AIIMS Tenders - View latest All India Institute Of Medical Sciences eTenders

AIIMS Tenders - Get latest update on All India Institute Of Medical Sciences Tenders. Search AIIMS civil Tenders, Construction Tenders, Supply Tenders, Services Tenders published on All India Institute Of Medical Sciences e-tendering portal & e-Procurement website are available on AIIMS tender page. Many live business opportunities are available in AIIMS Tenders section. All India Institute Of Medical Sciences Tenders are further filtered by Bid Submission Date, Tender Value, Project Location & Product Category. Get daily alert on AIIMS Tenders.

1

Government Departments - delhi - Delhi

39846965 price schedule for domestic goods, goods of foreign origin located withhin india, goods to be imported from aboard, comprehensive annual maintenance contract ( camc ) after warranty period ; chemiluminescence & gel imaging & analysis system

Due Date : Oct 25, 2023
Tender Value : Ref. Document
View Notice
2

Government Departments - raebareli - Uttar Pradesh

39845660 rate contract for supply of plactic disposables for hospital , supply of plastic disposables for hospital , abdominal drain kit including drain tube and drainage bag size 32 , abdominal sponge with x-ray detectable thread woven into sponge. , ambu bag adult1.5 ltrs , ambu bag pediatrics0.5 ltr , anatomical face mask, 5 , anatomical face mask, 4 , ankle brace ( medium ) , arterial cannulasizes-20 g , arterial cannulasizes-22 g , baby drape for surgical incision a ) translucent so...

Due Date : Oct 19, 2023
Tender Value : rupee 4 Crore
View Notice
3

Government Departments - Hyderabad - Telangana

39841513 tender for requirement of surgical items for ent ot 1 micro ear instruments tray with silicon matt 2 uv sterilizable 24 inch farmalin chamber with 2 trays

Due Date : Oct 11, 2023
Tender Value : Ref. Document
View Notice
4

Government Departments - Hyderabad - Telangana

39841477 tender for “requirement of refilling for d-type & b type medical oxygen cylinders ( 5 to 6 months 1 d-type medical oxygen cylinder refilling (7 cumm) 2 b-type medical oxygen cylinder refilling (1.5 cumm) 3 transport charges for b & d type cylinder (up and down)

Due Date : Oct 11, 2023
Tender Value : Ref. Document
View Notice
5

Government Departments - Jodhpur - Rajasthan

39838731 corrigendum for tender for hearing lab equipment for the department of neonatology

Due Date : Oct 9, 2023
Tender Value : Ref. Document
View Notice
6

Government Departments - New Delhi - Delhi

39836863 tender for a/r and m/o to new clinical blocks sh: operation and maintenance of ro plant at terrace of new rak opd and surgery block at masjid moth, aiims, new delhi.

Due Date : Oct 4, 2023
Tender Value : rupee 11.83 Lakhs
View Notice
7

Government Departments - delhi - Delhi

39832736 purchase of western blot apparatus with compatible power pack/vertical electrophoresis system as per tender enquiry documents , western blot apparatus with compatible power pack (vertical electrophoresis system)

Due Date : Oct 30, 2023
Tender Value : Ref. Document
View Notice
8

Government Departments - rishikesh - Uttarakhand

39832495 tender for re tender for rate contract for procurement of ct injector syringe ( 190 ml. qft ) ct injector connecting tubing for department of radiodiagnosis.

Due Date : Oct 17, 2023
Tender Value : Ref. Document
View Notice
9

Government Departments - bhubaneswar - Odisha

39832240 provision of aluminium partition in ent opd, rbsk counter, mrd shredder machine room, fire control room, electrical maintenance office and chiller plant area of hospital complex, aiims, bhubaneswar

Due Date : Oct 16, 2023
Tender Value : rupee 15.20 Lakhs
View Notice
10

Government Departments - bhopal - Madhya Pradesh

39831303 tender for supply of consumable items for the vaccum pumps

Due Date : Oct 9, 2023
Tender Value : rupee 1.33 Lakhs
View Notice
11

Government Departments - Raipur - Chhattisgarh

39820208 tender for hindi & english general books for central library at aiims, raipur. 2 the alchemist paulo coelho harper 1 3 why has nobody told me this before dr. julie smith michael joreph 1 4 who will cry when you die robin sharma jaico publishing house 1 5 how to talk to anyone steve robinson blurb 1 6 how will you measure your life clayton christensen thorsons 1 7 the almanack of naval ravikant eric jorgenson harper 1 8 think and grow rich napoleon hill rupa publications india 1 9 atomic habits ...

Due Date : Oct 3, 2023
Tender Value : Ref. Document
View Notice
12

Government Departments - Raipur - Chhattisgarh

39819995 tender for purchase of reagent kits for the project work 1.t2622g-fp, dna oligo, forward primer dna oligonucleotide sequence: ctcaaggtaagagctgtg pack size-1umole, 2.t2622g-rp, dna oligo, reverse primer dna oligonucleotide sequence: ctcactacgagaaggatcctg aacctc, pack size-1umole, 3. syber green pcr kit (100), master mix, pack size-100 reactions

Due Date : Sep 28, 2023
Tender Value : Ref. Document
View Notice
13

Government Departments - Jodhpur - Rajasthan

39819926 tender for nasogastric securement device (large) at all india institute of medical sciences, jodhpur nasogastric securement device (large)  designed to deliver reliable securement to help keep nasogastric tubes in place with an easy-to-use.  solution, non-adhesive section at the base of the nose, transparent for visibility and fiber mesh backing a) size-2.25 in x.2.88 in. (5.7cm x 7.3cm)

Due Date : Sep 29, 2023
Tender Value : Ref. Document
View Notice
14

Government Departments - Jodhpur - Rajasthan

39819917 tender for ioban with pouch at all india institute of medical sciences, jodhpur ioban with pouch antimicrobial incise drape with pouch with, incise area: 11”x11” (30cm x30cm), 360-degree, plastic fluid-collection pouch is ideal for caesarean-section procedures. also available as a full body drape with pouch. tube and cord organizers, usfda approved. designed with continuous broad-spectrum antimicrobial activity in the drape adhesive where it can’t be washed away.

Due Date : Sep 29, 2023
Tender Value : Ref. Document
View Notice
15

Government Departments - Jodhpur - Rajasthan

39819910 tender for nasogastric securement device (small) at all india institute of medical sciences, jodhpur nasogastric securement device (small)  designed to deliver reliable securement to help keep nasogastric tubes in place with an easy-to-use.  solution, non-adhesive section at the base of the nose, transparent for visibility and fiber mesh backing a) size-1.75 in x.1.88 in. (4.5cmx4.7cm) 1600

Due Date : Sep 29, 2023
Tender Value : Ref. Document
View Notice
16

Government Departments - Jodhpur - Rajasthan

39812876 tender for supply of ioban. (medium), (large).

Due Date : Sep 29, 2023
Tender Value : Ref. Document
View Notice
17

Government Departments - New Delhi - Delhi

39812700 tender for a/r and m/o hostel 1 to 19 and allied areas sh- replacement of cp bib cock into two way bib cock for making provision of health faucet in hostel no. 13 at aiims.

Due Date : Oct 3, 2023
Tender Value : rupee 27816.0
View Notice
18

Government Departments - New Delhi - Delhi

39812677 tender for a/r and m/o to 50 no flat agv complex sh ripair of servent qtrs of 437 and other areas of hawa singh block at aiims,new delhi.

Due Date : Sep 30, 2023
Tender Value : rupee 1.62 Lakhs
View Notice
19

Government Departments - New Delhi - Delhi

39812660 tender for a/r and m/o hostel 1 to 19 and allied areas sh- disposal of malba from hostel no. 9 10 12 and 13 at aiims.

Due Date : Oct 3, 2023
Tender Value : rupee 1.18 Lakhs
View Notice
20

Government Departments - rishikesh - Uttarakhand

39809223 tender for procurement of weighing scale machine for the department of neonatology aiims rishikesh

Due Date : Oct 14, 2023
Tender Value : Ref. Document
View Notice
21

Government Departments - raipur - Chhattisgarh

39808725 tender for procurement of video bronchoscope system for department of paediatrics at aiims raipur

Due Date : Oct 14, 2023
Tender Value : Ref. Document
View Notice
22

Government Departments - delhi - Delhi

39808492 purchase of micro needling radio frequency equipment/ machine as per tender enquiry documents , micro needling radio frequency equipment/ machine

