630 Goat tenders in Maharashtra 2024

Get latest Goat related Tenders, online published by Bank Of Maharashtra, Cidco Maharashtra Ltd., City and Industrial Development Corporation of Maharashtra from Maharashtra state. Participate online through e-Procurement website for Goat tenders in Maharashtra. Download Tender Documents, BOQ, Technical Bids for Goat related Tenders from Maharashtra. Get Bidding support for etenders related to Goat Tenders in Maharashtra. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Goat tenders published from Maharashtra. Also get daily email alerts for Goat related tender notices published by Government of Maharashtra.

1

Government Departments - Vashi - Maharashtra

43205557 tender for work of replacement of existing 0.3 acsr goat conductor with high performance conductor (hpc) of 100kv padgha ambernath, 100 kv padgha mohane & 100 kv mohane ambernath lines under ehv pc o&m zone, vashi

Due Date : May 17, 2024
Tender Value : Ref. Document
View Notice
2

Government Departments - Pune - Maharashtra

43188836tender for 1) anti human igm (u chain specific) antibody produced in goat, make sigma aldrich, cat. no.12386, pack size 1ml./vial, qty. 50 vials.

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - Pune - Maharashtra

43100171tender for double jump ring work (bypass jump) by providing & fixing of wedge type connector for 0.3 goat conductor of 220kv pirangut kandalgaon line under ehv o&m dn ii, pune as per drawing & specification attached.

Due Date : Apr 10, 2024
Tender Value : Ref. Document
View Notice
4

Private Organizations - Solapur - Maharashtra

43082137auction sale of skins of goats

Due Date : Jul 4, 2024
Tender Value : Ref. Document
View Notice
5

Government Departments - Pune - Maharashtra

43023364tender for procure the chemical (kit), 1. goat anti mouse igg secondary antibody hrp conjugate, cat no. 31430, qty 3.00 2. goat anti human igg secondary antibody hrp, make: thermofisher, cat no. 31410, qty 3.00

Due Date : Mar 30, 2024
Tender Value : Ref. Document
View Notice
6

Local Bodies - Mumbai Suburban - Maharashtra

42964982the work of providing of walk in cooler for the storage of dead goats at deonar the work of providing of walk in cooler for the storage of dead goats at deonar abattoir.

Due Date : Mar 22, 2024
Tender Value : rupee 26.56 Lakhs
View Notice
7

Government Departments - Pune - Maharashtra

42932410tender for supply of 1) anti human igm (u chain specific) antibody produced in goat, make sigma aldrich, cat. no. 12386 (pack size 1ml/vial), qty. 50 vials

Due Date : Mar 22, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - Navi Mumbai - Maharashtra

42914038tender for work of replacement of existing 0.3 acsr goat conductor with high performance conductor (hpc) of 100kv padgha ambernath, 100 kv padgha mohane & 100 kv mohane ambernath lines under ehv pc o&m zone, vashi

Due Date : Apr 4, 2024
Tender Value : rupee 38.45 Crore
View Notice
9

Government Departments - daund - Maharashtra

42770908 supply installation and commissioning of goat breeding unit , supply, installation and commissioning of goat breeding unit , chaff cutter single gear, 2hp, single phase electric motor, 1440 rpm, starter, v grooved pulley for motor, vee belts with accessorires , feed mill grinder and mixer intake hopper with grill and feeding control. feeding screw conveyor 6” ( 4 mtr height ) , 2hp 1440rpm foot, screw blade 3mm thick, high carbon blade, belt drive, hammer mill rotor 2880 rpm, 5hp...

Due Date : Mar 21, 2024
Tender Value : Ref. Document
View Notice
10

Local Bodies - Mumbai Suburban - Maharashtra

42736584 work of design, development, installation, testing & commissioning of animal inventory management system for sheep / goats & cattle services on rental basis with operation & maintenance and related work during bakari –eid 2024 at deonar abattoir. 2 renting 5 noscolour printers for barcode / qr code& id cards 15 days in religious festival bakari eid 2024 3 renting 17 nos of computers / tab / laptop for various operations for the system during bakari eid 2024 for 15 days in religious ...

Due Date : Mar 12, 2024
Tender Value : Ref. Document
View Notice
11

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42707657bids are invited for non veg items, chicken broiler dressed chilled , meat dressed chilled goat , pork frozen , buffalo meat frozen , egg fresh hen , fish fresh rohu , fish fresh basa , fish fresh catla total quantity : 62996

Due Date : Mar 7, 2024
Tender Value : Ref. Document
View Notice
12

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42707575bids are invited for non veg items , chicken broiler dressed chilled , meat dressed chilled goat , pork frozen , buffalo meat frozen , eggs fresh hen , fish freshrohu, catla total quantity : 42600

Due Date : Mar 7, 2024
Tender Value : Ref. Document
View Notice
13

Local Bodies - govandi - Maharashtra

42671632design and installation animal inventory management system at deonar abattoir work of design, development, installation, testing and commissioning of animal inventory management system for sheep/goats and cattle services on rental basis with operation and maintenance and related work during bakari eid 2024 at deonar abattoir.

Due Date : Mar 11, 2024
Tender Value : Ref. Document
View Notice
14

Local Bodies - yavatmal - Maharashtra

42626738weekly market and goat market revenue collection at nagar panchayat babhulgaon for further details refer nia of this tender

Due Date : Mar 7, 2024
Tender Value : Ref. Document
View Notice
15

Government Departments - Osmanabad - Maharashtra

42587799development to punyasholk ahilyadevi sheeps and goats development farm at tirth (bk.) (project under aspiration district programme conservation, training and extension project of osmanabadi breed of goats) tq.tuljapur, district dharashiv.

Due Date : Mar 5, 2024
Tender Value : rupee 86.98 Lakhs
View Notice
16

Government Departments - Pune - Maharashtra

42503090tender for double jumpering work (bypass jump) by providing & fixing of wedge type connector for 0.3 goat conductor of 220kv pirangut kandalgaon line under ehv o&m dn ii, pune as per drawing & specification attached.q

Due Date : Mar 1, 2024
Tender Value : Ref. Document
View Notice
17

Government Departments - Mumbai - Maharashtra

42430459bids are invited for consumables, fitc anti cd177 antibody mem 166 abcam , bd facs lysing solution 10x , bd pharmingena c apc mouse antihuman cd15 clone hi98 , twist ef library prep plus udis plate c andfast hyb , nextseq 1000 by 2000 p1 reagents 300 cycles , bd pharmingena c fitc goat anti mouse igtotal quantity : 7

Due Date : Feb 24, 2024
Tender Value : Ref. Document
View Notice
18

Local Bodies - chopda - Maharashtra

42402268 tender for inviting tender for supply of printing material to m c chopda for the year of 2024 25. 2 retail receipt book duplicate 100 pages 3 property tax / panipatti and other tax collection receipt book duplicate 100 pa 4 panipatti receipt book duplicate 100 pani 5 property tax demand register 300 pani 6 property and other recovery challan 100 pani 250 towards property tax recovery 8 property tax bill book duplicate 100 pages 9 property tax notice book duplicate 100 pages 10 property ...

Due Date : Feb 27, 2024
Tender Value : Ref. Document
View Notice
19

Government Departments - Mumbai - Maharashtra

42249088bids are invited for chemical ethanolamine a percent y99 percent 100ml , n ethylmaleimide a percent crystalline y98 percent hplc , sulfo nhs acetate cas number 152305 87 8 , 2 morpholinoethanesulfonic acid monohydrate buffer substance mes , igg from goat serum 50mg total quantity : 5

Due Date : Feb 26, 2024
Tender Value : Ref. Document
View Notice
20

Government Departments - Mumbai - Maharashtra

42222557bids are invited for consumabale western i blot gel transfer stack with nitrocellulose membrane kit , nupage bistris 10 percent 1w wpk welcome pk , pmca antibody f 3 , glutathione antibody d8 , goat anti mouse igg hrp conjugate total quantity : 5

Due Date : Feb 26, 2024
Tender Value : Ref. Document
View Notice
21

Government Departments - Mumbai - Maharashtra

42205261bids are invited for chemical hla dr bv510 l243 , anti hu cd34 bv510 8g12 , anti hu st2 il 33r pe , anti hu cd141 pe 1a4 , anti hu cd1c apc af750 l161 , anti hu cd3 fitc ucht1 , hu ccr10 bb515 1b5 , anti hu cd19 bv510 hib19 , goat anti mouse igg fitc 2ab , hla dr pb immu 357 total quantity : 20

Due Date : Feb 24, 2024
Tender Value : Ref. Document
View Notice
22

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42150326bids are invited for non veg items chicken broiler dressed chilled , meat dressed chilled goat , pork frozen , buffalo meat frozen , egg fresh hen , fish fresh rohu , fish fresh basa , fish fresh catla total quantity : 62996

Due Date : Feb 24, 2024
Tender Value : rupee 28.52 Lakhs
View Notice
23

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

42150318bids are invited for non veg items chicken broiler dressed chilled , meat dressed chilled goat , pork frozen , buffalo meat frozen , eggs fresh hen , fish fresh rohu, catla total quantity : 42600

Due Date : Feb 24, 2024
Tender Value : rupee 29.81 Lakhs
View Notice
24

Government Departments - Mumbai - Maharashtra

42117481bids are invited for consumables goat anti human igg hrp cat. no 2040 0 , mouse anti human igg1 fc hrp hp6001 cat. no 904 0 , mouse anti human igg4 fc hrp southern biotech hsn code 38220090 , p3813 5x10pak phosphate buffered saline , purified goat f ab 2 anti human igg antibody invitrogen thermofischer cat no 31122 2mg total quantity : 5

Due Date : Feb 20, 2024
Tender Value : Ref. Document
View Notice
25

Private Organizations - Amravati - Maharashtra

42111807tender for required the following materials for goat sub project under navtejaswini maharashtra rural women enterprise development project. १ goat fodder (stand) २ water stand

Due Date : Feb 15, 2024
Tender Value : Ref. Document
View Notice
26

Government Departments - Mumbai - Maharashtra

42101968bids are invited for consumables goat anti human igg hrp cat. no 2040 0 , mouse anti human igg1 fc hrp hp6001 cat. no 904 0 , mouse anti human igg4 fc hrp southern biotech hsn code 38220090 , p3813 5x10pak phosphate buffered saline , purified goat f ab 2 anti human igg antibody invitrogen thermofischer cat no 31122 2mg total quantity : 5

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
27

Government Departments - Mumbai - Maharashtra

42101939 bids are invited for consumables i2136 1ml anti human igg fc specific antibody produced in goat affinity isolated antibody buffered aqueous solution i2136 1ml , i3391 1ml anti human igg fc specific f abae 2 fragment antibody produced in goat affinity isolated antibody buffered aqueous solution i3391 1ml , mouse anti human igg4 fc secondary antibody 250ug a 10651 , i9388 .5ml monoclonal anti human igg1 fc specific antibody produced in mouse clone hp 6001 ascites fluid i9388 .5ml , i5385 100ul ...

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
28

Private Organizations - Mumbai - Maharashtra

42087080tender for supply of items i. eggs 7. indian sweets & farsan 2. milk products 8. charcoal / wood 3. groceries 9. atta and maida 4. frozen vegetables 10. goat fresh / chilled 5. dry fruits 11. pulses 6. flowers 12. bread, pav & kulcha and . fresh vegetables 3. fresh fruits / imported fruits 2. exotic vegetables 4. fish sea food fresh / chilled

Due Date : Feb 17, 2024
Tender Value : Ref. Document
View Notice
29

Government Departments - Mumbai - Maharashtra

42069298bids are invited for consumables fitc anti cd1 antibody mem 166 abcam , bd facs lysing solution 10x , bd pharmingena c apc mouse anti human cd15 clone hi98 , twist ef library prep plus udis plate c andfast hyb , nextseq 1000 by 2000 p1 reagents 300 cycles , bd pharmingena c fitc goat anti mouse ig total quantity : 7

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
30

Government Departments - daund - Maharashtra

42065178 Corrigendum : supply, installation and commissioning of goat breeding unit supply, installation and commissioning of goat breeding unit , supply, installation and commissioning of goat breeding unit , chaff cutter single gear, 2hp,single phase electric motor, 1440 rpm, starter, v grooved pulley for motor, vee belts with accessorires , feed mill grinder and mixer intake hopper with grill and feeding control. feeding screw conveyor 6” (4 mtr height),2hp 1440rpm foot, screw blade 3mm thick, high carbon blade, b...

Due Date : Feb 28, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - Mumbai - Maharashtra

42046524bids are invited for pro carta plex , cell stimulation cocktail , white plates , anti human igm peroxidase antibody produced in goat , staurosporine , nigercin , anti human polyvalent immunoglobulins peroxidase antibody produced in goat total quantity : 7

Due Date : Feb 17, 2024
Tender Value : Ref. Document
View Notice
32

Local Bodies - latur - Maharashtra

42012857 tender for stray / deserted / sick stray animals on roads within latur city municipal corporation eg. 1. half acre of land of the organization for the work of catching cows, bullocks, buffaloes, reda, donkeys, small animals and goats etc., rearing loose animals, treating sick animals, registered cow protection organizations on contract basis with drivers and manpower, voluntary charitable organizations, women self help groups, labor cooperatives, unemployed organizations to appoint ...

Due Date : Feb 15, 2024
Tender Value : rupee 90 Lakhs
View Notice
33

Local Bodies - Pune - Maharashtra

41851612tender for for the year 2023 24, purchase of disinfectant powder required for mutton, beef, beef and goat slaughterhouse.

Due Date : Feb 4, 2024
Tender Value : rupee 6.60 Lakhs
View Notice
34

Government Departments - Mumbai - Maharashtra

41827802bids are invited for cell stimulation cocktail , white plates , pro carta plex , caspase inhibitor , anti human igm peroxidase antibody produced in goat , anti human polyvalent immunoglobulins peroxidase antibody produced in goat , staurosporine , nigercin , dneasy poersoil pro kit , human pmn elastase kit , human citrulinated h3 , ngs9go full workflow total quantity : 12

Due Date : Feb 5, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - Mumbai - Maharashtra

41816820 Corrigendum : bids are invited for consumables phosphate buffered saline ph 7.4 liquid sterile filtered suitable for cell culture , tris hydrochloride greater percent titration ph 7.0 .0 suitable for fish 500g , 1 butanol . percent , hexane anhydrous 5 percent , 1 propanol anhydrous 99.7 percent , toluene anhydrous 99.8 percent , edac hydrochloride 25g 1 ethyl 3 3e1 dimethylaminopropyl carbodiimide hcl , n hydroxysulfosuccinimide sodium salt a percentage y 98 percent hplc , igg from goat serum 50mg total...

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
36

Private Organizations - pune - Maharashtra

41674878 tender for supply of materials eggs, fish & sea food, goat meat, milk & milk products, chicken sausages & cold cuts, green peas and american corn, pork products, vegetables, english vegetables, fruits, groceries & provisions, breads & bakery products, bakery raw materials and misc. food products, ready to eat frozen foods, indian sweets, charcoal, cleaning items, chemicals & detergents, office stationery, printed stationery, all types of disposable items, scrap / garbage dry & wet, owc m...

Due Date : Feb 6, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Mumbai - Maharashtra

41525125 bids are invited for consumables for medical research mse 328107 fitc antihuman cd90 clone 5e10 , 323219 bv421 anti human cd105 clone 43a3 , 350807 apc antihuman cd325 clone 8e11 , 373807 pe l cy7 anti human lgr5, clone sazzzc5 , 3405 apc antihuman cd166 clone 3a6 , 125605 pe antihuman cd15, clone me480 , 420403 7aad viability staining solution , 330411 af488 antihuman ssea4 clone me8 1370 , 323605 pe antihuman cd140b, clone ba2 , 303115 apc antihuman cd31 clone wm59 , 332025 pe l ey7 antihu...

Due Date : Jan 19, 2024
Tender Value : rupee 7 Lakhs
View Notice
38

Government Departments - pune - Maharashtra

41450414 Corrigendum : purchase of goat pox vaccine under ascad for the year 2023 24. , goat pox vaccine (ip) along with diluent

Due Date : Feb 8, 2024
Tender Value : rupee 5.87 Crore
View Notice
39

Government Departments - Mumbai - Maharashtra

41444327 bids are invited for 1 er alpha antibody ( estrogen receptor alpha ) 100ug 2 rna micro kit 3 insulin elecsys cobase 100 ( 100t ) 4 insulin cs elecsys 2x2x1ml 5 qiagen qiamp dna mini kit ( 250 ) 6 xtream gene hp dna transfection reagent ( 1ml ) 7 collageanse type i a from c. histolyticum 50mg 8 hepes suitable for cell culture 100g 9 charcoal stripped fbs 500ml 10 trypsin edta ( 0.5% ) no phenol red 11 fbs cert usa origin 12 lipofectamine 2000 reagent 1.5ml ...

Due Date : Jan 15, 2024
Tender Value : Ref. Document
View Notice
40

Local Bodies - Nagpur - Maharashtra

41433781 tender for purchase of meera 71 and glassell for spraying the thorn bushes, congress grass, herbicides on the boundary, purchase of chemicals and insecticides for trees. no. w. catching the free animals of the area like cows, buffaloes, goats and depositing them in kanji haus (per animal rate to be paid) supplying materials like sodium hypochloride, sanitizer etc. for covid treatment. nor department annual supply of electrical materials as required for street lights as well as office electri...

Due Date : Jan 15, 2024
Tender Value : Ref. Document
View Notice
41

Government Departments - Pune - Maharashtra

41418462tender for supply of goat anti human igm (u chain specific) antibody, make sigma aldrich, cat. no. 12386, qty. 20 nos.

Due Date : Jan 8, 2024
Tender Value : Ref. Document
View Notice
42

Government Departments - PUNE - Maharashtra

41404629tender for purchase of h.s. + b.q., sheep pox, goat poχ, αντι rabies, blue tongue &anthrax vaccine under ascad for the year 2023 24

Due Date : Jan 18, 2024
Tender Value : Ref. Document
View Notice
43

Government Departments - pune - Maharashtra

41348324purchase of h.s. and b.q., sheep pox, goat pox, anti rabies, blue tongue and anthrax vaccine under ascad for the year 2023 24 , combined hemorrhagic septicemia+ black quarter vaccine (ip) , goat pox vaccine (ip) along with diluent , sheep pox vaccine (ip) along with diluent , blue tongue vaccine (ip) , anti –rabies vaccine(ip) , anthrax disease vaccine

Due Date : Jan 18, 2024
Tender Value : rupee 7 Crore
View Notice
44

Government Departments - Nashik - Maharashtra

41301419 Corrigendum : tender for project officer integrated tribal development project nashik under government ashram schools supply goat meat chicken sweets

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
45

Government Departments - Dhule - Maharashtra

41300995 Corrigendum : tender for project officer integrated tribal development project dhule under government ashram schools supply of goat meat chicken sweets

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
46

Government Departments - Ahmednagar - Maharashtra

41300927 Corrigendum : tender for project officer integrated tribal development project rajur under government ashram schools supply goat meat chicken sweets

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
47

Government Departments - yawal - Maharashtra

41300862 Corrigendum : tender for project officer integrated tribal development project yawal under government ashram schools supply goat meat chicken sweets

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
48

Government Departments - Nandurbar - Maharashtra

41299496 Corrigendum : tender for project officer integrated tribal development project taloda under government ashram schools supply goat meat chicken sweets

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
49

Government Departments - kalwan - Maharashtra

41299474 Corrigendum : tender for project officer integrated tribal development project kalwan under government ashram schools supply goat meat chiken sweets

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
50

Government Departments - mumbai - Maharashtra

41224180supply of non veg: mutton for mantralaya canteen, vidhan bhavan canteen mumbai and konkan bhavan canteen navi mumbai. 1 boneless mutton (breast/leg hoofless) / tendered goat mutton (breast/leg part without hoof) (bakra) 2 mutton chops (goat) / mutton chop (goat) 3 mutton khima (goat) / mutton khima (goat)

Due Date : Jan 1, 2024
Tender Value : rupee 1.84 Lakhs
View Notice
51

Boards / Undertakings / PSU - Mumbai - Maharashtra

41137813 tender for purchase of kits, plastic ware, glassware & chemicals for aquaculture division. 1 albumin (alb) colorimetric assay kit (b remocresol green method) e bc k057 s 100 assay 2 2 total protein (tp) colorimetric assay kit (biuret method) e bc k165 s 100 assay 2 3 glucose (glu) colorimetric assay kit (god pod method) e bc k234 s 100 assay 2 4 total cholesterol (tc) colorimetric assay kit (single reagent, cod pap method) e bc k109 s 100 assay 2 5 general cortisol, cor genlisatm elisa klu0009 ...

Due Date : Dec 19, 2023
Tender Value : Ref. Document
View Notice
52

Local Bodies - Pune - Maharashtra

41098868 purchase of spare parts for repairing works of toy train , spare part list 72 volt toy train , a ) mechanical part of engine , chassis of engine m.s.c channel 100 mm x 50 mm size of engine 3.6 inch ft breath x 9ft length , motor foundation with adjuster , cabin, boiler, 2 doors, buffer, silencer, battery cover, front main line box, tuff complete ms 18 gauge crc sheet body with square pipe structure , glass sliding windows , operator seat flat cushion , special moving assembly fr...

Due Date : Dec 20, 2023
Tender Value : Ref. Document
View Notice
53

Boards / Undertakings / PSU - pune - Maharashtra

41045836 procurement of recombinant antibodies , ab32572 recombinant anti beta catenin antibodies(e247) chip grade 100 ul , ab52649 recombinant anti gm130antibody(ep892y) cis golgi marker 100 ul , ab92547 recombinant anti vimentin antibody (epr3776) cytoskeleton marker 100 ul , ab61065 anti rpa32/rpa2(phospho t31) antibody . 100 ug , ab40772 recombinant anti e cadherin antibody (ep700y) intercellular junction marker 100 ul , ab150077 goat anti rabbit igg h&l (alexa fluor® 488) 500ug , ab205719 goat...

Due Date : Dec 26, 2023
Tender Value : rupee 3.66 Lakhs
View Notice
54

Boards / Undertakings / PSU - ratnagiri - Maharashtra

41017578 tender for price lists for carrying out the specified works in the goat rearing and poultry rearing set in the agricultural center, lanja area on contract basis daily cleaning of the set, taking the goats for grazing, fetching fodder/bush, feeding, helping with vaccination and medication as per instructions, plot preparation and fodder/bush planting, and incidental work., cleaning before bringing birds in the poultry house, spreading the chaff, washing the food bowls, feeding the birds, dail...

Due Date : Dec 21, 2023
Tender Value : Ref. Document
View Notice
55

Government Departments - pombhurna - Maharashtra

40950030tender for construction of goat farm on survey no. 219 at chakthanewadana, tah pombhurna

Due Date : Dec 13, 2023
Tender Value : rupee 12 Lakhs
View Notice
56

Government Departments - ratnagiri - Maharashtra

40823039arc for fresh provision, group ii , meat fresh (goat) , fowl dressed , fish surumai , fish pomfret , fish mackrael , fish gander , fish saundal , fish rohu , fish katla , eggs => limited

Due Date : Dec 18, 2023
Tender Value : Ref. Document
View Notice
57

Local Bodies - Nanded - Maharashtra

40774739auction sale of 1) animal registration fee. 2) goat / sheep certificate fees. 3) daily weekly market, tay market. 4) animal push fee. 5) billboard poster banner. 6) excluding daily weekly market

Due Date : Dec 8, 2023
Tender Value : Ref. Document
View Notice
58

Government Departments - Pune - Maharashtra

40730674 providing different type of material 1.01 i my body 1.02 my family, relatives 1.03 domestic animals cow, goat, dog, cat 1.04 wild animals tiger, lion, giraffe, elephant 1.05 monsoon 1.06 vegetation trees, shrubs, vines 1.07 festivals nag panchami, rakshabandhan 1.08 birds crow, sparrow, parrot, peacock 1.09 water 1.1 our festivals ganapati festival, size 1.11 flowers rose, lotus, jaswand, shevanti, aster 1.12 fruits – bananas, guavas, cilantro, papay...

Due Date : Nov 28, 2023
Tender Value : Ref. Document
View Notice
59

Government Departments - Mumbai - Maharashtra

40634512bids are invited for chemicals goat anti mouse igg h plus l secondary antibody unconjugated , goat anti mouse igg h plus l secondary antibody hrp , powertracka c sybr green master mix for qpcr , primers sirt3 forward ae cggctctacacgcagaacatc3ae sirt3 reverse 5ae cagaggctccccaaagaacac3ae , primers pgc 1 forward 5ae tcagtcctcactggtggaca3ae pgc 1 reverse 5ae tgcttcgtcgtcaaaaacag3ae total quantity : 5

Due Date : Nov 24, 2023
Tender Value : Ref. Document
View Notice
60

Government Departments - Aurangabad - Maharashtra

40500760auction sale of unproductive osmanabadi goats

Due Date : Nov 8, 2023
Tender Value : Ref. Document
View Notice
61

Local Bodies - Pune - Maharashtra

40488473 purchase of spare parts for repairing works of toy train , spare part list 72 volt toy train , a) mechanical part of engine , chassis of engine m.s.c channel 100 mm x 50 mm size of engine 3.6 inch ft breath x 9ft length , motor foundation with adjuster , cabin, boiler, 2 doors, buffer, silencer, battery cover, front main line box, tuff complete ms 18 gauge crc sheet body with square pipe structure , glass sliding windows , operator seat flat cushion , special moving assembly front side of engin...

Due Date : Nov 13, 2023
Tender Value : Ref. Document
View Notice
62

Government Departments - Mumbai Suburban - Maharashtra

40447205bids are invited for mouse ige elisa set 20* 96 wells (q3) , histamine elisa kit (q3) , goat anti rabbit igg (q3) , goat anti mouse ige secondary antibody (q3) , monoclonal anti dinitrophenyl antibody (q3) mse total quantity : 5

Due Date : Nov 22, 2023
Tender Value : Ref. Document
View Notice
63

Government Departments - pombhurna - Maharashtra

40347685tender for construction of goat farm on survey no. 219 at chakthanewadana, tah pombhurna

Due Date : Nov 1, 2023
Tender Value : rupee 12 Lakhs
View Notice
64

Government Departments - Sangli - Maharashtra

40161812bids are invited for deco paints working , table vinear paint , door vinear paint , goat patti , installation charges total quantity : 2011

Due Date : Oct 23, 2023
Tender Value : Ref. Document
View Notice
65

Government Departments - Mumbai - Maharashtra

40152660 Corrigendum : bids are invited for chemicals ppx17 pro cartaplex 17 plex 1plate 17 plex ppx17 human magnetic procartaplex 96 well serum plasma luminex , recombinant human ifn 2 , recombinant human gm csf , recombinant human il 22 , recombinant human il 17a , recombinant human ifn omega protein , peroxidase affinipure goat anti human serum iga , peroxidase affinipure goat anti human igg fc fragmnet specific , 1 step turbo tmb elisa , stop solution for tmb substrates total quantity : 13

Due Date : Nov 3, 2023
Tender Value : Ref. Document
View Notice
66

Government Departments - Mumbai - Maharashtra

40105018bids are invited for chemicals meril meriscreen hbsag test kit , purified goat f ab 2 anti human igg antibody invitrogen thermofischer cat no 31122 2mg , hiv mp diagnostics 2.2 western blot kit cat no 11037 036 , taqman mgb probe compatible master mix taqman universal master mix ii thermofischer scientific inc cat no 4440043 , qiaamp at dna blood mini kit 250 qiagen cat no 51106 , innolia lia hiv i by ii score 28672 kit cat no 80540 total quantity : 9

Due Date : Oct 21, 2023
Tender Value : Ref. Document
View Notice
67

Statutory Bodies & Commissions/Committees - Sindhudurg - Maharashtra

40099659tender for price list for purchase of fodder for goats for mahe november 2023. fodder for goats (essential 18 to 20% protein 3 fat)

Due Date : Oct 20, 2023
Tender Value : Ref. Document
View Notice
68

Government Departments - Maharashtra

39927638construction of milk processing building and goat sheds enrich farmer producer company limited

Due Date : Oct 9, 2023
Tender Value : rupee 1.40 Crore
View Notice
69

Statutory Bodies & Commissions/Committees - nashik - Maharashtra

39851976providing services of lunch, dinner, breakfast and tea at health and family welfare training center nashik tea / coffee / milk breakfast / breakfast for fasting lunch vegetarian full meal / fasting full meal dinner vegetarian full meal / fasting full meal total amount ( 1.01 to 1.04 ) special meals / non vegetarian meals chicken meal mutton meal ( goat ) fishche meals special vegetarian meals

Due Date : Oct 3, 2023
Tender Value : rupee 15 Lakhs
View Notice
70

Government Departments - Mumbai Suburban - Maharashtra

39827535 Corrigendum : request for proposals of outsourcing the maidc ‘sugras’ animal feed production in maharashtra & goa state., open market all maharashtra supply rates , h.p.pellet , spl. h. p. pellet , mahashakti pellet , goshakti pellet , sugras gold pellet , uttam pellets , sarvottam pellets , sugras pashudhan pellets , sugras goratna pellets , sheep/ goat feed pellets , mumbai spl. mash , calf starter pellet , calf grower pellet , high fibre pellet , mldb destination wise supply rates , breeding bull ration pe...

Due Date : Oct 25, 2023
Tender Value : Ref. Document
View Notice
71

Government Departments - Mumbai Suburban - Maharashtra

39753143bids are invited for goat anti mouse lgg secondary antibody for detection 800 nm (q3) , goat anti rabbit lgg secondary antibody for detection 700 nm (q3) mse total quantity : 4

Due Date : Oct 11, 2023
Tender Value : Ref. Document
View Notice
72

Boards / Undertakings / PSU - Ratnagiri - Maharashtra

39684351 tender for daily cleaning of barns, taking goats to graze, fetching fodder, feeding and watering, assisting with vaccination and medication as per instructions, plot preparation fodder planting and incidental work. cleaning before bringing the birds in the poultry house, spreading the feathers, washing the food and water bowls, feeding the birds, cleaning the birds daily, giving instruction and medication as per instructions, filling the putty bag after the sale of the birds and doing ancillar...

Due Date : Sep 26, 2023
Tender Value : Ref. Document
View Notice
73

Local Bodies - warora - Maharashtra

39680222disposal of died cows,horse, goat, sheep, buffalows at dumping yard under municipal council warora area (third call)

Due Date : Sep 22, 2023
Tender Value : Ref. Document
View Notice
74

Government Departments - amravati - Maharashtra

39573621 Corrigendum : e tender for supply of vegetable, dairy products, meat, eggs etc. ( perishable goods ) at divisional dy. commissioner women child development office amravati region 1 vegetable / fruits / dairy products / non vegetarian products 2 carrots ( non perishable vegetable ) 3 cauliflower 4 cabbage 5 carly 6 tondli 7 dhemse 8 chilli peppers 9 toads 10 mula 11 fenugreek seeds 12 chavalai bhaji 13 spinach vegetable 14 shepubhaji 15 gholbhaji 16 kandapat 17 kothibir 18 ratali ...

Due Date : Oct 9, 2023
Tender Value : rupee 27.75 Lakhs
View Notice
75

Boards / Undertakings / PSU - bhusawal - Maharashtra

39553612etender for supply of non veg items in jnv bhusawal , chicken without skin , eggs hen good quality , goat mutton , fish

Due Date : Sep 23, 2023
Tender Value : Ref. Document
View Notice
76

Boards / Undertakings / PSU - bhusawal - Maharashtra

39553499tender for supply of non veg items/chicken, goat meat, eggs, , vehicle hiring, annual maintenance contract computer and cctv cameras.

Due Date : Sep 23, 2023
Tender Value : Ref. Document
View Notice
77

Local Bodies - warora - Maharashtra

39499203disposal of died cows,horse, goat, sheep, buffalows at dumping yard under municipal council warora area (second call)

Due Date : Sep 11, 2023
Tender Value : Ref. Document
View Notice
78

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

39485507bids are invited for chicken broiler dressed chilled,meat dressed chilled goat,pork frozen,buffalo meat frozen,eggs fres total quantity : 66750

Due Date : Sep 7, 2023
Tender Value : Ref. Document
View Notice
79

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

39485500bids are invited for boq meat gp items chicken broiler dressed chilled , meat dressed chilled goat , pork frozen , buffalo meat frozen , egg fresh hen , fish fresh , fish basa sea , fish rohu sea , fish tuna sea total quantity : 70639

Due Date : Sep 7, 2023
Tender Value : Ref. Document
View Notice
80

Government Departments - Mumbai Suburban - Maharashtra

39448284 bids are invited for sirt1 1f3 mouse mab , tri methyl histone h3 lys27 rabbit monoclonal antibody , tri methyl histone h3 lys9 rabbit monoclonal antibody , acetyl histone h3 lys9 c5b11 rabbit monoclonal antibody , acetyl histone h3 lys27 d5e4 xpr rabbit monoclonal antibody , acetyl histone h3 lys18 d8z5h rabbit mab , phospho histone h2a x ser139 20e3 rabbit mab , sirt6 recombinant rabbit monoclonal antibody , sirt7 mouse monoclonal antibody , tri methyl histone h3 lys4 c42d8 rabbit mab , goat ...

Due Date : Sep 25, 2023
Tender Value : Ref. Document
View Notice
81

Local Bodies - Mumbai - Maharashtra

39425615tender for deojar slaughter house here for goats and consumer of the department (pandara colour) design and supply of pick color identification jets as per sample.

Due Date : Sep 6, 2023
Tender Value : Ref. Document
View Notice
82

Government Departments - Mumbai Suburban - Maharashtra

39394010 bids are invited for genelute mse genelute plasmid miniprep kit merck pln70 1kt , genelute pcr clean up kit merck na1020 , genelute gel extraction kit merck , immobilon western chemiluminescent hrp substrate merck wbkls0100 , nbt bcip stock solution merck 11681451001 , western blocker solution merck w0138 , bicinchoninic acid kit for protein determination merck bca1 1kt , genelute mammalian genomic dna miniprep kits merck g1n70 , anti cd63 antibody produced in rabbit merck sab5700799 100ul , an...

Due Date : Sep 19, 2023
Tender Value : Ref. Document
View Notice
83

Government Departments - Mumbai Suburban - Maharashtra

39197890bids are invited for supply of goat anti mouse igg secondary antibody as per tech spec & quantity given in attachment (q3) mse total quantity : 4

Due Date : Sep 7, 2023
Tender Value : Ref. Document
View Notice
84

Local Bodies - yavatmal - Maharashtra

39152195weekly market and goat market revenue collection at nagar panchayat babhulgaon for further details refer nia of this tender,

Due Date : Aug 23, 2023
Tender Value : Ref. Document
View Notice
85

Private Organizations - Maharashtra

39102555 request for proposal nav tejasiwni maharashtra rural women’s enterprise development project: procurement of vehicles (for office use), office furniture, office goods (computer laptops, printers, air conditioners, audiovisual set), virtual lab set up, printed training material, farm products (seeds, equipment), livestock (goats, cows, poultry, fisheries etc.), food processing equipment, equipment for enterprise development (milk coolers, oil seed processor, etc), nutritional products (millet...

Due Date : Sep 7, 2023
Tender Value : Ref. Document
View Notice
86

Government Departments - Mumbai Suburban - Maharashtra

39094555bids are invited for fap monoclonal antibody (f 11 24) ; bms168 100 microgram (q3) , fap recombinant rabbit monoclonal antibody (ja56 11) ; ma5 32670; 100 microlitre (q3) , goat anti rabbit igg (h+ l) crossed adsorbed secondary antibody, pe labeled, p2771mp; 500 microlitre (q3) , goat anti human igg fc secondary antibody, pe labeled, clone no. 12 4998 82; 100 microgram (q3) , goat anti human igg fc cross adsorbed secondary antibody, hrp, clone no. 31413; 1 millilitre (q3) total quantity : 15

Due Date : Sep 1, 2023
Tender Value : Ref. Document
View Notice
87

Government Departments - mumbai - Maharashtra

39077603tender for procurement of vehicles (for office use), office furniture, office goods (computer laptops, printers, air conditioners, audiovisual set), virtual lab set up, printed training material, farm products (seeds, equipment), livestock (goats, cows, poultry, fisheries etc.), food processing equipment, equipment for enterprise development (milk coolers, oil seed processor, etc), nutritional products (millets etc.,),

Due Date : Aug 25, 2023
Tender Value : Ref. Document
View Notice
88

Government Departments - Mumbai - Maharashtra

38974388bids are invited for consumables goat anti human igg hrp , goat anti human iga hrp , goat anti human igm hrp , goat anti human igg1 fc hrp , goat anti human igg2 fc hrp , goat anti human igg3 hinge hrp , goat anti human igg4 fc hrp , startem , cups and pins pack size p upon pac , triniclot aptt reagent total quantity : 27

Due Date : Aug 16, 2023
Tender Value : Ref. Document
View Notice
89

Government Departments - Mumbai - Maharashtra

38974193 bids are invited for thermofisher consumables 1 human hcg beta elisa 2 trizol reagent 200ml 3 dnase i, amplification grade, 100 units invitrogen 4 superscript iv first strand synthesis system 100 reaction 5 etbr 10 mg / ml 6 loading dye 6x ( 5x1.0ml ) 7 25bp dna ladder 50ug 8 immuno clear standard modules f16 polysorp 2x8 wells flat bottom 9 af488 goat anti mouse igg 0.5ml 10 af488 goat anti rabbit igg 0.5ml 11 af568 rabbit anti goat 0.5ml 12 af568 goat...

Due Date : Aug 14, 2023
Tender Value : rupee 23.01 Lakhs
View Notice
90

Government Departments - Satara - Maharashtra

38948358 tender for special repairs to lnspection vehicle no. mh 42 a 6582 (bolero)for year 2023 24. 1 left side front door 1 no. 2 wheel arch front and rear 2 nos. 3 left side door glass 1 no. 4 door hinges 2 nos. 5 tail lamp assembly 1 no. 6 front bumper assembly 1 no. 7 foot rest 1 no. 8 ball joint kit 4 nos. 9 lower arm bushing kit 2 nos. 10 suspension bush kit 1 no. 11 steering rack and set 1 set. 12 steering ball joint set 1 set. 13 door moulding 1 set 14 left side mirror 1 no. 15 windshield glas...

Due Date : Aug 10, 2023
Tender Value : Ref. Document
View Notice
91

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

38901080bids are invited for boq meat gp items chicken broiler dressed chilled , meat dressed chilled goat , pork frozen , buffalo meat frozen , egg fresh hen , fish fresh , fish basa sea , fish rohu sea , fish tuna sea total quantity : 70639

Due Date : Aug 17, 2023
Tender Value : Ref. Document
View Notice
92

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

38898535bids are invited for non veg items chicken broiler dressed chilled , meat dressed chilled goat , pork frozen , buffalo meat frozen , eggs fresh hen , fish fresh total quantity : 66750

Due Date : Aug 12, 2023
Tender Value : Ref. Document
View Notice
93

Boards / Undertakings / PSU - palghar - Maharashtra

38663596tender for supply of non veg items egg ( chicken ) chicken broiler cleaned hua ( undressed ) chicken broiler without skin mutton goat bokud mutton ( goat male ) surmai fish surmai fish prans prawns paplet poplet chicken gavarani

Due Date : Aug 9, 2023
Tender Value : rupee 1 Lakhs
View Notice
94

Government Departments - Mumbai - Maharashtra

38631111bids are invited for chemicals goat anti human igg hrp total quantity : 2

Due Date : Jul 25, 2023
Tender Value : Ref. Document
View Notice
95

Local Bodies - Nashik - Maharashtra

38428604bids are invited for kirana ( q3 ) groceries 2. beat buffalo milk 0% 3. vegetables and bananas 4. cooking 5. providing goat meat. 6. grinding of grains. 7. cooking gas 8. sanitation and cleaning 9. power supply 10. incidental expenses saadil

Due Date : Jul 10, 2023
Tender Value : Ref. Document
View Notice
96

Local Bodies - Nashik - Maharashtra

38428585bids are invited for bokadache matan ( q3 ) . groceries 2. banana milk 6% fat 3. vegetables and bananas 4. cooking 5. providing goat meat. 6. grinding of grains. 7. cooking gas 8. sanitation and cleaning 9. electricity supply 10. incidental expenses saadil

Due Date : Jul 10, 2023
Tender Value : rupee 5 Lakhs
View Notice
97

Statutory Bodies & Commissions/Committees - satara - Maharashtra

38414096tender for supply of mutton of goats.

Due Date : Jul 15, 2023
Tender Value : rupee 10 Lakhs
View Notice
98

Statutory Bodies & Commissions/Committees - Satara - Maharashtra

38414075tender for supply of mutton of goats

Due Date : Jul 15, 2023
Tender Value : rupee 10 Lakhs
View Notice
99

Government Departments - etapalli - Maharashtra

38399072supply of vegetables to kgbv etapalli taluka etapalli district gadchiroli onions garlic tomato chili potato eggplant cabbage cauliflower the mouth okra demsa carly fanas dodke kohla lovey parents fenugreek vegetable cows milk grassy pods vala pods guar pods capsicum radish carrot beat cucumber ginger sambar ( coriander ) apple banana oranges chick mutton ( goat ) chicken ( parrot ) chicken broiler egg

Due Date : Jul 5, 2023
Tender Value : Ref. Document
View Notice
100

Government Departments - aurangabad - Maharashtra

38398913punyashlok ahilyadevi maharashtra sheep and goat development corporations farm development, construction and other agricultural works for padegaon, aurangabad taluka, aurangabad district

Due Date : Jul 10, 2023
Tender Value : rupee 2.39 Crore
View Notice

Tenders By City

Tenders By Authority

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail