1181 Free tenders in Himachal Pradesh 2025

Get latest Free related Tenders, online published by Central University Of Himachal Pradesh, Government Of Himachal Pradesh, Himachal Pradesh Agriculture Development Society from Himachal Pradesh state. Participate online through e-Procurement website for Free tenders in Himachal Pradesh. Download Tender Documents, BOQ, Technical Bids for Free related Tenders from Himachal Pradesh. Get Bidding support for etenders related to Free Tenders in Himachal Pradesh. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Free tenders published from Himachal Pradesh. Also get daily email alerts for Free related tender notices published by Government of Himachal Pradesh.

Search Result

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

49127950 bids are invited for guest room bed side carpet , cloth stand , mattress , led 32 inch smart tv , quilt with cover , dish tv free , water camper , electric kettle , emergency light , iron , water bottle for water dispenser bed side carpet specificati

Due Date : Jun 4, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - dalhousie - Himachal Pradesh

49112724 tender for certain repair replacement of us security/ street lights mccbs and misc work at dalhousie cantt

Due Date : Jun 2, 2025

Tender Value :

20 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - dalhousie - Himachal Pradesh

49112654 tender for welcome maintenance and misc works at dalhousie cantt

Due Date : Jun 2, 2025

Tender Value :

9 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - dalhousie - Himachal Pradesh

49112537 tender for periodical services and misc works for internal surfaces at dalhousie cantt under age(i) dalhousie

Due Date : Jun 2, 2025

Tender Value :

20 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

49054986 tender for supply of medicines and consumable to kamla nehru state hospital for mother and child shimla

Due Date : May 30, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - bakloh - Himachal Pradesh

49054201 tender for certain repair to road and misc works at bakloh cantt

Due Date : May 26, 2025

Tender Value :

25 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - hamirpur - Himachal Pradesh

49045116 tender for supply of surgical consumables tender

Due Date : May 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kullu - Himachal Pradesh

48898537 tender for fish feed ingredients

Due Date : May 19, 2025

Tender Value :

32 Lakhs

View Notice

Government Departments - Bilaspur - Himachal Pradesh

48889857 tender for supply of 1 whole wheat 2 de oiled soya cake 1) protein ) fat (w) sand/silica lin seed oil 1) peroxide value ii) anisidine value i) nitrogen iv) colour v) antioxidant vi) moisture 4 5 yeast 1) crude protein f

Due Date : May 19, 2025

Tender Value :

32 Lakhs

View Notice

Government Departments - jubbal - Himachal Pradesh

48839920 tender for construction of link road from chakord to naloda km 0/000 to 0/570

Due Date : Apr 30, 2025

Tender Value :

15.74 Lakhs

View Notice

Boards / Undertakings / PSU - Chamba - Himachal Pradesh

48835796 bids are invited for purchase of misc item ball bearing single row no 7206be , ball valve, 80mm, bsp, class 150 or higher , nrv 80nb cast carbon steel to a 216 gr.150 , swing type, flanged ends , nrv wafer type dn200, 150 , pn 10, c s cps iii free sp

Due Date : May 9, 2025

Tender Value :

9.85 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - dalhousie - Himachal Pradesh

48833216 Corrigendum : tender for welcome maintenance and misc work at bakloh cantt

Due Date : May 21, 2025

Tender Value :

9 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - tanda - Himachal Pradesh

48726863 Corrigendum : tender for supply of consumables/surgicals/regents

Due Date : May 5, 2025

Tender Value :

10 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

48718919 bids are invited for medicine adapt paste for colostomy , urostomy tube of 60gm , antacid ,chewable, containing dried aluminium hydroxide ip 250mg mag hydroxide nf 250mg methyl polysiloxane 50 mg ,digene, tab , calcitonin nasal spray , cap doxepin hc

Due Date : May 7, 2025

Tender Value :

20.18 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

48718918 bids are invited for medicine 32 153 calamine lotion 50 ml tube , calcium and vit d3 syp 200ml bott , cap acebrophylline 100 mg , cap amantadine 100 mg , cap cyclosporine a micro emulsion 100 mg , cap ferrous fumarate 300 mg, cyanocobalamine 15 mcg a

Due Date : May 7, 2025

Tender Value :

14.51 Lakhs

View Notice

Boards / Undertakings / PSU - Solan - Himachal Pradesh

48698963 tender for supply of fresh pure wheat straw which is free from dust, gravel, sand, stones, dung and fungus

Due Date : May 1, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

48659578 bids are invited for medicine aspirin 75mg and atorvastatin 10mg and clopidogril 75mg tab , cap cefpodoxime 200mg and clavulanate 125 mg , cap clindamycin 300 mg , cap gamma and delta tocotrienol 400 mg softgel capsules ,ca probet, , cap lansoprazole

Due Date : May 2, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

48552270 tender for procurement of portable license free vhf/uhf radio hand set (walkie talkies) for the power house sawra kuddu hep (111mw), hppcl, snail, tehsil jubbal distt shimla 171206 .

Due Date : Apr 10, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - solan - Himachal Pradesh

48479420 tender for supply of 1. sand, gravel, stone, gutka, pebble per cubic feet, 2. cement transportation including loading unloading, 3. steel, bar, angle, pvc pipe, brick, shuttering etc., 3. window doors paint electrical items etc. rates including affected u

Due Date : Apr 5, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

48422569 tender for procurement of portable license free vhf/uhf radio hand set (walkie talkies) for the power house sawra kuddu hep (111mw), hppcl, snail, tehsil jubbal distt shimla 171206 .

Due Date : Apr 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - sirmaur - Himachal Pradesh

48378796 Corrigendum : tender for notice inviting tender for manufacturing, supply and installation of library furniture at iim sirmaur

Due Date : Apr 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

48365165 tender for supply of lab reagents/carbon free opd slips, at civil hospital theog distt. shimla for the financial year 2025 26

Due Date : Mar 29, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

48329486 Corrigendum : tender for special repair to bldg no dy 64 at alhilal mil stn

Due Date : Apr 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kangra - Himachal Pradesh

48311443 Corrigendum : tender for nit for the purchase of lab reagents

Due Date : Apr 8, 2025

Tender Value :

20 Lakhs

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

48288548 bids are invited for providing and fixing of 0 mm toughened glass partitions doors (make: saint gobain, tata, gold plu , free standing partition panel safety glass as per is 2553 total quantity : 1

Due Date : Apr 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

48263735 tender for procurement of portable license free vhf/uhf radio hand set ( walkie talkies) for the power house, sawra kuddu hep(lllmw),hppcl, snail, tehsil jubbal distt shimla 171206 .

Due Date : Mar 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Solan - Himachal Pradesh

48252339 various running work at zsi solan (h.p.) barrier free railing and misc work at zsi solan (h.p.)

Due Date : Mar 20, 2025

Tender Value :

4.31 Lakhs

View Notice

Government Departments - Mandi - Himachal Pradesh

48148486 tender for providing and fixing aluminium partition and various civil works in academic block a8 at south campus of iit mandi

Due Date : Mar 13, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mandi - Himachal Pradesh

48097123 supply including transportation and insurance of various gate/globe/ball valve for3x42mw larji hydro power plant, thalout distt mandi (hp

Due Date : Mar 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

48080556 bids are invited for medical equipments for als ambulance canvas stretcher folding , suction machine portable electric , suction pump foot operated , suction pump hand operated , inflatable splints latex free pneumatic air splints , rescue tools , em

Due Date : Mar 26, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Kangra - Himachal Pradesh

48077080 bids are invited for glasswares and plasticwares in physics laboratory measuring cylinder 5 ml , measuring cylinder 10 ml , measuring cylinder 25 ml , measuring cylinder 1000 ml , conical flask with screw cap 1000 ml , conical flask with screw cap 25

Due Date : Mar 27, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Solan - Himachal Pradesh

48033019 bids are invited for air cooled oil free air compressor with dryer (integrated stand alone) , reciprocating air compressor (iocl) total quantity : 1

Due Date : Mar 24, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

47976965 tender for procurement of items

Due Date : Mar 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47939954 Corrigendum : bids are invited for chemical alt r crispr cas9crrna , alt r crispr cas9 crrna , alt r crispr cas9crrna , alt r crispr cas9 tracr rna , alt r s.p.hifi cas9 nuclease v3 , nuclease free duplex buffer , idtx 1xte solution , portable sealed rechargeable

Due Date : Mar 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47931184 tender for procurement of portable license free vhf/uhf radio hand set ( walkie talkies) for the power house, sawra kuddu hep(lllmw),hppcl, snail, tehsil jubbal distt shimla 171206 .

Due Date : Mar 5, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

47928306 tender for procurement of item

Due Date : Mar 1, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

47890813 Corrigendum : tender for setting up of block public health unit (5bphu) at various district, himachal pradesh

Due Date : Mar 11, 2025

Tender Value :

1.90 Crore

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

47879893 bids are invited for jump suit for combat free fall total quantity : 40

Due Date : Feb 24, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Kangra - Himachal Pradesh

47879529 bids are invited for chemicals for lab in dpas rpmi1640 medium. hepes modifcation with l glutamine and 25mm hepes without sodium bicarbonate powder suitable for cell culture , fetal bovine serum non usa origin sterile fltered suitable for cell cultur

Due Date : Mar 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

47845761 tender for procurement of items

Due Date : Feb 24, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Kullu - Himachal Pradesh

47835402 tender for proposals for a comprehensive 5 night tour and travel package to kerala, india. the package should include the following services accommodation: 4 star or 3 star hotel accommodations (details of room types, amenities, and facilities to be provi

Due Date : Feb 27, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

47825579 tender for procurement of items

Due Date : Feb 23, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

47794327 bids are invited for dglp boq 15 patient circuit adult paed , mapleson non rebreathing system bain circuit , paediatric anaesthetic circuit complete nonrebreathing system , hand gloves size 7 pair of , hand gloves size 7 .5 pair of , polyglactin size

Due Date : Mar 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

47745273 tender for supply of articles, black gram, feed grade, free from impurities like pebbles/stones, husk & insects/mold, should be packed in poly propylene (pp) bags, net weight will be considered. gud (jaggery), free from impurities, solid form in pieces,

Due Date : Feb 27, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - UNA - Himachal Pradesh

47677750 tender for

Due Date : Feb 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kinnaur - Himachal Pradesh

47676725 bids are invited for surveillance tower portable x 04 erecting testing and commissioning of 10 mtr high ground mounted retractable high pneumatic telescopic loc murmi dogri , erecting testing and commissioning of 10 mtr high ground mounted retractabl

Due Date : Mar 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47647965 tender for construction of link road from ghatti gali to badiyar in km 0/00 to 1/00

Due Date : Feb 20, 2025

Tender Value :

15.33 Lakhs

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

47630874 tender for supply of print books to the library to himachal pradesh national law university, shimla

Due Date : Feb 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jubbal - Himachal Pradesh

47587847 Corrigendum : tender for r/r damages on kuddu dhadi saraji road km 0/00 to 11/550

Due Date : Feb 20, 2025

Tender Value :

4.87 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

47569127 Corrigendum : bids are invited for hydraulic hose hydraulic hose , hose 08 bsp hp 1910mm , hose 06 bsp hp1910mm , hose st pump , hose 1275 mm , hose , hose top part , hose bottom part , gasket cylender head , seal rocker cover , thermostat valve , switch oil press

Due Date : Mar 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - rohru - Himachal Pradesh

47526708 tender for supply order for 63 kva lt distribution box

Due Date : Feb 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kangra - Himachal Pradesh

47445656 tender for supply of material, design, erection, testing, commissioning forsop to lis dheera i, ii and iii under hp shiva project by providing 11 kv ht line, 11/0.4 kv, 100 kva sub station and 3 phase lt line in (e) section dheera under electrical sub div

Due Date : Feb 5, 2025

Tender Value :

23.93 Lakhs

View Notice

Government Departments - SHIMLa - Himachal Pradesh

47382375 tender for plant protection equipments (sprayer) isi marked

Due Date : Feb 13, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - tanda - Himachal Pradesh

47382285 Corrigendum : tender for etnder/surgical items/suture

Due Date : Mar 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

47382083 tender for bio fertilizers

Due Date : Feb 13, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kinnaur - Himachal Pradesh

47342931 tender for supply of dangri.

Due Date : Jan 31, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47324318 bids are invited for chemical alt r crispr cas9 crrna , alt r crispr cas9 crrna xt , alt r crispr cas9 tracr rna , alt r s.p. hifi cas9 nuclease v3 , nuclease free duplex buffer , idte , portable sealed rechargeable single cells nickel metal tota

Due Date : Feb 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - hamirpur - Himachal Pradesh

47254015 tender for procurement of lt distribution panel box for 100kva

Due Date : Jan 22, 2025

Tender Value :

1.99 Lakhs

View Notice

Boards / Undertakings / PSU - kangra - Himachal Pradesh

46983484 tender for extension of apron at kangra airport 2024

Due Date : Jan 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

46835381 Corrigendum : bids are invited for smarter race 5 3 kit , universal genome walker kit 2.0 , guide it complete sgrna screening system , verso cdna synthesis kit , high capacity cdna reverse transcription kit with rnase inhibitor , ultrapure dnase rnase free distil

Due Date : Jan 24, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kinnaur - Himachal Pradesh

46820985 bids are invited for surveillance tower portable erecting testing and commissioning of 10 mtr high ground mounted retractable high pneumatic telescopic loc murmi dogri , erecting testing and commissioning of 10 mtr high ground mounted retractable hig

Due Date : Jan 13, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Himachal Pradesh

46811994 tender for supply of rhinoplasty set in the department of burns and plastic surgery

Due Date : Jan 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

46795191 bids are invited for jump suit for combat free fall total quantity : 40

Due Date : Jan 10, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

46758497 bids are invited for and quick coupling oring type 42mm hydraulic steel tube cr6ni seamless cr vi free conforming to en 10305 4having od 42 mm and thickness 4mm e355 st 52 point 4 phospated and oiled in 6 m length , quick coupling oring type 42mm wit

Due Date : Jan 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

46722676 Corrigendum : bids are invited for alt r crispr cas9 crrna (sbe1 g1: taatactccaaacaccaaac) , alt r crispr cas9 crrna (sbe1 g2: tcaaacatggtaatggagtg) , alt r crispr cas9 crrna (sbe1 g3: gattcgtggggctcggggtt) , alt r crispr cas9 crrna (sbe1 g4: cttgggtttacaggttctgg)

Due Date : Jan 20, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

46698725 Corrigendum : bids are invited for medicines antacid ,chewable, containing dried aluminium hydroxide ip 250mg mag hydroxide nf 250mg methyl polysiloxane 50 mg ,digene, tab , cap doxepin hcl 75 mg , cap fluoxetine hcl 20 mg , cap doxycycline 100mg , cap gabapentin

Due Date : Jan 6, 2025

Tender Value :

18.31 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

46698706 Corrigendum : bids are invited for medicines arm sling pouch ,strap , bandage crepe, 10cm x 4m , bandage dvt stocking large , bandage dvt stocking medium , bandage elastic adhesive, 6 cm x 3 metres unstretched and 5 6 metres when stretched. , bandage open wove

Due Date : Jan 6, 2025

Tender Value :

15.91 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

46673725 bids are invited for medicines adhesive plaster 2.5 cm roll , bandage crepe, 15cm x 4m , bandage open wove uncompressed 10 cm x 4 metres , cap imatinib mesylate 400 mg , clotrimazole vaginal pessary 100mg , colostomy set 50 55 mm ,bag and base plate,

Due Date : Jan 3, 2025

Tender Value :

26.89 Lakhs

View Notice

Boards / Undertakings / PSU - Paonta Sahib - Himachal Pradesh

46646364 tender for requirement of water still pyrogen free distilled water .

Due Date : Dec 20, 2024

Tender Value : Ref. Document

View Notice

Government Departments - nahan - Himachal Pradesh

46560683 fabrication and supply of l.t. distribution panel box suitable for 100 kva sub station, complete in all respect as per tender specifications. , fabrication and supply of l.t. distribut

Due Date : Dec 17, 2024

Tender Value :

2 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

46540235 bids are invited for control line free fall parachute solo t size 290,control line free fall parachute solo t size total quantity : 10

Due Date : Dec 7, 2024

Tender Value : Ref. Document

View Notice

Government Departments - nahan - Himachal Pradesh

46515874 fabrication and supply of l.t. distribution panel box suitable for 250 kva sub station, complete in all respect as per tender specifications. , fabrication and supply of l.t. distribut

Due Date : Dec 12, 2024

Tender Value :

2 Lakhs

View Notice

Government Departments - hamirpur - Himachal Pradesh

46473400 tender for procurement of lt distribution panel box for 100kva

Due Date : Dec 9, 2024

Tender Value :

1.99 Lakhs

View Notice

Government Departments - hamirpur - Himachal Pradesh

46473399 tender for procurement of lt distribution panel box for 250kva

Due Date : Dec 9, 2024

Tender Value :

1.97 Lakhs

View Notice

Government Departments - nahan - Himachal Pradesh

46465599 tender for fabrication and supply of l.t. distribution panel box suitable for 250 kva sub station, complete in all respect as per tender specifications.

Due Date : Dec 10, 2024

Tender Value :

2 Lakhs

View Notice

Government Departments - hamirpur - Himachal Pradesh

46434188 tender for procurement of lt distribution panel box for 25kva

Due Date : Dec 5, 2024

Tender Value :

1.86 Lakhs

View Notice

Government Departments - hamirpur - Himachal Pradesh

46434016 tender for procurement of lt distribution panel box for 63kva

Due Date : Dec 5, 2024

Tender Value :

1.96 Lakhs

View Notice

Government Departments - nahan - Himachal Pradesh

46399453 fabrication and supply of l.t. distribution panel box suitable for 400 kva sub station, complete in all respect as per tender specifications. , fabrication and supply of l.t. distribut

Due Date : Dec 5, 2024

Tender Value :

2 Lakhs

View Notice

Government Departments - nahan - Himachal Pradesh

46399442 fabrication and supply of l.t. distribution panel box suitable for 250 kva sub station, complete in all respect as per tender specifications. , fabrication and supply of l.t. distribut

Due Date : Dec 5, 2024

Tender Value :

2 Lakhs

View Notice

Government Departments - Kinnaur - Himachal Pradesh

46355357 supply of superior quality snow kit with temperature tolerance upto ( 6) degree celsius for various power houses under generation circle, hpsebl bhabanagar.

Due Date : Dec 4, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Paonta Sahib - Himachal Pradesh

46349485 tender for water still pyrogen free distilled water boiling chamber & condenser model of 5 still (cap. 4 ltr/n2) .

Due Date : Nov 30, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kinnaur - Himachal Pradesh

46232221 tender for construction and development of infrastructure at nakdum bop of 2nd bn itbp .

Due Date : Dec 9, 2024

Tender Value :

12.11 Crore

View Notice

Statutory Bodies & Commissions/Committees - manali - Himachal Pradesh

46196620 Corrigendum : tender for repair/resurfacing of internal roads berm, path, hardstanding at dgre rdc, manali.

Due Date : Dec 10, 2024

Tender Value :

4.50 Lakhs

View Notice

Trust & NGO - KANGRA - Himachal Pradesh

46155797 tender for free operation of toilet bathroom section of men and women on the vestry near the east gate. for free operation of mens toilet and bathroom section on the vestry of temple office and business premises.

Due Date : Nov 28, 2024

Tender Value : Ref. Document

View Notice

Trust & NGO - KANGRA - Himachal Pradesh

46143506 tender for free operation of mens and womens toilet bath section on the vestry near the eastern gate. for free operation of mens and womens toilet and bathroom section on the vestry of temple office and business premises.

Due Date : Nov 27, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

46139507 bids are invited for bandage crepe, 15cm x 4m , bandage open wove uncompressed 10 cm x 4 metres , cap imatinib mesylate 400 mg , clotrimazole vaginal pessary 100mg , colostomy set 50 55 mm ,bag and base plate, , colostomy set 60 mm ,bag and base plate

Due Date : Nov 14, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

46061396 bids are invited for alt r crispr cas9 sgrna , alt crispr cas9crrna(fla_ gl: ctaggaggtgaatctctcgt , alt rcrispr cas9crrna(fla_ g2: ttagaggtgtcacgaaa cta) , alt r crispr cas9 crrna (fla_ g3: ataacgatacagttgcaagt) , alt r crispr_ cas9 crrna (dvt_ gl: tctgtt

Due Date : Nov 30, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Hamirpur - Himachal Pradesh

46035873 tender for supply and installation of for icortm corrosion analyser etc for civil engineering department of nit hamirpur

Due Date : Nov 25, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

46035250 tender for invitation of bids for supply of expendable medical store at smc air force station dalhousie under price agreement 2024 25

Due Date : Nov 18, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Palampur - Himachal Pradesh

46035065 tender for supply of item

Due Date : Nov 19, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

46029028 bids are invited for nifedipine retard 20 mg captab , propranolol tr 40 mg, tab , ramipiril 2.5 mg tab , digoxin 0.25 mg tab , tab sacubitril 24 mg plus valsartan 26 mg , vasopressin 20 unitsml inj, 1ml ampoule , aspirin 75 mg tab , telmisartan 40 mg

Due Date : Nov 6, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Solan - Himachal Pradesh

46011593 Corrigendum : bids are invited for air cooled oil free air compressor with dryer (integrated stand alone) total quantity : 1

Due Date : Dec 17, 2024

Tender Value : Ref. Document

View Notice

Government Departments - rampur - Himachal Pradesh

45984043 tender for ceo/mm/ltd. tender/ no. 152 (lt panel 250 kva)/2024 25 fabrication and supply of l.t. distribution panel box suitable for 250 kva sub station, complete in all respect as per tender specifications. , fabrication and supply of l.t. distribut

Due Date : Nov 8, 2024

Tender Value :

2 Lakhs

View Notice

Government Departments - Kasauli - Himachal Pradesh

45982505 provision of barrier free elements for non residential building cri kasauli (h.p.)

Due Date : Nov 6, 2024

Tender Value :

3.53 Lakhs

View Notice

Government Departments - shimla - Himachal Pradesh

45947930 Corrigendum : tender for e tender for the supply surgical items to igmc and hospital shimla

Due Date : Nov 21, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

45914793 Corrigendum : tender for comprehensive maintenance of lt pannel, cable and connected itmes at 217 transit camp palchan excavating in trenchesin soft/diseintegrated soil, n exc 1.5 m wide and n exc 1.5 m in depth; for foundation, etc. or for shafts, wells, cesspits, m

Due Date : Nov 27, 2024

Tender Value :

6.50 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

45857854 bids are invited for echs boq10 kits for estimation of cholesterol kit 5x20ml erba , kits for estimation of glucose erba 2x200 ml , kits for estimation of urea erba 5x20ml , kits for estimation of uric acid erba 5x20 ml , kits for estimation of creat

Due Date : Nov 12, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

45832185 bids are invited for medicines antacid ,chewable, containing dried aluminium hydroxide ip 250mg mag hydroxide nf 250mg methyl polysiloxane 50 mg ,digene, tab , cap doxepin hcl 75 mg , cap fluoxetine hcl 20 mg , cap gabapentin 300 mg , cap glucosamine

Due Date : Nov 9, 2024

Tender Value :

16.44 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

45828124 bids are invited for 0.012 preformed niti arch wire upper pkt of 10 , 0.014 preformed niti arch wire upper pkt of 10 , 0.016 preformed niti arch wire upper pkt of 10 , 0.016 preformed niti arch wire lower pkt of 10 , 0.016 x 0.022 preformed niti arch

Due Date : Oct 21, 2024

Tender Value : Ref. Document

View Notice

100

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

45824562 Corrigendum : tender for setting up of bphu at ch nagrota bhagwan, kangra district

Due Date : Nov 5, 2024

Tender Value :

36 Lakhs

View Notice

Tenders By City

Top