Due Date : Oct 30, 2023
Tender Value : Ref. Document
View Notice
23

Government Departments - patna - Bihar

39807922 construction of artificial reproductive techniques ( art ) facility over roof of laundary building ( bank of india ) at aiims patna

Due Date : Oct 12, 2023
Tender Value : rupee 3.91 Crore
View Notice
24

Government Departments - Delhi - Delhi

39807918 price schedule for domestic goods, goods of foreign origin located withhin india, goods to be imported from aboard, turnkey ( civil / electrical / air-conditioning work ) work, comprehensive annual maintenance contract ( camc ) after warranty period

Due Date : Oct 27, 2023
Tender Value : rupee 1.80 Crore
View Notice
25

Government Departments - Delhi - Delhi

39807814 price schedule for domestic goods, goods of foreign origin located withhin india, goods to be imported from aboard, turnkey ( civil / electrical / air-conditioning work ) work, comprehensive annual maintenance contract ( camc ) after warranty period; ultrasonic aspirator ( cusa ) for liver and bone tumors

Due Date : Oct 27, 2023
Tender Value : rupee 80 Lakhs
View Notice
26

Government Departments - mangalagiri - Andhra Pradesh

39806786 rate contract for refilling of medical gas cylinder , medical gas cylinders , oxygen ( o2 ) a, b & d type to be quoted per cubic meter , nitrous oxide ( n2o ) a & d type to be quoted per kg , carbon dioxide ( co2 ) d type to be quoted per kg

Due Date : Oct 13, 2023
Tender Value : rupee 30 Lakhs
View Notice
27

Government Departments - Rajkot - Gujarat

39805914 tender for answer book & envelopes answerbook (24 pages) answerbook (08 pages) a2 size envelopes (18x14)

Due Date : Sep 29, 2023
Tender Value : Ref. Document
View Notice
28

Government Departments - Multi State

39794985 tender for supply / repair to surgery block sh renovation of room no.812 surgical block for frozen section facility at aiims

Due Date : Oct 3, 2023
Tender Value : rupee 5.07 Lakhs
View Notice
29

Government Departments - New Delhi - Delhi

39794980 tender for a/r and m/o to surgery block at masjid moth sh providing and fixing damaged false ceiling at ots at surgery block aiims new delhi.

Due Date : Oct 3, 2023
Tender Value : rupee 5.61 Lakhs
View Notice
30

Government Departments - New Delhi - Delhi

39794937 tender for a/r and m/o to cder sh replacement of damaged pvc pipe and repair work at foyer area and fixing of gi metal false ceiling and pvc flooring at cder at aiims.

Due Date : Oct 3, 2023
Tender Value : rupee 5.90 Lakhs
View Notice
31

Government Departments - New Delhi - Delhi

39794896 tender for a/r and m/o to p.c and teaching block. sh: repl. of various damaged furniture blind false ceiling etc at various locations at aiims.

Due Date : Oct 4, 2023
Tender Value : rupee 10.26 Lakhs
View Notice
32

Government Departments - New Delhi - Delhi

39794840 tender for a/r and m/o to garden area sh site preparation for plantation drive at shiva road from gate no.6b to 7 at aiims.

Due Date : Sep 26, 2023
Tender Value : rupee 4.28 Lakhs
View Notice
33

Government Departments - New Delhi - Delhi

39794775 tender for a/r and m/o to garden area sh supplying of various flowerly items gifted potted plants bouquet for offices vip movements and institute events at aiims.

Due Date : Oct 3, 2023
Tender Value : rupee 3.33 Lakhs
View Notice
34

Government Departments - New Delhi - Delhi

39794722 tender for a/r and m/o to resdl campus at a.v. nagar south sh supply of bush cutter at a.v nagar civil enquiry at aiims,new delhi.

Due Date : Sep 30, 2023
Tender Value : rupee 37803.0
View Notice
35

Government Departments - New Delhi - Delhi

39794683 tender for a/r and m/o to resdl campus at a.v nagar sh internal finishing of old a and b, new a and b e type qtrs and new type iii qtrs at aiims.

Due Date : Sep 30, 2023
Tender Value : rupee 5.71 Lakhs
View Notice
36

Government Departments - Jodhpur - Rajasthan

39792827 tender for supply of medicines, cap. flucloxacillin 500 mg inj. flucloxacillin 500 mg inj. flucloxacillin 1 gm.

Due Date : Sep 26, 2023
Tender Value : Ref. Document
View Notice
37

Government Departments - Jodhpur - Rajasthan

39792758 tender for supply of compostable solid waste management bags (color - green).

Due Date : Sep 26, 2023
Tender Value : Ref. Document
View Notice
38

Government Departments - Jodhpur - Rajasthan

39792686 tender for supply of medicines. inj. sugammdax 100mg/ml inj. cefazolin mdi levosalbutamol 50mcg +ipratropium 20 mcg.

Due Date : Sep 26, 2023
Tender Value : Ref. Document
View Notice
39

Government Departments - Jodhpur - Rajasthan

39792496 tender for supply of surgical instruments at all india institute of medical sciences, jodhpur.

Due Date : Sep 27, 2023
Tender Value : Ref. Document
View Notice
40

Government Departments - Jodhpur - Rajasthan

39792290 tender for supply of compostable solid waste management bags (color - blue) at all india institute of medical sciences, jodhpur compostable solid waste management bags color green signage’s on bags compostable material, reduce, reuse, recycle logo, iso certificate & hospital name material 1. solid waste collection bags should be made up of compostable material of thickness of 50 micron and nonchlorinated. 2. bags shall be printed as per the requirement of the biomedical waste management comm...

Due Date : Sep 26, 2023
Tender Value : Ref. Document
View Notice
41

Government Departments - raebareli - Uttar Pradesh

39785588 supply of operating microscope for opthalmology department , operating microscope

Due Date : Oct 12, 2023
Tender Value : rupee 1.10 Crore
View Notice
42

Government Departments - rishikesh - Uttarakhand

39785569 tender for call for objection against repair of leica microsystems on properitary article basis.

Due Date : Oct 13, 2023
Tender Value : Ref. Document
View Notice
43

Government Departments - raebareli - Uttar Pradesh

39785471 supply of fluroscent microscope with fish and ihc analysis , fluroscent microscope with fish & ihc analysis workstation & hybridization chamber

Due Date : Oct 12, 2023
Tender Value : rupee 55 Lakhs
View Notice
44

Government Departments - bhubaneswar - Odisha

39785223 construction of shed for ambulance parking near animal house inside hospital complex, aiims, bhubaneswar.

Due Date : Oct 12, 2023
Tender Value : rupee 8.43 Lakhs
View Notice
45

Government Departments - Rajkot - Gujarat

39784220 tender for purchase of the qx200 droplet digital pcr system (dd-pcr) - 01 for the department of biochemistry on proprietary basis at aiims rajkot

Due Date : Oct 7, 2023
Tender Value : Ref. Document
View Notice
46

Government Departments - Rajkot - Gujarat

39784165 tender for purchase of immunoassay microplate - fully automated enzyme linked immunoassay absorbant system (evolis system - biorad) 01 for the department of biochemistry on proprietary basis at aiims rajkot

Due Date : Oct 7, 2023
Tender Value : Ref. Document
View Notice
47

Government Departments - Rajkot - Gujarat

39784094 tender for genexpert iv-2-l-10c on proprietary basis - invitation of comments/objections w.r.t. proprietary nature of the equipment if any, thereof.

Due Date : Oct 7, 2023
Tender Value : rupee 16.07 Lakhs
View Notice
48

Government Departments - Rajkot - Gujarat

39784011 tender for automated anaerobic jar system (anoxomat) on proprietary basis - invitation of comments/objections w.r.t. proprietary nature of the equipment if any, thereof.

Due Date : Oct 7, 2023
Tender Value : rupee 13.57 Lakhs
View Notice
49

Government Departments - Raebareli - Uttar Pradesh

39781229 tender for purchase of fluroscent microscope with fish & ihc analysis workstation & hybridization chamber (metaphase finder system with fluorescence)

Due Date : Oct 7, 2023
Tender Value : rupee 55 Lakhs
View Notice
50

Government Departments - Raebareli - Uttar Pradesh

39781208 tender for purchase of operating microscope for ophthalmology department

Due Date : Oct 7, 2023
Tender Value : rupee 1.10 Crore
View Notice
    Top
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2023 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail