377 Halogen Lamp tenders in Maharashtra 2024

Name: Indian Air Force
Start: Apr 24, 2024
End: Apr 27, 2024
Location: Indian Air Force

Get latest Halogen Lamp related Tenders, online published by Bank Of Maharashtra, Cidco Maharashtra Ltd., City and Industrial Development Corporation of Maharashtra from Maharashtra state. Participate online through e-Procurement website for Halogen Lamp tenders in Maharashtra. Download Tender Documents, BOQ, Technical Bids for Halogen Lamp related Tenders from Maharashtra. Get Bidding support for etenders related to Halogen Lamp Tenders in Maharashtra. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Halogen Lamp tenders published from Maharashtra. Also get daily email alerts for Halogen Lamp related tender notices published by Government of Maharashtra.

Search Result

Statutory Bodies & Commissions/Committees - PUNE - Maharashtra

43228817 bids are invited for two pin plug 300mm ( q3 ) , reflector lamp, 50mm, 48w, 4mm round female connector for centre linelight ( idm 4582 ) ( q3 ) , terminal strip, 2 pole ( connector for inset light ) ( q3 ) , aluminium reflector ( q3 ) , base plate ( q3 ) , constant current regulator 10 kva ( q3 ) , constant current regulator 15 kva ( q3 ) , constant current regulator 4 kva ( q3 ) , plug kd 503.2 ( q3 )...

Due Date : Apr 27, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - pune - Maharashtra

43199144bids are invited for 200w 6.6a bi pin halogen lamp total quantity : 200

Due Date : Apr 22, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - PUNE - Maharashtra

43170860 bids are invited for ps cable assembly ( q3 ) , diode zener 5.1 v ( q3 ) , m7 control head lead ( e1 ) ( q3 ) , transistor silicon 100p ( q3 ) , 7000 ch pcb ( q3 ) , xukubjxc3s250e 4tqg1441 foga ( spartan 3e ) ( q3 ) , xilinx xc3s250e 4pqg2081 fpga ( spartan 3e ) ( q3 ) , interface module ( q3 ) , el 5.6 inch quarter vga mono display ( q3 ) , hard disk drive modified ( q3 ) , reduntant hub of pvr4u ( q3 ) , usb hdd modified ( sata ) ( q3 ) , dv...

Due Date : Apr 18, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42739262bids are invited for 200w 6.6a bi pin halogen lamp (q3) total quantity : 200

Due Date : Mar 28, 2024

Tender Value : Ref. Document

View Notice

Local Bodies - kundalwadi - Maharashtra

42656228 procurement and supply of electrical materials for electrical department m c kundalwadi , lamps and tubes for indoor & outdoor , supplying lamp 230v, 40 w. , supplying lamp 230v, 60 w. , supplying lamp 230v, 100 w. , supplying tube rod 36/40 w. , supplying t5 24 w energy efficient fluorosenttube , supplying led lamps 2 to 3 w, 230v intergraltype , supplying led lamps 5 to 8 w, 230v intergraltype , tube side patti g.i material , supplying cfl street light fitting suitable for 2* above 18 to 36w ...

Due Date : Mar 7, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Aurangabad - Maharashtra

42279505 tender for annual rate contract for supply of auto electric spare parts and auto electric job work for all types of csmc vehicles. ( 2024 25 ) fog lamp assly each revolving lamp assly w / out magnet revolving lamp assly w / magnet lence, magn.revolving lamp hal bulb revolving lamp revolving lamp bracket steel indicator & parking lamp assly combination switch assly fog lamp bulb ( halogen ) fuse box complete wriring harness set air pressure horn set reflector meter holder wit...

Due Date : Feb 27, 2024

Tender Value :

19.40 Lakhs

View Notice

Local Bodies - Nagpur - Maharashtra

42229615 municipal council wanadongri invite e tender for year 2024 2025 ( 12 months ) for material supply for street light arrangement and other office related electrical works. 2 4 feet 40w fluorescent lamp 3 36w 6500w super saver t8 tubularfluorescent lamp 4 cfl 36w / 6500k 2g11 lamp 5 4 pin pl led 18w rod ( lamp ) 6 40w fluorescent lamp 7 1*36 / 40w heavy duty polyester filled copper ballasts 8 36w ftl electronic ballasts for 36w 6500k super saver tubularfluorescent lamp 9 b...

Due Date : Feb 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Pune - Maharashtra

42113190supply of twin beam head light 24vtwin beam head light 24v,twin beam head light 24v 100/90 watts with halogen lamp as per rdso spec no. elrs/spec/pr/0024/rev.01 sept 2004 or latest for demu dpc power car make: signotron model no tbhl e 40 01 or delco make model no dtbh/06 or similar to be procured as per clw approved vendors only, [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Feb 20, 2024

Tender Value : Ref. Document

View Notice

Local Bodies - dharmabad - Maharashtra

42071778 supplying of electrical equipments for electrical department mc dharmabad , lamps and tubes for indoor & outdoor , supplying lamp 230v, 40 w. , supplying lamp 230v, 60 w. , supplying lamp 230v, 100 w. , supplying tube rod 36/40 w. , supplying t5 24 w energy efficient fluorosenttube , supplying led lamps 2 to 3 w, 230v intergraltype , supplying led lamps 5 to 8 w, 230v intergraltype , tube side patti g.i material , supplying cfl street light fitting suitable for 2* above 18 to 36w cfl, electroni...

Due Date : Feb 15, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Bhusawal - Maharashtra

42022063 supply of connector for halogen lamp with ptfe wir [connector for halogen lamp with ptfe wire and sleeving for twin beam head light as per m/s signotron drg. no. sig/halo/conn/mech/01 (part no 3292)]connector for halogen lamp with ptfe wir [connector for halogen lamp with ptfe wire and sleeving for twin beam head light as per m/s signotron drg. no. sig/halo/conn/mech/01 (part no 3292)],connector for halogen lamp with ptfe wire and sleeving for twin beam head light as per m/s signotron drg. no...

Due Date : Feb 15, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Pune - Maharashtra

41880372supply of twin beam head light 24vtwin beam head light 24v,twin beam head light 24v 100/90 watts with halogen lamp as per rdso spec no. elrs/spec/pr/0024/rev.01 sept 2004 or latest for demu dpc power car make: signotron model no tbhl e 40 01 or delco make model no dtbh/06 or similar to be procured as per clw approved vendors only, [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Feb 7, 2024

Tender Value : Ref. Document

View Notice

Government Departments - MUMBAI - Maharashtra

41467404 bids are invited for sigma roche merck products mse 4693159001 protease inhibitor cocktail tablets complete mini edta free , t3251 100g , pcr primers scale 50nmole bases desalted , ufc700308 centricon plus 70 centrifugal filter 3kda cutoff , sct123 gelred nucleic acid stain 10000xwater , primers for dv23rrna 23s 1991f 5ccatctcttgactgtctcggctat3 , primers 23s 2138r5cctacctattctctacatggtggtgtt3 , 04793773001 probe c111, set of 2 , 0534462001 lamp halogen 12v power assay , 4...

Due Date : Jan 15, 2024

Tender Value :

2.72 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

41334243 bids are invited for band antenna cable assembly w5 (q3) , male connector antenna manpack vhf (q3) , power amplifier & filter b1b2 (q3) , rf filter and coax s w a5 (q3) , interface unit b21 (q3) , directional detecter a9 (q3) , ssd ic digital divdr( 4041) (q3) , lamp 0.06amp 24v 1.5w (q3) , ic 15584 (metal) (q3) , parallel port 16 bit soundport streo codec (q3) , transzorb (q3) , universal ac dc switching power supply (q3) , handle chasis (q3) , reflective tape (q3) , pvc dust cover for 57 pi...

Due Date : Jan 24, 2024

Tender Value : Ref. Document

View Notice

Government Departments - gondiya - Maharashtra

41287385 Corrigendum : arrangement of pavilion and other necessary service facilities, publicity, publicity and organization of the entire festival for gondia district agriculture and wheat mahotsav. 1.01 hiring of venue as per requirement for planning of district agriculture and nutritious grass mahotsav. 1.02 cleaning and leveling of the place for planning the district agriculture and nutritious grass mahotsav. 1.03 planning venue for district agriculture and nutritious grass mahotsav, patra / bamboo compoun...

Due Date : Dec 30, 2023

Tender Value :

20 Lakhs

View Notice

Local Bodies - pimpri - Maharashtra

41226831 providing mandap and related works in ward no. 14 year 2023 24 hire charges for providing and erecting temporary pendal with cotton cover including all materrial transporation and labour etc. ( rate / sq.ft. ) for six day hire charges for providing and erecting temporary mandap with c.g.i. sheet covering and cotton cover including all materails transportation and labour ect. complete ( rate / sq.ft. ) for six day hire charges for providing and erecting stage with back screen wall...

Due Date : Dec 25, 2023

Tender Value :

82.61 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

41218325bids are invited for 22bz1c004 ea3778v app 2pin two pin plug assembly (q3) , 22bz1c004 ea3778v ama rb4x200w rb arb5 lamp holder for bi pin halogen (q3) , 22bz1c004 ea3778v ama rb4x200w rb arb6 halogen lamp 200w 6.6a bi pin (q3) total quantity : 351

Due Date : Jan 11, 2024

Tender Value : Ref. Document

View Notice

Local Bodies - pimpri - Maharashtra

40725209 providing material for various programme in nilu phule natyagrah in ward no.31 providing manpower on daily basis. supplying mazdoor / unskilled heavy male labour etc. supplying mazdoor / unskilled heavy female labour etc. hire charges for jcb js140 ( 8 to10 mt ) including operator, disel , oil & other necessary maintainance , labour etc. complete. hire charges for excavator ( jcb js140 / tata hitachi ex120 ) 0.6 cum capacity including operator, disel, oil & other nece...

Due Date : Nov 28, 2023

Tender Value :

16.86 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

40632295 Corrigendum : bids are invited for chemicals albumin kit c 111 pack 2 100 tests , total protein kit c 111 pack 2 100 tests , alkaline phospatase c111 alp kit pack 2 100 tests , alanine aminotransferase sgpt kit pack 2 100 tests , cobas c111 roche aspartate aminotransferase sgot kit pack 2 100 tests , bilirubin direct kit c 111 pack 2 100 tests , urea or bun kit c 111 pack 2 100 tests , bilirubin total kit c 111 pack 2 100 tests , creatinine jaffe kit c 111 pack 2 100 tests , microalbumin c111 , crp 2 x 100 t...

Due Date : Dec 8, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - kalwa - Maharashtra

40366464 Corrigendum : tender for supply of spares and accessories for maintenance dept. ofchhatrapati shivaji maharaj hospital . , b.p. metal valve with bulb , b.p. rubber bag adult , b.p. cloth bag with double velcro adult , b.p. m / f adaptor , castor with wheels 5” , stretcher trolleywheels5” , castor with wheels 2” , wheels2” , stereliser coil 1.5 kw , stereliser coil 2 kw , autoclave coil 3kw , ecg machine5 no arm leads only , ecg machine chest bulbs with metal cup set...

Due Date : Nov 8, 2023

Tender Value :

26.53 Lakhs

View Notice

Government Departments - nagpur - Maharashtra

40255698 supply of consumable glf spares supply of consumable glf spares at dr babasaheb ambedkar international airport nagpur , supply of following glf spares to suit the existing installation and as per the list of approved makes, and the material supplied should be in confirmity of latest aai / icao specifications. , essna connector 6 sq.mm. , essna connector 16 sq.mm. , 45w 6.6a bi pin halogen lamp for taxi , halogen lamp 200w bi pin halogen lamp ( p ) , halogen lamp complete set rny ( 2...

Due Date : Oct 23, 2023

Tender Value :

15.47 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

40105506 Corrigendum : bids are invited for spares for eimco elecon make udm track recoil assembly part no 627m000000062 , filter element part no eea0003479 , hydrulic pump part no 611b050000077 , shaft seal for fan motor part no 627a00023003 , chain part no 611a050000114 , hydrulic motor part no 611a050000116 , hydrulic motor part no 611a050000122 , shaft seal part no eea0019089 , drill sprocket part no 611a060000034 , seal kit part no eea0018586 , drill ext cylinder part no 611b050000109 , seal kit part...

Due Date : Oct 27, 2023

Tender Value :

20.49 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

39918036bids are invited for tungsten halogen calibration lamp along with its precision lamp source (q3) mse total quantity : 1

Due Date : Oct 21, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Palghar - Maharashtra

39873772 Corrigendum : bids are invited for tungsten halogen lamps (non vehicle) as per is 12948 (q3) total quantity : 300

Due Date : Oct 30, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

39847944bids are invited for yellow filter (q3) , bi directional elevated type high intensity runway edge light fitting (q3) , medium intensity elevated type omni directional taxiway edge light fitting (q3) , 200w 6.6a bi pin halogen lamps (q3) total quantity : 145

Due Date : Oct 6, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

39807093bids are invited for yellow filter (r& l) 180 deg for ama aun runway light fitting 180 deg yellow filter (q3) , bi directional elevated type high intensity runway edge light fitting (q3) , medium intensity elevated type omni directional taxiway edge light fitting (q3) , 200w 6.6a bi pin halogen lamps (q3) total quantity : 145

Due Date : Oct 14, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Ratnagiri - Maharashtra

39630434 bids are invited for electrical tool & equipments ( q3 ) measuring steel tape, 5 meter knife double bladed electrician, 100 mm pipe vice cast iron with hardened, jaw open type, 100 mm crimping tool, 1.5 sq mm to 16 sq mm crimping tool, 16 sq mm to 95 sq mm wire cutter and stripper, 150 mm mallet hard wood, 0.50 kg table vice, 100 mm jaw pin type, shackle type, egg type & suspension type insulators including hardware fitting hydrometer hand drill machine 0.6mm capacity ...

Due Date : Sep 23, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Pune - Maharashtra

39552925 tender for mechanical bio medical equipments yearly repair and maintenance of pmc various hospital, maternity homes and dispensaries 1 liquid medical oxygen tank ( 13kl, 10kl, 1kl ) 2 oxygen tank pressure regulator 3 tank vaporizer gasket 4 safety wall 5 pressure valve 6 upeer filling valve 7 lower filling valve 8 inlet valve 9 outlet valve 10 taflon seat 11 vapourizer flange taplon seat 12 spool ball valve 13 pressure regulator 14 pressure gauge meter 15 oxyge...

Due Date : Sep 18, 2023

Tender Value :

55 Lakhs

View Notice

Government Departments - Pune - Maharashtra

39385475bids are invited for halogendisplayoptic lamp 3200k (cp 72) 2000 watts 240 volt (q3) , halogen displayoptic lamp 3200k (cp70) 1000 watts 240 volt (q3) total quantity : 29

Due Date : Sep 19, 2023

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kolhapur - Maharashtra

39254185 tender for supply, installation & commissioning of ftir spectrometer (atr) no. name & specification qty rate inclusive all taxes, gst etc ftir spectrometer (atr) 1 measurement wavenumber range: 7800 to 220 cm 1 upto (200cm 1 preferred.) analysis: analyze solid and liquid materials with atr atr: with diamond crystal extended range (optional):25000 to 20 cm 1 resolution:0.25, 0.5, 1.0, 2, 4, 8, 16 cm 1 signal to noise ratio:47000: 1 detector: standard: dlatgs (with peltier temperature cont...

Due Date : Aug 31, 2023

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

39155604supply of amy p gmmi no. 20766623322 / halogen lamp assay 12v 50w, halogen lamp assay 12v50w, cobas gmmi no. 4813707001. pack size 1 per pack quantity 10 packs. ( ami 23 24 ) , amy p gmmi no. 20766623322 pack size 1x200 test. quantity 15 packs. ( ami 23 24 )

Due Date : Aug 23, 2023

Tender Value : Ref. Document

View Notice

Government Departments - RATNAGIRI - Maharashtra

39098242 Corrigendum : bids are invited for electrical tool kit ( q3 ) |measuring steel tape, 5 meter knife double bladed electrician, 100 mm pipe vice cast iron with hardened, jaw open type, 100mm crimping tool, 1.5 sq mm to 16 sq mm |crimping tool, 16 sq mm to 95 sq mm wire cutter and stripper, 150 mm mallet hard wood, 0.50 kg table vice, 100 mm jaw relay a ) . cut out relays 16a, 440v b ) reverse current 16a, 440v c ) over current 16a, 440v d ) under voltage 360v 440v pin type, shackl...

Due Date : Aug 25, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Solapur - Maharashtra

39007648 Corrigendum : bids are invited for plug socket piano switch lamp holder 230 v, 5 a ( q3 ) , various lamps halogen incandescent lamp fluorescent tube hp mercury vapor lamp high pressure sodium ( q3 ) , various electronic components resistors, diode, transistor, ujt, fet, scr, diac, traic, igbt, small ( q3 ) , rheostat ( sliding type ) 0 25 ohm, 2 amp 0 300 ohm, 2 amp rheostat ( sliding type ) 0 25 ohm, 2 ( q3 ) , fuses hrc glass rewire type ( q3 ) , elcb and rccb 25amps, ...

Due Date : Sep 5, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - gultekdi - Maharashtra

38532287 purchasing of car accessories for pmc vehicles 1 seat cover ( velvet ) 2 ambassador 3 indica / vista 4 jeep ( sumo, marshal, bilero, scorpio ) 5 indigo / manza / tiago 6 corolla / altis 7 ciaz / swift / etios 8 omni 9 seat cover ( bmd ) 10 ambassador 11 indica / vista 12 jeep ( sumo, marshal, bilero, scorpio ) 13 indigo / manza / tiago 14 corolla / altis 15 ciaz / swift / etios 16 omni 17 laying and jointing pvc pipe. heading 18 ambassador 1...

Due Date : Jul 14, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Pune - Maharashtra

38305815 providing mandap related works in ward no 15 year 2023 24 hire charges for providing and erecting temporary pendal with cotton cover including all materrial transporation and labour etc. ( rate / sq.ft. ) , hire charges for providing and erecting temporary mandap with c.g.i. sheet covering and cotton cover including all materails transportation and labour ect. complete ( rate / sq.ft. ) , hire charges for providing and erecting stage with back screen wall and with wooden planks coverd with...

Due Date : Jul 6, 2023

Tender Value :

8.39 Lakhs

View Notice

Local Bodies - Pune - Maharashtra

38305268 tender for providing mandap related works in ward no 19 year 2023 24 hire charges for providing and erecting temporary pendal with cotton cover including all material transportation and labour etc. ( rate / sq.ft. ) , hire charges for providing and erecting temporary mandap with c.g.i. sheet covering and cotton cover including all materails transportation and labour ect. complete ( rate / sq.ft. ) hire charges for providing and erecting stage with back screen wall and with wooden planks ...

Due Date : Jul 6, 2023

Tender Value :

8.42 Lakhs

View Notice

Local Bodies - kundalwadi - Maharashtra

38270431 procurement and supply of electrical materials for electrical department for kundalwadi municipal council for the year 202324 , lamps and tubes for indoor & outdoor , supplying lamp 230v, 40 w. , supplying lamp 230v, 60 w. , supplying lamp 230v, 100 w. , supplying tube rod 36/40 w. , supplying t5 24 w energy efficient fluorosenttube , supplying led lamps 2 to 3 w, 230v intergraltype , supplying led lamps 5 to 8 w, 230v intergraltype , tube side patti g.i material , supplying cfl street light fi...

Due Date : Jun 27, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Palghar - Maharashtra

38234096 Corrigendum : bids are invited for tungsten halogen lamps (non vehicle) as per is 12948 (q3) total quantity : 300

Due Date : Aug 3, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - gultekdi - Maharashtra

38195270 purchasing of car accessories for pmc vehicles 1 seat cover ( velvet ) 2 ambassador 3 indica / vista 4 jeep ( sumo, marshal, bilero, scorpio ) 5 indigo / manza / tiago 6 corolla / altis 7 ciaz / swift / etios 8 omni 9 seat cover ( bmd ) 10 ambassador 11 indica / vista 12 jeep ( sumo, marshal, bilero, scorpio ) 13 indigo / manza / tiago 14 corolla / altis 15 ciaz / swift / etios 16 omni 17 laying and jointing pvc pipe. heading 18 ambassador 1...

Due Date : Jun 24, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Wardha - Maharashtra

38158736 bids are invited for electrician lab equipments ( q3 ) a. trainees tool kit ( for each additional unit trainees tool kit sl. 1 12 is required additionally ) 1. measuring steel tape 5 meter ( 20 +1 ) nos. 2. combination plier insulated 200 mm ( 20 +1 ) nos. 3. screwdriver insulated 4mm x 150 mm, diamond head ( 20 +1 ) nos. 4. screwdriver insulated 6mm x 150 mm ( 20 +1 ) nos. 5. electrician screwdriver thin stem insulated handle 4mm x 100 mm ( 20 +1 ) nos. 6. heavy duty scr...

Due Date : Jun 23, 2023

Tender Value : Ref. Document

View Notice

Government Departments - BHUSAWAL - Maharashtra

38153324supply of twin beam head light assembly complete comprising of double filament [ 100 90w ] 24v halogen lamp as per rdso specification no. elrs / spec / pr / 0024 ( rev 1 ) of sep?04. for track machines. part make: signotron / matsushi / delco hsn code: 9405 4010 [ warranty period: 30 months after the date of delivery ]

Due Date : Jul 10, 2023

Tender Value : Ref. Document

View Notice

Cooperative - pune - Maharashtra

38139524 selling of scrap machineries, unused machineries and unused / scrap materials at government milk scheme, pune 1 2 lorry bridge type vajnakata s.s.milk pump for r m rd ss weighing bowl 3 4 ss dumptak 5 6 ss dumptak air compressor 1 h.p. milk storage tank capacity 6000 lt. ( taki nos. 1 to 6 ) milk pump 3 h.p. ss milk pump for process milk storage tank capacity 15, 000 ltr. ( talk no.9, 10, 11 & 12 ) milk storage tank capacity 15, 000 ltr. ( talk no....

Due Date : Jul 3, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - dharmabad - Maharashtra

38019506 dharmabad municipal council procurement and supply of electrical materials for electrical departmen dharmabad municipal council procurement and supply of electrical materials for electrical departmen , lamps and tubes for indoor & outdoor , supplying lamp 230v, 40 w. , supplying lamp 230v, 60 w. , supplying lamp 230v, 100 w. , supplying tube rod 36/40 w. , supplying t5 24 w energy efficient fluorosenttube , supplying led lamps 2 to 3 w, 230v intergraltype , supplying led lamps 5 to 8 w, 230v in...

Due Date : Jun 16, 2023

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

37814111 supply of halogen lamp for twin beam head light 100 / 90 watts, 24 v, h4 p45 type having two filaments 100 watts for normal and other for dimmer as per rdso specn. no. elrs / spec / hl / 01 of july 1997 and 1999 and elrs / spec / pr / 0024 [ rev 1 sept 2004 ] [ make mico / phonix / halonix / ge / pl ilips / sylvaniya / autopal. [ warranty period: 30 months after the date of delivery ] amm ( carshed ) sanpada , cr maharashtra 477.00 numbers amm d ( emu ) kalva , cr maharashtra 733....

Due Date : Jun 15, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

37761656 bids are invited for spares for eimco elcon make udm or track recoil assembly part no 627m000000062 , track roller assembly part no 1027c050000005 , filter element part no eea0003479 , hydrulic pump part no 611b050000077 , shaft seal for fan motor part no 627a00023003 , conversion kit in bracket gear box part no 611b070000319 , chain part no 611a050000114 , hydrulic motor part no 611a050000116 , hydrulic motor part no 611a050000122 , shaft seal part no eea0019089 , ...

Due Date : May 30, 2023

Tender Value :

38.59 Lakhs

View Notice

Local Bodies - dharmabad - Maharashtra

37748424 tender for supplying of electrical equipments for electrical department mc dharmabad 1 supplying of electrical equipments 2 supplying lamp 230v, 40 w. 3 supplying lamp 230v, 60 w. 4 supplying lamp 230v, 100 w. 5 supplying tube rod 36/40 w. 6 supplying t5 24 w energy efficient fluorosenttube 7 supplying led lamps 2 to 3 w, 230v intergraltype 8 supplying led lamps 5 to 8 w, 230v intergraltype 9 tube side patti g.i material 10 supplying cfl street light fitting suitable for 2* above 18...

Due Date : May 29, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

37683430 bids are invited for spares for eimco elecon make udm or eea0019876 , check valve part no 77728871 , relif cartridge part no eea008997 , check valve pilot operated part no 77729800 , control valve boom part no 77005032 , main relif valve part no eea0018888 , rpp regulator part no 78320719 , hyd motor part no 611b050000143 , halogen reflector lamp part no eea0019292 , double selector valve part no 611b050000082 , seal lit part no eea0021827 , seak kit part no 18792 , seal kit swing c...

Due Date : May 26, 2023

Tender Value :

60.26 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

37683296 bids are invited for spares for eimco elecon make sdl bush part no 625a000003260 , bush part no 625a050000128 , bush mbh75 90 80s part no mbh7590805 , bush metric part no mbh506050a , bush part no mbh405050a , bush mbh50 60 50s part no mbh506050s , filter element part no eea0001160 , filter element part no eea0003479 , spring compression spring part no 625a000001439 , drive sprocket part no 6118050000200 , halogen reflector lamp part no eea0019292 , hydraulic fan motor pa...

Due Date : May 26, 2023

Tender Value :

59.36 Lakhs

View Notice

Government Departments - kalyan - Maharashtra

37651348 supply of medical equipment and instruments ( 2023 2024, 2024 2025 two years ) , fogger machine for fumigation & disinfectant tasks ( high power jetain watts inpleallarfansystem 600 watts 5 ltr tank capacity , boyles appratus ( 2 n2o provision safty n2o cuttoff, o2 failure alarm ) : specification : • anesthesia work station with vantilator & veporiser ( qty 01 ) • diamention: 1356mm x 845mm x 620mm • two gas machine with oxygen & nitrus oxide with each yoke • vantilator should be mi...

Due Date : May 25, 2023

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Nashik - Maharashtra

37403377providing of halogen lamp

Due Date : May 2, 2023

Tender Value : Ref. Document

View Notice

Government Departments - kharghar - Maharashtra

37174900 Corrigendum : item rate running contract for annual electrical works and supply of electrical items for the year 2023 24 at actrec 1 point wiring 1.1 sitc of wiring for light point / fan point / exhaust fan point / call bellpoint with 1.5 sq.mm frls pvc insulated copper conductorsingle core cable in surface / recessed steel conduit, withmodular switch, modular plate, suitable gi box and earthing thepoint with 1.5 sq.mm frls pvc insulated copper conductorsingle core cable etc. as required. 1.2 si...

Due Date : May 10, 2023

Tender Value :

40 Lakhs

View Notice

Government Departments - Sangli - Maharashtra

37171393 bids are invited for electrician tool kit measuring steel tape 5 meter , combination plier insulated 200 mm , screw driver , electrician screw driver , heavy duty screw driver insulated , electrician screw driver , punch centre , knife double bladed electrician , neon tester 500 v , steel rule , hammer cross peen , hammer ball peen , pincer 150 mm , c clamp 200 mm , c clamp 100 mm , spanner adjustable drop forged 150mm , spanner adjustable drop forged 300mm , b...

Due Date : Apr 18, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Nashik - Maharashtra

37128383 bids are invited for electrician tool kit measuring steel tape 5 meter , combination plier insulated 200 mm , screw driver insulated 4mm x 150 mm diamond head , screw driver insulated 6mm x 150 mm , electrician screw driver thin stem insulated handle 4mm x 100 mm , heavy duty screw driver insulated 5mm x 200 mm , electrician screw driver thin stem insulated handle 4mm x 250 mm , punch centre 9mm x 150 mm , knife double bladed electrician 100 mm , neon tester 500 v , steel rule in metr...

Due Date : Apr 20, 2023

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

37114689supply of halogen lamp assay 12v 50w, cobas gmmi no. 4813707001. pack size: 1 pc.

Due Date : May 8, 2023

Tender Value : Ref. Document

View Notice

Government Departments - nagpur - Maharashtra

36919826 supply of day to day electrical spares and luminaries spares supply of day to day electrical spares and luminaries spares at dr babasaheb ambedkar international airport nagpur , 2.5 sq.mm copper wire , 2 core x 1.5 sq.mm copper flexible cable , 3 core x 1 sq.mm flexible cable , 3 core x 1.5 sq.mm flexible cable , 3 core x 2.5 sq.mm flexible cable , 3 core x 2.5 sq.mm submersible flat cable , 4 core x 4 sq.mm. flexible copper cable , 2 core x 4 sq.mm aluminium ser...

Due Date : Mar 28, 2023

Tender Value :

8.51 Lakhs

View Notice

Government Departments - Sangli - Maharashtra

36875691 bids are invited for electrician tools 1 ( 1 ) measuring steel tape 5 meter 42 nos. 2 ( 2 ) combination plier insulated 200 mm 42 nos. 3 ( 3 ) screw driver 5mm x 150mm diamond head ( philips head ) 42 nos. 4 ( 4 ) screw driver insulated 6 mm x 150 mm 42 nos. 5 ( 5 ) electrician screw driver thin stem insulated handle5 mm x 100 mm 42 nos. 6 ( 6 ) heavy duty screw driver insulated 5 mm x 200 mm 42 nos. 7 ( 7 ) electrician screw driver thin stem insulated handle 5 mm x...

Due Date : Mar 29, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - pune - Maharashtra

36850918procurement of lab reagents on pac basis for roche cobas c111 , items : , c111 glucose , c111 urea , c111 creatinine , c111 uric acid , c111 cholestrol , c111 triglyceride , c111 hdl , c111 total bilirubin , c111 total protein , sgot , sgpt , albumin test kit , alk phospate , cobas cleaner , cfas lipid , halogen lamp , ise deprotinzer , c111 micro cuvettee , nacl

Due Date : Mar 22, 2023

Tender Value :

2.89 Lakhs

View Notice

Local Bodies - kundalwadi - Maharashtra

36813172 supply of electrical materials for electrical department m.c. kundalwadi , lamps and tubes for indoor & outdoor , supplying lamp 230v, 40 w. , supplying lamp 230v, 60 w. , supplying lamp 230v, 100 w. , supplying tube rod 36/40 w. , supplying t5 24 w energy efficient fluorosenttube , supplying led lamps 2 to 3 w, 230v intergraltype , supplying led lamps 5 to 8 w, 230v intergraltype , tube side patti g.i material , supplying cfl street light fitting suitable for 2* above 18 to 36w cfl, electronic...

Due Date : Mar 23, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Nagpur - Maharashtra

36766457 auction sale of 1] used, unserviceable tyres with/ without tube, 2] scrap electrical items , 3) electrical cable, 4) scrap furniture & fixture items etc 1) used, unserviceable tyres for heavy/light vehicles with/ without tube. [one lot of 82 nos.] 2) scrap electrical items such as tube lights, fittings, switch boards, fuse boxes, switched, streetlight fittings, and fittings for halogen lamps. (115 kgs.) 3) electrical cable (270 kgs,) 4) scrap furniture & fixture items etc. as per annexure 4 ...

Due Date : Mar 27, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Palghar - Maharashtra

36526755 Corrigendum : bids are invited for tungsten halogen lamps (non vehicle) as per is: 12948 (q3) mse total quantity : 300

Due Date : Apr 13, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai Suburban - Maharashtra

36278011bids are invited for spares of spectro quoanto mse 90.80.1.89.5 shutter 1 pc p 1.74026.0001 oem merck , 90.80.1.90.5 halogen lamp p 1.74010.0001 oem merck , 90.80.13.391.5 display resistiv p 1.74007.0001oem merck total quantity : 3

Due Date : Mar 1, 2023

Tender Value : Ref. Document

View Notice

Government Departments - bhusawal - Maharashtra

36011386 supply of connector for signotron make halogen lamp with ptfe wire and sleeving for twin beam head light as per m/s signotron drg. no. sig/halo/conn/mech/01 (part no 3292).connector for signotron make halogen lamp with ptfe wire and sleeving for twin beam head light as per m/s signotron drg. no. sig/halo/conn/mech/01 (part no 3292).,connector for signotron make halogen lamp with ptfe wire and sleeving for twin beam head light as per m/s signotron drg. no. sig/halo/conn/mech/01 (part no 3292)...

Due Date : Feb 6, 2023

Tender Value : Ref. Document

View Notice

Government Departments - nagpur - Maharashtra

35846820 supply of consumable glf spares supply of consumable glf spares at dr babasaheb ambedkar international airport nagpur , supply of following glf spares to suit the existing installation and as per the list of approved makes and the material supplied should be in confirmity of latest aai / icao specifications. , tr isolating 200w / 6.6 / 6.6 amp for cat/papi , c.i.dummy plate for housing box , 6 sq.mm. essna connector , 16 sq.mm. essna connector , bi pin holder for taxi/papi/runway/cat/approach ,...

Due Date : Feb 2, 2023

Tender Value :

14.36 Lakhs

View Notice

Boards / Undertakings / PSU - Amravati - Maharashtra

35814072 supply of cctv, dlp, office and lab. equipment, etc. , applied electronics , embedded system trainer board: m51 02 is a single board microcontroller trainer ki t based on 8 bit 8051 microcontroller, which is widely used to train engineers to develop on software / hardware for any industrial process & control. kit has power full monitor eprom, ram, i / o lines, timer / counter, serial, lcd display and keyboard for man to machine interface. 16k bytes of eprom with 32k ...

Due Date : Feb 3, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

35759285 bids are invited for halogen rgb 50 watt flood , halogen lamps bulb 30 watt flood , training bd for new mechanical machanism , display bd for spectrum analyzer 3x3 , display bd for function generator 3x3 , display bd for digital phosphor oscilloscope 3x3 , display bd for power meter 3x3 , display board for field insp standard rdr flycatcher 3x9 , display bd for tech specification of adfcr 5x4 , display bd for n2 sealing and puring eqpt 4x3 , display bd for specification testing of radio set 4x5...

Due Date : Jan 23, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - PUNE - Maharashtra

34889406 bids are invited for establishment of pbi lab to include all eqpt chemicals and trg 1 explosive detection kit detection of exp set 1 2 spot tiles spot test nos 10 3 droppers used during chemical analysis nos 10 4 measuring cylinder used during chemical analysis nos 6 5 funnel used during chemical analysis nos 10 6 filter paper (pkt) whatmann no 42 used during chemical analysis nos 5 7 amber store bottle used during chemical analysis nos 24 8 stirring glass rod used during chemical analysis no...

Due Date : Nov 22, 2022

Tender Value : Ref. Document

View Notice

Government Departments - asvini - Maharashtra

34743738 Corrigendum : replacement and repair of spare parts of pvms no niv, linear accelerator (model primus 3d fd analyser), qty 01 on ote/sin gle bid basis replacement and repair of spare parts of pvms no niv, linear accelerator (model primus 3d fd analyser), qty 01 on ote/sin gle bid basis , cosumable , replacement and repair of spare parts of linear accelerator (model – primus 3d fd analyser) defining light assy – h & halogen lamp 12v 50w

Due Date : Dec 8, 2022

Tender Value : Ref. Document

View Notice

Local Bodies - Pune - Maharashtra

34630617 purchasing of car accessories for pmc vehicles 1 seat cover ( velvet ) 2 ambassador 3 indica / vista 4 jeep ( sumo, marshal, bilero, scorpio ) 5 indigo / manza / tiago 6 corolla / altis 7 ciaz / swift / etios 8 omni 9 seat cover ( bmd ) 10 ambassador 11 indica / vista 12 jeep ( sumo, marshal, bilero, scorpio ) 13 indigo / manza / tiago 14 corolla / altis 15 ciaz / swift / etios 16 omni 17 laying and jointing pvc pipe. heading 18 ambassador 1...

Due Date : Nov 9, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - pune - Maharashtra

34614841 procurement of multiple material groups (260 lines) , various system spares : , transistor 2n2905 , filling plug washer , internal tooth washer 6ba , microphone , transistor (jan2222a) , potmeter 1k , diode jtx in5711 , ic 15584 (metal) , potmeter 10kohm (top adjustment) , integrated circuit , usb cable , transzorb , power supply card , ac adopter , battery , ssm plane washer , spacer for ulb hole , transistor bc 107a , reflective tape , data downloader with display , portable antena of garmin ...

Due Date : Nov 28, 2022

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

34475337 bids are invited for supply of electrical spares for ioo building nac and porta cabin at mumbai copper conductor frlsh wire , 3 core flexible copper cable , flouresecent lamp , incandescent lamp , halogen lamp , screw type led lamp , led batten light , electrolytic capacitor , universal type starter , penta piano type 6 a switch , penta 6a pin socket , penta power switch , universal socket , 20 and 10 a combined unit with box , electronic step type fan regulator , batten holder , 3 pin plug...

Due Date : Oct 31, 2022

Tender Value :

7.46 Lakhs

View Notice

Government Departments - tarapur - Maharashtra

34337946 manufacturing, pre despatch inspection, packing, supply, safe delivery, installation, commissioning, training and guarantee of vertical light path profile projector , vertical light path profile projector specifications: 1. x & y measuring range: 250 350mm x 120 150 mm 2. work stage area: 400 450 x 220 250 mm with 1 accessory mounting slot 3. scale resolution: 0.0005mm or better 4. screen diameter: at least 350 mm with rotation, vertically mounted with hood 5. accuracy:2.5 + l...

Due Date : Nov 14, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - pune - Maharashtra

34255118 Corrigendum : procurement of 28 lines of mafi spares , electrical/electronics items : , inner 180° clear lens (r) , prism pad for centreline lights (idm 4582) , bi dir top cover for centreline lights (idm 4582) , gasket for base plate , touchdown zone white unidirectional light inset with 8 inch shallow base , prism clear for touchdown zone lights (idm 4671) , gasket for the prism for touchdown zone lights (idm 4671) , spreader lens clear for approach fitting , standard remote control interface (idm 8000 s1...

Due Date : Nov 28, 2022

Tender Value : Ref. Document

View Notice

Local Bodies - gultekdi - Maharashtra

34236012 purchasing of car accessories for pmc vehicles 1 seat cover ( velvet ) 2 ambassador 3 indica / vista 4 jeep ( sumo, marshal, bilero, scorpio ) 5 indigo / manza / tiago 6 corolla / altis 7 ciaz / swift / etios 8 omni 9 seat cover ( bmd ) 10 ambassador 11 indica / vista 12 jeep ( sumo, marshal, bilero, scorpio ) 13 indigo / manza / tiago 14 corolla / altis 15 ciaz / swift / etios 16 omni 17 laying and jointing pvc pipe. heading 18 ambassador 1...

Due Date : Oct 13, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - MUMBAI - Maharashtra

34106209bids are invited for 060008 auriscope, fibreoptic light transmission, halogen lamp 3 v using two aa size battery comple ( q3 total quantity : 30

Due Date : Sep 27, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

33903917 bids are invited for copper conductor frlsh wire , 3 core flexible copper cable , fluorescent lamp , incandescent lamp , halogen lamp , led lamp , led batten , fan capacitor , universal type starter , piano type switch and sockets , step type fan regulator , holder , 3 pin plug top 6 a , 3 pin plug top 16 a , switch and sockets , insulation taperoll , pvc switch board boxes , casing caping , pvc band , circular surface box with lid , space bar saddle , time switch , led i...

Due Date : Sep 22, 2022

Tender Value :

7.88 Lakhs

View Notice

Government Departments - pune - Maharashtra

33805454 supply and installation of consumable deuterium lamp, halogen lamp with adjusted base and filter wheel for uv vis spectrometer ( specord plus ) supply and installation of consumable deuterium lamp, halogen lamp with adjusted base and filter wheel for uv vis spectrometer ( specord plus ) , supply and installation of consumables deuterium lamp, halogen lamp with adjusted base and filter wheel for uv vis spectrometer ( specord plus ) , bid in inr ( including concessi...

Due Date : Sep 13, 2022

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - gondia - Maharashtra

33553520 Corrigendum : supply of glf spares at birsi airport, gondia for the year 2022 23 supply of glf spares at birsi airport, gondia for the year 2022 23 , supply of 200w, 6.6 a halogen lamps with in built holder with pk 30d base, male connector ( make: osram, cat no. 64382 hlx c 200w 15 6.6a pk30d or equivalent ) as required. , supply of 150 w, 6.6 a halogen lamps with in built holder with pk 30d base, male connector ( make: osram, cat no. 64361 hlx z 150w 15 6.6a pk30d osram or equivalent ) as requi...

Due Date : Sep 8, 2022

Tender Value :

6.79 Lakhs

View Notice

Government Departments - Maharashtra

33125779supply of twin beam led head light for electrictwin beam led head light for electric,complete twin beam head light assembly as per rdso specn. no. rdso/spec/pr 0024(rev 1)sept 2004 admen (1) with 24 v 100/90 watts twin filament halogen lamp. dy cmm (acl) bsl , cr maharashtra 60.00 set

Due Date : Aug 17, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

33085366bids are invited for 060008 auriscope, fibreoptic light transmission, halogen lamp 3 v using two aa size battery comple (q3) total quantity : 30

Due Date : Jul 26, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Nagpur - Maharashtra

32991734 supply of consumable glf spares at dr babasaheb ambedkar international airport nagpur supply of consumable glf spares at dr babasaheb ambedkar international airport nagpur , supply of following glf spares to suit the existing installation and as per the list of approved makes, and the material supplied should be in confirmity of latest aai / icao specifications. , tr isolating 300 w 6.6/ 6.6 amp for runway , essna connector 6 sq.mm. , essna connector 16 sq.mm. , 1 mtr. secondary lead for runw...

Due Date : Jul 20, 2022

Tender Value :

7.38 Lakhs

View Notice

Boards / Undertakings / PSU - Ratnagiri - Maharashtra

32843248bids are invited for aviation obstruction lamp, 230 v ac, medium intensity, led , halogen lamps for generators condition monitoring and lighting areas 1000watt ,halogen lamps for generators conditionmonitoring and lighting areas 500 watt total quantity : 2520

Due Date : Jul 8, 2022

Tender Value :

6.07 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Ahmednagar - Maharashtra

32809758 bids are invited for tip cleaner 25 gm pack , scissors blade ss 200mm , drill hand brace 0 to10 mm , bradawl 150 mm by 6mm square pointed , mallet hard wood 0.50 kg , pin type, shackle type, egg type and suspension type insulators including hardware fitting set containing each one , working bench 2.5 m by 1.20 m by 0.75 m , metal rack 100cm by 150cm by 45cm , drill s.s. twist block 2 mm, 5 mm 6 mm set of 3 , bus bar with brackets 1 mte each , milli voltmet...

Due Date : Jul 4, 2022

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mumbai - Maharashtra

32790277 supply of spares at ats complex, mumbai 4 core armoured copper cable , 4 core armoured aluminium cable, 3 core flexible copper cable, copper conductor frlsh wire , 4 core cable jointing kit , casing and capings, frp junction box , 4 way connector, switch and sockets , , pvc surface box , led emergency light, led lamp., n halogen lamp, emergency exit light, nylon anti bird net , , drill bit set , hallem sheet , fan regulator, fan capacitor, ceiling rose , hbc fuse link...

Due Date : Jul 4, 2022

Tender Value :

20.65 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

32778656 bids are invited for 4 core armoured copper cable , 4 core armoured aluminium cable , 3 core flexible copper cable , copper conductor frlsh wire , 4 core cable jointing kit , casing and capings , frp junction box , 4 way connector , switch and sockets , pvc surface box , led emergency light , led lamp , halogen lamp , emergency exit light , nylon anti bird net , drill bit set , hallem sheet , fan regulator , fan capacitor , ceiling rose , hbc fuse link , dp rcbo , sp dc series mcb , digital mul...

Due Date : Jul 4, 2022

Tender Value :

20.65 Lakhs

View Notice

Boards / Undertakings / PSU - Yavatmal - Maharashtra

32714311eandm supply of electrical consumables viz pvc tape rubber volcanising tape ht para tape cotton tape push button indicating lamp halogen bulb and g i nut and bolts in respect of rajur incline colliery gsa

Due Date : Jun 21, 2022

Tender Value :

1.14 Lakhs

View Notice

Boards / Undertakings / PSU - gondia - Maharashtra

32630441 supply of glf spares at birsi airport, gondia for the year 2022 23. , supply of 200w, 6.6 a halogen lamps with in built holder with pk 30d base, male connector ( make: osram, cat no. 64382 hlx c 200w 15 6.6a pk30d or equivalent ) as required. , supply of 150 w, 6.6 a halogen lamps with in built holder with pk 30d base, male connector ( make: osram, cat no. 64361 hlx z 150w 15 6.6a pk30d osram or equivalent ) as required. , supply of 200w 6.6a bi pin halogen lamps ...

Due Date : Jul 4, 2022

Tender Value :

4.11 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Nandurbar - Maharashtra

32539251 bids are invited for drill hand brace 0 10 mm , mallet hard wood 050 kg , tool bits 12 x150 mm sq. assorted shaped , drill s.s. twist block 2 mm , 5mm, 6 mmm set of 3 , bus bar with brackets 1 mte each , milli voltmeter centre zero analog , portable box , laboratory type induction coil 1000 w , smoothing cutters 50 mm x 200 m , plane cutters 50 mm x 200 mm , rubber mat , tool bit assorted sizes on holder , rotary switch 16 a , 440 v , series test lamp 230 volt, ...

Due Date : Jun 15, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

32476842 bids are invited for flange part no. eea0015406 , wheel stud part no. , eea0015419 , wheel nut part no. eea0015421 , hub seal part no. eea0015443 , cable steering valve part no. 412a000000228 , oil level window part no. 241a000000284 , oil seal pump shaft seal part no. eea0010052 , transmission repair kit part no. eea0018039 , brake valve part no. 811b050000000150 , filter element part no. eea0001160 , pressure guage brake part no. 813b000000185 , idler sprocket part no.250a070000036 , halogen...

Due Date : Jun 11, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - NANDURBAR - Maharashtra

32463880 bids are invited for operators chairs , scissors blade ss 200mm , drill hand brace 0 to 10 mm , desolderinggunheatproofnozzle, pvc type , bradawl 150 mm x 6mm square pointed , mallet hard wood 0.50 kg , pintype shackletype eggtypeand suspensiontype , working bench 2.5 m x 1.20 m x 0.75 m , metal rack 100cm x 150cm x 45cm , drill s s twist block 2 mm 5 mm 6 mm set of 3 , bus bar with brackets 1 mre each , wiringboard3meterx 1meterwith0.5meterproj , relay a. cut o...

Due Date : Jun 15, 2022

Tender Value : Ref. Document

View Notice

Cooperative - Maharashtra

32367774supply of lighting material unit 2 1. ammeterrange 2. push button,red color 3. flurescent tube choke 4. halogen holder 5. halogen lamp assembly 6. pin type pendent holder 7. sp switch piyano 8. three pin socket 9. tube fitting set,led type 10. water proof tube fitting set 11. lamp etc

Due Date : Jun 9, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - mumbai - Maharashtra

32312787 bids are invited for fluorescent tape for night marking of emergency ways lifebuoy , anti cockroach gel chalk , detergent solution , oil and grease remover , lint free cloth , gloves leather a , clip jubilee 5 , clip jubilee 4 , clip jubilee 2 2.750 , clip jubilee 2 , rope polypropylene 4mm , paint brush 13 mm , paint brush 3 , rope polypropylene 16 mm , rope polypropylene 08 mm , rope polypropylene 20 mm , rope polypropylene 12 mm , rope polypropylene 10 mm , polythene...

Due Date : May 21, 2022

Tender Value : Ref. Document

View Notice

Government Departments - aurangabad - Maharashtra

32279470 Corrigendum : supply of 200 w led blinder light and etc for dept. of drama supply of 200 w led blinder light and etc for dept. of drama , supply of 200 w led blinder light and etc for dept. of drama , 200w led blinder light, beam angle 30, color temperature 3200k or 5600k model can led bldr 200 make : canara , 150w led rgbw cyclorama light, dmx / rdm / manual / master slavemodel : can led wash 1215make : canara , profile spot 750w spot light 26 complete with color frame and gabo holdermodel : cl 19 26...

Due Date : Jun 7, 2022

Tender Value : Ref. Document

View Notice

Local Bodies - Nanded - Maharashtra

32200651 supplying of electrical equipments for electrical department supplying of electrical equipments for electrical department , supplying of electrical equipments , supplying lamp 230v, 40 w. , supplying lamp 230v, 60 w. , supplying lamp 230v, 100 w. , supplying tube rod 36 / 40 w. , supplying t5 24 w energy efficient fluorosenttube , supplying led lamps 2 to 3 w, 230v intergraltype , supplying led lamps 5 to 8 w, 230v intergraltype , tube side patti g.i material , supplying cfl stre...

Due Date : May 23, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Maharashtra

32013406supply of halogen lamphalogen lamp,halogen lamp for twin beam head light 100/90 watts, 24 v, h4 p45 type having two filaments 100 watts for normal and other for dimmer as per rdso specn. no. elrs/spec/hl/01 of july 1997 and 1999 and elrs/spec/pr/0024 [rev 1 sept 2004] [make mico/phonix/halonix/ge/philips/sylvaniya/autopal . amm d(emu) kalva , cr maharashtra 613.00 numbers

Due Date : May 10, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

31994847 Corrigendum : bids are invited for fluorescent tape for night marking of emergency ways lifebuoy , anti cockroach gel chalk , detergent solution , oil and grease remover , lint free cloth , gloves leather a , clip jubilee 5 , clip jubilee 4 , clip jubilee 2 2.750 , clip jubilee 2 , rope polypropylene 4mm , paint brush 13 mm , paint brush 3 , rope polypropylene 16 mm , rope polypropylene 08 mm , rope polypropylene 20 mm , rope polypropylene 12 mm , rope polypropylene 10 mm , polythene bag 14x16x75 micron , ro...

Due Date : May 19, 2022

Tender Value : Ref. Document

View Notice

Government Departments - ahmednagar - Maharashtra

31896061 Corrigendum : supplying office electrical material for apmc ahmednagar year 2022 2023 led bulb , led tube set , tube bar , metal highlight chock , condenser , tube set , street light fitting , halogen lamp , ceiling fan , wire , wire bundle , service wire , flexible wire bundle , mcb , fuse set , main switch , pipe , insulation tap , casing scale etc

Due Date : Apr 29, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

31712166bids are invited for tungsten halogen calibration lamp as per attached technical specification (q3) total quantity : 1

Due Date : Apr 25, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Sangli - Maharashtra

31679615 bids are invited for electrical spares total quantity : 78 1 de soldering gun heart proof nozzle pvc type 2 bus bar with brackets 1 mte each 3 relay a) cut out relays 16a, 440 v b) reverse current 4 millit voltmeter centre zero analog, portable box type 5 laboratory type induction coil 1000 w 6 rubber mat 2x4x1 7 rotary switch 16a/440v 8 warious lamps (halogen incandesent flouorescent tub) 9 thermostat 10 limit switch limt switch liver operated 2a 500v 2con 11 ceiling fan coil wind...

Due Date : Apr 20, 2022

Tender Value : Ref. Document

View Notice

Local Bodies - kundalwadi - Maharashtra

31576452 supply of electrical department related items for municipal council for year 2022 23 supply of electrical department related items for municipal council for year 2022 23 , lamps and tubes for indoor & outdoor , supplying lamp 230v, 40 w. , supplying lamp 230v, 60 w. , supplying lamp 230v, 100 w. , supplying tube rod 36 / 40 w. , supplying t5 24 w energy efficient fluorosenttube , supplying led lamps 2 to 3 w, 230v intergraltype , supplying led lamps 5 to 8 w, 230v in...

Due Date : Mar 30, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Maharashtra

31445004 bids are invited for 4 core armoured copper cable , 4 core armoured aluminium cable , 3 core flexible copper cable , copper conductor frlsh wire , 4 core cable jointing kit , casing and capings , frp junction box , 4 way connector , switch and sockets , pvc surface box , led emergency light , led lamp , halogen lamp , emergency exit light , nylon anti bird net , drill bit set , hallem sheet , fan regulator , fan capacitor , ceiling rose , hbc fuse link , ...

Due Date : Mar 25, 2022

Tender Value :

14.87 Lakhs

View Notice

100

Boards / Undertakings / PSU - Mumbai - Maharashtra

31422802 supply of electrical spares at ats complex, mumbai 4 core armoured copper cable , 4 core armoured aluminium cable , 3 core flexible copper cable, copper conductor frlsh wire , 4 core cable jointing kit, casing and capings, frp junction box , i4 way connector, switch and sockets, pvc surface box , led emergency light, led lamp, halogen lamp , emergency exit light, nylon anti bird net, drill bit set, hallem sheet, fan regulator, fan capacitor, ceiling rose , hbc fuse l...

Due Date : Mar 25, 2022

Tender Value :

14.87 Lakhs

View Notice

Tenders By City

Tenders By Authority

Top