Health And Family Welfare Department has published Providing Chemicals/Glassware In M. P. Shah Govt. Medical College, Jamnagar.(Prat-1 Of 2). Submission Date for this Tender is 14-12-2020. Chemical Supply Tenders in Gujarat. Bidders can get complete Tender details and download the document.
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 358 | 1 | METHANOL | RANKEM BRAND | 2.5 LIT |
| 2 . | 359 | 2 | METHANOL | M.W. 32.04 | 2.5 LIT |
| 3 . | 360 | 3 | DPX MOUNTANT FOR MICROSCOPY | MOLYCHEM BRAND | 500 ML |
| 4 . | 361 | 4 | DPX MOUNTANT FOR MICROSCOPY | PRODUCT CODE: 23140 | 500 ML |
| 5 . | 362 | 5 | XYLENE (Sulphur free) | RANKEM BRAND | 2.5 LIT |
| 6 . | 363 | 6 | FORMALIN SOUTION | RANBAXY RANKEM | 5 LIT |
| 7 . | 364 | 7 | FORMALIN SOUTION | 37.41 W/V | 5 LIT |
| 8 . | 365 | 8 | FORMALIN SOUTION | OR | 5 LIT |
| 9 . | 366 | 9 | FORMALIN SOUTION | MERCK | 5 LIT |
| 10 . | 367 | 10 | DETTOL ANTISEPTIC LIQUID | DETTOL | 500 ML |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 368 | 1 | BEAKERS | 500 ML | 500 ML |
| 2 . | 369 | 2 | BEAKERS | 250 ML | 250 ML |
| 3 . | 370 | 3 | BEAKERS | 100 ML | 100 ML |
| 4 . | 371 | 4 | BEAKERS | 50 ML | 50 ML |
| 5 . | 372 | 5 | GLASS TEST TUBES WITH CONICAL BOTTOM | 10 ML | 10 ML |
| 6 . | 373 | 6 | GLASS PETRI DISH WITH LID | 4’’ | 4’’ |
| 7 . | 374 | 7 | WIDE MOUTH CLEAR BOTTLE | 200 ML | 200 ML |
| 8 . | 375 | 8 | WIDE MOUTH CLEAR BOTTLE | 100 ML | 100 ML |
| 9 . | 376 | 9 | COPOLINE JAR WITH LID | 75 ML | 75 ML |
| 10 . | 377 | 10 | MICROSCOPIC ROUND COVER GLASS (ENGLISH GLASS) | 18 MM | 18 MM |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 378 | 1 | 10 % NaOCl Solution | Laboratory Reagent grade | 500 mL packs |
| 2 . | 379 | 2 | 2,.2 Dipyridyl Pure | AR / GR / Excellar Quality with All Assay Details | 100 gm packs |
| 3 . | 380 | 3 | 2-4 Dinitrophenyl Hydrazine | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 4 . | 381 | 4 | 4 Amino Antipyrine | AR / GR / Excellar Quality with All Assay Details | 100 gm packs |
| 5 . | 382 | 5 | Acetest reagent tablet | For estimation of Acetone & Acetoacetate in serum & urine | - |
| 6 . | 383 | 6 | acetic acid | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 7 . | 384 | 7 | Acetic acid Glacial | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 8 . | 385 | 8 | Acetone | Analytical grade | 500 gm |
| 9 . | 386 | 9 | Acid Ascorbic | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 10 . | 387 | 10 | Acid Benzoic | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 11 . | 388 | 11 | Acid citric | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 12 . | 389 | 12 | Acid Hippuric | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 13 . | 390 | 13 | Acid Hydrochloric AR / GR | Excellar Quality with All Assay Details /EM/Qualigen/Ranbaxy/SRL | 2.5 Litre packs |
| 14 . | 391 | 14 | Acid Hydrochloric LR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 15 . | 392 | 15 | Acid Lactic ( Lithium salt) | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 16 . | 393 | 16 | Acid Molybdic | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 17 . | 394 | 17 | Acid Nitric AR/GR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 18 . | 395 | 18 | Acid Phospho tungstic | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 19 . | 396 | 19 | Acid Picric | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 20 . | 397 | 20 | Acid Succinic acid LR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 21 . | 398 | 21 | Acid sulfuric AR/GR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 22 . | 399 | 22 | Acid Sulfuric LR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 23 . | 400 | 23 | Acid Sulphanilic. | AR / GR / Excellar Quality with All Assay Details.EM/Qualigen/Ranbaxy/SRL | 100 gm Packs |
| 24 . | 401 | 24 | Acid Sulphosalisylic | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 25 . | 402 | 25 | Acid Tartaric | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 26 . | 403 | 26 | Acid trichloride AR/GR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 27 . | 404 | 27 | Acid trichloroacetic AR/GR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 28 . | 405 | 28 | Agarose powder | analytical grade, | 100 gm pack |
| 29 . | 406 | 29 | Albumin Fraction - V Human. | Pure, AR / GR Quality with All Assay Details. Certified Material. | 5 or 10 gm packs |
| 30 . | 407 | 30 | Albumin Standard | 4.0 mg % in liquid stable | 1 x 3 ml packs |
| 31 . | 408 | 31 | albumin(bovine) | Pure, AR / GR Quality with All Assay Details. Certified Material. | 5 gm |
| 32 . | 409 | 32 | albumin(flakes) | Pure, AR / GR Quality with All Assay Details. Certified Material. | 500 gm |
| 33 . | 410 | 33 | Alcohol ethanol absolute | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 34 . | 411 | 34 | Alcohol Free Disinfectant for Blood Collection procedure of skin disinfection | Aqueous Benzalkonium Chloride Solutions | 1 Litre packs |
| 35 . | 412 | 35 | Alcohol methanol extra pure | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 36 . | 413 | 36 | Alcohol n-butyl | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 37 . | 414 | 37 | Alcohol propen 2- ol | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 38 . | 415 | 38 | Amidoschwartz 10B powder | Analytical grade | 50 gm |
| 39 . | 416 | 39 | Ammonia Solution (liquid) | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 40 . | 417 | 40 | Ammonical silver nitrate | Analytical grade | 100 gm |
| 41 . | 418 | 41 | Ammonium chloride AR/GR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 42 . | 419 | 42 | Ammonium Molybdate | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 43 . | 420 | 43 | Ammonium Sulphate | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 500 gm packs |
| 44 . | 421 | 44 | Ammonium Sulphate LR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 45 . | 422 | 45 | Ammonium Thyocyanate | EM/Qualigen/Ranbaxy/SRL | 250 gm |
| 46 . | 423 | 46 | Anesthetic Ether | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 47 . | 424 | 47 | Antimany Trichoric | EM/Qualigen/Ranbaxy/SRL | 50 gm |
| 48 . | 425 | 48 | Barbituric acid powder | Analytical grade | 100 gm |
| 49 . | 426 | 49 | Barium Chloride | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 50 . | 427 | 50 | Barium Hydroxide | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 428 | 1 | Benedict Qualitative Reagent | - | 2.5 Litre or 5 Litre packs |
| 2 . | 429 | 2 | benzidine powder | - | 100 gm |
| 3 . | 430 | 3 | Benzidine Pure | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 4 . | 431 | 4 | Benzoic acid | AR / GR / Excellar Quality with All Assay Details. | 100 gm Packs |
| 5 . | 432 | 5 | Bilirubin powder | Analytical grade, | 1 gm pack |
| 6 . | 433 | 6 | Bilirubin Pure | EM/Qualigen/Ranbaxy/SRL | 1 gm pack |
| 7 . | 434 | 7 | borax powder | - | 500 gm |
| 8 . | 435 | 8 | Bovine Albumin | EM/Qualigen/Ranbaxy/SRL | 5 gm pack |
| 9 . | 436 | 9 | Bromine Liquid | EM/Qualigen/Ranbaxy/SRL | 100 ml |
| 10 . | 437 | 10 | Caffine powder | analytical grade, | 100 gm pack |
| 11 . | 438 | 11 | Calcium Chloride | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 12 . | 439 | 12 | Casein | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 13 . | 440 | 13 | Cellulose acetate strip | For electrophoresis | - |
| 14 . | 441 | 14 | Cetylpyridinium Chloride | Analytical grade | 100 gm |
| 15 . | 442 | 15 | Chloroform | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 500 ml packs |
| 16 . | 443 | 16 | Cholesterol Powder | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 10 gm packs |
| 17 . | 444 | 17 | Chondroitin sulphate | Analytical grade | 100 gm |
| 18 . | 445 | 18 | Citric acid | Analytical grade | 100 gm |
| 19 . | 446 | 19 | Copper Sulphate AR/GR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 20 . | 447 | 20 | Copper Sulphate LR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 21 . | 448 | 21 | Costic soda | Commercial grade 50% | 500 gm |
| 22 . | 449 | 22 | Creatinine Powder | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 50 gm |
| 23 . | 450 | 23 | Cupric Acetate | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 24 . | 451 | 24 | D - Xylose Powder | AR / GR / Excellar Quality with All Assay Details | 100 gm packs |
| 25 . | 452 | 25 | Dextrin | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 26 . | 453 | 26 | Dextrose /D Glucose | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 27 . | 454 | 27 | Di.Nitro Phenyl Hydrazine. | AR / GR / Excellar Quality with All Assay Details | 100 gm Packs |
| 28 . | 455 | 28 | Diacetyl Monoxime. | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 100 gm packs |
| 29 . | 456 | 29 | Diethyl ether | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 30 . | 457 | 30 | Di-Sodium EDTA. | AR / GR / Excellar Quality with All Assay Details. | 500 gm Packs |
| 31 . | 458 | 31 | Di-Sodium Hydrogen Phosphate. | AR / GR / Excellar Quality with All Assay Details | 100 gm Packs |
| 32 . | 459 | 32 | Di-Sodium Phenyl Phosphate | AR / GR / Excellar Quality with All Assay Details | 100 gm packs |
| 33 . | 460 | 33 | Ditaurobilirubin powder | Analytical grade | 5 gm |
| 34 . | 461 | 34 | Ferric chloride powder | Analytical grade,EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 35 . | 462 | 35 | Fibrin | EM/Qualigen/Ranbaxy/SRL | 10 gm packs |
| 36 . | 463 | 36 | Fibrinogen | EM/Qualigen/Ranbaxy/SRL | 10 gm packs |
| 37 . | 464 | 37 | Formaldehyde | LR grade with Assay details Minimum 37-41 % w/v. Packs,EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 38 . | 465 | 38 | Formalin Solution | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 39 . | 466 | 39 | Fructose | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 40 . | 467 | 40 | Gelatin | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 41 . | 468 | 41 | Glacial Acitic acid | Analytical grade | 500 ml |
| 42 . | 469 | 42 | Glucose AR/GR | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 43 . | 470 | 43 | Glycerine | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 44 . | 471 | 44 | Hydrogen Peroxide | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 45 . | 472 | 45 | Hypochloride solution 5% | 5 Ltr can, with ISO certified company | 1 or 5 litre |
| 46 . | 473 | 46 | Indicator alpha nephthol | EM/Qualigen/Ranbaxy/SRL | 10 gm packs |
| 47 . | 474 | 47 | Indicator Bromo Cresol Green | EM/Qualigen/Ranbaxy/SRL | 10 gm packs |
| 48 . | 475 | 48 | Indicator Chlorophenol Red | EM/Qualigen/Ranbaxy/SRL | 10 gm packs |
| 49 . | 476 | 49 | Indicator Metheline blue | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 50 . | 477 | 50 | Indicator Methyl Red | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 478 | 1 | Indicator Methyl violet | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 2 . | 479 | 2 | Indicator Phenphtheline | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 3 . | 480 | 3 | Indicator Thymol | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 4 . | 481 | 4 | Indicator Toffer’s reagent | EM/Qualigen/Ranbaxy/SRL | 100 ml |
| 5 . | 482 | 5 | Iodine powder | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 6 . | 483 | 6 | Iso Propyl Alcohol | Laboratory Reagent grade | 500 mL packs |
| 7 . | 484 | 7 | Lactose | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 8 . | 485 | 8 | L-Alanine. | AR / GR / Excellar Quality with All Assay Details. | 100 gm packs |
| 9 . | 486 | 9 | Lead Acetate | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 10 . | 487 | 10 | Maltose | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 11 . | 488 | 11 | Mercuric Sulphate | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 12 . | 489 | 12 | Methanol. | AR / GR / Excellar Quality with All Assay Details. | 500 ml Packs |
| 13 . | 490 | 13 | Methyl melonic acid | powder, analytical grade | 100 gm |
| 14 . | 491 | 14 | Methyl Violate | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 15 . | 492 | 15 | n-Butanol | Analytical grade | 500 ml |
| 16 . | 493 | 16 | Ninhydrin powder | Analytical grade,EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 17 . | 494 | 17 | nitric acid | - | 500 ml |
| 18 . | 495 | 18 | O-Phosphoric Acid. | AR / GR / Excellar Quality with All Assay Details | 500 ml packs |
| 19 . | 496 | 19 | O-Toludine. | AR / GR / Excellar Quality with All Assay Details | 250 ml Packs |
| 20 . | 497 | 20 | para - Bromo Aniline. | AR / GR / Excellar Quality with All Assay Details. | 100 gm Packs |
| 21 . | 498 | 21 | Parrafin wax | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 22 . | 499 | 22 | Pepsin | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 23 . | 500 | 23 | Peptone | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 24 . | 501 | 24 | Petroleum Ether | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 25 . | 502 | 25 | Phenyl Hydrazine Hydrochloride Powder | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 26 . | 503 | 26 | Phloroglucinol | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 27 . | 504 | 27 | Picric Acid | AR / GR / Excellar Quality with All Assay Details | 500 gm Packs |
| 28 . | 505 | 28 | p-nitroaniline | Analytical grade | 100 gm |
| 29 . | 506 | 29 | Potassium Chloride | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 30 . | 507 | 30 | Potassium Dichromate | LR grade with Assay details. | 500 gm packs |
| 31 . | 508 | 31 | Potassium Dihydrogen Phosphate. | AR / GR / Excellar Quality with All Assay Details | 500 gm packs |
| 32 . | 509 | 32 | Potassium Ferricynate | AR / GR / Excellar Quality with All Assay Details | 500 gm Packs |
| 33 . | 510 | 33 | Potassium Iodide | AR / GR / Excellar Quality with All Assay Details | 500 gm Packs |
| 34 . | 511 | 34 | Potassium Oxalate. | AR / GR / Excellar Quality with All Assay Details | 500 gm Packs |
| 35 . | 512 | 35 | Pottassium Chromate | LR grade with Assay Details. | 500 ml packs |
| 36 . | 513 | 36 | Rennin | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 37 . | 514 | 37 | Resorsinol | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 38 . | 515 | 38 | Silver Nitrate | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 39 . | 516 | 39 | Sodium Acetate | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 40 . | 517 | 40 | Sodium acetate trihydrate | Analytical grade | 500 gm |
| 41 . | 518 | 41 | Sodium Azide | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 42 . | 519 | 42 | Sodium barbitone powder | Analytical grade | 100 gm |
| 43 . | 520 | 43 | Sodium Benzoate | analytical grade, | 100 gm pack |
| 44 . | 521 | 44 | Sodium Bicarbonate. | AR / GR / Excellar Quality with All Assay Details. | 500 gm Packs |
| 45 . | 522 | 45 | Sodium Bile salt | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 46 . | 523 | 46 | Sodium Carbonate | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 47 . | 524 | 47 | Sodium Chloride Anhydrous. | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL 500 gm Packs | 500 gm |
| 48 . | 525 | 48 | Sodium Citrate | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 49 . | 526 | 49 | Sodium Fluoride. | AR / GR / Excellar Quality with All Assay Details. | 500 gm Packs |
| 50 . | 527 | 50 | sodium hydroxide pellets | AR / GR / Excellar Quality with All Assay Details. | 500 gm Packs |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 528 | 1 | Sodium Hydroxide. | AR / GR / Excellar Quality with All Assay Details.EM/Qualigen/Ranbaxy/SRL In Pellets or Flakes | 500 gm Packs |
| 2 . | 529 | 2 | Sodium Hypobromide | EM/Qualigen/Ranbaxy/SRL | 500 ml |
| 3 . | 530 | 3 | Sodium Hypochlorite. | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 500 ml packs |
| 4 . | 531 | 4 | Sodium Molybdate | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 5 . | 532 | 5 | Sodium Nitrate | Analytical grade | 500 gm |
| 6 . | 533 | 6 | Sodium Nitrite AR / GR | AR / GR / Excellar Quality with All Assay Details. | 500 gm Packs |
| 7 . | 534 | 7 | Sodium Nitropruside. | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 500 gm Packs |
| 8 . | 535 | 8 | Sodium Nitroprusside | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 9 . | 536 | 9 | Sodium Phosphate | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 10 . | 537 | 10 | Sodium Potassium Tartrate | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL In ampoule packs. | 500 gm |
| 11 . | 538 | 11 | Sodium Sulphate. | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 500 gm Packs |
| 12 . | 539 | 12 | Sodium Sulphite Anhydrous. | AR / GR / Excellar Quality with All Assay Details | 500 gm Packs |
| 13 . | 540 | 13 | sodium taurocholate | - | 250 gm Packs |
| 14 . | 541 | 14 | Sodium Tungstate. | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 100 gm Packs |
| 15 . | 542 | 15 | Starch Soluble | AR / GR / Excellar Quality with All Assay Details. EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 16 . | 543 | 16 | Sucrose | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 17 . | 544 | 17 | Sulphanilic acid powder | Analytical grade, | 100 gm pack |
| 18 . | 545 | 18 | Sulphosalycilic Acid | AR / GR / Excellar Quality with All Assay Details | 100 gm Packs |
| 19 . | 546 | 19 | Sulphur Powder | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 20 . | 547 | 20 | Thiosemi Carbazide. | AR / GR / Excellar Quality with All Assay Details,EM/Qualigen/Ranbaxy/SRL | 500 gm Packs |
| 21 . | 548 | 21 | Thiourea. | AR / GR Quality with All Assay Details. | 100 gm Packs |
| 22 . | 549 | 22 | Thymol Crystals | AR / GR / Excellar Quality with All Assay Details. | 500 gm Pack |
| 23 . | 550 | 23 | Toludine blue O | Analytical grade | 100 ml |
| 24 . | 551 | 24 | Trisodium citrate | Analytical grade | 500 gm |
| 25 . | 552 | 25 | Triton X 100 | LR grade, Assay 98-100 % Max. limit of Impurity (Water) not more than 0.2% About | 500 ml packs |
| 26 . | 553 | 26 | Urea | EM/Qualigen/Ranbaxy/SRL | 500 gm |
| 27 . | 554 | 27 | Urease Powder | - | 100 gm |
| 28 . | 555 | 28 | uri strips for glucose,protein, ketone body | - | - |
| 29 . | 556 | 29 | Uric acid | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| 30 . | 557 | 30 | Vanillin | EM/Qualigen/Ranbaxy/SRL | 100 gm |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 558 | 1 | Auto Pipette Variable volume | 200 to 1000 µl Erba Biohit/ Cap Arrow | - |
| 2 . | 559 | 2 | Auto Pipette Variable volume | 50 to 200 µl Erba Biohit/ Cap Arrow | - |
| 3 . | 560 | 3 | Auto Pipette Variable volume | 20 to 100 µl Erba Biohit/ Cap Arrow | - |
| 4 . | 561 | 4 | Auto pipettes disposable Tips | For 1 to 10 ul | - |
| 5 . | 562 | 5 | Auto pipettes disposable Tips | For 10 to 200 ul | - |
| 6 . | 563 | 6 | Auto pipettes disposable Tips | For 1000 ul | - |
| 7 . | 564 | 7 | Auto pipettes of fixed volume | 10 ul Erba Biohit/ Cap Arrow | - |
| 8 . | 565 | 8 | Auto pipettes of fixed volume | 200 ul Erba Biohit/Cap Arrow | - |
| 9 . | 566 | 9 | Auto pipettes of fixed volume | 100 ul Erba Biohit/ Cap Arrow | - |
| 10 . | 567 | 10 | Auto pipettes of fixed volume | 1000 ul Erba Biohit | - |
| 11 . | 568 | 11 | Auto pipettes of fixed volume | 50 ul Erba Biohit | - |
| 12 . | 569 | 12 | Burette | 25 ml glass burettes with glass cork | - |
| 13 . | 570 | 13 | Calibrated weights | ISO 9000, 2001 certified with calibration certificate, Ranges - 1µg, 50 µg, 100 µg, 250 µg, 500 µg, 1000 µg, 5000 µg, and 10000 µg. | - |
| 14 . | 571 | 14 | Digital hygrometer (Temperature & Humidity meter) | a. temperature range. Temperature: -50 to +70°C (-58 to +158°F), Humidity range: 10% to 99%RH b.Resolution: Temperature: 0.1°C (0.1°F), Humidity: 1%RH c.accuracy: Temperature: ±1°C (1.8°F), Humidity: ±5% RH (40% to 80%) ISO 9000, 2001 certified with calibration certificate d.power supply: 1.5V(AAA size) x1 e.product dimension: 100x108x20 mm f.weight: approx 160 gm g. storage condition: -20 to +60°C,20% to 80%RH h. features: display temp., humidity, time simultaneously, memory of MAX and MIN measuring value, alarm function, clock & calendar function, desk-top placing or wall hanging. supply with Calibration Certificate | - |
| 15 . | 572 | 15 | Digital Temperature Sensor | Digital displayer, Temperature probe attached with wire. Temperature: -50 to +70°C (-58 to +158°F) ISO 9000, 2001 certified with calibration certificate Wire should be of good quality and should tolerate freezing as well as high temperature. | - |
| 16 . | 573 | 16 | Eppendrof cups | Plastic with cap 1.5 ml, conical | - |
| 17 . | 574 | 17 | Eppendrof cups | Plastic with cap 1 ml,conical | - |
| 18 . | 575 | 18 | Glass slide (80x60 mm) | - | - |
| 19 . | 576 | 19 | Graduated Glass cylinder | Class A glass cylinder for accurate measurement of Q.C material. With unique serial number for tracebility and certificate of calibration to national standard. Volume 10 ml. | - |
| 20 . | 577 | 20 | Microfuge Tubes 1 mL with Rack. | Flat Cap, Taper bottom, Thin Wall, Graduated, Polypropylene. Eppendorf type. One Rack for 10-20 Tube Free with every 200 MicroTubes. Pack of 1000 tubes | - |
| 21 . | 578 | 21 | Microfuge Tubes 0.5 mL with Rack. | Flat Cap, Taper bottom, Thin Wall, Graduated, Polypropylene. Eppendorf type. One Rack for 10-20 Tube Free with every 200 MicroTubes. Pack of 1000 tubes | - |
| 22 . | 579 | 22 | Microfuge Tubes 1.5 mL with Rack. | Flat Cap, Taper bottom, Thin Wall, Graduated, Polypropylene. Eppendorf type. One Rack for 10-20 Tube Free with every 200 MicroTubes. Pack of 1000 tubes | - |
| 23 . | 580 | 23 | Micropipette Stand with Tips Holder | 4 pipette stand, ABS Plastic Autoclavable | - |
| 24 . | 581 | 24 | Pipette 5ml Graduated | Glass Borosil with Calibration Certificate for Graduation and Volume Accuracy | - |
| 25 . | 582 | 25 | Plastic Rack for Test-Tubes | Size 6 x 4 three layer Holes for 12 x 75 mm tubes, Plastc Pack of 10 racks | - |
| 26 . | 583 | 26 | Plastic Rack for Test-Tubes | Size 10 x 3 three layer Holes for 12 x 75 mm tubes, Plastc Pack of 10- racks | - |
| 27 . | 584 | 27 | Plastic Rack for Test-Tubes | Size 12 x 6 three layer Holes for 12 x 75 mm tubes, Plastc Pack of 10 racks | - |
| 28 . | 585 | 28 | Plastic syringe | Sterile, 15 ml | - |
| 29 . | 586 | 29 | PVC Rack Small | For small size Test Tubes 100 x 12 mm and 75 x 12 mm 12 x 4 Rows with handle. | - |
| 30 . | 587 | 30 | Rack for Tubes in ABS Plastic with or without handle, | About 50 Round Hole positions, various colors. Diameters : 17 mm Pack of 10 | - |
| 31 . | 588 | 31 | Rack for Tubes in ABS Plastic with or without handle, | About 50 Round Hole positions, various colors. Diameters : 13 mm Pack of 10 | - |
| 32 . | 589 | 32 | Rack for Tubes in ABS Plastic with or without handle, | About 50 Round Hole positions, various colors. Diameters : 7 mm Pack of 10 | - |
| 33 . | 590 | 33 | Refrigerator Rack for Microtubes | 50 wells. Lower part of rack can hold water or crushed ice. Pack of 10 racks. | - |
| 34 . | 591 | 34 | Secondary tube for serum storage | 12mmODX75mm length, capacity 4-5ml,with pastic cap. | - |
| 35 . | 592 | 35 | Stainless steel aluminium | For 2 ml test tubes | - |
| 36 . | 593 | 36 | Storage Rack for Microtubes in Acryllic Box | Box with Transparent Cover and about 50 wells for 0.5 ml microtubes Pack of 10 | - |
| 37 . | 594 | 37 | Test tube | 15x150 mm (inner diameter) without rim Borosil | 100 article |
| 38 . | 595 | 38 | Test tube flat bottom | 15x75 mm Borosil | - |
| 39 . | 596 | 39 | Test Tube Rack - Peg Type | Plastic, Autoclavable, suitable for Test Tubes 10 - 15 mm diameter. Pack of 20 racks | - |
| 40 . | 597 | 40 | Test tube racks of | with 48 wholes | - |
| 41 . | 598 | 41 | Test tube stand | Aluminium stand with 6 x 3 holes in which 20 ml test tube should be placed | - |
| 42 . | 599 | 42 | Test tube without rim, Trough glass for washing, round bottom | 12x75 mm Borosil | - |
| 43 . | 600 | 43 | Polythin beker non gratuated | 100 ml, 250 ml, 500 ml, 1000 ml | - |
| 44 . | 601 | 44 | Glass dropper ( 30 cm long x 0.5 cm inner diameter ) ( 30 cm long x 0.75 cm inner diameter | - | 5000 article |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 602 | 1 | Hypocloride | Disinfectant | 10 Ltr |
| 2 . | 603 | 2 | Sanitizer | Alcoholic Rub | 500 ml |
| 3 . | 604 | 3 | Glass Bottle | Glass Bottle with 500 mnk Capacity with Screw Cap ( Good Quality Glass Material) | 500 ml |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 605 | 1 | Soyabean Casien Digest | Hi-media | 500 gm |
| 2 . | 606 | 2 | Simmon\s Citrate Media | Hi-media | 500 gm |
| 3 . | 607 | 3 | TCBS Media | Hi-media | 500 gm |
| 4 . | 608 | 4 | SS Agar | Hi-media | 500 gm |
| 5 . | 609 | 5 | Bile Esculin Agar | Hi-media | 500 gm |
| 6 . | 610 | 6 | Saubroud\s Dextrose Agar | Hi-media | 500 gm |
| 7 . | 611 | 7 | Sodium Chloride powder | Hi-media | 500 gm |
| 8 . | 612 | 8 | Sodium Torocholate powder | Hi-media | 500 gm |
| 9 . | 613 | 9 | Yeast extract | Hi-media | 500 gm |
| 10 . | 614 | 10 | Di-sodium hydrogen sulphate | Hi-media | 500 gm |
| 11 . | 615 | 11 | Corn meal agar | Hi-media | 500 gm |
| 12 . | 616 | 12 | Sodium deoxycholate | Hi-media | 500 gm |
| 13 . | 617 | 13 | Methyl violet | Hi-media | 100 gm |
| 14 . | 618 | 14 | Iodine | Hi-media | 50 gm |
| 15 . | 619 | 15 | Crystal Violet | Hi-media | 100 gm |
| 16 . | 620 | 16 | Muller Hinton Agar | Hi-media | 500 gm |
| 17 . | 621 | 17 | Mcconkey Agar | Hi-media | 500 gm |
| 18 . | 622 | 18 | Beef extract powder | Hi-media | 500 gm |
| 19 . | 623 | 19 | Agar agar powder | Hi-media | 5 kg |
| 20 . | 624 | 20 | Peptone type-1 bacteriological | Hi-media | 500 gm |
| 21 . | 625 | 21 | Mannitol salt agar | Hi-media | 500 gm |
| 22 . | 626 | 22 | Glucose anhydrus | Hi-media | 500 gm |
| 23 . | 627 | 23 | lactose powder | Hi-media | 500 gm |
| 24 . | 628 | 24 | Sucrose powder | Hi-media | 500 gm |
| 25 . | 629 | 25 | Mannitol powder | Hi-media | 500 gm |
| 26 . | 630 | 26 | Triple sugar Iron | Hi-media | 500 gm |
| 27 . | 631 | 27 | Wilson & Blair agar (Ready to use) , M322 | Hi-media | 500 gm |
| 28 . | 632 | 28 | XLD agar | Hi-media | 500 gm |
| 29 . | 633 | 29 | Andrede\s Indicator | Hi-media | 200 ml |
| 30 . | 634 | 30 | Lactophenol cotton blue | Hi-media | 500 ml |
| 31 . | 635 | 31 | Indian Ink | Hi-media | 200 ml |
| 32 . | 636 | 32 | Geimsa stain | Hi-media | 500 ml |
| 33 . | 637 | 33 | Basic fuschin stain | Hi-media | 100 gm |
| 34 . | 638 | 34 | Methylene blue | Hi-media | 100 gm |
| 35 . | 639 | 35 | Neutral red | Hi-media | 100 gm |
| 36 . | 640 | 36 | Methyl red | Hi-media | 100 gm |
| 37 . | 641 | 37 | Melachite green | Hi-media | 100 gm |
| 38 . | 642 | 38 | Briliant green | Hi-media | 100 gm |
| 39 . | 643 | 39 | Disodium Hydrogen phosphate | Hi-media | 500 gm |
| 40 . | 644 | 40 | Sodium Bicarbonate | Hi-media | 500 gm |
| 41 . | 645 | 41 | Barium Chloride | Hi-media | 500 ml |
| 42 . | 646 | 42 | KOH pallets | Hi-media | 500 gm |
| 43 . | 647 | 43 | NaOH Pallets | Hi-media | 500 gm |
| 44 . | 648 | 44 | Phenol crystals | Hi-media/Mark | 500 ml |
| 45 . | 649 | 45 | Potassium Tellurite | Hi-media | 500 gm |
| 46 . | 650 | 46 | Methanol | Hi-media/Mark | 500 ml |
| 47 . | 651 | 47 | Glyserol | Hi-media/Mark | 500 ml |
| 48 . | 652 | 48 | Lactic acid | Hi-media/Mark | 500 ml |
| 49 . | 653 | 49 | Pottasium Permanganate | Hi-media/Mark | 500 gm |
| 50 . | 654 | 50 | Ammonia | Hi-media/Mark | 500 ml |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 655 | 1 | Pottasium Dichromate | Hi-media/Mark | 500gm |
| 2 . | 656 | 2 | Disposable petri dish 90 mm good quality | Hi-media | 500 × 1 pack |
| 3 . | 657 | 3 | Disposable petri dish 100 mm good quality | Tarson | 500 × 1 pack |
| 4 . | 658 | 4 | Urine container good quality | Tarson | 100 × 1 pack |
| 5 . | 659 | 5 | Sputum container good quality | Tarson | 100 × 1 pack |
| 6 . | 660 | 6 | Disposable Loop | Tarson | 200 × 1 pack |
| 7 . | 661 | 7 | Pus stick | Hi-media | 1000 × 1 pack |
| 8 . | 662 | 8 | Spirit lamp aluminium (125mm) good quality | Tarson | aluminium |
| 9 . | 663 | 9 | Acid prrof plastic bucket with lids, good quality, 15 liter white/red | Tarson | 10 litter |
| 10 . | 664 | 10 | Test tube(18mm x150 mm) | Tarson | 4000 |
| 11 . | 665 | 11 | Measuring cylinder (100ml) | Borosil | 10 |
| 12 . | 666 | 12 | Measuring cylinder (500ml) | Borosil | 10 |
| 13 . | 667 | 13 | Glass Beaker (Large) | Borosil | 10 |
| 14 . | 668 | 14 | Funnels 200mm | Borosil | 10 |
| 15 . | 669 | 15 | 1000 µL Sterile filter tips | Hi-media | 1 × 96 (rack packing) |
| 16 . | 670 | 16 | 200 µl Sterile filter tips | Hi-media | 1 × 96 (rack packing) |
| 17 . | 671 | 17 | 20 µL Sterile filter tips | Hi-media | 1 × 96 (rack packing) |
| 18 . | 672 | 18 | 10 µL Sterile filter tips | Hi-media | 1 × 96 (rack packing) |
| 19 . | 673 | 19 | Powder free nitrile gloves( for PCR) (M) & (S)-SIZE | Hi-media/Mark | 10000 |
| 20 . | 674 | 20 | Sterilium | Hi-media/Mark | 500 ml |
| 21 . | 675 | 21 | Simple surgical mask | Hi-media/Mark | 100 × 1pack |
| 22 . | 676 | 22 | Ethanol for (PCR) | Hi-media/Mark | 450 ml × 1 bottle |
| 23 . | 677 | 23 | Isopropyl alcohol (For Instruments) | Hi-media/Mark | 450 ml × 1 bottle |
| 24 . | 678 | 24 | Hypochlorite 5% solution | Hi-media/Mark | 2-5 litter × 1 container |
| 25 . | 679 | 25 | Liquid hand wash solution | Hi-media/Mark | 500 ml × pack |
| 26 . | 680 | 26 | (H2SO4) Sulphuric acid | Hi-media/Mark | 2.5 liter |
| 27 . | 681 | 27 | HCL hydrochloric acid | Hi-media/Mark | 2.5 liter |
| 28 . | 682 | 28 | Formaline | Hi-media/Mark | 5 liter |
| 29 . | 683 | 29 | Di-pottasium hydrogen phosphate | Hi-media/Mark | 500 gm |
| 30 . | 684 | 30 | Microglass slide (75 x25mm) | Hi-media/Mark | 70 nos × 1 pack |
| 31 . | 685 | 31 | Micro glass slide concavity slide 75x25 mm (1.3 to 1.5 mm thick / diameter of cavity approx. 15 mm) | Blue Star | 70 nos × 1 pack |
| 32 . | 686 | 32 | Cover slip (22x 22 mm) | Blue Star | 50× 1 pack |
| 33 . | 687 | 33 | Cover slip (22x 25 mm) | Blue Star | 50× 1 pack |
| 34 . | 688 | 34 | Cover slip (22x 50 mm) | Blue Star | 50× 1 pack |
| 35 . | 689 | 35 | Cover slip (18x 18 mm) | Blue Star | 50× 1 pack |
| 36 . | 690 | 36 | Test tube (12x 75 mm) | Borosil | 50× 1 pack |
| 37 . | 691 | 37 | Durhams Tube | Blue Star | 1000× 1 pack |
| 38 . | 692 | 38 | Screw cap autoclaveble bottole(250 ml) | Borosil | 250 ml ×bottle |
| 39 . | 693 | 39 | Screw cap autoclaveble bottole (500 ml) | Borosil | 500 ml ×bottle |
| 40 . | 694 | 40 | Screw cap autoclaveble bottole (1 lit) | Borosil | 1000 ml ×bottle |
| 41 . | 695 | 41 | acetone | Hi-media | 2.5 litter × bottle |
| 42 . | 696 | 42 | kovacs reagent(Ready to use) | Hi-media | 250 ml ×bottle |
| 43 . | 697 | 43 | giemsa srain | Hi-media | 500 ml |
| 44 . | 698 | 44 | albert\s stain A and B ( ready to use ) | Hi-media | (A 125ml + b 125ml)×pack |
| 45 . | 699 | 45 | MC Farland standard Media | Hi-media | 500gm |
| 46 . | 700 | 46 | phenyl alenuin agar | Hi-media | 500gm |
| 47 . | 701 | 47 | cled agar | Hi-media | 500gm |
| 48 . | 702 | 48 | carbol fuschin powder | Hi-media | 500gm |
| 49 . | 703 | 49 | Nutrient agar | Hi-media | 500gm |
| 50 . | 704 | 50 | sheep blood agar | Hi-media | 500gm |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 705 | 1 | glucose phosphate broth | Hi-media | 500gm |
| 2 . | 706 | 2 | glycerole buffer saline | Hi-media | 500gm |
| 3 . | 707 | 3 | ferric chlorite anhydrous | Hi-media | 500 gm |
| 4 . | 708 | 4 | alpha nephthol | Hi-media | 500 gm |
| 5 . | 709 | 5 | oxidase reagent | Hi-media | 100gm |
| 6 . | 710 | 6 | hydrogen peroxide | Hi-media | 100ml |
| 7 . | 711 | 7 | urea difco | Hi-media | 500 gm |
| 8 . | 712 | 8 | mono pottasium phosphate | Hi-media | 500 gm |
| 9 . | 713 | 9 | alkaline peptone water | Hi-media | 500 gm |
| 10 . | 714 | 10 | bactophenol red | Hi-media | 100 gm |
| 11 . | 715 | 11 | phenol red | Hi-media | 100 gm |
| 12 . | 716 | 12 | yellow tips - 20 µl | Tarson | 1000 × pack |
| 13 . | 717 | 13 | blue tips - 1000µl | Tarson | 1000 × pack |
| 14 . | 718 | 14 | filter paper rough (50*70) | Tarson | 1000 × pack |
| 15 . | 719 | 15 | Distilled water | lab ultra | 10 litter |
| 16 . | 720 | 16 | single use plastic pasteur-pipettes sterile individually packed | genaxy | 500 × pack |
| 17 . | 721 | 17 | Eppendorf tube (1.5 ML) | Tarson | 500 × pack |
| 18 . | 722 | 18 | Eppendorf tube (2.0 ML) | Tarson | 500 × pack |
| 19 . | 723 | 19 | nuclease free water | Hi-media | 500ML × 1 Bottle |
| 20 . | 724 | 20 | cryovials (2.0ML) | Tarson | 100 × pack |
| S.NO | TenderItemID | Sr. No. | Item Name | Specification | Pack size |
| 1 . | 725 | 1 | Immunoflorescence-Respirtaory Syncitial Virus –Slide with adsorbed antigens , Anti Respirtaory SyncitialVirus-(RSV) (IgM),Ready to Use Reagents | •In built Cell Control well • Ready to Use NC & PC | IVD & CE marked Pack size 10/20/30/50/100slides |
| 2 . | 726 | 2 | Immunoflorescence-Rubella virus -Slide with adsorbed antigens, Anti-Rubella virus (IgG), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 3 . | 727 | 3 | Immunoflorescence-Toxoplasma Gondii –Slide with adsorbed with protozoal smear at least 2fields, AntiToxoplasma Gondii (IgA), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 4 . | 728 | 4 | Immunoflorescence-Toxoplasma Gondii –Slide with adsorbed with protozoal smear at least 2fields, AntiToxoplasma Gondii (IgG), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 5 . | 729 | 5 | Immunoflorescence-Toxoplasma Gondii –Slide with adsorbed with protozoal smear at least 2fields, AntiToxoplasma Gondii (IgM), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 6 . | 730 | 6 | Immunoflorescence-Varicella zoster virus –Slide with adsorbed antigens , Anti Varicella zoster virus-VZV (IgM), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 7 . | 731 | 7 | Immunoflorescence-Varicella zoster virus –Slide with adsorbed antigens , Anti Varicella zoster virus-VZV (IgA), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 8 . | 732 | 8 | Immunoflorescence-Varicella zoster virus –Slide with adsorbed antigens , Anti Varicella zoster virus-VZV (IgG), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 9 . | 733 | 9 | Immunoflorescence-Mosaic Chlamydia –Slide with adsorbed antigens at least 2 fields, MosaicChlamydia Trachomatis / C. Pneumoniae (IgM), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 10 . | 734 | 10 | Immunoflorescence-Mosaic: Herpes Simplex Virus –Slide with adsorbed antigens at least 2 fields, MosaicHerpes Simplex Virus(HSV1/HSV2(IgG), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 11 . | 735 | 11 | Immunoflorescence-Mosaic: Herpes Simplex Virus –Slide with adsorbed antigens at least 2 fields, MosaicHerpes Simplex Virus(HSV1/HSV2(IgM), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 12 . | 736 | 12 | Immunoflorescence-Epstein Barr Virus –Slide with expressing cells , Epstein Barr Virus-EBVaviditytest (CA-IgG/CA-IgM/EBV-EA/EBV-NA), | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 13 . | 737 | 13 | Immunoflorescence-TO.R.C.H.Profile –Slide with adsorbed antigens For TORCH profile IgG, | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 14 . | 738 | 14 | Immunofluorescent Assay for Viral and Bacteriapneumonia - (Legionella, Mycoplasma, Coxiella,Chlamydia, Adenovirus, Respiratory syncitial virus,Parainfluenza, Influenza A and B) -IgMImmunofluorescent Assay | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 15 . | 739 | 15 | Immunofluorescent Assay for Viral and Bacteriapneumonia - (Legionella, Mycoplasma, Coxiella,Chlamydia, Adenovirus, Respiratory syncitial virus,Parainfluenza, Influenza A and B) -IgG ImmunofluorescentAssay | • In built Cell Control well • Ready to Use NC & PC• Ready to Use reagents | IVD & CE marked Pack size 10/20/30/50/100slides |
| 16 . | 740 | 16 | Kit - for CD4/ CD8 - Close system - BD FACS calibur | - | - |
| 17 . | 741 | 17 | Kit - HDV – IgM –96 well ELISA | Serum can be used as sample.• Both Sensitivity and specificity should be more than 99%.• Documented study should be provided along with tender forsensitivity & specificity claims.• Should have shelf life of 1 – 2 years.• Should be stored at room temperature or in refrigerator (2 – 8 C).• Company should provide Good manufacturing product (GMP)/ WHOcertificate & ISO 13485 certificate / FDA approved along with tender.• Kit should provide all accessories & positive and negative controls.• For ELISA kit, 12 strips of 8 wells should be supplied• Should have good consumer base in Gujarat.• Expiry should be 1 – 2 year from date of Manufacturing.• It is preferable, if kit is approved by any apex Govt. institute in India.• It is preferable, if kit has good rapport in commercial market sincelast 3 years.• Detailed literature regarding kit should be provided along withtender.• Authority letter from Manufacturer is mandatory.For imported item, CE certificate is must. | 96 well ELISA |
| 18 . | 742 | 18 | Kit - HDV Ag – 96 well ELISA | Serum can be used as sample. • Both Sensitivity & Specificity should be more than 99%. • Documented study should be provided along with tender for sensitivity & specificity claims. • Should have shelf life of 1– 2 years. • Should be stored at room temperature or in refrigerator (2 – 8 C). • Company should provide Good manufacturing product GMP/ WHO certificate & ISO 13485 certificate / FDA approved along with tender. • Kit should provide all accessories & positive ad negative controls. • For ELISA kit, strips of 8 wells should be supplied • Should have good consumer base in Gujarat. • Expiry should be 1– 2 year from date of Manufacturing. • It is preferable, if kit is approved a apex Govt. institute in India. • It is preferable, if kit has good rapport in commercial market since last 3 years. • Detailed literature regarding kit should be provided along with tender. • Authority letter from Manufacture is mandatory. • For imported item, CE certificate is must. | 96 well ELISA |
| 19 . | 743 | 19 | Kit – JE VIRUS– 96 well ELISA Serum/ CSF can be used as sample. | • Both Sensitivity & Specificity should be more than 99%. • Documented study should be provided along with tender for sensitivity & specificity claims. • Should have shelf life of 1– 2 years. • Should be stored at room temperature or in refrigerator (2 – 8 C). • Company should provide Good manufacturing product GMP/ WHO certificate & ISO 13485 certificate / FDA approved along with tender. • Kit should provide all accessories & positive ad negative controls. • For ELISA kit, strips of 8 wells should be supplied • Should have good consumer base in Gujarat. • Expiry should be 1– 2 year from date of Manufacturing. • It is preferable, if kit is approved a apex Govt. institute in India. • It is preferable, if kit has good rapport in commercial market since last 3 years. • Detailed literature regarding kit should be provided along with tender. • Authority letter from Manufacture is mandatory. • For imported item, CE certificate is must. | 96 well ELISA |
| 20 . | 744 | 20 | Kit – Anti- HBS titre 96 well ELISA | • Serum can be used as sample.• Both Sensitivity and specificity should be more than 99%.• Documented study should be provided along with tender forsensitivity & specificity claims.• Should have shelf life of 1 – 2 years.• Should be stored at room temperature or in refrigerator (2 – 8 C).• Company should provide Good manufacturing product (GMP)/ WHOcertificate & ISO 13485 certificate / FDA approved along with tender.• Kit should provide all accessories & positive and negative controls.• For ELISA kit, 12 strips of 8 wells should be supplied• Should have good consumer base in Gujarat.• Expiry should be 1 – 2 year from date of Manufacturing.• It is preferable, if kit is approved by any apex Govt. institute in India.• It is preferable, if kit has good rapport in commercial market sincelast 3 years.• Detailed literature regarding kit should be provided along withtender.• Authority letter from Manufacturer is mandatory.For imported item, CE certificate is must. | 96 well ELISA |
| 21 . | 745 | 21 | PCR Kit - HCV One step RT PCR Kit – | Should have broadest detection profile -Should have broadest detection profile while remaining specific to HCV genome -Primer and Probe sequences should have 100 % homology with a broad range & clinically relevant reference sequences based on a comprehensive bioinformatics analysis. -With endogenous ACTB control -Should contain all required reagents -kit of 150 reagents | - |
| 22 . | 746 | 22 | Real time PCR based kit for Dengue genotyping – | • Real Time based kit for indetification and genotyping for dengue virus in human sample. • Preferred sample type is serum for the detection of the virus. • Chemistry – Taqman Probe based chemistry for detection. • Consists of following components – o Isolation kit for isolation of nucleic acid from sample o Primers & Probes for detection of all dengue types o Master mix for detection of the same in real time PCR o Pack size of 96 reaction • Sequence of the primers & probe – DenS (GGATAGACCAGAGATCCTGCTGT ) DenAs1 (CATTCCATTTTCTGGCGTTC ) DenAs2 (CAATCCATCTTGCGGCGCTC) DenP (CAGCATCATTCCAGGCACAG ) • Should be validated on LightCycler real time PCR system. | - |
| 23 . | 747 | 23 | Real-Time PCR Kit - HBV Qualitative - Compatible with thermocycler Qiagen | Real-Time PCR Kit - HBV Quantitative- Compatible with thermocycler Qiagen | 250 Reaction |
| 24 . | 748 | 24 | Real-Time PCR Kit - HDV Qualitative - Compatible with thermocycler Qiagen | Real-Time PCR Kit - HDV Quantitative- Compatible with thermocycler Qiagen | 250 Reaction |
| 25 . | 749 | 25 | Real-Time PCR Kit - HCV Qualitative - Compatible with thermocycler Qiagen | Real-Time PCR Kit - HCV Quantitative- Compatible with thermocycler Qiagen | 250 Reaction |
| 26 . | 750 | 26 | Real-Time PCR Kit - HPV 6/11 - Compatible with thermocycler Qiagen | - | 250 Reaction |
| 27 . | 751 | 27 | Real-Time PCR Kit - HPV 6/18 - Compatible with thermocycler Qiagen | - | 250 Reaction |
| 28 . | 752 | 28 | Real-Time PCR Kit - HPV High Risk Quantitative - Compatible with thermocycler Qiagen | - | 250 Reaction |
| 29 . | 753 | 29 | Real-Time PCR Kit - HPV high risk typing - Compatible with thermocycler Qiagen | - | 250 Reaction |
| 30 . | 754 | 30 | Real-Time PCR Kit - HSV I& II typing - Compatible with thermocycler Qiagen | - | 250 Reaction |
| 31 . | 755 | 31 | Real-Time PCR Kit - NHS Meningitidis - NHS Meningitidis | (N.meningitidis, H.influenzae, Str.pneumoniae), Compatible with thermocycler Qiagen | 250 Reaction |
| 32 . | 756 | 32 | Real-Time PCR Kit – Rotavirus - Compatible with thermocycler Qiagen | - | 250 Reaction |
| 33 . | 757 | 33 | Real-Time PCR Kit - Rotavirus/Norovirus/Astrovirus - Compatible with thermocycler Qiagen | - | 250 Reaction |
| 34 . | 758 | 34 | RNA extraction kit - Qiagen , 50 test Column based for extraction of RNA from viruses in clinical samples | - | 50 Reaction |
| 35 . | 759 | 35 | RNA extraction kit - Qiagen , 2 x 50 test Column based for extraction of RNA from viruses in clinical samples | - | 2x50 Reaction |
| 36 . | 760 | 36 | RNA extraction kit - Qiagen , 250 test Column based for extraction of RNA from viruses in clinical samples | - | 250 Reaction |
| 37 . | 761 | 37 | RNA extraction Kit for Body fluids - Qiagen , 50 test Column based for extraction of RNA from viruses in clinical samples | - | 50 Reaction |
| 38 . | 762 | 38 | DNA extraction kit - QIAamp DNA Blood mini Kit 250 test /50 tests | - | 250 Reaction |
| 39 . | 763 | 39 | DNA extraction kit - QIAamp DNA purfiation from whole Blood samples (250 reactions) | - | 250 Reaction |
| 40 . | 764 | 40 | DNA extraction Kit for Blood - QIAamp DNA purfiation from Serum samples (250 reactions) | - | 250 Reaction |
| 41 . | 765 | 41 | Universal master mix for PCR - For 1000 reactions | - | 1000 Reaction |
| 42 . | 766 | 42 | DNA extraction Kit for Body fluids - QIAamp DNA purfiation from tissues (250 reactions) | - | 250 Reaction |
| 43 . | 767 | 43 | Immunotroll cells for quality control of CD-4 test (Normal count cells)- 60 tests | - | 60 Test |
| 44 . | 768 | 44 | Immunotroll cells for quality control of CD-4 test (low count cells)- 60 tests | - | 60 Test |
| 45 . | 769 | 45 | sample tubes for CD4 flow count test-3.5 ml capacity, 1X 150 No. | - | 1X 150 No |
| 46 . | 770 | 46 | Molecular biology grade microcentrifuge tubes-1.7ml capacity, 1000No. | - | 1000 Reaction |
| 47 . | 771 | 47 | Prodin 300 preservative-50mol bottel | - | 50 mol bottel |
| 48 . | 772 | 48 | TaqMan Universal Master Mix Lt.with UNG- 5 ml sufficient for 200 reaction at 50 µl each | - | 200 Reaction |
Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy
For Tender Information Services Visit : TenderDetail
