}
  • Home   ›
  •   Indian Tenders   › Tender Notice : 51274435

    • Tender For Kfd Rt-Pcr Regaents Tender For The Vdlshimoga 2025-26, Shivamogga-Karnataka

    Department Of Health And Family Welfare has published Tender For Kfd Rt-Pcr Regaents Tender For The Vdlshimoga 2025-26. Submission Date for this Tender is 17-10-2025. Indicators and Reagents Tenders in Shivamogga Karnataka. Bidders can get complete Tender details and download the document.




    Tender Notice

    51274435
    Tender For Kfd Rt-Pcr Regaents Tender For The Vdlshimoga 2025-26
    Tender
    Indian
    Karnataka
    Shivamogga
    17-10-2025

    Tender Details

    Supply Of Kfd Rt-Pcr Reagents For Virus Diagnostic Laboratory Shimoga - Beta Actin Qsy Probe Vic5tcaagatcattgctcctcctgagcgc3 50000Picomoles,Actin Rp5gccgatccacacggagtact3 80000Picomoles,Actin Fp5ggcacccagcacaatgaag3 80000Picomoles,Taqman Fast Virus 1 Step Master Mix For Qpcr Catalog Number 4444434 1 Qty 200X5,Taqman Qsy Probe-50Nm Kfdv Ns5 Probe 6Fam Atg Gag Agg Agc Gcc Tga Ccc G 22 Bases Catalog No 4482779 50000 Picomoles,Kfdv Ns5 R1-Tca Tcc Cca Ctg Acc Agc At 20 Bases Catalog No 4304971 80000 Picomoles,Sequence Detetction Primer Kfdv Ns5f1 Tgg Aag Cct Ggc Tga Aag Ag 20 Bases 4304971 80000 Picomoles

    Key Value

    Document Fees
    INR 500 /-
    EMD
    INR 150000.0 /-
    Need a Bussiness Loan? Apply Now!
    Tender Value
    Refer document

    Attachment

    FileName File Description File Size
    Click here to download tender document Tender Documents 0 KB
    RBbranding
    Disclaimer :
    We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
    Tell us about your Product / Services,
    We will Find Tenders for you
    BootCamp
    RBTendersdetails2
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail