gem tender

Gem Portal – Find Government eMarketplace Portal tenders on this page. All tender notices published on gem tender portal are available herewith. You can search gem tender by your product category and services. Contact our customer support team for GeM Registration. Give us call to register your company with GeM Portal.The Government e-Marketplace (GeM) is a government-e-commerce portal. It is a one-stop to enable easy and smooth online procurement of the Consumer Goods & Services that are needed by various Government Departments, Organizations, Military and PSUs in India.Get Daily Gem Tenders brief information from this page.

1

Local Bodies - Coimbatore - Tamil Nadu

34998002 bids are invited for desktop computers ( q2 ) total quantity : 1

Due Date : Nov 28, 2022
Tender Value : Ref. Document
2

Statutory Bodies & Commissions/Committees - DEHRADUN - Uttarakhand

34997997 bids are invited for correction signal as per drawing no. ( code ) 13686569000 ( q3 ) , normalize unit ( pcb ) as per drawing no. ( code ) 1368655400 ( q3 ) , pcb assy for stabilizer ( t-90 ) as per drawing no. ( code ) 1368657700 ( lf-7441123596 ) ( q3 )

Due Date : Dec 16, 2022
Tender Value : Ref. Document
3

Statutory Bodies & Commissions/Committees - South Goa - Goa

34997988 bids are invited for sofa set 5 seater as per specification as per specification , supply and fixing good quality fabric polyester vertical binds with slat width 114mm and slat thickness 2mm window cover , decorative coir mat 85 cm x 50 cm , supply and install work station cubical made out of powder coated aluminium section minimum thickness of powder coating 50 micron approx surface area of 25 sqm as per specification , supply and install work station cubical made out of powder co...

Due Date : Dec 14, 2022
Tender Value : Ref. Document
4

Statutory Bodies & Commissions/Committees - Bathinda - Punjab

34997979 bids are invited for mt spare total quantity : 420

Due Date : Dec 7, 2022
Tender Value : Ref. Document
5

Government Departments - Dewas - Madhya Pradesh

34997975 bids are invited for hopper tipper dumper (q3) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
6

Government Departments - Dewas - Madhya Pradesh

34997971 bids are invited for tricycle , dustbin , wheel barrow , safety tool kit , incinerator total quantity : 18

Due Date : Dec 5, 2022
Tender Value : Ref. Document
7

Statutory Bodies & Commissions/Committees - BANGALORE - Karnataka

34997966 bids are invited for door curtains total quantity : 24

Due Date : Nov 28, 2022
Tender Value : Ref. Document
8

Government Departments - Jamnagar - Gujarat

34997956 bids are invited for 4mp full hd wdr ir vandal dome camera , 16 channel network video recorder , cat 6, 4 pair utp cable for cctv camera system , 22 fhd monitor screen , surveillance hdd for nvr , poe switch , installation and commissioning of cctv camera system

Due Date : Dec 7, 2022
Tender Value : Ref. Document
9

Government Departments - Kamrup Metro - Assam

34997924 bids are invited for anaphylaxis kit for anm , aefi kit for mos , bleaching power 250g pkt , absorbent cotton roll 25 gm net , hydrocortisone injection 10 ml vial with diluent total quantity : 40000

Due Date : Dec 5, 2022
Tender Value : Ref. Document
10

Government Departments - Mathura - Uttar Pradesh

34997901 bids are invited for almirah steel ( version 2 ) ( q3 ) , executive table ( q3 ) total quantity : 206

Due Date : Dec 5, 2022
Tender Value : rupee 23.69 Lakhs
11

Government Departments - Ghaziabad - Uttar Pradesh

34997896 bids are invited for led bulb , holder , 1.5 sqmm wire , electric insulation tape , bucket , mug , tooth brush , tooth paste , bath soap , paper glass , dustbin 20 ltr with polythene , paint , terrakota , white markin , bamboo 15 feet , nariyal rassi , iron sabbal , genuine microsoft windows for computer , epson l6270 cmyb ink set , epson l6270 black ink total quantity : 11505

Due Date : Dec 6, 2022
Tender Value : Ref. Document
12

Statutory Bodies & Commissions/Committees - BANGALORE - Karnataka

34997886 bids are invited for sipper bottle total quantity : 5

Due Date : Nov 28, 2022
Tender Value : Ref. Document
13

Statutory Bodies & Commissions/Committees - Betul - Madhya Pradesh

34997868 bids are invited for equipments suction machine , bp instruments , weight machine total quantity : 35

Due Date : Dec 5, 2022
Tender Value : rupee 5 Lakhs
14

Local Bodies - Jhansi - Uttar Pradesh

34997850 bids are invited for providing electrical connection for sutimeel electric cremetorium under nagar nigam jhansi total quantity : 1

Due Date : Dec 5, 2022
Tender Value : rupee 12.83 Lakhs
15

Statutory Bodies & Commissions/Committees - Bathinda - Punjab

34997835 bids are invited for mt spares total quantity : 709

Due Date : Dec 7, 2022
Tender Value : Ref. Document
16

Government Departments - Hazaribagh - Jharkhand

34997830 bids are invited for shorts and jersey for football players - specification attached with boq , stud shoes for football players - specification attached with boq , socksfor football players - specification attached with boq , shin guards for football players - specification attached with boq , goalkeeper gloves - specification attached with boq total quantity : 18480

Due Date : Dec 6, 2022
Tender Value : rupee 77.95 Lakhs
17

Boards / Undertakings / PSU - Noida - Uttar Pradesh

34997816 bids are invited for grpa api 6d ball valve 36in 600 series ww ug mov as per specs , grpa supervision charges as per specs , grpb api 6d ball valve 36in 600 series ww ug mov as per specs , grpb supervision charges as per specs , grpc api 6d ball valve 36in 600 series ww ug mov as per specs , grpc supervision charges as per specs , grpd api 6d ball valve 36in 600 series ff ag mov as per specs , grpd supervision charges as per specs

Due Date : Nov 29, 2022
Tender Value : Ref. Document
18

Local Bodies - Imphal West - Manipur

34997797 bids are invited for vacuum loader with silt containers ( q3 ) total quantity : 1

Due Date : Dec 16, 2022
Tender Value : Ref. Document
19

Statutory Bodies & Commissions/Committees - bathinda - Punjab

34997795 bids are invited for mt spares - - ( a ) lv7 / tata 264154440135 assy side ind lamp 24v lh ( b ) lv7 / tata 3110-107083 bearing roller taper ( c ) lv7 / tata 2520-012550 propeller shaft ( d ) lv7 / tmb 2651-1540-9916 regulator ( e ) lv7 / tmb 2078-2910-0120 assy clutch master cylinder ( f ) lv7 / tmb 340-332-1306 king pin lower ( g ) lv7 / tmb 1460-362-457 pressure control valve ( h ) lv7 / tmb 2786-0399-9935 seal oil ( j ) lv7 / tmb 2576-7250-0124 assy window...

Due Date : Dec 7, 2022
Tender Value : Ref. Document
20

Statutory Bodies & Commissions/Committees - 24 Paraganas North - West Bengal

34997792 bids are invited for 3.60 ghz processor , raid card , 32 gb mem ddr4 udimm exx 128 gb , 1 tb hardisk , power supply 650 watt 80 plus gold , 4 x1 gbps lan card , servicing of equipment

Due Date : Nov 28, 2022
Tender Value : Ref. Document
21

Government Departments - JANJGIR-champa - Chhattisgarh

34997783 bids are invited for recovery vehicle ( q3 ) total quantity : 1

Due Date : Dec 26, 2022
Tender Value : Ref. Document
22

Government Departments - Durgapur - West Bengal

34997781 bids are invited for television tv ( q2 ) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
23

Private Organizations - Mirzapur - Uttar Pradesh

34997770 bids are invited for mr kit -supply and fittment of artificial aids / limbs for divyangjan details of equipment - kit for mental retarded ( daily living / educational / vo cational ( q3 ) total quantity : 50

Due Date : Dec 13, 2022
Tender Value : rupee 5 Lakhs
24

Government Departments - Dewas - Madhya Pradesh

34997769 bids are invited for tricycle , dustbin , wheel barrow , safety tool kit total quantity : 7

Due Date : Dec 5, 2022
Tender Value : Ref. Document
25

Statutory Bodies & Commissions/Committees - BANGALORE - Karnataka

34997761 bids are invited for 24 core or higher processor workstation along with 72 to 81 cm display and 05 year warranty total quantity : 4

Due Date : Nov 29, 2022
Tender Value : Ref. Document
26

Government Departments - Jammu - Jammu And Kashmir

34997757 bids are invited for combination switch , self brush gear lucas total quantity : 2

Due Date : Dec 5, 2022
Tender Value : Ref. Document
27

Government Departments - Ratnagiri - Maharashtra

34997755 bids are invited for house keeping material phenyl , acid , harpic , brooms , full brooms , mob with rods , get rid of ants powder , bleaching powder , handwash dettol , odonil , naphthalene balls damber golya , vaypaar , napkeen white , steel brush kathya , water cooler , wheel garbage , wheel dustbeen , three seater chair , fan , plastic jar , table , office table , revolving chair , office chair total quantity : 606

Due Date : Dec 6, 2022
Tender Value : Ref. Document
28

Statutory Bodies & Commissions/Committees - Ri Bhoi - Meghalaya

34997716 bids are invited for piston , piston ring set , head gasket , fuel feed pump , fuel injection pump , alternator , avr , connection rod , packing kit , oil pump assy , injector , valve set , mounting pad total quantity : 17

Due Date : Nov 28, 2022
Tender Value : rupee 5 Lakhs
29

Government Departments - RUPNAGAR - Punjab

34997714 bids are invited for storage drums 20l , cooker 12l , cooker 30l , patila 20l , patila 80l , kadhai 30l aluminium , kadhai 100l iron , tawa small , tawa big , wall mounted rack for laddles , tea coffee dispenser , sauce pan small , sauce pan big , casseroles , steel plates , glasses , spoons , forks , katoris , ladle kadhchi , spatulas , jugs , knives , peeler , grater , strainer small , strainer big , steel aata paraat , big steel bowl , tongs , spice box ,...

Due Date : Dec 16, 2022
Tender Value : Ref. Document
30

Statutory Bodies & Commissions/Committees - South Goa - Goa

34997695 bids are invited for procurement of t and p and miscellaneous items supply and fixing cat 6 ethernet cable for internet connection in and including pvc casing 25mm fixed on wall with screw complete as per specification , supply and fixing rj 45 wall mount cat 6 and dual socket lan input output network keystone jack gang box dual port face plate complete as per specification , tp link 16 port splitter gigabit desktop and rackmount switch tl sg1016d as per specification , rj 45 connector as per s...

Due Date : Dec 5, 2022
Tender Value : Ref. Document
31

Statutory Bodies & Commissions/Committees - South Andamans - Andaman And Nicobar Islands

34997554 bids are invited for restaurant table (q3) , restaurant chair (q3) , computer table (q3) total quantity : 58

Due Date : Dec 10, 2022
Tender Value : rupee 1.47 Lakhs
32

Government Departments - Unakoti - Tripura

34997515 bids are invited for 3 seater school bench with shelf ( q3 ) total quantity : 300

Due Date : Dec 16, 2022
Tender Value : Ref. Document
33

Local Bodies - Ahmednagar - Maharashtra

34997512 bids are invited for hp all in one desktop model no- 24-ck0550in total quantity : 3

Due Date : Dec 5, 2022
Tender Value : rupee 5 Lakhs
34

Government Departments - Kannur - Kerala

34997509 bids are invited for safety footwear - bis specification-is:15298 part 2 ( q3 ) mse total quantity : 167

Due Date : Dec 6, 2022
Tender Value : Ref. Document
35

Government Departments - Jammu - Jammu And Kashmir

34997504 bids are invited for gypsy spares rear wheel oil seal , sparking plug o ring , tappet cover gaskit , shocker bush upper , dalla handle outer , accelerator cable total quantity : 400

Due Date : Dec 5, 2022
Tender Value : Ref. Document
36

Government Departments - Kendujhar - Odisha

34997503 bids are invited for all in one , i5 aio , ink tank printer , tablet pc , external hdd , power bank total quantity : 8

Due Date : Dec 5, 2022
Tender Value : Ref. Document
37

Statutory Bodies & Commissions/Committees - mumbai - Maharashtra

34997494 bids are invited for oem / compatible cartridge / consumable ( q2 ) total quantity : 93

Due Date : Dec 6, 2022
Tender Value : rupee 4.48 Lakhs
38

Government Departments - Pakur - Jharkhand

34997490 bids are invited for led driver 30 watt , led driver 90 watt , led pcb 30 watt , led pcb 90 watt total quantity : 1300

Due Date : Dec 5, 2022
Tender Value : Ref. Document
39

Government Departments - Khordha - Odisha

34997484 bids are invited for online ups (version 2.0) (q2) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
40

Government Departments - Dewas - Madhya Pradesh

34997480 bids are invited for tricycle , dustbin , wheel barrow , safety tool kit total quantity : 8

Due Date : Dec 5, 2022
Tender Value : Ref. Document
41

Statutory Bodies & Commissions/Committees - North Sikkim - Sikkim

34997476 bids are invited for ppc 01 mother receipe rajasthani sweet lime pickle 500g , swad mixed pickle 500g , haldirams punjabi masala papad , dil kush papad bikaji moong dal , mother receipe green chilli pickle 400g , jk spices triupati coconut powder , mother receipe garlic pickle total quantity : 574

Due Date : Nov 28, 2022
Tender Value : rupee 2 Lakhs
42

Statutory Bodies & Commissions/Committees - BALESWAR - Odisha

34997471 bids are invited for executive table total quantity : 1

Due Date : Nov 28, 2022
Tender Value : Ref. Document
43

Government Departments - Jabalpur - Madhya Pradesh

34997467 bids are invited for office steel almirah- steel office almirah total quantity : 29

Due Date : Dec 10, 2022
Tender Value : Ref. Document
44

Government Departments - New Delhi - Delhi

34997464 bids are invited for compatible cartridge -1 hp laserjet m104w 2 hp laserjet m104w 3 hp lj 1015 1022 toner q 2612a 4 hp lj 1007 toner cc 388a 5 canan ir 2525 6 hp laser jet2015 7 hp 2420 toner 11a total quantity : 365

Due Date : Dec 5, 2022
Tender Value : Ref. Document
45

Government Departments - DHARWAD - Karnataka

34997449 bids are invited for inverter with sine wave output as per is:13314 total quantity : 32

Due Date : Nov 28, 2022
Tender Value : Ref. Document
46

Government Departments - Jaipur - Rajasthan

34997446 bids are invited for all in one pc (q2) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
47

Government Departments - Mainpuri - Uttar Pradesh

34997443 bids are invited for handloom blanket- relief (q3) total quantity : 6000

Due Date : Dec 5, 2022
Tender Value : Ref. Document
48

Statutory Bodies & Commissions/Committees - Kendrapara - Odisha

34997441 bids are invited for supply of different types of conveyor pulleys conveyor pulley total quantity : 10

Due Date : Dec 16, 2022
Tender Value : Ref. Document
49

Local Bodies - Tiruvannamalai - Tamil Nadu

34997432 bids are invited for line interactive ups with avr ( version 2.0 ) ( q2 ) ( pac only ) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
50

Boards / Undertakings / PSU - Chikkaballapura - Karnataka

34997431 bids are invited for stationary items a4 size paper , regsiters 2q , registers 3q , registers 4q , ruled note book , big dust bins , small dust bins , floor mats , hand towels , pen drive , hand wash refilling , tissue paper , loose sheets , napkins , duster , attendance register , surgical gloves , aprons plastic , disposable gloves total quantity : 1774

Due Date : Dec 7, 2022
Tender Value : rupee 5 Lakhs
51

Local Bodies - Katihar - Bihar

34997428 bids are invited for lsba slwm items paddle rikshaw , dustbin 10 ltr green , dustbin 10 ltr blue , community dustbin with stand , safety kit , tools and tackles total quantity : 6766

Due Date : Dec 6, 2022
Tender Value : Ref. Document
52

Statutory Bodies & Commissions/Committees - North Sikkim - Sikkim

34997421 bids are invited for condiment catch red chilly powder 1 kg , catch turmeric powder masala powder 1 kg , catch coriander powder masala powder 1 kg , catch black pepper kali mirchwhole 1 kg , catch spice sambhar masala 100g , catch chicken masala 100g , catch meat masala 100g , catch garam masala 100g total quantity : 104

Due Date : Nov 28, 2022
Tender Value : rupee 50000.0
53

Government Departments - DHANBAD - Jharkhand

34997384 bids are invited for all in one pc total quantity : 40

Due Date : Nov 28, 2022
Tender Value : Ref. Document
54

Government Departments - mumbai - Maharashtra

34997379 bids are invited for paper shredding machines ( version 2.0 ) total quantity : 4

Due Date : Nov 29, 2022
Tender Value : Ref. Document
55

Government Departments - Agra - Uttar Pradesh

34997378 bids are invited for pole and mast -- 1 supply & fixing of 8 mtr gi octagonal pole of approved make ( top dia 70mm, bottom dia 155 mm and base plate 12mm thik ) having 3mm thikness with single arm bracket ( 1 mtr length ) on rcc foundationincluding the cost of foundation, foundation bolts, excavation & back filling and required t&p completee in all respect..pwd sor no. 645 2 s / f of angle iron fram fabricated as per design approved of angle iron size 40mmx40mmxfor fixing 4 to 6 floo...

Due Date : Dec 5, 2022
Tender Value : Ref. Document
56

Boards / Undertakings / PSU - MORADABAD - Uttar Pradesh

34997376 bids are invited for atta chhaki total quantity : 3000

Due Date : Nov 28, 2022
Tender Value : Ref. Document
57

Government Departments - Osmanabad - Maharashtra

34997372 bids are invited for bc mats ( q3 ) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
58

Government Departments - Akola - Maharashtra

34997339 bids are invited for agricultural spray drone (q3) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
59

Local Bodies - Dewas - Madhya Pradesh

34997336 bids are invited for tricycle , dustbin , wheel barrow , safety tool kit total quantity : 14

Due Date : Dec 5, 2022
Tender Value : Ref. Document
60

Government Departments - Kallakurichi - Tamil Nadu

34997328 bids are invited for organic liquid foliar spray total quantity : 22500

Due Date : Dec 5, 2022
Tender Value : Ref. Document
61

Statutory Bodies & Commissions/Committees - Ananthnag - Jammu And Kashmir

34997322 bids are invited for luminus inverter 1050 ah , luminus bty 12 v 150 ah total quantity : 8

Due Date : Nov 28, 2022
Tender Value : Ref. Document
62

Local Bodies - Kanniyakumari - Tamil Nadu

34997246 bids are invited for desktop computers (q2) ( pac only ) total quantity : 1

Due Date : Nov 30, 2022
Tender Value : Ref. Document
63

Government Departments - Jamnagar - Gujarat

34997242 bids are invited for procurement of paints for 19th narmada and 43nd salaya channel annual buoy maintenance- epoxy golden yellow , epoxy black paint , epoxy white paint , synthetic white enamel , epoxy green paint , epoxy red paint , primer red oxide , antifouling red procurement of paints for 19th narmada and 43nd salaya total quantity : 750

Due Date : Dec 9, 2022
Tender Value : rupee 5.23 Lakhs
64

Local Bodies - Katihar - Bihar

34997227 bids are invited for e cart garbage garbage e-cart total quantity : 1

Due Date : Dec 6, 2022
Tender Value : Ref. Document
65

Statutory Bodies & Commissions/Committees - ri Bhoi - Meghalaya

34997166 bids are invited for injector assy , piston assy , piston ring , avr , self startor assy , alternator total quantity : 7

Due Date : Nov 28, 2022
Tender Value : rupee 5 Lakhs
66

Local Bodies - Madurai - Tamil Nadu

34997163 bids are invited for desktop computers (q2) ( pac only ) total quantity : 1

Due Date : Nov 28, 2022
Tender Value : Ref. Document
67

Local Bodies - Tiruvannamalai - Tamil Nadu

34997161 bids are invited for line interactive ups with avr (version 2.0) (q2) ( pac only ) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
68

Government Departments - panipat - Haryana

34997158 bids are invited for solenoid valve total quantity : 3

Due Date : Dec 9, 2022
Tender Value : Ref. Document
69

Government Departments - Jaipur - Rajasthan

34997153 bids are invited for office furniture officers tables , revolving chairs , cushined chairs , staff tables , visitor chairs , racks total quantity : 90

Due Date : Dec 16, 2022
Tender Value : rupee 5 Lakhs
70

Government Departments - Hathras - Uttar Pradesh

34997149 bids are invited for black bag for nursery total quantity : 1242000

Due Date : Dec 5, 2022
Tender Value : Ref. Document
71

Statutory Bodies & Commissions/Committees - North Sikkim - Sikkim

34997127 bids are invited for condimenet items catch red chilly powder lal mirch powder 1 kg , catch turmeric powder masala haldi powder 1 kg , catch coriander powder masala dhaniya powder 1 kg , catch cumin jeera seed whole pack , catch kasuri methi dried funugreek whole pouch , catch whole spices catch big cardamom black cardamom elaichi 1 kg , catch black pepper kali mirch whole 1 kg , catch natural catch clove lung whole 1 kg , catch methi dana fenugreek seed 1 kg , catach ajwain whole 100g , catch ...

Due Date : Nov 28, 2022
Tender Value : rupee 2 Lakhs
72

Statutory Bodies & Commissions/Committees - Mathura - Uttar Pradesh

34997118 bids are invited for repair of motor cycle mse repairing of motor cycle veh va no 9a 07937l under ge east mathura total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
73

Local Bodies - Bhubaneswar - Odisha

34997115 bids are invited for cam analysis apparatus total quantity : 1

Due Date : Nov 28, 2022
Tender Value : Ref. Document
74

Government Departments - Solan - Himachal Pradesh

34997108 bids are invited for oem / compatible cartridge / consumable total quantity : 70

Due Date : Nov 28, 2022
Tender Value : Ref. Document
75

Government Departments - Shillong - Meghalaya

34997097 bids are invited for primers sle project microbiology fcn1 rs299727 minus 191g greater than a fcn1 191af cccatgagcctggttatca , fcn1 rs299727 minus 191g greater than a fcn1 191gf cccatgagcctggttatcg , fcn2rs 765453 minus 64a greater than c fcn2 64ac common fwd , dash cacaagcaagtcagcctgtt , fcn2 rs17549193 6359c greater than t fcn2 6359cf ttgcacttcttggattgtgc , fcn2 rs17549193 6359c greater thant fcn2 6359tf cctgcacaggagattcccggat , fcn2 rs7851696 6424g greater thant p6424 under...

Due Date : Dec 6, 2022
Tender Value : rupee 5 Lakhs
76

Government Departments - Khargone - Madhya Pradesh

34997082 bids are invited for ghantagadi - hopper tipper dumper total quantity : 2

Due Date : Dec 5, 2022
Tender Value : Ref. Document
77

Statutory Bodies & Commissions/Committees - sri Ganganagar - Rajasthan

34997071 bids are invited for lancer total quantity : 1

Due Date : Nov 28, 2022
Tender Value : Ref. Document
78

Government Departments - Dewas - Madhya Pradesh

34997061 bids are invited for tricycle , dustbin , wheel barrow , safety tool kit total quantity : 12

Due Date : Dec 5, 2022
Tender Value : Ref. Document
79

Local Bodies - Tiruvannamalai - Tamil Nadu

34997055 bids are invited for multifunction machines mfm (q2) ( pac only ) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
80

Statutory Bodies & Commissions/Committees - NEW Delhi - Delhi

34997051 bids are invited for stationary value regulated lead acid batteries as per is:15549 ( q3 ) total quantity : 31

Due Date : Dec 2, 2022
Tender Value : Ref. Document
81

Government Departments - Unakoti - Tripura

34997045 bids are invited for pratikshalya -6 mtr x 2.3x3.3 stainless steel bus que shelter, side advertisement panel ( q3 ) total quantity : 10

Due Date : Dec 16, 2022
Tender Value : Ref. Document
82

Local Bodies - Tiruvannamalai - Tamil Nadu

34997016 bids are invited for line interactive ups with avr (version 2.0) (q2) ( pac only ) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
83

Government Departments - BANGALORE - Karnataka

34997013 bids are invited for desktop computers total quantity : 61

Due Date : Nov 28, 2022
Tender Value : Ref. Document
84

Government Departments - Patna - Bihar

34997004 bids are invited for tractors (q1) total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
85

Statutory Bodies & Commissions/Committees - Ri Bhoi - Meghalaya

34996999 bids are invited for carburator , spark plug , injector assy , fuel injection pump , tappet gasket , avr , fuel feed pump total quantity : 16

Due Date : Nov 28, 2022
Tender Value : rupee 5 Lakhs
86

Government Departments - Vidisha - Madhya Pradesh

34996995 bids are invited for bleaching mse total quantity : 5000

Due Date : Dec 5, 2022
Tender Value : rupee 5 Lakhs
87

Government Departments - Pondicherry - Puducherry

34996769 bids are invited for nabulizer ( q2 ) total quantity : 3

Due Date : Dec 6, 2022
Tender Value : rupee 96000.0
88

Government Departments - Balangir - Odisha

34996758 bids are invited for hopper tipper dumper total quantity : 15

Due Date : Dec 5, 2022
Tender Value : Ref. Document
89

Government Departments - New Delhi - Delhi

34996751 bids are invited for ret cam imaging system total quantity : 1

Due Date : Dec 12, 2022
Tender Value : Ref. Document
90

Local Bodies - Nabarangpur - Odisha

34996746 bids are invited for desktop computers (q2) total quantity : 3

Due Date : Dec 5, 2022
Tender Value : rupee 1.95 Lakhs
91

Statutory Bodies & Commissions/Committees - kanpur - Uttar Pradesh

34996743 bids are invited for sodium hydroxide pure is: 252: 2013 ( fourth revision ) , ra-2018 ( q3 ) total quantity : 18061

Due Date : Dec 16, 2022
Tender Value : Ref. Document
92

Government Departments - nagpur - Maharashtra

34996741 bids are invited for intermittent pneumatic compression device total quantity : 5

Due Date : Nov 29, 2022
Tender Value : Ref. Document
93

Government Departments - Balrampur - Uttar Pradesh

34996736 bids are invited for specific refractive error children & old age (q3) total quantity : 3230

Due Date : Dec 19, 2022
Tender Value : Ref. Document
94

Government Departments - Hathras - Uttar Pradesh

34996733 bids are invited for quilt , quilt cover , mattress , bedsheet , cover sheet , pillow , pillow cover total quantity : 3827

Due Date : Dec 5, 2022
Tender Value : rupee 10.50 Lakhs
95

Statutory Bodies & Commissions/Committees - Mathura - Uttar Pradesh

34996711 bids are invited for repair to eicher veh ba no 9d 208820p under ge east mathura total quantity : 1

Due Date : Dec 5, 2022
Tender Value : Ref. Document
96

Statutory Bodies & Commissions/Committees - West Kameng - Arunachal Pradesh

34996699 bids are invited for singing rock harness total quantity : 10

Due Date : Nov 28, 2022
Tender Value : rupee 70000.0
97

Statutory Bodies & Commissions/Committees - DARJILING - West Bengal

34996692 bids are invited for oem / compatible cartridge / consumable ( q2 ) total quantity : 66

Due Date : Dec 12, 2022
Tender Value : Ref. Document
98

Statutory Bodies & Commissions/Committees - KOLKATA - West Bengal

34996687 bids are invited for usb camera for video conferencing system total quantity : 1

Due Date : Nov 28, 2022
Tender Value : Ref. Document
99

Statutory Bodies & Commissions/Committees - KORAPUT - Odisha

34996684 bids are invited for washer total quantity : 1400

Due Date : Nov 28, 2022
Tender Value : Ref. Document
100

Local Bodies - Kanniyakumari - Tamil Nadu

34996680 bids are invited for desktop computers (q2) ( pac only ) total quantity : 1

Due Date : Nov 30, 2022
Tender Value : Ref. Document
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2022 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail