}

Tender For Supply Of Reagents/ Kits/ Chemicals, Akola-Maharashtra

Government Medical College has published Tender For Supply Of Reagents/ Kits/ Chemicals. Submission Date for this Tender is 15-12-2023. Chemical Supply Tenders in Akola Maharashtra. Bidders can get complete Tender details and download the document.




Tender Notice

41034419
Tender For Supply Of Reagents/ Kits/ Chemicals
Tender
Indian
Maharashtra
Akola
15-12-2023

Tender Details

Tender For Supply Of Reagents/ Kits/ Chemicals - DNA Ladder 1 kb, 100bp wityh dyes DNA Tracing dye-Bromophenol Blue (6X) SYBRTM Safe DNA Gel Stain TAE Buffer 50X/20X (for Agarose Gel Electrophoresis)-50X Gel Purification Kit for 50Rxn./250Rxn. Dengue Serotyping RT Kit - Real Star Altona Diagnostic or TRUPCR Real Time PCR kit for Zika, Dengue and Chikungunya - trioplex kit (Mnf.-GENES2ME) PCR Buffer :mix - Buffer, Mgel2, dNTPs, 2x PCR Master Mix with enqyme Taq Polymerase Taq Polymerase-high fidelity Milli Q Distilled Water - Merck Sigma Aldrich 500ML/1 lit. Conventional Primer - Dengue (Reference - Lanciotti et al) DENV Consensus Primers- • DI: STCAATATGCTGAAACGCGCGAGAAACCG3 D2: 5TTGCACCAACAGTCAATGTCTTCAGGTTC3 Dengue Serotype - Specific Reverse Primers . TS 2: 5 CGCCACAAGGGCCATGAACAG 3 TS 1:5 CGTCTCAGTGATCCGGGGA 3 TS 3:5 TAACATCAT-CATGAGACAGAGC 3 Chinkunguuya Primer- CHK IF: 5 CGAGATACTGCCCGTCCCGT-3 CHK1 R:5GTCACGCGTCTCCGCTTGTTT-3 NS, Dengue Elisa Kit

Key Value

Document Fees
Refer document
EMD
Refer document
Tender Value
Refer document
Disclaimer :
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tell us about your Product / Services,
We will Find Tenders for you

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail