242 Multiplex tenders in Maharashtra 2025

Get latest Multiplex related Tenders, online published by Bank Of Maharashtra, Cidco Maharashtra Ltd., City and Industrial Development Corporation of Maharashtra from Maharashtra state. Participate online through e-Procurement website for Multiplex tenders in Maharashtra. Download Tender Documents, BOQ, Technical Bids for Multiplex related Tenders from Maharashtra. Get Bidding support for etenders related to Multiplex Tenders in Maharashtra. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Multiplex tenders published from Maharashtra. Also get daily email alerts for Multiplex related tender notices published by Government of Maharashtra.

1

Boards / Undertakings / PSU - Kolhapur - Maharashtra

49863351 auction for sale of immovable property. mr. tushar mahendrakumar thakar and mrs. devika tushar thakar, flat no. 6, 3rd floor, go padma kutir, gayatri nagar, r.s. no. 124, near new pride multiplex, a/p sangli, dist. sangli

Due Date : Jul 22, 2025
Tender Value : rupee 18.07 Lakhs
View Notice
2

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

49835839 bids are invited for multiplex rt pcr kit for respiratory pathogen, multiplex rt pcr kits for tropical infection,hbv dna total quantity : 105

Due Date : Jun 27, 2025
Tender Value : Ref. Document
View Notice
3

Boards / Undertakings / PSU - sevagram - Maharashtra

49759907 Corrigendum : tender for annual rate contract for fever multiplex real time pcr kits

Due Date : Aug 5, 2025
Tender Value : Ref. Document
View Notice
4

Statutory Bodies & Commissions/Committees - pune - Maharashtra

49732905 tender for single tender enquiry for agpath id one step rt pcr and taqpath one step multiplex master mix

Due Date : Jun 24, 2025
Tender Value : rupee 10 Lakhs
View Notice
5

Government Departments - Mumbai - Maharashtra

49646134 bids are invited for 10ul xl lr tip ster fltr 1 pack 10 x 96 tips by rack make thermo catalog gltflr102 10 q , 20ul xl lr tip ster fltr 1 pack 10 x 96 tips by rack make thermo fisher catalog gltflr113 20 q , 200ul xl lr tip ster fltr 1 pack 10 x 96 t

Due Date : Jul 5, 2025
Tender Value : Ref. Document
View Notice
6

Government Departments - Mumbai - Maharashtra

49646090 bids are invited for ortho coombs reagent , hplc water merk , ethanol ar , takara emerald gt pcr mastermix takara , dream taq green pcr mastermix thermofisher , 6x tri track dna loading dye thermofisher , encode sequencing clean up wash buffer 500ml

Due Date : Jul 5, 2025
Tender Value : Ref. Document
View Notice
7

Government Departments - Mumbai - Maharashtra

49598715 bids are invited for consumables mse quagen multiplex pcr kit100 cat.no 206143 , dimethyl sulfoxide molecular grade cat.no d8418 50 ml. sigma , primer lis f 5ataccatgg tta ccc cat tgagc3 , primer lis r 5agggctcattacatgtggaccc3 , primer 4.2 f 5ggtttac

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
8

Government Departments - trombay - Maharashtra

49571045 tender for supply, installation, warranty and training of multiplex, nested pcr filmarray system as per detailed specifications given in annexure 1 (technical specifications)

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
9

Government Departments - Mumbai - Maharashtra

49347440 bids are invited for consumables depc treated water 100ml catalog am9915g make ambion , platinuma c multiplex pcr master mix 250 make thermofisher catalog no 4464269 , q5 a high fidelity 2x master mix 500 make neb catalog m0492s , multiplex pcr 5x ma

Due Date : Jun 18, 2025
Tender Value : Ref. Document
View Notice
10

Government Departments - Mumbai - Maharashtra

49269479 bids are invited for consumables qiagen multiplex pcr kit , sigma oligonucleotides 50d desalted a , anti s small , 6x dna loading dye , sigma oligonucleotides 50d desalted b , consumables for digital duplicators total quantity : 1008

Due Date : Jun 13, 2025
Tender Value : Ref. Document
View Notice
11

Boards / Undertakings / PSU - sevagram - Maharashtra

49164284 tender for annual rate contract for meningitis multiplex real time pcr kits

Due Date : May 31, 2025
Tender Value : Ref. Document
View Notice
12

Boards / Undertakings / PSU - sevagram - Maharashtra

49163979 tender for annual rate contract for respiratory multiplex real time pcr kits

Due Date : May 31, 2025
Tender Value : Ref. Document
View Notice
13

Government Departments - Pune - Maharashtra

48811016 auction sale of property unit no.10, ground floor, xion mall multiplex, survey no.15/5, 15/6,15/7,15/8, 16,17/1,17/3,17/2/2,17/2/1,18/1 and 18/2, mouje hinjewadi, near dmart and vivanta, hinjewadi aundh road, hinjewadi, pune (area: 621.00 sq.ft (5

Due Date : May 6, 2025
Tender Value : Ref. Document
View Notice
14

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

48806974 bids are invited for consumables for molecular biology multiplex rt pcr kit for respiratory pathogen , multiplex rt pcr kits for tropical infection , hbv dna quantitative real time pcr kit ivd and ce usfda approved , hcv rna real time quantitative pc

Due Date : May 13, 2025
Tender Value : Ref. Document
View Notice
15

Local Bodies - Kolhapur - Maharashtra

48203954 Corrigendum : tender for purchase lubricant oil, griss, coolunt, petrolium product etc. for kmc all vehicles machinary

Due Date : Apr 29, 2025
Tender Value : Ref. Document
View Notice
16

Government Departments - pune - Maharashtra

48121931 tender for procurement of items on proprietary basis

Due Date : Mar 10, 2025
Tender Value : Ref. Document
View Notice
17

Government Departments - Mumbai - Maharashtra

47598772 bids are invited for consumbales pneumovax 23 , meningococcal vaccine , tab. pentids 400 one strip of 10 tablets , quagen multiplex pcr kit , hydrosick tablets 200mg 1 strip pack of 10 tablets , consumables for point of care test (poct) equipment

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
18

Boards / Undertakings / PSU - sevagram - Maharashtra

47526786 Corrigendum : tender for annual rate contract for respiratory multiplex real time pcr kits

Due Date : Mar 24, 2025
Tender Value : Ref. Document
View Notice
19

Boards / Undertakings / PSU - sevagram - Maharashtra

47526761 tender for annual rate contract for fever multiplex real time pcr kits

Due Date : Feb 22, 2025
Tender Value : Ref. Document
View Notice
20

Boards / Undertakings / PSU - sevagram - Maharashtra

47526755 Corrigendum : tender for annual rate contract for meningitis multiplex real time pcr kits

Due Date : Mar 24, 2025
Tender Value : Ref. Document
View Notice
21

Government Departments - pune - Maharashtra

47504710 tender for supply of diagnostic kits, primer, probe and chemicals supply of diagnostic kits, primer, probe and chemicals for pcr , name of the primer, probe and chemicals required for pcr or goods , kit for albumin estimation , kit for total protein estim

Due Date : Feb 6, 2025
Tender Value : rupee 19.19 Lakhs
View Notice
22

Government Departments - Chandrapur - Maharashtra

47465031 Corrigendum : tender for supply of non ssr item ce dar magvine , play equipment , multi activity play system actual equipment size: 42x 30x 16 ft. children capacity : 45 children material specification : structure gi/ ms pipe : class b and conforming to is 1239, od 114

Due Date : Feb 11, 2025
Tender Value : Ref. Document
View Notice
23

Government Departments - Mumbai Suburban - Maharashtra

47428571 bids are invited for mouse cytokine multiplex panel total quantity : 2

Due Date : Jan 30, 2025
Tender Value : Ref. Document
View Notice
24

Government Departments - Mumbai - Maharashtra

47412059 bids are invited for consumables hplc with pda detector for amino acid profiling , cyt inf d , cyt inf efdb 20 , dfs taq polymerase bioron 500 units , 4you4 dntp mix 10mm each 200ul , taqara ex taq polymerase hot start 250 unit , qiagen multiplex pcr

Due Date : Feb 18, 2025
Tender Value : Ref. Document
View Notice
25

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

47371542 bids are invited for multiplex rt pcr kit for respiratory pathogens , disease specific real time pcr kits real time pcr kits (v2) total quantity : 192

Due Date : Feb 14, 2025
Tender Value : Ref. Document
View Notice
26

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

47365217 bids are invited for multiplex rt pcr kit for tropical infection , disease specific real time pcr kits real time pcr kits (v2) total quantity : 192

Due Date : Feb 14, 2025
Tender Value : Ref. Document
View Notice
27

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

47187031 bids are invited for consumables for anveshan 48 encephalitis meningitis real time pcr kit , multiplex rt pcr kits for tropical infection , japanese encephalitis virus real time pcr kit compatible with roche lc 480 ivdcefda approved , 20 microlitre t

Due Date : Feb 4, 2025
Tender Value : Ref. Document
View Notice
28

Local Bodies - parel - Maharashtra

47072665 Corrigendum : tender for purchase of nucleic acid amplification multiplex pcr assay forqualitative detection of neuro virusesinmeningitis/meningoencephalitiskit (enterovirus, epstein barr virus , herpes simplex virus 1 , herpes simplex virus2 , hsv 2 , hcv , hhv 6 , hh

Due Date : Mar 5, 2025
Tender Value : rupee 3 Lakhs
View Notice
29

Government Departments - miraj - Maharashtra

46964087 tender for respiratory viral pathogen multiplex/panel rt pcr kit

Due Date : Jan 10, 2025
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46904635 bids are invited for consumables for anveshan 48 encephalitis meningitis real time pcr kit , multiplex rt pcr kits for tropical infection , japanese encephalitis virus real time pcr kit compatible with roche lc 480 ivdcefda approved , 20 microlitre t

Due Date : Jan 16, 2025
Tender Value : Ref. Document
View Notice
31

Government Departments - pune - Maharashtra

46882939 Corrigendum : rate contract for the supply of primer, probe & chemicals required for pcr

Due Date : Jan 6, 2025
Tender Value : rupee 3.67 Lakhs
View Notice
32

Government Departments - goregaon - Maharashtra

46814149 Corrigendum : supply of laboratory media, consumables, pcr kits etc

Due Date : Jan 23, 2025
Tender Value : rupee 32 Lakhs
View Notice
33

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46518939 bids are invited for carbapenemase gene multiplex pcr kit,rapid and visual multiplex immunochromatographic assay for the total quantity : 345

Due Date : Dec 7, 2024
Tender Value : Ref. Document
View Notice
34

Government Departments - Mumbai - Maharashtra

46379490 bids are invited for consumable dfs taq polymerase bioron 500 units , 4you4 dntp mix 10mm each 200ul , gel loading dye r0611 thermo , r001a 250 u takara taq takara , generular tm 100bp dna ladder , ultra pure agarose 16500 500 , qiagen multiplex

Due Date : Dec 18, 2024
Tender Value : Ref. Document
View Notice
35

Boards / Undertakings / PSU - sevagram - Maharashtra

46152964 tender for annual rate contract for supply of rtpcr kits

Due Date : Dec 3, 2024
Tender Value : Ref. Document
View Notice
36

Government Departments - Mumbai - Maharashtra

46075327 Corrigendum : bids are invited for bfmi sfci ea 10 u by i 1 by 4 l er1161 , multiplex bead assay custom aimplex human 7 plex panel aimplex biosciences il 1beta il 4 il 6 il 22 ifn gamma tnf alpha il 17a , human interferon gamma induced protein 10kda ip10 elisa kit

Due Date : Dec 9, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Mumbai - Maharashtra

46050663 bids are invited for e el h6073 human mmp1 elisa kit 96 tests , e el h1449 human mmp7 elisa kit 96 tests , e el h6075 human mmp 9 elisa kit 96 tests , e el h1270 human parc by ccl18 pulmonary activation regulated chemokine elisa kit 96 tests , e el h0

Due Date : Nov 27, 2024
Tender Value : Ref. Document
View Notice
38

Government Departments - Mumbai Suburban - Maharashtra

46037911 bids are invited for mouse cytokine multiplex panel total quantity : 2

Due Date : Nov 26, 2024
Tender Value : Ref. Document
View Notice
39

Government Departments - Mumbai - Maharashtra

46027161 bids are invited for consumables for medical research 0020302400 hemosil rinse solutions 4 litres , smn 11373993 ftd 42.1 32 ruo ftd urethritis plus ruo multiplex realtime detection kit , a28007 taqman adv microrna cdna syn kit , 4444557 taqman fa

Due Date : Nov 21, 2024
Tender Value : rupee 4.02 Lakhs
View Notice
40

Government Departments - Mumbai - Maharashtra

45954384 bids are invited for mak360 mitochondrial complex iii activity assay kit , c2506 cytochrome c from equine heart 50mg , 10771 histopaque 1077 100ml , 4352135 1kt itraq reagents multiplex kit , prx 07 mxprm9k 7plex multiplex cytokine assay kit 1 plate

Due Date : Nov 18, 2024
Tender Value : rupee 4.95 Lakhs
View Notice
41

Government Departments - Mumbai - Maharashtra

45950295 bids are invited for magnetic bead based multiplex immunoassay system total quantity : 1

Due Date : Nov 2, 2024
Tender Value : Ref. Document
View Notice
42

Government Departments - Mumbai - Maharashtra

45942274 bids are invited for import chemical consumables for medical research mse itraq reagents multiplex kit 4352135 , dichloromethane 650463 , ammonium per sulphate aps a3678 , dimethyl sulfoxide 5ml d2650 , mitochondrial complex iii acitivity assay kit

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
43

Government Departments - Mumbai - Maharashtra

45901002 bids are invited for rptmag 86k 02 milliplex map rat pituitary magnetic bead panel endocrine multiplex assay , 33001 cf488a tyramide amplification kit with hrp goat anti rabbit and cf dye or biotin tyramide , ab228559 homocysteine assay kit fluorometr

Due Date : Nov 14, 2024
Tender Value : rupee 4.84 Lakhs
View Notice
44

Government Departments - Mumbai - Maharashtra

45862898 bids are invited for multiplex bead assay custom aimplex human 7 plex panel aimplex biosciences , e el h6073 human mmp1 elisa kit 96 tests , e el h1449 human mmp7 elisa kit 96 tests , e el h6075 human mmp 9 elisa kit 96 tests , e el h1270 human parc b

Due Date : Nov 13, 2024
Tender Value : Ref. Document
View Notice
45

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

45855887 Corrigendum : bids are invited for terminalia arjuna , cassia fistula , peltophorum pterocarpum , lagerstomia , bambusa multiplex , bamboosa vulgaris yellow , bamboosa vulgaris green , dendrocalamus asper , dendrocalamus giganteus , bambusa tulda , thyrsostachys oliver

Due Date : Jan 3, 2025
Tender Value : Ref. Document
View Notice
46

Government Departments - goregaon - Maharashtra

45739007 Corrigendum : tender for supply of laboratory media, consumables, pcr kits

Due Date : Nov 5, 2024
Tender Value : rupee 32 Lakhs
View Notice
47

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45684167 bids are invited for cre pcr kit and other consumables carbapenemase gene multiplex pcr kit , rapid and visual multiplex immunochromatographic assay for the qualitative detection and differentiation of five common carbapenemases kpc oxa 48 like vim i

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
48

Government Departments - pune - Maharashtra

45548973 Corrigendum : tender for supply of primer, probe and chemicals required for pcr , name of the primer, probe and chemicals required for pcr or goods , 100 bp dna ladder , 2x pcr master mix , 50 x tae , molecular biology grade ethanol , molecular biology grade water , m

Due Date : Oct 22, 2024
Tender Value : rupee 25 Lakhs
View Notice
49

Boards / Undertakings / PSU - pune - Maharashtra

45339786 tender for construction of workshop building at iiser pune

Due Date : Sep 30, 2024
Tender Value : rupee 3.70 Crore
View Notice
50

Government Departments - Raigad - Maharashtra

45079570 bids are invited for magnetic bead based multiplex immunoassay system total quantity : 1

Due Date : Sep 26, 2024
Tender Value : Ref. Document
View Notice
51

Government Departments - Mumbai - Maharashtra

45070451 bids are invited for consumables taqman mastermix 2x 101625 , 119104 taqman master mix , trackit 100bp ladder , 6x dna loading dye 5x1 ml r0611 , expina c pcr sv clean up 200preps , expina c cleanup sv 113 102 , mini type d column with collectiontube

Due Date : Sep 27, 2024
Tender Value : Ref. Document
View Notice
52

Government Departments - Pune - Maharashtra

44965092 tender for procurement of taqman fast virus 1 step multiplex mastermix for qpcr (no rox), 1x1ml, make: thermofisher, qty 5.

Due Date : Sep 2, 2024
Tender Value : Ref. Document
View Notice
53

Government Departments - Mumbai - Maharashtra

44876193 bids are invited for consumables rna extraction kit for nasopharyngeal swab , respiratory viral panel by multiplex pcr , factor v leiden rt pcr detection kit 100 rxns nfvl23001 , climatronics novita nd328 dehumidifier , fitc mouse anti human cd69 tot

Due Date : Sep 14, 2024
Tender Value : Ref. Document
View Notice
54

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

44875935 bids are invited for multiplex rt pcr kits for tropical infection total quantity : 192

Due Date : Sep 13, 2024
Tender Value : Ref. Document
View Notice
55

Government Departments - Miraj - Maharashtra

44830141 tender for price lists for purchase of kits required in vrdl laboratory respiratory pathogen multiplex/panel rt pcr kit

Due Date : Aug 30, 2024
Tender Value : Ref. Document
View Notice
56

Government Departments - Mumbai - Maharashtra

44005629 Corrigendum : tender for maharashtra tourism advertisement in domestic multiplex cinema hall theatres.

Due Date : Jul 15, 2024
Tender Value : Ref. Document
View Notice
57

Government Departments - Mumbai - Maharashtra

43561943 bids are invited for 1 human anti cd45 monoclonal antibody(hi30),fitc 2 human anti cd19 monoclonal antibody(hib19),pe 3 human anti cd7 monoclonal antibody (cd7 6b7),apc 4 mouse anti cd45 monoclonal antibody (30 f11),pe cyanine7 5 cd68 antibody,an

Due Date : Jun 27, 2024
Tender Value : Ref. Document
View Notice
58

Government Departments - Navi Mumbai - Maharashtra

43554043 bids are invited for fully automated multiplex ihc stainer total quantity : 1

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
59

Government Departments - Mumbai - Maharashtra

43392610 bids are invited for consumables qiaamp dna blood mini kit 250rxn , sigma oligonucleotides 50d desalted a , sigma oligonucleotides 50d desalted b , sigma oligonucleotides 50d desalted c , qiagen multiplex pcr kit total quantity : 393

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
60

Boards / Undertakings / PSU - Mumbai - Maharashtra

43375287 e tender for procurement of mak sinthax ep 2 grease mak multiplex cs2 grease at lobp budge budge

Due Date : May 18, 2024
Tender Value : Ref. Document
View Notice
61

Government Departments - Mumbai - Maharashtra

43276716 bids are invited for consumables dfs taq polymerase bioron 500 units , 4you4 dntp mix 10mm each 200ul , generulertm 100bp plus dna ladder ready touse 50 g , invitrogena c ultrapurea c agarose cat 16500500 500g x3 43 969.00 , qiagen multiplex pcr kit

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
62

Government Departments - mumbai - Maharashtra

43155105 tender for “providing comprehensive architectural services for conceptualizing and designing of new engineering structures with high standard aesthetic value such as commercial complex, residential complex, multimodal transport hubs, sport complex, rai

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
63

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

43144203 bids are invited for multiplex pcr kit for std panel ivd and ceusfda approved , scrub typhus real time pcr kit compatible with roche lc 480 ivd and cefda approved , parvovirus b 19 real time pcr kit ivd ceusfda approved , pneumocystis jirovecii real t

Due Date : Apr 12, 2024
Tender Value : Ref. Document
View Notice
64

Government Departments - mumbai - Maharashtra

43001078 tender for providing comprehensive architectural services for conceptualizing and designing of new engineering structures with high standard aesthetic value such as commercial complex, residential complex, multimodal transport hubs, sport complex, railwa

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
65

Local Bodies - Mumbai - Maharashtra

42814969 Corrigendum : tender for supply of laboratory chemicals, stains, reagents, etc

Due Date : Jul 11, 2024
Tender Value : Ref. Document
View Notice
66

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42603756 bids are invited for real time pcr kits flu panel with rsv real time pcr kit , respiratory pathogen panel multiplex pcr kit , encephalitis meningitis real time pcr kit , nitrile gloves size small , nitrile gloves size medium , sterile microtips with

Due Date : Mar 11, 2024
Tender Value : Ref. Document
View Notice
67

Government Departments - Mumbai - Maharashtra

42440435 bids are invited for consumable qiagen multiplex pcr kit , pdml xmnl 2500 units , sigma oligonucleotides 50d desalted , dfs taq polymerase bioron 500 units , 4you4 dntp mix 10 mm each 200ul total quantity : 198

Due Date : Mar 5, 2024
Tender Value : Ref. Document
View Notice
68

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42326324 bids are invited for std panel pcr kits multiplex pcr kit for std panel ivd and ceusfda approved , scrub typhus real time pcr kit compatible with roche lc 480 ivd and cefda approved , parvovirus b 1 real time pcr kit ivd ceusfda approved , pneumocyst

Due Date : Mar 4, 2024
Tender Value : Ref. Document
View Notice
69

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42299186 bids are invited for aes project consumables real time pcr kit for neuro 9 pathogens validated on roche lc 480 and rotor gene rg3000 ivd cefda approved , multiplex rt pcr kits for tropical infection , japanese encephalitis virus real time pcr kit com

Due Date : Mar 9, 2024
Tender Value : Ref. Document
View Notice
70

Government Departments - Raigad - Maharashtra

42258290 Corrigendum : bids are invited for fully automated multiplex ihc stainer (q3) total quantity : 1

Due Date : Mar 26, 2024
Tender Value : Ref. Document
View Notice
71

Government Departments - Mumbai - Maharashtra

42225797 bids are invited for molecular weight marker 100bp , agarose le , ethanol absolute , thermal printer paper , one step rt pcr kit , rubella primers for real time pcr , rubella probes for real time pcr , rnase primers probes , measles and rubella multi

Due Date : Feb 26, 2024
Tender Value : rupee 11.84 Lakhs
View Notice
72

Government Departments - Mumbai - Maharashtra

42222676 bids are invited for consumables paxgenei blood rna tube a , paxgenei blood rna tube b , paxgenei blood rna tube c , paxgenei blood rna tube d , roche kapa kapa2g fast multiplex pcr kit of 1.25ml 100x25microl rxn total quantity : 101

Due Date : Feb 26, 2024
Tender Value : Ref. Document
View Notice
73

Government Departments - Mumbai Suburban - Maharashtra

42101377 bids are invited for multiplex human cytokinechemokinegrowth factors panel (q3) mse total quantity : 1

Due Date : Feb 29, 2024
Tender Value : Ref. Document
View Notice
74

Government Departments - Mumbai - Maharashtra

42099439 bids are invited for consumabale varianttm ii b thalassemia short program , sigma oligonucleotides 5od 50nm hplc purified , qiagen multiplex pcr kit , cell pack pack size 20 lts , stromatolyser wh pack size 500ml total quantity : 518

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
75

Government Departments - Mumbai - Maharashtra

42066231 bids are invited for consumables qlaamp dna mini kit 250 , qiagen multiplex pcr kit a , qiagen multiplex pcr kit b , twist custom panel 12 reactions 500 probes , nebnext ultra ii q5 master mix total quantity : 34

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
76

Government Departments - Pune - Maharashtra

41890746 bids are invited for magnetic bead based multiplex immuno assay system (q3) total quantity : 1

Due Date : Feb 9, 2024
Tender Value : Ref. Document
View Notice
77

Government Departments - Mumbai - Maharashtra

41709814 bids are invited for chemicals ahg bioclone clear combs sera , anti human globulin ahg coombs reagent green colored , id dc screening , anti d ig m eryclone , qiagen multiplex pcr kit 100 total quantity : 11

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
78

Government Departments - Mumbai - Maharashtra

41569293 bids are invited for chemicals emeraldamp gt pcr master mix 160rxns , emeraldamp gt pcr master mix 160rxns a , qiagen multiplex pcr kit 100 , portable 5 tb external hard disk drive hdd , 2tb wd external ssd high speed total quantity : 11

Due Date : Jan 22, 2024
Tender Value : Ref. Document
View Notice
79

Statutory Bodies & Commissions/Committees - PUNE - Maharashtra

41219817 bids are invited for carbapenemase gene multiplex pcr kit , rapid and visual multiplex immunochromatographic assay for the qualitative detection and differentiation of five common carbapenemases kpc oxa 48 like vim imp and ndm , dna extraction kit fro

Due Date : Dec 22, 2023
Tender Value : Ref. Document
View Notice
80

Government Departments - Mumbai - Maharashtra

41218862 bids are invited for chemicals dfstaq dna polymerase500 units , 4you dntp mix 10mm 200ul bioron , mp biomedical agarose ultrapure 500gm , qiagen multiplex pcr kit , hpyf3i ddel 500 units total quantity : 59

Due Date : Jan 1, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - Mumbai - Maharashtra

41118904 bids are invited for consumables sta deficient viii a , emicizumab controls , emicizumab calibrator , qiagen multiplex pcr kit , sta deficient viii b total quantity : 7

Due Date : Dec 26, 2023
Tender Value : Ref. Document
View Notice
82

Government Departments - Mumbai - Maharashtra

41114452 bids are invited for consumables qiagen multiplex pcr kit 100 , sigma oligonucleotides 50d desalted , pdml xmnl 2500 units , hpyf31 dde1 500 units a , hpyf31 dde1 500 units b total quantity : 480

Due Date : Dec 26, 2023
Tender Value : Ref. Document
View Notice
83

Government Departments - Mumbai - Maharashtra

40769416 Corrigendum : bids are invited for 1 iq multiplex powermix (2x) containing dntps, mgcl2, itaq dna pol 200 reactions 2 power pac universal power supply for a broad range of electrophoresis and blotting application 3 sybr assay taq universal 4 blotting roller 5

Due Date : Dec 28, 2023
Tender Value : rupee 4.65 Lakhs
View Notice
84

Government Departments - Mumbai - Maharashtra

40650288 bids are invited for chemicals qiaamp dna blood midi kit , qiagen multiplex pcr kit 100 , qiagen multiplex pcr kit 100 a , qiagen multiplex pcr kit 100 b , tae buffer tris acetate edta 50x total quantity : 31

Due Date : Nov 27, 2023
Tender Value : Ref. Document
View Notice
85

Government Departments - Mumbai - Maharashtra

40527305 bids are invited for chemicals eia 316 cic c1q elisa kit 6 wells , multiplex bead assay nr basic kit nr diluent kit , human timp 1 elisa , anti tpo elisa , ace elisa total quantity : 9

Due Date : Nov 17, 2023
Tender Value : Ref. Document
View Notice
86

Local Bodies - MUMbai - Maharashtra

40516533 rate contract of supply of dengue chikungunya multiplex real time pcr kit (qualitative), master mix, controls and dengue chikungunya primers forward & reverse and probes

Due Date : Nov 9, 2023
Tender Value : Ref. Document
View Notice
87

Local Bodies - Mumbai - Maharashtra

40480990 tender for supply of dengue chikunguniya multiplex real time pcr kit, master mix, control and dengue chikungunya primers forward and reserve and probs.

Due Date : Nov 9, 2023
Tender Value : Ref. Document
View Notice
88

Local Bodies - mumbai - Maharashtra

40475138 tender for providing chikungunya multiplex real time pcr kit, master mix, controls and dengue chikungunya primer forward and reverse ands probs.

Due Date : Nov 9, 2023
Tender Value : Ref. Document
View Notice
89

Government Departments - Mumbai - Maharashtra

40473123 bids are invited for automated syndromic multiplex pcr system (biofire film array) (q3) total quantity : 1

Due Date : Nov 23, 2023
Tender Value : Ref. Document
View Notice
90

Local Bodies - Mumbai - Maharashtra

40466659 purchase of dengue chikungunya multiplex real time pcr (qualitative ) amplification/detection kit 25 kits for pcr laboratory at kasturba hospital.

Due Date : Nov 9, 2023
Tender Value : Ref. Document
View Notice
91

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

40419851 bids are invited for carbapenemase gene pcr kit carbapenemase gene multiplex pcr kit , rapid and visual multiplex immunochromatographic assay for the qualitative detection and differentiation of five common carbapenemases kpc oxa 48 like vim imp and

Due Date : Nov 9, 2023
Tender Value : Ref. Document
View Notice
92

Government Departments - Mumbai - Maharashtra

39992993 bids are invited for consumables portable 2 tb external hard disk drive hdd , portable 2 tb external hard disk drive hdd a , portable 2 tb external hard disk drive hdd b , qiagen multiplex pcr kit , eqas hemoglobin program from period dec to nov tota

Due Date : Oct 16, 2023
Tender Value : Ref. Document
View Notice
93

Government Departments - Mumbai Suburban - Maharashtra

39770575 bids are invited for mouse cytokine multiplex kit (q3) mse total quantity : 1

Due Date : Oct 12, 2023
Tender Value : Ref. Document
View Notice
94

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

39763703 bids are invited for hcv hiv pcr kits hcv rna real time quantitative pcr detection kit compatible with roche lc 480 , hiv rna real time quantitative pcr kit 96 test per kit , real time pcr kit for respiratory pathogens 21 validated on roche lc 480 an

Due Date : Oct 2, 2023
Tender Value : Ref. Document
View Notice
95

Government Departments - Mumbai Suburban - Maharashtra

39394193 bids are invited for mouse th1thth17 multiplex panel for simultaneous and quantitative detection of mouse cytokines by (q3) mse total quantity : 2

Due Date : Sep 21, 2023
Tender Value : Ref. Document
View Notice
96

Government Departments - Mumbai - Maharashtra

39133374 bids are invited for consumables for medical research srl and atcc 92300 , 22249 , 66273 , 19914 , 83651 , 66886 , 96370 , 200 , 65553 , crl 2539 luc2 , 0175p , 01025p , multiplex real time pcr detection kit , bewo cell line , jeg3 cell line , 10762

Due Date : Aug 24, 2023
Tender Value : rupee 5 Lakhs
View Notice
97

Government Departments - Raigad - Maharashtra

39097687 Corrigendum : bids are invited for fully automated multiplex ihc stainer (q3) total quantity : 1

Due Date : Sep 26, 2023
Tender Value : Ref. Document
View Notice
98

Government Departments - Mumbai - Maharashtra

39010525 bids are invited for chemicals a qiagen multiplex pcr kit , qiagen multiplex pcr kit , nextseq 1000 by2000 p1 reagents 300 cycles , ficoll paque plus , naei restriction enzyme 500units total quantity : 9

Due Date : Aug 18, 2023
Tender Value : Ref. Document
View Notice
99

Government Departments - Mumbai - Maharashtra

38841518 bids are invited for consumables alpha gene deletion multiplex pcr kit qiagene , pcr tube 0.2 ml , tarson tips 20 200ul , tarson filter tips 2 20ul , bd vacutainer lithium heparin 4ml total quantity : 3151

Due Date : Aug 7, 2023
Tender Value : Ref. Document
View Notice
100

Government Departments - PUNE - Maharashtra

38829095 tender for kits and chemical to microbiology dept.

Due Date : Jul 29, 2023
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail