280 Multi Modal tenders in Maharashtra 2025

Get latest Multi Modal related Tenders, online published by Bank Of Maharashtra, Cidco Maharashtra Ltd., City and Industrial Development Corporation of Maharashtra from Maharashtra state. Participate online through e-Procurement website for Multi Modal tenders in Maharashtra. Download Tender Documents, BOQ, Technical Bids for Multi Modal related Tenders from Maharashtra. Get Bidding support for etenders related to Multi Modal Tenders in Maharashtra. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Multi Modal tenders published from Maharashtra. Also get daily email alerts for Multi Modal related tender notices published by Government of Maharashtra.

1

Government Departments - Jalna - Maharashtra

49744289 tender for consultancy services for obtaining consent to operate (cto), preparation and submission of half yearly environment clearance (ec) compliance report for multi modal logistic park (mmlp) at jalna in the state of maharashtra

Due Date : Jul 21, 2025
Tender Value : Ref. Document
View Notice
2

Government Departments - Mumbai - Maharashtra

49598715 bids are invited for consumables mse quagen multiplex pcr kit100 cat.no 206143 , dimethyl sulfoxide molecular grade cat.no d8418 50 ml. sigma , primer lis f 5ataccatgg tta ccc cat tgagc3 , primer lis r 5agggctcattacatgtggaccc3 , primer 4.2 f 5ggtttac

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
3

Government Departments - Mumbai - Maharashtra

49568254 bids are invited for consumables mse micropipette 0. to 10 ul , micropipette 10 to 100 ul , , multi modal intra operative nerve monitoring and consumables total quantity : 5

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
4

Government Departments - Mumbai - Maharashtra

49568235 bids are invited for consumables mse yellow tips 200ul genaxy 1000 per pack , blue tips 1000ul 1000 per bag genaxy , saponin , kimtech kimwipes 280 per box , tris hydroxymethyl aminomethane 99.9 , multi modal intra operative nerve monitoring and co

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
5

Government Departments - Mumbai - Maharashtra

49568224 bids are invited for consumables mse corona green am cell permeant , atp determination kit , , multi modal intra operative nerve monitoring and consumables total quantity : 5

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
6

Government Departments - Mumbai - Maharashtra

49561126 bids are invited for consumables mse fluo 4 am , pmca antibody f 3 , goat anti human iga secondary antibody hrp , 2 7 dichlorofluorescin diacetate , , multi modal intra operative nerve monitoring and consumables total quantity : 12

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
7

Government Departments - Mumbai - Maharashtra

49560984 bids are invited for consumables mse primer d1s80 f 3 5gtg ttg ttg gag atg cac gtg ccc ctt gc3 , primer d1s80 r 5 5gaa act ggc ctc caa aca ctg ccc gcc g3 , primer actbp2 f35aca tct ccc cta ccg cta ta 3 , primer actbp2 r35aat ctg ggc gac aag agt ga 3

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
8

Government Departments - Mumbai - Maharashtra

49560954 bids are invited for consumables mse pop 7 384 cat no 4393708 make appliedbiosystems , conditioning reagent 3500 series make appliedbiosystems , 3500 xl capillary array 50 cm , flaxi gene250 dna kit quagen 51206 , 100 bp dna molecular ladder , 1 kb

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
9

Government Departments - Mumbai - Maharashtra

49560930 bids are invited for consumables mse cell pack dcl sysmex xn 550 20 ltr , sulfolyser sls 210 sysmex xn 550 500 ml , lyser cell wdf sysmex xn , multi modal intra operative nerve monitoring and consumables total quantity : 7

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
10

Government Departments - Mumbai - Maharashtra

49560911 bids are invited for consumables mse sysmex cell pack xp 100 20 liters a , sysmex cell pack xp 100 20 liters b , sysmex cell pack xp 100 20 liters c , , multi modal intra operative nerve monitoring and consumables total quantity : 8

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
11

Government Departments - Mumbai - Maharashtra

49493196 bids are invited for consumables mse chromosomal microarray acgh 30k a , chromosomal microarray acgh 30k b , chromosomal microarray acgh , multi modal intra operative nerve monitoring and consumables total quantity : 5

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
12

Government Departments - Mumbai - Maharashtra

49493163 bids are invited for consumables mse qubit dsdna quantitation broad range , ssdna qubit kit q10212 , erythrocyte lysis buffer qaigen cat no. 79217 , , multi modal intra operative nerve monitoring and consumables total quantity : 8

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
13

Government Departments - Mumbai - Maharashtra

49489702 bids are invited for consumables sterol analysis in plasma , liver function test , renal function test , lipid profile test , c reactive protein , multi modal intra operative nerve monitoring and consumables total quantity : 10

Due Date : Jun 25, 2025
Tender Value : Ref. Document
View Notice
14

Government Departments - Mumbai - Maharashtra

49332454 bids are invited for consumables qualisa hiv 4.0 , trustwell hiv ag ab elisa kit 4th generation , retroquick hiv 1 and 2 device , alere determine hiv 1 or 2 , innolia lia hiv i ii score 28672 kit cat no 80540 , mp diagnostic 2.2 hiv westernblot kit

Due Date : Jun 17, 2025
Tender Value : Ref. Document
View Notice
15

Government Departments - Mumbai - Maharashtra

49289798 bids are invited for consumables tab.pentid 200mg 1strips of 10 tablet , tab.hydrosick 200mg 1 strips of 10 tablets , cap. hydroxyurea 500mg , tab.folic acid 5mg 1 strips of 30 tablets , tab. rabeprazole sodium 20 mg 1 strips of 10 tablets , tab c

Due Date : Jun 14, 2025
Tender Value : Ref. Document
View Notice
16

Government Departments - Mumbai - Maharashtra

49289760 bids are invited for consumables nextseq tm 1000 by 2000 p2 xleap sbs tm reagent kit 100 cycles 20100987 , dmso d260 x ml , kimtech kimwipes 280 per box a , kimtech kimwipes 280 per box b , kimtech kimwipes 280 per box c , multi modal intra opera

Due Date : Jun 14, 2025
Tender Value : Ref. Document
View Notice
17

Government Departments - Mumbai - Maharashtra

49273090 bids are invited for consumables human timp 1 tissue inhibitors of metalloproteinase 1 elisa kit 96 tests e el h0184 elabscience , tgf beta1 transforming growth factor beta 1 elisa kit 96 tests elabscience e el 0162 , kimtech kimwipes 280 per box a ,

Due Date : Jun 13, 2025
Tender Value : Ref. Document
View Notice
18

Government Departments - Mumbai - Maharashtra

49269700 bids are invited for consumables trupcr hcv detection and genotyping kit real time pcr for detection of all hcv viruses and differentiation of hcv genotypes , microamp fast 8 tube strip 0.1 ml , microamp optical 8 cap strips , meril meriscreen hbsag

Due Date : Jun 13, 2025
Tender Value : Ref. Document
View Notice
19

Government Departments - Mumbai - Maharashtra

49269616 bids are invited for consumables ddpcr plates 6 well semi skirted cat 1200125 a , dg 32 automated droplet generation cartridges a , pipet tips for the auto dg system , ddpcr supermix 2x for probes 5ml , ddpcr plates 96 well semi skirted cat 12001925

Due Date : Jun 13, 2025
Tender Value : Ref. Document
View Notice
20

Government Departments - Mumbai - Maharashtra

49269459 bids are invited for consumables qiaamp dna blood mini kit 250 qiagen cat no 51106 , qiaamp viral rna mini kit 50 , applied biosystems powerup sybr green master mix for qpcr 100rxns 1ml , taqman universal master mix ii no ung , human lipocalin 2ngal

Due Date : Jun 13, 2025
Tender Value : Ref. Document
View Notice
21

Government Departments - Mumbai - Maharashtra

49240350 supply of development of gati shakti multi modal cargo terminal (gct) under gct policy at bhilad entirely on railway land.development of gati shakti multi modal cargo terminal (gct) under gct policy at bhilad entirely on railway land.,

Due Date : Jun 13, 2025
Tender Value : rupee 20.0
View Notice
22

Government Departments - Mumbai - Maharashtra

49148887 bids are invited for consumables tablet vitamin b12 500mcg strip of 15 tablets , tablet vitamin b12 1500mcg strip of 10 tablets , naso b12 nasal spray 250mcg per spray , tablet orofer xt strip of 10 tablets , hydrosick tablets 200mg 1 strip pack

Due Date : Jun 6, 2025
Tender Value : Ref. Document
View Notice
23

Government Departments - Mumbai - Maharashtra

49108672 bids are invited for consumables 50 microscope slides grade p.2 76 x 26 x 1.25mm plain rohem , tmre mitochondrial membrane potential assay cat 7861313 g bioscience , cytochalasin b from drechslera dematioidea c6762 1mg , acridine orange hemizinc chl

Due Date : Jun 4, 2025
Tender Value : Ref. Document
View Notice
24

Government Departments - Mumbai - Maharashtra

48926602 supply of contract for development of gati shakti multi modal cargo terminal under gct policy at somathane entirely on railway land.contract for development of gati shakti multi modal cargo terminal under gct policy at somathane entirely on railway l

Due Date : May 29, 2025
Tender Value : rupee 100.0
View Notice
25

Government Departments - Mumbai - Maharashtra

48926285 supply of contract for development of gati shakti multi modal cargo terminal under gct policy at holding yard of jnpt, entirely on railway land.contract for development of gati shakti multi modal cargo terminal under gct policy at holding yard of jnp

Due Date : May 23, 2025
Tender Value : rupee 100.0
View Notice
26

Government Departments - mumbai - Maharashtra

48832739 Corrigendum : tender for appointment of consultant for study of increasing cargo throughput at sittwe port, myanmar part of kaladan multi modal transit transport project

Due Date : Jun 9, 2025
Tender Value : rupee 76 Lakhs
View Notice
27

Government Departments - Maharashtra

48655988 Corrigendum : tender for rfp for handling of containers and cargo for multi modal logistics park (mmlp), jalna in the state of maharashtra

Due Date : May 9, 2025
Tender Value : Ref. Document
View Notice
28

Government Departments - Mumbai - Maharashtra

48448300 bids are invited for neuromuscular transmission monitor (tof d monitor) , multi modal intra operative nerve monitoring and consumables total quantity : 3

Due Date : Apr 18, 2025
Tender Value : Ref. Document
View Notice
29

Government Departments - Raigad - Maharashtra

48444042 tender for height raising / diversion of 400kv dc talegaon kharghar line between existing loc. no.113 to 131 & 220kv kalwa temghar, dchil colourchem & colourchem temghar d/c line for proposed multi modal corridor heighway between virar alibaug (ch 45+

Due Date : Apr 1, 2025
Tender Value : Ref. Document
View Notice
30

Government Departments - mumbai - Maharashtra

48176815 tender for development of gati shakti multi modal cargo terminal (gct) under gct policy at gangadhara (ggar) entirely on railway land.

Due Date : Apr 3, 2025
Tender Value : Ref. Document
View Notice
31

Government Departments - mumbai - Maharashtra

48175142 tender for development of gati shakti multi modal cargo terminal (gct) under gct policy at gangadhara (ggar), entirely on railway land.

Due Date : Apr 3, 2025
Tender Value : Ref. Document
View Notice
32

Government Departments - Maharashtra

48150549 Corrigendum : tender for rfp for handling of containers and cargo for multi modal logistics park (mmlp), jalna in the state of maharashtra

Due Date : Apr 2, 2025
Tender Value : Ref. Document
View Notice
33

Government Departments - mumbai - Maharashtra

48012828 Corrigendum : tender for implementation of multi modal integration facilities at six underground metro stations viz. dharavi, shitala devi mandir, dadar, siddhivinayak, worli and acharya atre chowk.

Due Date : Mar 24, 2025
Tender Value : rupee 19.38 Crore
View Notice
34

Government Departments - Nagpur - Maharashtra

47922908 Corrigendum : bids are invited for multi modal intra operative nerve monitoring and consumables (q3) total quantity : 1

Due Date : May 5, 2025
Tender Value : Ref. Document
View Notice
35

Government Departments - Mumbai - Maharashtra

47859723 supply of development of gati shakti multi modal cargo terminal (gct) under gct policy at hol entirely on railway land.development of gati shakti multi modal cargo terminal (gct) under gct policy at hol entirely on railway land.,

Due Date : Mar 18, 2025
Tender Value : rupee 20.0
View Notice
36

Government Departments - Mumbai - Maharashtra

47815778 Corrigendum : bids are invited for consumables crp kit 100 tests cobas c111 a , crp kit 100 tests cobas c111 b , crp kit 100 tests cobas c111 c , crp kit 100 tests cobas c111 d , crp kit 100 tests cobas c111 e , crp kit 100 tests cobas c111 f , multi modal intra

Due Date : Mar 18, 2025
Tender Value : Ref. Document
View Notice
37

Government Departments - Mumbai - Maharashtra

47595520 bids are invited for consumables bd cd71 apc , bd cd235a pe cy 5 , taqman gene expression probe rpl15 , taqman gene expression probe rpl18 , taqman gene expression probe rpl35 , taqman gene expression probe rps20 , multi modal intra operative nerve

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
38

Government Departments - Mumbai - Maharashtra

47595441 bids are invited for consumables stempro 34 sfm 1x , fbs fetal bovine serum 00ml , bd cd45 fitc , bd cd34 pe , qubit rna broad range br assay kits , multi modal intra operative nerve monitoring and consumables total quantity : 5

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
39

Government Departments - Mumbai - Maharashtra

47595386 bids are invited for consumables precicontrol clinchem multi 1 roche 5ml , precicontrol clinchem multi 2 roche 5ml , cleaner cobas integra or cobas c111 roche 1000 ml , ise deproteinizer c111 , ambion depc treated water , takara emrald gt pcr master

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
40

Government Departments - Mumbai - Maharashtra

47595276 bids are invited for consumables human il 6 quantikine elisa kit 96 well cat d6050b make r and d , human il 8 cxcl8 quantikine elisa kit 96 well cat. d000c make r and d , human tnf alpha quantikine elisa kit 96 well cat dta00d make r and d , human

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
41

Government Departments - Mumbai - Maharashtra

47580330 Corrigendum : bids are invited for consumables clothes hangers pack of 10 hangers multicolor , birud key cabinet wall mount key lock box with key locking key organizer , lariox plastic plastic tapered hollow basket storage box w x h x d 230 x 130 x 190 mm , nesti

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
42

Government Departments - Mumbai - Maharashtra

47365699 bids are invited for consumables salsa mlpa ek1 reagent kit 100 reactions 6 vials fam , salsa mlpa p212 dba probemix 25reaction , rpmi 1640 medium 500ml , fbs fetal bovine serum 500ml , l glutamine , rneasy mini kit 50preps , concanavalin a , mul

Due Date : Feb 15, 2025
Tender Value : Ref. Document
View Notice
43

Government Departments - Mumbai - Maharashtra

47365581 bids are invited for consumables cycloheximide solution , stemcell technologies sepmate 15 ruo 100 tubes , stemcell technologies lymphoprep 250ml , stemcell technologies dulbecco pbs with 2 percent fbs , dnase i rnase free , trizmabase , magnesium ch

Due Date : Feb 15, 2025
Tender Value : Ref. Document
View Notice
44

Government Departments - Mumbai - Maharashtra

47365521 bids are invited for consumables 50 bp dna ladder , 100 bp dna ladder a , dna molecular weight marker vii , 100bp dna ladder b , dna gel loading dye 6x , 1 kb dna ladder 250 applications , 50 bp dna ladder 250 applications , 100bp dna ladder c , mult

Due Date : Feb 15, 2025
Tender Value : Ref. Document
View Notice
45

Government Departments - Mumbai - Maharashtra

47302468 bids are invited for consumables plasmid miniprep kit 0rxn cat no. nxg993 m mfd sciphi , glycine greater than equal to 99 percent and suitable for western blotting g8898 00g , tet2 antibody 4010 cell signaling , abl fusion gene rna seq for fusion g

Due Date : Feb 12, 2025
Tender Value : Ref. Document
View Notice
46

Government Departments - Mumbai - Maharashtra

47283056 bids are invited for consumables tarsons 15 ml graduated centrifuge tube pp 546021 25 pcs or pack , tarson 50ml graduated sterile centrifuge tube pp cat.no 546041 pack of 25tubes , universal tips yellow bulk 1 200ul genaxy gen ut 200 y 1000 per pack

Due Date : Feb 11, 2025
Tender Value : Ref. Document
View Notice
47

Government Departments - Mumbai - Maharashtra

47230853 bids are invited for consumables universal tips yellow bulk 1 200ul genaxy gen ut 200 y 1000 per pack , microtips 0.5 10ul pipette tips genaxy gen ut 10 c 1000 or pack , genaxy microtips 1000ul cat no gen ut 1000 c 500 per pack , genaxy clickseal 1

Due Date : Feb 8, 2025
Tender Value : Ref. Document
View Notice
48

Government Departments - Mumbai - Maharashtra

47230432 bids are invited for consumables human serum iron si elisa kit cat no mbs380160 make mybiosource a , human serum iron si elisa kit cat no mbs380160 make mybiosource b , human c reactive protein crp elisa kit brand calbiotech cat no cr37c a , hum

Due Date : Feb 8, 2025
Tender Value : Ref. Document
View Notice
49

Government Departments - Mumbai - Maharashtra

47230395 bids are invited for consumables human serum ferritin sf elisa kit for 96 tests brand calbiotech catalogue no fr24t , tibc elisa kit human total iron binding capacity tibc elisa kit make mybiosource cat no mbs3801798 , human serum vitamin b12 eli

Due Date : Feb 8, 2025
Tender Value : Ref. Document
View Notice
50

Government Departments - Mumbai - Maharashtra

47230289 Corrigendum : bids are invited for consumables sta deficient viii , startem 10 vials per box 1x10 ref no 503 10 , rotem tips , cups and pins pack size p by pac , chromogenix coatesti sp4 factor viii bovine , hemosil electrachrome factor viii 2x3 ml , multi modal

Due Date : Feb 12, 2025
Tender Value : Ref. Document
View Notice
51

Government Departments - Mumbai - Maharashtra

47212183 Corrigendum : bids are invited for consumables sta def viii fviii deficient plasma catlog no 725 , dade actin activated cephaloplastin , siemens owren vernolbuffer 15mlx10 b423425 , siemens actin fs 2mlx10 b421820 , siemens factop viii deficient plasma 1mlx8 ot

Due Date : Feb 17, 2025
Tender Value : Ref. Document
View Notice
52

Government Departments - Mumbai - Maharashtra

47212151 Corrigendum : bids are invited for consumables z hemosil rinse solution 1x4000ml 20302400 5 , hemosil z calibration plasma 10x1ml 20003700 5 , hemosil normal control assayed 0020003110 , hemosil low abnormal control assayed 0020003210 , hemosil special test contro

Due Date : Feb 17, 2025
Tender Value : Ref. Document
View Notice
53

Government Departments - Mumbai - Maharashtra

47211330 bids are invited for consumables encode custom gene expression assay with master mix cat no. eil cust 01 a , encode custom gene expression assay with master mix cat no. eil cust 01 b , encode custom gene expression assay with master mix cat no. eil

Due Date : Feb 7, 2025
Tender Value : Ref. Document
View Notice
54

Government Departments - Mumbai - Maharashtra

47211055 bids are invited for consumables groshong nxt picc 4fr with mi kit cat no. 7655405 mfg bard a , groshong nxt picc 4fr with mi kit cat no. 7655405 mfg bard b , groshong nxt picc 4fr with mi kit cat no. 7655405 mfg bard c , groshong nxt picc 4fr with m

Due Date : Feb 7, 2025
Tender Value : Ref. Document
View Notice
55

Government Departments - Mumbai - Maharashtra

47210752 bids are invited for consumables qubit dsdna br assay kit 100 1 kit , qubittm microrna assay kit , encode instamix cat no. enc imm 100 make encode innovations , rpmi 1640 medium 500ml a , rpmi 1640 medium 500ml b , multi modal intra operative nerve

Due Date : Feb 7, 2025
Tender Value : Ref. Document
View Notice
56

Government Departments - Mumbai - Maharashtra

47210685 bids are invited for consumables 15 ml centrifuge tube graduated with cap sterile conical bottom tarsons 546021 500 nos per 1 case , microcentrifuge tubes 1.5ml tarsons 500010 500 tubes per pack , tarsons ria vials 12x75mm pack of 500 cat 850020 ,

Due Date : Feb 7, 2025
Tender Value : Ref. Document
View Notice
57

Government Departments - Mumbai - Maharashtra

47210638 bids are invited for consumables collection tubes 2ml qiagen cat no 19201 1000 tubes per pack , 10ul universal graduated filter tips 10 packs per case cat no pf 10 s l f r pfact , 20ul universal graduated filter tips 10packs per case cat no pf 20 s

Due Date : Feb 7, 2025
Tender Value : Ref. Document
View Notice
58

Government Departments - Mumbai - Maharashtra

47210602 bids are invited for consumables universal tips yellow bulk 1 200ul genaxy gen ut 200 y 1000 per pack , gen ut 1000 b genaxy gentip 1000ul blue ut100027 05 23 500tips or pack , clickseal graduated micro centrifuge tubes 1.5ml genaxy gen mt 175 c 50

Due Date : Feb 7, 2025
Tender Value : Ref. Document
View Notice
59

Government Departments - Mumbai - Maharashtra

47205299 bids are invited for consumables gala dry floor mop with stick , mop with stick , red big non chlorinated bags 33 x 52 60 micron , black big non chlorinated colour coded biohazard bags 33 x 52 60 micron 15pices pkt with bar code , surgical gloves

Due Date : Feb 6, 2025
Tender Value : Ref. Document
View Notice
60

Government Departments - Mumbai - Maharashtra

47162219 tender for contract for development of gati shakti multi modal cargo terminal under gct policy at holding yard of jnpt, entirely on railway land.

Due Date : Feb 24, 2025
Tender Value : rupee 100.0
View Notice
61

Government Departments - Mumbai - Maharashtra

47136638 bids are invited for consumables pathodetect hbv quantitative pcr kit 50 rxn including extraction kit cat. phbvq50 hsn 30021099 , pathodetect hbv extraction kit 50 rxn cat. phbvqce50 hsn 382019 a , pathodetect hbv extraction kit 50 rxn cat. phbvqc

Due Date : Feb 1, 2025
Tender Value : Ref. Document
View Notice
62

Government Departments - Jalna - Maharashtra

47089355 Corrigendum : tender for construction of external road connectivity to the proposed multi modal logistics park at jalna on epc mode

Due Date : Feb 6, 2025
Tender Value : rupee 4.38 Crore
View Notice
63

Government Departments - Mumbai - Maharashtra

47075898 supply of development of gati shakti multi modal cargo terminal (gct) under gct policy at hol entirely on railway landdevelopment of gati shakti multi modal cargo terminal (gct) under gct policy at hol entirely on railway land,

Due Date : Jan 31, 2025
Tender Value : rupee 20.0
View Notice
64

Government Departments - Maharashtra

46793778 Corrigendum : tender for independent engineer services for supervision of development and operations of multi modal logistics park mmlp pune at village pawalewadi, maval taluka, district pune in the state of maharashtra through ppp on dbfot basis

Due Date : Jun 5, 2025
Tender Value : Ref. Document
View Notice
65

Government Departments - Mumbai - Maharashtra

46743731 supply of contract for development of gati shakti multi modal cargo terminal under gct policy at holding yard of jnpt, entirely on railway land.contract for development of gati shakti multi modal cargo terminal under gct policy at holding yard of jnp

Due Date : Jan 24, 2025
Tender Value : rupee 100.0
View Notice
66

Government Departments - Mumbai - Maharashtra

46526479 supply of development of gati shakti multi modal cargo terminal (gct) under gct policy at hol entirely on railway landdevelopment of gati shakti multi modal cargo terminal (gct) under gct policy at hol entirely on railway land,

Due Date : Dec 31, 2024
Tender Value : rupee 20.0
View Notice
67

Local Bodies - Thane - Maharashtra

46524053 tender for appointment of agency for pm gatishakti national master plan for multi modal connectivity by central government for kulgaon badlapur municipal council area

Due Date : Dec 9, 2024
Tender Value : Ref. Document
View Notice
68

Government Departments - Solapur - Maharashtra

46362715 supply of contract for development of gati shakti multi modal cargo terminal (gct) entirely on railway land at modnimb (mlb) stationcontract for development of gati shakti multi modal cargo terminal (gct) entirely on railway land at modnimb (mlb) sta

Due Date : Dec 26, 2024
Tender Value : rupee 20.0
View Notice
69

Government Departments - Mumbai - Maharashtra

45742039 bids are invited for consumables pop7 3730 or 3730xl dna analyzers , tube 5x seq buffer small a , tube 5x seq buffer small b , tube 5x seq buffer small c , tube 5x seq buffer small d pop7 37303730xl dna analyzers chemiluminescence immuno analyzers re

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
70

Government Departments - Mumbai - Maharashtra

45734592 bids are invited for consumables zymo spin tm ib columns 250 pack , zymo sequencing wash buffer , zymo sequencing binding buffer a , collection tube 1.5 ml a , zymo sequencing binding buffer b zymo spin tm dna marker relevant multi modal intra op

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
71

Government Departments - Mumbai - Maharashtra

45734568 bids are invited for consumables 3730 buffer 10x w or edta 500ml each , bdt v3.1 seq std kit , hi di formamide bottle 25 ml , pop7 3730 or 3730xl dna analyzers , hi di formamide bottle 25 ml b 3730 buffer(10x) wedta 500ml each ph buffer solution rele

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
72

Government Departments - Mumbai - Maharashtra

45711069 bids are invited for consumables ha hyaluronic acid elisa kit 6 tests eu2556 finetest , human np n terminal procollagen propeptide elisa kit 6 tests e el h0183 elabscience , human timp 1 tissue inhibitors of metalloproteinase 1 elisa kit 6 tests e el

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
73

Government Departments - Mumbai - Maharashtra

45711066 bids are invited for consumables whole exome sequencing minumum coverage of 80x cap or nabl accredited for molecular diagnosis graphical user interface for raw data analysis of all files and fastq and vcf files a , whole exome sequencing minumum cove

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
74

Government Departments - Mumbai - Maharashtra

45705219 bids are invited for consumables varianttm ii b thalassemia short program pack 00 tests , biorad variant ii hplc kits a hsn code 38220090 , biorad variant ii hplc kits b hsn code 38220090 , biorad variant ii hplc kits c hsn code 38220090 , eqas he

Due Date : Nov 2, 2024
Tender Value : rupee 5 Lakhs
View Notice
75

Government Departments - Mumbai - Maharashtra

45681577 bids are invited for consumables zymmune cap ip 100mg manufacturing zydus trans immune a , zymmune cap ip 100mg manufacturing zydus trans immune b , zymmune cap ip 100mg manufacturing zydus trans immune c , zymmune cap ip 100mg manufacturing zydu

Due Date : Nov 2, 2024
Tender Value : Ref. Document
View Notice
76

Government Departments - Mumbai - Maharashtra

45659764 Corrigendum : bids are invited for consumables whole exome sequencing with minimum coverage of 0x cap accredited for molecular diagnosis graphical user interface for all raw data files a , whole exome sequencing with minimum coverage of 0x cap accredited for molec

Due Date : Nov 26, 2024
Tender Value : Ref. Document
View Notice
77

Government Departments - Mumbai - Maharashtra

45659751 bids are invited for consumables whole exome sequenicng and analysis a , whole exome sequenicng and analysis b , whole exome sequenicng and analysis c , whole exome sequenicng and analysis d , whole exome sequenicng and analysis e whole exome sequeni

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
78

Government Departments - Mumbai - Maharashtra

45659648 bids are invited for consumables whole transcriptome sequencing and standard analysis a , whole transcriptome sequencing and standard analysis b , whole transcriptome sequencing and standard analysis c , whole transcriptome sequencing and standard an

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
79

Government Departments - Mumbai - Maharashtra

45648927 bids are invited for consumables chromium next gem single cell 3 gel beads kit v3.1 4 reaction partno 1000129 10x genomics , kimtech kimwipes 280 or box a , kimtech kimwipes 280 or box b , kimtech kimwipes 280 or box c , kimtech kimwipes 280 or box d

Due Date : Oct 31, 2024
Tender Value : Ref. Document
View Notice
80

Government Departments - Mumbai - Maharashtra

45648912 bids are invited for consumables romy 500mcg manufacturing intas a , romy 500mcg manufacturing intas b , romy 500mcg manufacturing intas c , romy 500mcg manufacturing intas d , romy 500mcg manufacturing intas e romy 500mcg manufacturing: intas r

Due Date : Oct 31, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - Mumbai - Maharashtra

45648895 bids are invited for consumables thymogam atg 250mg or 5ml manufacturing bharat serum vaccine a , thymogam atg 250mg or 5ml manufacturing bharat serum vaccine b , thymogam atg 250mg or 5ml manufacturing bharat serum vaccine c , thymogam atg 250mg or

Due Date : Oct 31, 2024
Tender Value : Ref. Document
View Notice
82

Government Departments - mumbai - Maharashtra

45647554 Corrigendum : tender for implementation of multi modal integration facilities at six underground metro stations viz. bkc, bandra colony, santacruz, chatrapati shivaji maharaj domestic airport csia t1, sahar road and chatrapati shivaji maharaj international airport

Due Date : Nov 14, 2024
Tender Value : rupee 14.17 Crore
View Notice
83

Government Departments - Mumbai - Maharashtra

45639189 bids are invited for consumables bd vacutainer tube k2 edta 10ml cat no. 367525 , bd vacutainer tube k2 edta 6ml cat no. 367863 , bd vacutainer tube k2 edta 4ml cat no. 367861 , sodium heparin vaccutainer 4 ml , bd vacutainer tube citrate 2.7ml cat n

Due Date : Oct 31, 2024
Tender Value : Ref. Document
View Notice
84

Local Bodies - Thane - Maharashtra

45577352 tender for the appointment of an agency for network connectivity of infrastructure under digital platform through the ambitious initiative of the central government called pm gatishakti national master plan for multi modal connectivity in kulgaon badlapur

Due Date : Oct 10, 2024
Tender Value : Ref. Document
View Notice
85

Local Bodies - Thane - Maharashtra

45546126 tender for appointment of agency for pm gatishakti national master plan for multi modal connectivity by central gevernment for kulgaon badlapur municipal council area

Due Date : Oct 10, 2024
Tender Value : Ref. Document
View Notice
86

Government Departments - Mumbai - Maharashtra

45545269 bids are invited for consumables 51 8981e 7 aad 2ml bd sold as 559925 , fitc annexin v cat no 55420 , paxgenei blood rna tube , paxgene blood mirna kit cat 763134 , nitrile hand glove small box of 100 e 7 aad 2ml bd sold as special proofed canvas du

Due Date : Oct 25, 2024
Tender Value : Ref. Document
View Notice
87

Government Departments - Mumbai - Maharashtra

45499021 bids are invited for consumables surgi safe small , surgi safe large , tissue paper , register 100 pages sunderam , sterilium 5 ltr , shine liquid soap 5ltr , phenyl 5 liters , sodium hypochloride 5ltr gemarpts searched surgi safe small strings used in ge

Due Date : Oct 22, 2024
Tender Value : Ref. Document
View Notice
88

Government Departments - Mumbai - Maharashtra

45486565 bids are invited for consumables qubita c 1x dsdna hs assay kit q33230 , illumina flex lysis reagent kit 96 sample 2001706 , corning microvolume pipette tips 0 1 10ul cls4894 , high sensitivity d1000 screentape , high sensitivity d1000 reagents gemar

Due Date : Oct 22, 2024
Tender Value : Ref. Document
View Notice
89

Government Departments - Mumbai - Maharashtra

45379211 bids are invited for consumables seat cover for vehicle innova , seat cover for vehicle marazzo , sun shades a set of for innova and marazzo , floor matting for innova , speakers for innova a set of 4 speakers , monitor android system for innova wi

Due Date : Oct 16, 2024
Tender Value : Ref. Document
View Notice
90

Government Departments - Mumbai - Maharashtra

45379194 bids are invited for consumables hbcab elisa kit , hbc igm elisa kit , hbe ag and ab elisa kit , hbs ab elisa kit , benesphera hbsag advanced elisa make avantor benp15001007 , pbs 1x dulbeccos formula without magnesium and calcium gemarpts searche

Due Date : Oct 16, 2024
Tender Value : Ref. Document
View Notice
91

Government Departments - Mumbai - Maharashtra

45379141 bids are invited for consumables glass petriplate 90mm , conical flask flat bottom 1000ml , conical flask flat bottom 500ml , plastic beaker 1000ml , plastic beaker 500ml , plastic petriplate , chimney 3x32 pcs cobas c111 , lamp halogen 12v upon 20w

Due Date : Oct 16, 2024
Tender Value : Ref. Document
View Notice
92

Local Bodies - mumbai - Maharashtra

45327490 tender for hiring a project management consultant (pmc) to supervise and monitor the implementation of multi modal integration facilities at 10 stations of mumbai metro line 7a and 9

Due Date : Sep 27, 2024
Tender Value : Ref. Document
View Notice
93

Government Departments - Mumbai - Maharashtra

45311337 supply of contract for development of gati shakti multi modal cargo terminal under gct policy at somathane entirely on railway land.contract for development of gati shakti multi modal cargo terminal under gct policy at somathane entirely on railway l

Due Date : Oct 16, 2024
Tender Value : rupee 100.0
View Notice
94

Local Bodies - Mumbai - Maharashtra

45250741 tender for appointment of contractors for implementation of multi modal integration facilities at total 16 metro stations of mumbai metro line 4 & 4a (total 2 packages: package 1 & package 2) (kfw procurement no. for pkg 1: 511728 & pkg 2: 511729 )

Due Date : Oct 9, 2024
Tender Value : rupee 139.85 Crore
View Notice
95

Local Bodies - Thane - Maharashtra

44854840 Corrigendum : tender for appointment of project management consultant for supervision and monitoring of multi modal integration facilities implementation at 6 stations of mumbai metro line 5 phase 1 balkum naka to dhamankar naka

Due Date : Sep 26, 2024
Tender Value : Ref. Document
View Notice
96

Boards / Undertakings / PSU - mumbai - Maharashtra

44780217 Corrigendum : tender for providing multi modal transportation

Due Date : Sep 11, 2024
Tender Value : Ref. Document
View Notice
97

Government Departments - Mumbai - Maharashtra

44679866 tender for contract for development of gati shakti multi modal cargo terminal under gct policy at somathane entirely on railway land.

Due Date : Aug 29, 2024
Tender Value : rupee 100.0
View Notice
98

Government Departments - mumbai - Maharashtra

44338594 tender for consultancy services for authority engineer for construction of access controlled multi modal corridor from navghar to balavali in the state of maharashtra on epc mode for mmc 04 and 05

Due Date : Aug 21, 2024
Tender Value : Ref. Document
View Notice
99

Government Departments - mumbai - Maharashtra

44337553 Corrigendum : tender for consultancy services for authoritys engineer for construction of access controlled multi modal corridor from navghar to balavali in the state of maharashtra on epc mode for mmc 10 and 11

Due Date : Sep 20, 2024
Tender Value : Ref. Document
View Notice
100

Local Bodies - mumbai - Maharashtra

44308218 tender for appointment of project management consultant (pmc) for supervision and monitoring of multi modal integration facilities implementation at 10 stations of mumbai metro line 7a & 9

Due Date : Jul 29, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail