 8. HighPrep PCR – DX (5mL) 9. HighPrep DTR-DX (5ml) 10. MyMag™ 96X magnetic Plate

Key Value

Document Fees
Refer document
EMD
Refer document
Tender Value
Refer document
Disclaimer :
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tell us about your Product / Services,
We will Find Tenders for you

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail