Ministry Of Health And Family Welfare-MOHFW has published Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later.. Submission Date for this Tender is 04-12-2020. Chemical Supply Tenders in NEIGRIHMS, Shillong, Meghalaya Meghalaya. Bidders can get complete Tender details and download the document.
| Sr No | CorrigendumDate | Corrignedum | CorrigendumType | NewSubmissionDate |
| 1 | 20-Jan-2020 | Extension | Date | 21-02-2020 |
| 2 | 13-Feb-2020 | Date Extensionn2 | Date | 05-03-2020 |
| 3 | 03-Mar-2020 | Extension2 | Date | 17-04-2020 |
| 4 | 10-Nov-2020 | Date Extension November | Date | 04-12-2020 |
| 5 | 27-Nov-2020 | Amendment | Fee | 04-12-2020 |
| Description of Stores /Items: Open e-Tender for processing of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, etc for the Institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. | |||||
|---|---|---|---|---|---|
| Sl. No. | Item Description | Item Code / Make | Quantity | Units | |
| 1 | 1.01 | Albumin | Item1 | 1 | per ml |
| 2 | 1.02 | Microalbumin | Item2 | 1 | per ml |
| 3 | 1.03 | Gamma Glutamyl Tranferase | Item3 | 1 | per ml |
| 4 | 1.04 | (??- GGT) | Item4 | 1 | per ml |
| 5 | 1.05 | Amylase | Item5 | 1 | per ml |
| 6 | 1.06 | Lipase | Item6 | 1 | per ml |
| 7 | 1.07 | CK | Item7 | 1 | per ml |
| 8 | 1.08 | CK-MB | Item8 | 1 | per ml |
| 9 | 1.09 | LDH | Item9 | 1 | per ml |
| 10 | 1.1 | Total Cholesterol | Item10 | 1 | per ml |
| 11 | 1.11 | Triglyceride | Item11 | 1 | per ml |
| 12 | 1.12 | HDL | Item12 | 1 | per ml |
| 13 | 1.13 | LDL | Item13 | 1 | per ml |
| 14 | 1.14 | Calcium | Item14 | 1 | per ml |
| 15 | 1.15 | Copper | Item15 | 1 | per ml |
| 16 | 1.16 | Phosphorus | Item16 | 1 | per ml |
| 17 | 1.17 | Zinc | Item17 | 1 | per ml |
| 18 | 1.18 | Parameter | Item18 | 1 | per ml |
| 19 | 1.19 | Iron | Item19 | 1 | per ml |
| 20 | 1.2 | TIBC | Item20 | 1 | per ml |
| 21 | 1.21 | ADA | Item21 | 1 | per ml |
| 22 | 1.22 | ADA Calibrator | Item22 | 1 | per ml |
| 23 | 1.23 | G-6-PD | Item23 | 1 | per ml |
| 24 | 1.24 | Glycosylated Hb | Item24 | 1 | per ml |
| 25 | 1.25 | Glycosylated Hb Calibrator | Item25 | 1 | per ml |
| 26 | 1.26 | CRP | Item26 | 1 | per ml |
| 27 | 1.27 | CRP Calibrator | Item27 | 1 | per ml |
| 28 | 1.28 | a-1 Acid Glycoprotein | Item28 | 1 | per ml |
| 29 | 1.29 | Ammonia | Item29 | 1 | per ml |
| 30 | 1.3 | Lactate | Item30 | 1 | per ml |
| 31 | 1.31 | Glutathione Peroxidase | Item31 | 1 | per ml |
| 32 | 1.32 | Superoxide dismutase | Item32 | 1 | per ml |
| 33 | 1.33 | Total Antioxidant Status | Item33 | 1 | per ml |
| 34 | 1.34 | Homocysteine | Item34 | 1 | per ml |
| 35 | 1.35 | ASO | Item35 | 1 | per ml |
| 36 | 1.36 | RF | Item36 | 1 | per ml |
| 37 | 1.37 | Lipoprotein (a) | Item37 | 1 | per ml |
| 38 | 1.38 | Lipoprotein (a) Calibrator | Item38 | 1 | per ml |
| 39 | 1.39 | Transferrin | Item39 | 1 | per ml |
| 40 | 1.4 | Cystatin C | Item40 | 1 | per ml |
| 41 | 1.41 | Gentamycin | Item41 | 1 | per ml |
| 42 | 1.42 | Barbiturates | Item42 | 1 | per ml |
| 43 | 1.43 | Valproic Acid | Item43 | 1 | per ml |
| 44 | 1.44 | Phenitoin | Item44 | 1 | per ml |
| 45 | 1.45 | VMA | Item45 | 1 | per ml |
| 46 | 1.46 | Galactosemia | Item46 | 1 | per ml |
| 47 | 1.47 | Calcitonin | Item47 | 1 | per ml |
| 48 | 1.48 | Calcitriol | Item48 | 1 | per ml |
| 49 | 1.49 | Galactokinase | Item49 | 1 | per ml |
| 50 | 1.5 | Galactose-1-phosphate uridyl transferase | Item50 | 1 | per ml |
| 51 | 1.51 | Renin | Item51 | 1 | per ml |
| 52 | 1.52 | ACTH | Item52 | 1 | per ml |
| 53 | 1.53 | Interleukin 1 | Item53 | 1 | per ml |
| 54 | 1.54 | Interleukin 4 | Item54 | 1 | per ml |
| 55 | 1.55 | Interleukin10 | Item55 | 1 | per ml |
| 56 | 1.56 | Leukotrine A4 | Item56 | 1 | per ml |
| 57 | 1.57 | Leukotrine B4 | Item57 | 1 | per ml |
| 58 | 1.58 | Leukotrine C4 | Item58 | 1 | per ml |
| 59 | 1.59 | Leukotrine D4 | Item59 | 1 | per ml |
| 60 | 1.6 | Leukotrine E4 | Item60 | 1 | per ml |
| 61 | 1.61 | TNFa | Item61 | 1 | per ml |
| 62 | 1.62 | Cephalosporin | Item62 | 1 | per ml |
| 63 | 1.63 | Serum tryptase | Item63 | 1 | per ml |
| 64 | 1.64 | Urine fluoride | Item64 | 1 | per ml |
| 65 | 1.65 | Anti-dsDNA Antibody | Item65 | 1 | per ml |
| 66 | 1.66 | Anti nuclear antibody | Item66 | 1 | per ml |
| 67 | 1.67 | Anti-sm Antibody | Item67 | 1 | per ml |
| 68 | 1.68 | Sodium carbonate | Item68 | 1 | per gm |
| 69 | 1.69 | Potassium Dihydrogen Phosphate | Item69 | 1 | per gm |
| 70 | 1.7 | Potassium Dihydrogen Phosphate KH2PO4 (HPLC grade) | Item70 | 1 | per gm |
| 71 | 1.71 | Creatinine powder | Item71 | 1 | per gm |
| 72 | 1.72 | Isopropyl alcohol, AR Grade | Item72 | 1 | per ml |
| 73 | 1.73 | Acetone – AR grade AR grade | Item73 | 1 | per ml |
| 74 | 1.74 | Ammonium chloride –AR grade, | Item74 | 1 | per gm |
| 75 | 1.75 | Ammonium nitrate – AR grade, | Item75 | 1 | per gm |
| 76 | 1.76 | Ammonium persulphate – AR grade, | Item76 | 1 | per gm |
| 77 | 1.77 | Calcium chloride dihydrade – AR grade, | Item77 | 1 | per gm |
| 78 | 1.78 | Dinitro phenyl hydrazine AR grade, | Item78 | 1 | per gm |
| 79 | 1.79 | Magnesium chloride – AR grade, | Item79 | 1 | per gm |
| 80 | 1.8 | Magnesium sulfate –AR grade, | Item80 | 1 | per gm |
| 81 | 1.81 | Methanol – Acetone free – HPLC grade, | Item81 | 1 | per ml |
| 82 | 1.82 | Methanol (HPLC grade) | Item82 | 1 | per ml |
| 83 | 1.83 | Potassium dichromate – AR grade, | Item83 | 1 | per gm |
| 84 | 1.84 | Silver nitrate – AR grade, | Item84 | 1 | per gm |
| 85 | 1.85 | Sodium bicarbonate – AR grade, | Item85 | 1 | per gm |
| 86 | 1.86 | Sodium acetate dehydrate –AR grade, | Item86 | 1 | per gm |
| 87 | 1.87 | Ammonium acetate – AR grade, | Item87 | 1 | per gm |
| 88 | 1.88 | Thio semi carbazide – AR grade, | Item88 | 1 | per gm |
| 89 | 1.89 | Ethidium bromide soln 10ml– Biotechnology grade, | Item89 | 1 | per ml |
| 90 | 1.9 | Guanidium iso thiocyanate – Biotechnology grade, | Item90 | 1 | per gm |
| 91 | 1.91 | IPTG AR grade, | Item91 | 1 | per gm |
| 92 | 1.92 | 100 bp DNA ladder 1 ml X 5 | Item92 | 1 | per gm |
| 93 | 1.93 | Taq Polymerase with PCR buffer 3-5 U/µl, 1000 U per vial | Item93 | 1 | per gm |
| 94 | 1.94 | dNTPs 100 millimolar each | Item94 | 1 | per ml |
| 95 | 1.95 | EcoRI restriction enzyme 0.5 ml X 1 | Item95 | 1 | per ml |
| 96 | 1.96 | BamHI 0.5 ml X 1 | Item96 | 1 | per ml |
| 97 | 1.97 | HinDIII 0.5 ml X 1 | Item97 | 1 | per ml |
| 98 | 1.98 | DNA ligase 0.5 ml X 1 | Item98 | 1 | per ml |
| 99 | 1.99 | DNA extraction kit(column based) for 50 extraction | Item99 | 1 | per ml |
| 100 | 2 | RNA extraction kit(column based) for 20 extraction | Item100 | 1 | per ml |
| 101 | 2.01 | Plasmid extraction kit(column based) for 50 extraction | Item101 | 1 | per ml |
| 102 | 2.02 | Oligo nucleotide primers (HPLC purification) | Item102 | 1 | per ml |
| 103 | 2.03 | RNAlater | Item103 | 1 | per ml |
| 104 | 2.04 | DEPC mol bio grade | Item104 | 1 | per ml |
| 105 | 2.05 | Nuclese K | Item105 | 1 | per ml |
| 106 | 2.06 | Milipore Prefiltrate Kit Cartridge | Item106 | 1 | pc |
| 107 | 2.07 | Milipore Proguard 2 Pack Cat. No. PROG0002 | Item107 | 1 | pc |
| 108 | 2.08 | Milipore Q Guard 1 Cat. No. QGARD00R1 | Item108 | 1 | pc |
| 109 | 2.09 | Milipore Tank Vent Filter Cat. No. TANKMPK01 | Item109 | 1 | pc |
| 110 | 2.1 | Milipore Sanitization Tablet Cat. No. ZWCL01F50 | Item110 | 1 | pc |
| 111 | 2.11 | Millipore millicare Elix cat no JMBM01747 | Item111 | 1 | pc |
| 112 | 2.12 | Millipore Quantum Ex cat. No- QTUM000Ex | Item112 | 1 | pc |
| 113 | 2.13 | MX cart 5 micron | Item113 | 1 | pc |
| 114 | 2.14 | MX cart 1 micron | Item114 | 1 | pc |
| 115 | 2.15 | RO cartridge | Item115 | 1 | pc |
| 116 | 2.16 | Non sterile millipak 40 | Item116 | 1 | pc |
| 117 | 2.17 | Progard TS 2 | Item117 | 1 | pc |
| 118 | 2.18 | 1 micron filter | Item118 | 1 | pc |
| 119 | 2.19 | 3 micron filter | Item119 | 1 | pc |
| 120 | 2.2 | MX cartridge 5 µm | Item120 | 1 | pc |
| 121 | 2.21 | 20 '' carbon cartridge | Item121 | 1 | pc |
| 122 | 2.22 | Sanitization tablets | Item122 | 1 | pc |
| 123 | 2.23 | PM kit | Item123 | 1 | pc |
| 124 | 2.24 | XL wash solution | Item124 | 1 | per ml |
| 125 | 2.25 | 200-1000 µl microtips | Item125 | 1 | pc |
| 126 | 2.26 | 100-200 µl microtips | Item126 | 1 | pc |
| 127 | 2.27 | 5-50 µl microtips | Item127 | 1 | pc |
| 128 | 2.28 | 1-5 ml microtips | Item128 | 1 | pc |
| 129 | 2.29 | 200-1000 µl micropipette | Item129 | 1 | pc |
| 130 | 2.3 | 100-200 µl micropipette | Item130 | 1 | pc |
| 131 | 2.31 | 5-50 µl micropipette | Item131 | 1 | pc |
| 132 | 2.32 | 2-20 µl micropipette | Item132 | 1 | pc |
| 133 | 2.33 | Microcentrifuge tube 1.5ml | Item133 | 1 | pc |
| 134 | 2.34 | Ammonium persulphate AR | Item134 | 1 | per gm |
| 135 | 2.35 | Potassium iodate (KIO3) | Item135 | 1 | per gm |
| 136 | 2.36 | Toluene AR | Item136 | 1 | per ml |
| 137 | 2.37 | Arsenous acid(As2O3) | Item137 | 1 | per ml |
| 138 | 2.38 | Arsenic trioxide | Item138 | 1 | per ml |
| 139 | 2.39 | Ceric ammonium sulphate | Item139 | 1 | per gm |
| 140 | 2.4 | 20bp DNA ladder | Item140 | 1 | pc |
| 141 | 2.41 | TRIS – base AR grade | Item141 | 1 | per gm |
| 142 | 2.42 | Fok I & NlaIII restriction enzyme | Item142 | 1 | pc |
| 143 | 2.43 | DNA loading buffer | Item143 | 1 | pc |
| 144 | 2.44 | DNA sample loading dye | Item144 | 1 | pc |
| 145 | 2.45 | Ethiduim bromide | Item145 | 1 | pc |
| 146 | 2.46 | Primer (Both forward & reverse) | Item146 | 1 | pc |
| 147 | 2.47 | 10 X TBE | Item147 | 1 | pc |
| 148 | 2.48 | Heparinised vial | Item148 | 1 | pc |
| 149 | 2.49 | Disposable syringe | Item149 | 1 | pc |
| 150 | 2.5 | Microwave oven | Item150 | 1 | pc |
| 151 | 2.51 | Glucose kit | Item151 | 1 | per kit |
| 152 | 2.52 | Bilirubin Kit | Item152 | 1 | per kit |
| 153 | 2.53 | G6-PD kit | Item153 | 1 | per kit |
| 154 | 2.54 | Vacutainer | Item154 | 1 | pc |
| 155 | 2.55 | Disposable syringe | Item155 | 1 | pc |
| 156 | 2.56 | Cystatin C kit | Item156 | 1 | per kit |
| 157 | 2.57 | Bilirubin Kit | Item157 | 1 | per kit |
| 158 | 2.58 | Creatinine kit | Item158 | 1 | per kit |
| 159 | 2.59 | AST kit | Item159 | 1 | per kit |
| 160 | 2.6 | ALT kit | Item160 | 1 | per kit |
| 161 | 2.61 | ISE wash 2 solution | Item161 | 1 | per ml |
| 162 | 2.62 | ISE cal-3 solution | Item162 | 1 | per ml |
| 163 | 2.63 | ISE cal -4 solution | Item163 | 1 | per ml |
| 164 | 2.64 | Microcentrifuge tube 2ml | Item164 | 1 | pc |
| 165 | 2.65 | SP kit | Item165 | 1 | per kit |
| 166 | 2.66 | Rep prep solution | Item166 | 1 | per ml |
| 167 | 2.67 | Sample applicator | Item167 | 1 | pc |
| 168 | 2.68 | Disposable sample cup | Item168 | 1 | pc |
| 169 | 2.69 | AST | Item169 | 1 | per test |
| 170 | 2.7 | ALT | Item170 | 1 | per test |
| 171 | 2.71 | Creatinine | Item171 | 1 | per test |
| 172 | 2.72 | Albumin | Item172 | 1 | per test |
| 173 | 2.73 | Glucose | Item173 | 1 | per test |
| 174 | 2.74 | GGT | Item174 | 1 | per test |
| 175 | 2.75 | BUN | Item175 | 1 | per test |
| 176 | 2.76 | HDL cholesterol | Item176 | 1 | per test |
| 177 | 2.77 | LDL cholesterol | Item177 | 1 | per test |
| 178 | 2.78 | Cholesterol | Item178 | 1 | per test |
| 179 | 2.79 | UIBC | Item179 | 1 | per test |
| 180 | 2.8 | RF RTG latex | Item180 | 1 | per test |
| 181 | 2.81 | CRP | Item181 | 1 | per test |
| 182 | 2.82 | Uric acid | Item182 | 1 | per test |
| 183 | 2.83 | Triglyceride | Item183 | 1 | per test |
| 184 | 2.84 | ALP | Item184 | 1 | per test |
| 185 | 2.85 | Total bilirubin | Item185 | 1 | per test |
| 186 | 2.86 | IgG | Item186 | 1 | per test |
| 187 | 2.87 | Direct bilirubiun | Item187 | 1 | per test |
| 188 | 2.88 | IgM | Item188 | 1 | per test |
| 189 | 2.89 | Protein | Item189 | 1 | per test |
| 190 | 2.9 | IgA | Item190 | 1 | per test |
| 191 | 2.91 | Phosphorus | Item191 | 1 | per test |
| 192 | 2.92 | C3 | Item192 | 1 | per test |
| 193 | 2.93 | Calcium | Item193 | 1 | per test |
| 194 | 2.94 | CK-MB | Item194 | 1 | per test |
| 195 | 2.95 | Lipase | Item195 | 1 | per test |
| 196 | 2.96 | ASO | Item196 | 1 | per test |
| 197 | 2.97 | Iron | Item197 | 1 | per test |
| 198 | 2.98 | C4 | Item198 | 1 | per test |
| 199 | 2.99 | Amylase | Item199 | 1 | per test |
| 200 | 3 | CK | Item200 | 1 | per test |
| 201 | 3.01 | Acid phosphatase | Item201 | 1 | per test |
| 202 | 3.02 | Transferrin | Item202 | 1 | per test |
| 203 | 3.03 | LDH | Item203 | 1 | per test |
| 204 | 3.04 | Magnessium | Item204 | 1 | per test |
| 205 | 3.05 | HB-DH | Item205 | 1 | per test |
| 206 | 3.06 | Haptoglobin | Item206 | 1 | per test |
| 207 | 3.07 | Lactate | Item207 | 1 | per test |
| 208 | 3.08 | Microalbumin | Item208 | 1 | per test |
| 209 | 3.09 | Microalbumin calibrator | Item209 | 1 | per test |
| 210 | 3.1 | Cholinesterase | Item210 | 1 | per test |
| 211 | 3.11 | Urine CSF protein | Item211 | 1 | per test |
| 212 | 3.12 | Wash solution | Item212 | 1 | per ml |
| 213 | 3.13 | Cleaning solution | Item213 | 1 | per ml |
| 214 | 3.14 | Cleaning solution weekly wash | Item214 | 1 | per ml |
| 215 | 3.15 | CRP latex calibrator | Item215 | 1 | per test |
| 216 | 3.16 | Urine calibrator | Item216 | 1 | per test |
| 217 | 3.17 | System calibrator | Item217 | 1 | per test |
| 218 | 3.18 | HDL calibrator | Item218 | 1 | per test |
| 219 | 3.19 | LDL calibrator | Item219 | 1 | per test |
| 220 | 3.2 | CRP calibrator | Item220 | 1 | per test |
| 221 | 3.21 | RF calibrator | Item221 | 1 | per test |
| 222 | 3.22 | CK-MB calibrator | Item222 | 1 | per test |
| 223 | 3.23 | Xl-300/600 cuvette | Item223 | 1 | pc |
| 224 | 3.24 | Beckman coulter AU 2700 cuvettes | Item224 | 1 | pc |
| 225 | 3.25 | Xl-300/600 Lamp | Item225 | 1 | pc |
| 226 | 3.26 | Beckman coulter AU 2700 lamp | Item226 | 1 | pc |
| 227 | 3.27 | EQAS (Bio-Rad) | Item227 | 1 | per test |
| 228 | 3.28 | ApoA1 & ApoB reagent & calibrator | Item228 | 1 | per test |
| 229 | 3.29 | Bio-Rad lipid conrol | Item229 | 1 | per test |
| 230 | 3.3 | Ethylene Glycol (Ethandiol | Item230 | 1 | pc |
| 231 | 3.31 | Methylene Soluble (working Reagent | Item231 | 1 | pc |
| 232 | 3.32 | Tissue Capsule Big | Item232 | 1 | pc |
| 233 | 3.33 | Tissue Capsule Small | Item233 | 1 | pc |
| 234 | 3.34 | Tissue Cassettes Big | Item234 | 1 | pc |
| 235 | 3.35 | Tissue Cassettes Small | Item235 | 1 | pc |
| 236 | 3.36 | Stock Phloxine B | Item236 | 1 | pc |
| 237 | 3.37 | Progesterone Receptor | Item237 | 1 | pc |
| 238 | 3.38 | ANA Kit for SLE (Indirect Immunoflurescence Method) | Item238 | 1 | per test |
| 239 | 3.39 | Hb/Cayanaid Method standard | Item239 | 1 | pc |
| 240 | 3.4 | Nalidixid 10ug | Item240 | 1 | per disc |
| 241 | 3.41 | Netilmycin 10ug | Item241 | 1 | per disc |
| 242 | 3.42 | Furozotidime 30ug | Item242 | 1 | per disc |
| 243 | 3.43 | Antigen and antibody HCV ELISA test kits | Item243 | 1 | per test |
| 244 | 3.44 | Cell counter reagents | Item244 | 1 | pc |
| 245 | 3.45 | (Machine available is ABX pentra which is a closed system) | Item245 | 1 | per gm |
| 246 | 3.46 | Reagent for APTT | Item246 | 1 | per test |
| 247 | 3.47 | Calcium Chloride for APTT estimation | Item247 | 1 | per test |
| 248 | 3.48 | Control plasma N | Item248 | 1 | per test |
| 249 | 3.49 | Reaction tube | Item249 | 1 | per test |
| 250 | 3.5 | CA CLEAN | Item250 | 1 | per test |
| 251 | 3.51 | OWRENS Veronal buffer | Item251 | 1 | per test |
| 252 | 3.52 | Standard Human Plasma | Item252 | 1 | per test |
| 253 | 3.53 | Sodium Azide (NaN3) | Item253 | 1 | per test |
| 254 | 3.54 | Bovine thrombin | Item254 | 1 | per test |
| 255 | 3.55 | 1000 NIH units/ mg of protein | Item255 | 1 | per test |
| 256 | 3.56 | Anti DCE | Item256 | 1 | per test |
| 257 | 3.57 | Sc(1) | Item257 | 1 | per test |
| 258 | 3.58 | Sc(2) | Item258 | 1 | per test |
| 259 | 3.59 | Sc(3) | Item259 | 1 | per test |
| 260 | 3.6 | Yt(a) | Item260 | 1 | per test |
| 261 | 3.61 | Yt(b) | Item261 | 1 | per test |
| 262 | 3.62 | Do(a) | Item262 | 1 | per test |
| 263 | 3.63 | Do(b) | Item263 | 1 | per test |
| 264 | 3.64 | PYR Broth | Item264 | 1 | per gm |
| 265 | 3.65 | PYR -Pyrolidonyl-ß naphthylamine | Item265 | 1 | per test |
| 266 | 3.66 | Paradimethylaminobenzaldehyde | Item266 | 1 | per ml |
| 267 | 3.67 | P-dimethylaminocinamaldehyde | Item267 | 1 | pc |
| 268 | 3.68 | p-nitrophenylglycerol | Item268 | 1 | pc |
| 269 | 3.69 | Potassium Telurite | Item269 | 1 | pc |
| 270 | 3.7 | Potassium Cyanide (KCN) | Item270 | 1 | per gm |
| 271 | 3.71 | Para dimethyl aminobenzaldehyde | Item271 | 1 | per ml |
| 272 | 3.72 | Potassium hydroxide | Item272 | 1 | per gm |
| 273 | 3.73 | Potassium Hydrogen Sulphate | Item273 | 1 | per gm |
| 274 | 3.74 | Phenol Crystal (powder) | Item274 | 1 | per gm |
| 275 | 3.75 | Phosphate Buffer Saline | Item275 | 1 | per ml |
| 276 | 3.76 | Phenethyl alcohol | Item276 | 1 | per ml |
| 277 | 3.77 | Phenol red indicator | Item277 | 1 | per ml |
| 278 | 3.78 | Phenol red indicator | Item278 | 1 | per gm |
| 279 | 3.79 | Phenol red | Item279 | 1 | per gm |
| 280 | 3.8 | Phenylpyruvic acid Reagent | Item280 | 1 | pc |
| 281 | 3.81 | Potassium dichromate LR | Item281 | 1 | per gm |
| 282 | 3.82 | Potassium permanganate LR | Item282 | 1 | per gm |
| 283 | 3.83 | Potassium permanganate AR | Item283 | 1 | per gm |
| 284 | 3.84 | Potassium Phosphate monobasic | Item284 | 1 | per gm |
| 285 | 3.85 | Potassium Nitrate | Item285 | 1 | per gm |
| 286 | 3.86 | Phenol (Crystal) | Item286 | 1 | per gm |
| 287 | 3.87 | Peptone | Item287 | 1 | per gm |
| 288 | 3.88 | Raffinose AR | Item288 | 1 | per gm |
| 289 | 3.89 | Rhammnose | Item289 | 1 | per gm |
| 290 | 3.9 | Sodium/ Potassium Dichromate | Item290 | 1 | pc |
| 291 | 3.91 | Sodium citrate | Item291 | 1 | per ml |
| 292 | 3.92 | Sodium Pyruvate AR | Item292 | 1 | per gm |
| 293 | 3.93 | Sodium Biocarbonate LR | Item293 | 1 | per gm |
| 294 | 3.94 | Sodium acetate | Item294 | 1 | per gm |
| 295 | 3.95 | Sodium Iodide | Item295 | 1 | per gm |
| 296 | 3.96 | Sulphanilamine-AR | Item296 | 1 | per gm |
| 297 | 3.97 | Sugar assimilation disc – Cellobiose | Item297 | 1 | pc |
| 298 | 3.98 | Sugar assimilation disc – Dextrose | Item298 | 1 | pc |
| 299 | 3.99 | Sugar assimilation disc – Dulcitol | Item299 | 1 | pc |
| 300 | 4 | Sugar assimilation disc – Galactose | Item300 | 1 | pc |
| 301 | 4.01 | Sugar assimilation disc – Inositol | Item301 | 1 | pc |
| 302 | 4.02 | Sugar assimilation disc – Lactose | Item302 | 1 | pc |
| 303 | 4.03 | Sugar assimilation disc – Maltose | Item303 | 1 | pc |
| 304 | 4.04 | Sugar assimilation disc – Melibiose | Item304 | 1 | pc |
| 305 | 4.05 | Sugar assimilation disc - Raffinose | Item305 | 1 | pc |
| 306 | 4.06 | Sugar assimilation disc- Sucrose | Item306 | 1 | pc |
| 307 | 4.07 | Sugar assimilation disc – Trehalose | Item307 | 1 | pc |
| 308 | 4.08 | Sugar assimilation disc - Xylose | Item308 | 1 | pc |
| 309 | 4.09 | Salicin AR | Item309 | 1 | per gm |
| 310 | 4.1 | Tarric Acid | Item310 | 1 | per gm |
| 311 | 4.11 | Trehalose Ar | Item311 | 1 | per gm |
| 312 | 4.12 | Triypticase | Item312 | 1 | per gm |
| 313 | 4.13 | Thiosulphate | Item313 | 1 | per ml |
| 314 | 4.14 | Tri-Sodium Citrate | Item314 | 1 | per gm |
| 315 | 4.15 | Voges proskaeur reagent | Item315 | 1 | pc |
| 316 | 4.16 | Vibriostatic (0/129) Agent | Item316 | 1 | per ml |
| 317 | 4.17 | Wright’s Stain | Item317 | 1 | per gm |
| 318 | 4.18 | Xylose AR | Item318 | 1 | per gm |
| 319 | 4.19 | Vibrio cholerae-01 3ml | Item319 | 1 | per ml |
| 320 | 4.2 | Vibrio cholerae-0139 3ml | Item320 | 1 | per ml |
| 321 | 4.21 | Vibrio cholerae-Ogawa 3ml | Item321 | 1 | per ml |
| 322 | 4.22 | Vibrio cholerae-Inaba 3ml | Item322 | 1 | per ml |
| 323 | 4.23 | Salmonella Polyvalent O 3ml | Item323 | 1 | per ml |
| 324 | 4.24 | Salmonella Polyvalent H 3ml | Item324 | 1 | per ml |
| 325 | 4.25 | Salmonella Polyvalent O2 3ml | Item325 | 1 | per ml |
| 326 | 4.26 | Salmonella Polyvalent O4 3ml | Item326 | 1 | per ml |
| 327 | 4.27 | Salmonella Polyvalent O9 3ml | Item327 | 1 | per ml |
| 328 | 4.28 | Salmonella Polyvalent H Phase I a 3ml | Item328 | 1 | per ml |
| 329 | 4.29 | Salmonella Polyvalent H Phase Ib 3ml | Item329 | 1 | per ml |
| 330 | 4.3 | Salmonella Polyvalent H Phase Ic 3ml | Item330 | 1 | per ml |
| 331 | 4.31 | Salmonella Polyvalent H Phase Ii 3ml | Item331 | 1 | per ml |
| 332 | 4.32 | Shigella Polyvalent dysenteriae 3ml | Item332 | 1 | per ml |
| 333 | 4.33 | Shigella Polyvalent flexnerii 3ml | Item333 | 1 | per ml |
| 334 | 4.34 | Shigella Polyvalent sonnei 3ml | Item334 | 1 | per ml |
| 335 | 4.35 | Shigella Polyvalent boydii 3ml | Item335 | 1 | per ml |
| 336 | 4.36 | Cryptococcus antigen detection kit (latex Agglutination detection) | Item336 | 1 | per test |
| 337 | 4.37 | Antigen detection kit for Meningitis (H influenza b, N meningitis A & C, S. pneumonia, GBS, E.coli) | Item337 | 1 | per test |
| 338 | 4.38 | Amphotericin Powder | Item338 | 1 | per gm |
| 339 | 4.39 | Benzal Pennicillin Powder | Item339 | 1 | per gm |
| 340 | 4.4 | Cefoxitin 5gm/vial | Item340 | 1 | vial |
| 341 | 4.41 | Clindamycin Powder | Item341 | 1 | per gm |
| 342 | 4.42 | Ciprofloxacin 5gm/vial | Item342 | 1 | vial |
| 343 | 4.43 | Erythromycin Powder | Item343 | 1 | per gm |
| 344 | 4.44 | Gentamicin 5gm/vial | Item344 | 1 | vial |
| 345 | 4.45 | Imipenem 5gm/vial | Item345 | 1 | vial |
| 346 | 4.46 | Oxacillin 5gm/vial | Item346 | 1 | vial |
| 347 | 4.47 | Vancomycin 5gm/vial | Item347 | 1 | vial |
| 348 | 4.48 | Anidulafungin (0.015-128µg/ml) | Item348 | 1 | per strip |
| 349 | 4.49 | Ceftriaxone (0.016-256 ug /ml.) | Item349 | 1 | per strip |
| 350 | 4.5 | Ciprofloxacin (0.001-8ug / ml.) | Item350 | 1 | per strip |
| 351 | 4.51 | Ceftazidime+ Clavulanate(0.004-128ug / ml.) | Item351 | 1 | per strip |
| 352 | 4.52 | Clindamycin E-test (0.016-256 µg/ml) | Item352 | 1 | per strip |
| 353 | 4.53 | Colistin (0.06-0.25µg/ml) | Item353 | 1 | per strip |
| 354 | 4.54 | Caspofungin (0.015-128µg/ml | Item354 | 1 | per strip |
| 355 | 4.55 | Doripenem(0.002-32 µg/ml) | Item355 | 1 | per strip |
| 356 | 4.56 | Ertapenem (0.002-32 µg/ml) | Item356 | 1 | per strip |
| 357 | 4.57 | Fluconazole (0.016-256 µg/ml) | Item357 | 1 | per strip |
| 358 | 4.58 | Imipenem(0.004-128ug / ml.) | Item358 | 1 | per strip |
| 359 | 4.59 | Levofloxacin (0.001-8ug / ml.) | Item359 | 1 | per strip |
| 360 | 4.6 | Meropenem (4-256 µg/ml) | Item360 | 1 | per strip |
| 361 | 4.61 | Meropenem/EDTA (1-64 µg/ml) | Item361 | 1 | per strip |
| 362 | 4.62 | Moxifloxacin (0.001-8ug / ml.) | Item362 | 1 | per strip |
| 363 | 4.63 | Candida albicans ATCC 14053 | Item363 | 1 | vial |
| 364 | 4.64 | Candida guilliermondii ATCC 6260 | Item364 | 1 | vial |
| 365 | 4.65 | Candida Psedotropicalis TCC 4135 | Item365 | 1 | vial |
| 366 | 4.66 | Corynebacterium diptheriae ATCC 13812 Vial | Item366 | 1 | vial |
| 367 | 4.67 | Escherichia coli ATCC 25922 Vial | Item367 | 1 | vial |
| 368 | 4.68 | Escherichia coli ATCC 35218 Vial | Item368 | 1 | vial |
| 369 | 4.69 | Enterococcus faecalis ATCC 29212 Vial | Item369 | 1 | vial |
| 370 | 4.7 | Haemophilus influenzae ATCC-49766 Vial | Item370 | 1 | vial |
| 371 | 4.71 | Pseudomonas aeruginosa ATCC 27853 Vial | Item371 | 1 | vial |
| 372 | 4.72 | Positive Control for T.B. (My.TB H37rv strain) | Item372 | 1 | vial |
| 373 | 4.73 | Staphylococcus aureus ATCC 25923 Vial | Item373 | 1 | vial |
| 374 | 4.74 | Streptococcus pneumoniae ATCC 49619 Vial | Item374 | 1 | vial |
| 375 | 4.75 | Staphylococcus aureus ATCC 33591 Vial | Item375 | 1 | vial |
| 376 | 4.76 | Salmonella enterica subspecies enterica serovar cholerasuis ATCC-10708 Vial | Item376 | 1 | vial |
| 377 | 4.77 | Salmonella enterica subspecies enterica serovar paratyphi A ATCC-9150 Vial | Item377 | 1 | vial |
| 378 | 4.78 | Salmonella enterica subspecies enterica serovar typhimurium ATCC-25241 Vial | Item378 | 1 | vial |
| 379 | 4.79 | Shigella flexneri ATCC- 9199 Vial | Item379 | 1 | vial |
| 380 | 4.8 | AST for GNB AST –N280 | Item380 | 1 | per test |
| 381 | 4.81 | Media for Pediatric Sample -259794,BACT/ALERT PF | Item381 | 1 | per test |
| 382 | 4.82 | Media for Aerobic Sample – 259791, BACT/ALERT FA | Item382 | 1 | per test |
| 383 | 4.83 | Solution for Inoculum Preparation – V1204, 3x500 ml | Item383 | 1 | per test |
| 384 | 4.84 | Tubes for Inoculum Preparation - 69285(unsensitised tube) | Item384 | 1 | per test |
| 385 | 4.85 | Identification of Fermentes and Non-ferments – 21341(GN TEST KIT VTK) | Item385 | 1 | per test |
| 386 | 4.86 | DNA ladder / molecular weight marker size range : 100 to 1200 bp (50µg) | Item386 | 1 | per test |
| 387 | 4.87 | DNA Extraction kit | Item387 | 1 | per test |
| 388 | 4.88 | Deoxynucleotide triphosphate (dNTP) mixture | Item388 | 1 | per test |
| 389 | 4.89 | Anaerogas pack (5 nos/pack) | Item389 | 1 | pc |
| 390 | 4.9 | Autoclavable Biohazard plastic bag: size 10 ltr 10ltr | Item390 | 1 | pc |
| 391 | 4.91 | Anaerobic Blood Culture bottle – Adult (50/ pack) | Item391 | 1 | pc |
| 392 | 4.92 | Anaerobic Blood Culture bottle – Paediatric (50/ pack) | Item392 | 1 | pc |
| 393 | 4.93 | Anaerobic System Rubber Ring | Item393 | 1 | pc |
| 394 | 4.94 | Anaero Indicator Tablet RT (1x10/pkt) | Item394 | 1 | pc |
| 395 | 4.95 | Autoclavable Plastic Vial Flat Bottom,screw capped 11.5 mm x53 mm. | Item395 | 1 | pc |
| 396 | 4.96 | Craigie’s tube | Item396 | 1 | pc |
| 397 | 4.97 | Durham's tube 25 x 6 mm | Item397 | 1 | pc |
| 398 | 4.98 | Durham's tube 37x 6 mm | Item398 | 1 | pc |
| 399 | 4.99 | Embading Cassette 1x1000/box | Item399 | 1 | pc |
| 400 | 5 | Kline Concavity Slides 75x56x3 mm thick & 12 concavity code GW097 | Item400 | 1 | pc |
| 401 | 5.01 | Microtips (Autoclavable) with box (96’s/pack) 0.1ul - 20µl | Item401 | 1 | pc |
| 402 | 5.02 | Microtips (Autoclavable) with box (96’s/pack) 2ul - 200µl | Item402 | 1 | pc |
| 403 | 5.03 | Microtips (Autoclavable) with box (96’s/pack) 50ul - 1000µl | Item403 | 1 | pc |
| 404 | 5.04 | Microtips (Autoclavable) 0.1ul - 20µl | Item404 | 1 | pc |
| 405 | 5.05 | Microtips (Autoclavable) 2ul - 20ul | Item405 | 1 | pc |
| 406 | 5.06 | Microtips (Autoclavable) 5ul-50ul | Item406 | 1 | pc |
| 407 | 5.07 | Microtips (Autoclavable) 20ul-200ul | Item407 | 1 | pc |
| 408 | 5.08 | Microtips (Autoclavable) 200ul-1000ul | Item408 | 1 | pc |
| 409 | 5.09 | Microtips-1000 ul | Item409 | 1 | pc |
| 410 | 5.1 | Microtips-5000 ul | Item410 | 1 | pc |
| 411 | 5.11 | Microtitre plate with round bottom wells 96wells | Item411 | 1 | pc |
| 412 | 5.12 | Microtitre plate with detachable wells 96wells | Item412 | 1 | pc |
| 413 | 5.13 | Micro centrifuge Autoclavable Plastic Tubes with cap 2ml | Item413 | 1 | pc |
| 414 | 5.14 | Micro centrifuge Autoclavable Plastic Tubes with cap 5ml | Item414 | 1 | pc |
| 415 | 5.15 | Micro centrifuge Autoclavable Plastic Tubes with cap 10ml | Item415 | 1 | pc |
| 416 | 5.16 | Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. Capacity 30ml | Item416 | 1 | pc |
| 417 | 5.17 | Museum Jar, With Cover 160x110x60mm | Item417 | 1 | pc |
| 418 | 5.18 | Museum Jar, With Cover 170x130x210 mm | Item418 | 1 | pc |
| 419 | 5.19 | Screw capped tubes 20x150mm | Item419 | 1 | pc |
| 420 | 5.2 | Serum vials sample storage box & stand for 3ml capacity | Item420 | 1 | pc |
| 421 | 5.21 | Sample Container -Wide mouth bottle,125ml Autoclavable (Polypropylene) 125ml | Item421 | 1 | pc |
| 422 | 5.22 | Storage vials (autoclavable) 2ml | Item422 | 1 | pc |
| 423 | 5.23 | Teasing Needles for moulds | Item423 | 1 | pc |
| 424 | 5.24 | Test Tube Stand - Test -tube size - 25mm diametre | Item424 | 1 | pc |
| 425 | 5.25 | Test Tube Stand - test -tube size - 16mm diametre | Item425 | 1 | pc |
| 426 | 5.26 | Test Tube Stand - Test-tube size - 10mm diametre | Item426 | 1 | pc |
| 427 | 5.27 | Test tube basket, large | Item427 | 1 | pc |
| 428 | 5.28 | Test tube basket, small | Item428 | 1 | pc |
| 429 | 5.29 | Test tube rack to accommodate 3 ml. test tubes 5X15 | Item429 | 1 | pc |
| 430 | 5.3 | Test tube rack to accommodate 5 ml. test tubes 5X15 | Item430 | 1 | pc |
| 431 | 5.31 | Test tube racks:4 x 13 | Item431 | 1 | pc |
| 432 | 5.32 | Test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes) | Item432 | 1 | pc |
| 433 | 5.33 | Test Tube Carrier (stainless steel) | Item433 | 1 | pc |
| 434 | 5.34 | V.D.R.L. Slides (75mmx50mm 1.45mm) | Item434 | 1 | pc |
| 435 | 5.35 | Wash bottle plastic with delivery Nozzle 200ml | Item435 | 1 | pc |
| 436 | 5.36 | Wash bottle plastic with delivery Nozzle 60ml | Item436 | 1 | pc |
| 437 | 5.37 | Bunsen burner | Item437 | 1 | pc |
| 438 | 5.38 | Bacteriological loop holder with loop (ready to use) | Item438 | 1 | pc |
| 439 | 5.39 | Biological indicator for steam | Item439 | 1 | pc |
| 440 | 5.4 | Bowie DickTest Pack Steam | Item440 | 1 | pc |
| 441 | 5.41 | Ice box 5 litres | Item441 | 1 | pc |
| 442 | 5.42 | Labels for Micro centrifuge tubes white Size ½” | Item442 | 1 | pc |
| 443 | 5.43 | Metaloops (Changeable Nichrome loop embedded in Brass rod with heat resistant handle with- | Item443 | 1 | pc |
| 444 | 5.44 | a. 2 mm diameter Nichrome wire | Item444 | 1 | pc |
| 445 | 5.45 | b. 3 mm diameter Nichrome wire | Item445 | 1 | pc |
| 446 | 5.46 | c. 4 mm diameter Nichrome wire | Item446 | 1 | pc |
| 447 | 5.47 | Metaloops (Fixed straight Nichrome loop embedded in SS rod with heat resistant handle with- | Item447 | 1 | pc |
| 448 | 5.48 | Microtome Knife | Item448 | 1 | pc |
| 449 | 5.49 | Mops | Item449 | 1 | pc |
| 450 | 5.5 | Magnifying glass, big size with handle | Item450 | 1 | pc |
| 451 | 5.51 | Mortar - Pestle | Item451 | 1 | pc |
| 452 | 5.52 | Nichrome loop-4 mm | Item452 | 1 | pc |
| 453 | 5.53 | Nichrome loop-2 mm | Item453 | 1 | pc |
| 454 | 5.54 | Nichrome loop-1.3 mm | Item454 | 1 | pc |
| 455 | 5.55 | Pipette stand( vertical & horizontal) 4/5 pipettes | Item455 | 1 | pc |
| 456 | 5.56 | Staining rack. 20 slide capacity. | Item456 | 1 | pc |
| 457 | 5.57 | Sprit Lamp glass/ metal | Item457 | 1 | pc |
| 458 | 5.58 | Screwdrivers -multipurpose | Item458 | 1 | pc |
| 459 | 5.59 | Silver aluminium foil | Item459 | 1 | pc |
| 460 | 5.6 | Surgical Knife (Big) | Item460 | 1 | pc |
| 461 | 5.61 | Sterile swab sticks | Item461 | 1 | pc |
| 462 | 5.62 | Syringe driven filters PTFE (hydrophilic) pore size 0.22µm | Item462 | 1 | pc |
| 463 | 5.63 | Thermometer 37degree C | Item463 | 1 | pc |
| 464 | 5.64 | Twine | Item464 | 1 | pc |
| 465 | 5.65 | Universal collection vials (Urine pot) | Item465 | 1 | pc |
| 466 | 5.66 | Universal Wash Reagents 500ml | Item466 | 1 | pc |
| 467 | 5.67 | Anti-CD 56 | Item467 | 1 | per ml |
| 468 | 5.68 | Anti-61 | Item468 | 1 | per ml |
| 469 | 5.69 | Anti-CD 68 | Item469 | 1 | per ml |
| 470 | 5.7 | Anti-CD 33 | Item470 | 1 | per ml |
| 471 | 5.71 | Anti-Ki 67 (Mib) | Item471 | 1 | per ml |
| 472 | 5.72 | Anti Neurofilament Protein | Item472 | 1 | per ml |
| 473 | 5.73 | Anti-Synaptophysin | Item473 | 1 | per ml |
| 474 | 5.74 | Anti-GFAP | Item474 | 1 | per ml |
| 475 | 5.75 | Anti-CD 99 | Item475 | 1 | per ml |
| 476 | 5.76 | Anti-CD 31 | Item476 | 1 | per ml |
| 477 | 5.77 | Anti-B HCG | Item477 | 1 | per ml |
| 478 | 5.78 | Poly-L.Lysine | Item478 | 1 | per ml |
| 479 | 5.79 | Anti-CD 20 (B cells) | Item479 | 1 | per ml |
| 480 | 5.8 | Anti-CD 45 (LCA) | Item480 | 1 | per ml |
| 481 | 5.81 | Anti-S 100 | Item481 | 1 | per ml |
| 482 | 5.82 | Anti- Desmin | Item482 | 1 | per ml |
| 483 | 5.83 | Anti-C-erb B-2 (Her-L/Neu) | Item483 | 1 | per ml |
| 484 | 5.84 | Anti-ER | Item484 | 1 | per ml |
| 485 | 5.85 | Anti-PR | Item485 | 1 | per ml |
| 486 | 5.86 | Anti-CD 3 | Item486 | 1 | per ml |
| 487 | 5.87 | Anti-CD 20 | Item487 | 1 | per ml |
| 488 | 5.88 | Anti-CD 117 | Item488 | 1 | per ml |
| 489 | 5.89 | Anti-CD 34 | Item489 | 1 | per ml |
| 490 | 5.9 | Anti-CD 30 | Item490 | 1 | per ml |
| 491 | 5.91 | Anti-Cyclin D1 | Item491 | 1 | per ml |
| 492 | 5.92 | Anti-CD 15 | Item492 | 1 | per ml |
| 493 | 5.93 | Anti-CD 5 | Item493 | 1 | per ml |
| 494 | 5.94 | FITC-Conjugated Rabbit | Item494 | 1 | per ml |
| 495 | 5.95 | Anti-Human IgA (alpha chain) | Item495 | 1 | per ml |
| 496 | 5.96 | FITC-Conjugated Rabbit | Item496 | 1 | per ml |
| 497 | 5.97 | Anti-Human IgG (Gamma chain) | Item497 | 1 | per ml |
| 498 | 5.98 | FITC-Conjugated Rabbit | Item498 | 1 | per ml |
| 499 | 5.99 | Anti-Human Kappa Light chain | Item499 | 1 | per ml |
| 500 | 6 | FITC-Conjugated Rabbit | Item500 | 1 | per ml |
| 501 | 6.01 | Anti-Human C3c Complement | Item501 | 1 | per ml |
| 502 | 6.02 | FITC-Conjugated Rabbit | Item502 | 1 | per ml |
| 503 | 6.03 | Anti-Human IgM (Mu chain) | Item503 | 1 | per ml |
| 504 | 6.04 | FITC-Conjugated Rabbit | Item504 | 1 | per ml |
| 505 | 6.05 | Anti-Human Lambda (Light chain) | Item505 | 1 | per ml |
| 506 | 6.06 | ANA by Hep-2-cell-line substrate(kit with reagents) | Item506 | 1 | pc |
| 507 | 6.07 | Electrodes for µpH System 361 | Item507 | 1 | pc |
| 508 | 6.08 | Osmium Tetroxide | Item508 | 1 | pc |
| 509 | 6.09 | Chromium trioxide | Item509 | 1 | pc |
| 510 | 6.1 | Zinc Chloride | Item510 | 1 | pc |
| 511 | 6.11 | Di-Sodium hydrogen phosphate anhydrous | Item511 | 1 | per gm |
| 512 | 6.12 | Di-Sodium hydrogen Orthophosphate Dibasic | Item512 | 1 | per gm |
| 513 | 6.13 | Sodium dihydrogen orthophosphate monohydrate | Item513 | 1 | per gm |
| 514 | 6.14 | Sodium borate | Item514 | 1 | per gm |
| 515 | 6.15 | Alpha napthyl butyrate | Item515 | 1 | per gm |
| 516 | 6.16 | Anti-CISH kits-HPV16/18DNA | Item516 | 1 | per ml |
| 517 | 6.17 | ER/P-R control | Item517 | 1 | per ml |
| 518 | 6.18 | Anti-Melanomal(HMB45) | Item518 | 1 | per ml |
| 519 | 6.19 | Anti Myeloperoxidase | Item519 | 1 | per ml |
| 520 | 6.2 | Anti -NSE | Item520 | 1 | per ml |
| 521 | 6.21 | Anti-PLAP | Item521 | 1 | per ml |
| 522 | 6.22 | Anti-bc12 oncoprotein | Item522 | 1 | per ml |
| 523 | 6.23 | Anti-Cytokeratin7 | Item523 | 1 | per ml |
| 524 | 6.24 | Anti-Cytokeratin20 | Item524 | 1 | per ml |
| 525 | 6.25 | Anti-BRCA 1Protein | Item525 | 1 | per ml |
| 526 | 6.26 | Anti-IgA | Item526 | 1 | per ml |
| 527 | 6.27 | Anti-IgM | Item527 | 1 | per ml |
| 528 | 6.28 | Anti-IgG | Item528 | 1 | per ml |
| 529 | 6.29 | Anti-compliment CD3 | Item529 | 1 | per ml |
| 530 | 6.3 | Anti-Rb gene protein | Item530 | 1 | per ml |
| 531 | 6.31 | Anti-P53 protein | Item531 | 1 | per ml |
| 532 | 6.32 | Anti-WT1 turmor | Item532 | 1 | per ml |
| 533 | 6.33 | Anti-Vimentin (V9) | Item533 | 1 | per ml |
| 534 | 6.34 | Anti-EMA(E29) | Item534 | 1 | per ml |
| 535 | 6.35 | Anti-p169INK4) | Item535 | 1 | per ml |
| 536 | 6.36 | Kappa | Item536 | 1 | per ml |
| 537 | 6.37 | Lamda | Item537 | 1 | per ml |
| 538 | 6.38 | Eosine spirit soluble | Item538 | 1 | per ml |
| 539 | 6.39 | PAP Pen Immuno histochemistry | Item539 | 1 | per ml |
| 540 | 6.4 | Anti-CD 1a | Item540 | 1 | per ml |
| 541 | 6.41 | Anti-SMA | Item541 | 1 | per ml |
| 542 | 6.42 | Anti-Myogenin | Item542 | 1 | per ml |
| 543 | 6.43 | Fluorescent bchiff reagent | Item543 | 1 | per ml |
| 544 | 6.44 | Carmine | Item544 | 1 | per ml |
| 545 | 6.45 | Acriffarine | Item545 | 1 | per ml |
| 546 | 6.46 | Cresyl fast blue | Item546 | 1 | per ml |
| 547 | 6.47 | Luxol fast blue | Item547 | 1 | per ml |
| 548 | 6.48 | Cresyl violet | Item548 | 1 | per ml |
| 549 | 6.49 | Epinephrine (3x0.5ml) | Item549 | 1 | pc |
| 550 | 6.5 | Aggrecetion ristocetion A Sulfate (3x0.5ml) | Item550 | 1 | pc |
| 551 | 6.51 | A D P(Adenosine-5l Diphosphate(3x0.5ml) | Item551 | 1 | pc |
| 552 | 6.52 | Arachidonic acid lyohillzed sodium Arachidonate | Item552 | 1 | pc |
| 553 | 6.53 | Collagen Soluble Calfskin(3x0.5ml) | Item553 | 1 | pc |
| 554 | 6.54 | Vw Fator Assay ristocetin cofactor (3x0.5ml) | Item554 | 1 | pc |
| 555 | 6.55 | Test tube( siliconized,flate bottom 7x25x55mm) | Item555 | 1 | pc |
| 556 | 6.56 | Stri Bars plastic coaled MICRO | Item556 | 1 | pc |
| 557 | 6.57 | Cryo Glue (Tissue Embedding Medium)for Cryostat Machine | Item557 | 1 | pc |
| 558 | 6.58 | Diposables blades for Cryostat Machine | Item558 | 1 | pc |
| 559 | 6.59 | Silicon Tubal Ring | Item559 | 1 | pc |
| 560 | 6.6 | Laser Spectacles | Item560 | 1 | pc |
| 561 | 6.61 | Fluid Warmer | Item561 | 1 | pc |
| 562 | 6.62 | Filter for Suction Machine( Atmos) | Item562 | 1 | pc |
| 563 | 6.63 | NIBP Monitor with integrated cuff arm | Item563 | 1 | pc |
| 564 | 6.64 | Serum Zinc | Item564 | 1 | per ml |
| 565 | 6.65 | Copper | Item565 | 1 | per ml |
| 566 | 6.66 | Ceruloplasmin | Item566 | 1 | per ml |
| 567 | 6.67 | Ammonia | Item567 | 1 | per ml |
| 568 | 6.68 | Ammonia | Item568 | 1 | per ml |
| 569 | 6.69 | Alcohol | Item569 | 1 | per ml |
| 570 | 6.7 | D- Dimer | Item570 | 1 | per ml |
| 571 | 6.71 | Anti ds DNA | Item571 | 1 | per ml |
| 572 | 6.72 | Anti sn Antibody | Item572 | 1 | per ml |
| 573 | 6.73 | Vitamin D | Item573 | 1 | per ml |
| 574 | 6.74 | Vitamin E | Item574 | 1 | per ml |
| 575 | 6.75 | NGAL | Item575 | 1 | per ml |
| 576 | 6.76 | Cystatin C | Item576 | 1 | per ml |
| 577 | 6.77 | G6 PD | Item577 | 1 | per ml |
| 578 | 6.78 | Lactate | Item578 | 1 | per ml |
| 579 | 6.79 | Apo A1 | Item579 | 1 | per ml |
| 580 | 6.8 | Homocysteine | Item580 | 1 | per ml |
| 581 | 6.81 | BNP | Item581 | 1 | per ml |
| 582 | 6.82 | Urinary VMA | Item582 | 1 | per ml |
| 583 | 6.83 | Blood ketones | Item583 | 1 | per ml |
| 584 | 6.84 | Lip a | Item584 | 1 | per ml |
| 585 | 6.85 | ANA | Item585 | 1 | per ml |
| 586 | 6.86 | Anti phospholipid antibody | Item586 | 1 | per ml |
| 587 | 6.87 | Vitamin C | Item587 | 1 | per ml |
| 588 | 6.88 | ENA | Item588 | 1 | per ml |
| 589 | 6.89 | Vitamin K | Item589 | 1 | per ml |
| 590 | 6.9 | Iodine | Item590 | 1 | per ml |
| 591 | 6.91 | APO B | Item591 | 1 | per ml |
| 592 | 6.92 | Troponin T | Item592 | 1 | per ml |
| 593 | 6.93 | CK MB1 | Item593 | 1 | per ml |
| 594 | 6.94 | CK MB 2 | Item594 | 1 | per ml |
| 595 | 6.95 | TIBC | Item595 | 1 | per ml |
| 596 | 6.96 | Transferrin | Item596 | 1 | per ml |
| 597 | 6.97 | IgG | Item597 | 1 | per ml |
| 598 | 6.98 | IgM | Item598 | 1 | per ml |
| 599 | 6.99 | IgA | Item599 | 1 | per ml |
| 600 | 7 | Inhibin A | Item600 | 1 | per ml |
| 601 | 7.01 | ß trace protein | Item601 | 1 | per ml |
| 602 | 7.02 | ?eta 2 microgobulin | Item602 | 1 | per ml |
| 603 | 7.03 | Alpha 1 Antitrypsin | Item603 | 1 | per ml |
| 604 | 7.04 | a -1 Microglobulin | Item604 | 1 | per ml |
| 605 | 7.05 | a-2 Macroglobulin | Item605 | 1 | per ml |
| 606 | 7.06 | Screening kit for inborn error of metabolism | Item606 | 1 | per ml |
| 607 | 7.07 | EQAS for clinical chemistry,Immunoassay, electrolyte, HbA1C. | Item607 | 1 | per ml |
| 608 | 7.08 | TPO (Thyroperoxidase) antibody | Item608 | 1 | per ml |
| 609 | 7.09 | Control for M-band electrophoresis | Item609 | 1 | per ml |
| 610 | 7.1 | TNF-a | Item610 | 1 | per ml |
| 611 | 7.11 | IL-2 | Item611 | 1 | per ml |
| 612 | 7.12 | Procalcitonin | Item612 | 1 | per ml |
| 613 | 7.13 | 5'ACAGCGTCATGGCAGAGCAGGTGGC3’ | Item613 | 1 | per ml |
| 614 | 7.14 | 5'AAAAGCTCTTCCCGCAGGATCCCGC3’ | Item614 | 1 | per ml |
| 615 | 7.15 | 5'GTGGCTGTTCCGGGATGGCCTTCTG3’ | Item615 | 1 | per ml |
| 616 | 7.16 | 5'CTTGAAGAAGGGCTCACTCTGTTTG3’ | Item616 | 1 | per ml |
| 617 | 7.17 | 5'CAGTACGATGATGCAGC3’ | Item617 | 1 | per ml |
| 618 | 7.18 | 5'CAGGTAGAAGAGGCGGT3’ | Item618 | 1 | per ml |
| 619 | 7.19 | amikacin ,neomycin & | Item619 | 1 | per ml |
| 620 | 7.2 | tobramycin standard (HPLC grade) | Item620 | 1 | per ml |
| 621 | 7.21 | EDTA gel (15%) | Item621 | 1 | Per gm |
| 622 | 7.22 | Acrylic - Heat cure-clear | Item622 | 1 | Pc |
| 623 | 7.23 | Acrylic - Heat cure-pink | Item623 | 1 | Pc |
| 624 | 7.24 | Acrylic - Self cure-clear | Item624 | 1 | Pc |
| 625 | 7.25 | Acrylic - Self cure-pink | Item625 | 1 | Pc |
| 626 | 7.26 | Agate Spatula | Item626 | 1 | Pc |
| 627 | 7.27 | Alginate impression material ( Dustless) | Item627 | 1 | Pc |
| 628 | 7.28 | Articulation paper | Item628 | 1 | Pc |
| 629 | 7.29 | Bur - Airotor-Diamond | Item629 | 1 | Pc |
| 630 | 7.3 | Bur - Airotor-TC- straight fissure | Item630 | 1 | Pc |
| 631 | 7.31 | Calcium Hydroxide paste for root canal | Item631 | 1 | Pc |
| 632 | 7.32 | Dappen dish | Item632 | 1 | Pc |
| 633 | 7.33 | Dental Floss – waxed, 25 m | Item633 | 1 | Pc |
| 634 | 7.34 | Dental Stone | Item634 | 1 | Pc |
| 635 | 7.35 | Dentin bonding agent | Item635 | 1 | Pc |
| 636 | 7.36 | Die stone | Item636 | 1 | Pc |
| 637 | 7.37 | Disposable Suction Tips with copper wire | Item637 | 1 | Pc |
| 638 | 7.38 | Emery Sheet - 100, 150 and 400 Grade | Item638 | 1 | Pc |
| 639 | 7.39 | Endodontic Gutta Percha Points(15-80) | Item639 | 1 | Pc |
| 640 | 7.4 | Etchant gel ( 37 % Phosphoric Acid) | Item640 | 1 | Pc |
| 641 | 7.41 | Fiber Composite splint | Item641 | 1 | Pc |
| 642 | 7.42 | Flexible Composite polishing discs | Item642 | 1 | Pc |
| 643 | 7.43 | Formocresol | Item643 | 1 | Pc |
| 644 | 7.44 | GIC- High strength pacakable for posteriors | Item644 | 1 | Pc |
| 645 | 7.45 | Glass Ionomer Cement Type I | Item645 | 1 | Pc |
| 646 | 7.46 | Glass Ionomer Cement Type II | Item646 | 1 | Pc |
| 647 | 7.47 | Gluma Dentin Desensitizer | Item647 | 1 | Pc |
| 648 | 7.48 | Gutta Percha Sticks | Item648 | 1 | Pc |
| 649 | 7.49 | Halogen bulbs- 12V, 55 W | Item649 | 1 | Pc |
| 650 | 7.5 | Hydroxyapatite Bone graft Material | Item650 | 1 | Pc |
| 651 | 7.51 | K File - all sizes | Item651 | 1 | Pc |
| 652 | 7.52 | Light cure composite - Flowable - All shades | Item652 | 1 | Pc |
| 653 | 7.53 | Light cure composite - nano-hybrid – all shades | Item653 | 1 | Pc |
| 654 | 7.54 | Modelling wax sheet no.2 | Item654 | 1 | Pc |
| 655 | 7.55 | Non Eugenol Impression Paste - standard pack | Item655 | 1 | Pc |
| 656 | 7.56 | Pinnacle tracing sticks ( minimum three years shelf life) | Item656 | 1 | Pc |
| 657 | 7.57 | Polishing brush for dental lathe | Item657 | 1 | Pc |
| 658 | 7.58 | Polymer Reinforced Zinc oxide Eugenol cement | Item658 | 1 | Pc |
| 659 | 7.59 | Pumice powder for polishing dentures | Item659 | 1 | Pc |
| 660 | 7.6 | Silver reinforced Glass Ionomer | Item660 | 1 | Pc |
| 661 | 7.61 | Supernal Base Plate | Item661 | 1 | Pc |
| 662 | 7.62 | Tissue conditioner ( Soft reliner) | Item662 | 1 | Pc |
| 663 | 7.63 | Ultrasonic scaler tip | Item663 | 1 | Pc |
| 664 | 7.64 | Vacuum formed sheets - Soft and hard - 2 and 3mm | Item664 | 1 | Pc |
| 665 | 7.65 | Vulcanite Trimmer ( TC) | Item665 | 1 | Pc |
| 666 | 7.66 | Zinc oxide Eugenol impression paste | Item666 | 1 | Pc |
| 667 | 7.67 | Self Cure Acrylic Tooth Colour Temporary Crown Materials (Powder & Liquid) | Item667 | 1 | Pc |
| 668 | 7.68 | Cold - Cure Acrylic Powder With Liquid (White Colour) | Item668 | 1 | Pc |
| 669 | 7.69 | Pits and Fissure Sealant | Item669 | 1 | Pc |
| 670 | 7.7 | Zinc oxide Eugenol impression paste | Item670 | 1 | Pc |
| 671 | 7.71 | IRM (Intermediate Restorative Materials) | Item671 | 1 | Pc |
| 672 | 7.72 | GIC Fuji Tupe IX | Item672 | 1 | Pc |
| 673 | 7.73 | GIC Type -II Restoative Materials | Item673 | 1 | Pc |
| 674 | 7.74 | Light Cure Composite Nano- Filling Materials | Item674 | 1 | Pc |
| 675 | 7.75 | Alginate impression material ( Dustless) | Item675 | 1 | Pc |
| 676 | 7.76 | Dental Stone | Item676 | 1 | Pc |
| 677 | 7.77 | Wedges | Item677 | 1 | Pc |
| 678 | 7.78 | Miracle Mix Materials | Item678 | 1 | Pc |
| 679 | 7.79 | Hand Piece Lubricant | Item679 | 1 | Pc |
| 680 | 7.8 | Dycal | Item680 | 1 | Pc |
| 681 | 7.81 | Suction Tips | Item681 | 1 | Pc |
| 682 | 7.82 | Acrylic Teeth Set | Item682 | 1 | Pc |
| 683 | 7.83 | Polishing Paste | Item683 | 1 | Pc |
| 684 | 7.84 | Polishing Rubber Cups and Bristle | Item684 | 1 | Pc |
| 685 | 7.85 | Disposable Glass | Item685 | 1 | Pc |
| 686 | 7.86 | Abrasive Strips for Polishing Proximal Areas of Teeth | Item686 | 1 | Pc |
| 687 | 7.87 | Cellophene Matrix Strips for LC Restoration | Item687 | 1 | Pc |
| 688 | 7.88 | Applicator Tips for LC | Item688 | 1 | Pc |
| 689 | 7.89 | Desensitizing Varnish | Item689 | 1 | Pc |
| 690 | 7.9 | Burs For Tooth Reduction Set | Item690 | 1 | Pc |
| 691 | 7.91 | Dental stone cutting Burs (Small Size) | Item691 | 1 | Pc |
| 692 | 7.92 | H-Files for Both Anterior and Posterior | Item692 | 1 | Pc |
| 693 | 7.93 | K- File for Both Anterior and Posterior | Item693 | 1 | Pc |
| 694 | 7.94 | Broaches | Item694 | 1 | Pc |
| 695 | 7.95 | Reamers for Both Anterior and Posterior | Item695 | 1 | Pc |
| 696 | 7.96 | Gutta Percha | Item696 | 1 | Pc |
| 697 | 7.97 | Absorbant Paper Point | Item697 | 1 | Pc |
| 698 | 7.98 | Titanium Post (All Sizes) | Item698 | 1 | Pc |
| 699 | 7.99 | Protapper Gutta Parcha All Size | Item699 | 1 | Pc |
| 700 | 8 | Alveogel | Item700 | 1 | Pc |
| 701 | 8.01 | RC CAL (Intra Canal Dressing Paste) | Item701 | 1 | Pc |
| 702 | 8.02 | Fiber Optics Air Rotor Hand Pieces with Coupling Unit | Item702 | 1 | Pc |
| 703 | 8.03 | GP Cutter | Item703 | 1 | Pc |
| 704 | 8.04 | Tungsten Carbide Burs For Air Rotor and Micro Motor HandPieces | Item704 | 1 | Pc |
| 705 | 8.05 | Sectional Matrixs | Item705 | 1 | Pc |
| 706 | 8.06 | Metal Crown | Item706 | 1 | Pc |
| 707 | 8.07 | Zinc oxide powder and eugenol (Big Size) | Item707 | 1 | Pc |
| 708 | 8.08 | Zinc oxide eugenol (Powder ) | Item708 | 1 | Pc |
| 709 | 8.09 | Zinc oxide eugenol (Liquid) | Item709 | 1 | Pc |
| 710 | 8.1 | Zinc oxide eugenol (ready mix) | Item710 | 1 | Pc |
| 711 | 8.11 | ZnO Impression paste | Item711 | 1 | Pc |
| 712 | 8.12 | Dycal Cement | Item712 | 1 | Pc |
| 713 | 8.13 | Stone burs (all sizes and shape) | Item713 | 1 | Pc |
| 714 | 8.14 | Stone burs for polishing (fine) | Item714 | 1 | Pc |
| 715 | 8.15 | Composit polishing disc | Item715 | 1 | Pc |
| 716 | 8.16 | Composite Cement | Item716 | 1 | Pc |
| 717 | 8.17 | Composite filling kit | Item717 | 1 | Pc |
| 718 | 8.18 | Composite finishing and polishing | Item718 | 1 | Pc |
| 719 | 8.19 | Composite polishing disc | Item719 | 1 | Pc |
| 720 | 8.2 | Composite polishing kit | Item720 | 1 | Pc |
| 721 | 8.21 | Composite polishing paste | Item721 | 1 | Pc |
| 722 | 8.22 | Endo Wash 5% 450ml | Item722 | 1 | Pc |
| 723 | 8.23 | Bristle Brush & Cup | Item723 | 1 | Pc |
| 724 | 8.24 | Eugenol 15ml | Item724 | 1 | Pc |
| 725 | 8.25 | Eugenol 110ml | Item725 | 1 | Pc |
| 726 | 8.26 | DPI Selfcure | Item726 | 1 | Pc |
| 727 | 8.27 | Ketac Molar | Item727 | 1 | Pc |
| 728 | 8.28 | NT Premium | Item728 | 1 | Pc |
| 729 | 8.29 | One Coat Bond | Item729 | 1 | Pc |
| 730 | 8.3 | GIC LC (Mini) GC | Item730 | 1 | Pc |
| 731 | 8.31 | PIVO Crown & Bridge Kit | Item731 | 1 | Pc |
| 732 | 8.32 | Protaper Hand Kit 21/25mm | Item732 | 1 | Pc |
| 733 | 8.33 | Mouth Mith Handle (GDC) | Item733 | 1 | Pc |
| 734 | 8.34 | Explorer (GDC) | Item734 | 1 | Pc |
| 735 | 8.35 | Surgical scissor (BRP) | Item735 | 1 | Pc |
| 736 | 8.36 | DPI Alloy | Item736 | 1 | Pc |
| 737 | 8.37 | Tri Hawk | Item737 | 1 | Pc |
| 738 | 8.38 | Glyde 3mlx1 | Item738 | 1 | Pc |
| 739 | 8.39 | GP F4-F5 (Dentsply) | Item739 | 1 | Pc |
| 740 | 8.4 | GP (15/35/40 ) Dentsply | Item740 | 1 | Pc |
| 741 | 8.41 | Dtech Etchn | Item741 | 1 | Pc |
| 742 | 8.42 | H File 15/20/25 | Item742 | 1 | Pc |
| 743 | 8.43 | Matrix Band No1 | Item743 | 1 | Pc |
| 744 | 8.44 | Diamond Bur | Item744 | 1 | Pc |
| 745 | 8.45 | Shofu Crown & Bridge Kit | Item745 | 1 | Pc |
| 746 | 8.46 | Vitrebond | Item746 | 1 | Pc |
| 747 | 8.47 | AH 26 | Item747 | 1 | Pc |
| 748 | 8.48 | Ketac Silver | Item748 | 1 | Pc |
| 749 | 8.49 | API Needle Holder | Item749 | 1 | Pc |
| 750 | 8.5 | NSK Push Button Airotor Handpiece | Item750 | 1 | Pc |
| 751 | 8.51 | Apex Locator Pixi Dentsply | Item751 | 1 | Pc |
| 752 | 8.52 | Lightcure Michine Coltene | Item752 | 1 | Pc |
| 753 | 8.53 | Sealer Machine with Pouch | Item753 | 1 | Pc |
| 754 | 8.54 | Scaller Tips Satellec | Item754 | 1 | Pc |
| 755 | 8.55 | Ultrasonic Cleaner | Item755 | 1 | Pc |
| 756 | 8.56 | Smart Burs | Item756 | 1 | Pc |
| 757 | 8.57 | Anti Fog Mouth Mirror | Item757 | 1 | Pc |
| 758 | 8.58 | Flouride Solution with Applicator | Item758 | 1 | Pc |
| 759 | 8.59 | Luting Cement | Item759 | 1 | Pc |
| 760 | 8.6 | Silicon Base Impression Materials | Item760 | 1 | Pc |
| 761 | 8.61 | Base Putty Impression Materials | Item761 | 1 | Pc |
| 762 | 8.62 | Light Body Impression Materials | Item762 | 1 | Pc |
| 763 | 8.63 | Re Cap | Item763 | 1 | Pc |
| 764 | 8.64 | DVI Self | Item764 | 1 | Pc |
| 765 | 8.65 | Propopar Band Kit 21/25ml | Item765 | 1 | Pc |
| 766 | 8.66 | GHOFU Crown & Bridge Kit | Item766 | 1 | Pc |
| 767 | 8.67 | ALT 26 | Item767 | 1 | Pc |
| 768 | 8.68 | APL Needle Holder | Item768 | 1 | Pc |
| 769 | 8.69 | Giyote 3ml | Item769 | 1 | Pc |
| 770 | 8.7 | IA File 15/20/25 | Item770 | 1 | Pc |
| 771 | 8.71 | Otech | Item771 | 1 | Pc |
| 772 | 8.72 | Flowable Composite Shade | Item772 | 1 | Pc |
| 773 | 8.73 | Plastic Filling Instruments | Item773 | 1 | Pc |
| 774 | 8.74 | Cement Spatula | Item774 | 1 | Pc |
| 775 | 8.75 | Cement Condenser | Item775 | 1 | Pc |
| 776 | 8.76 | Ball Burnisher (API) | Item776 | 1 | Pc |
| 777 | 8.77 | Extraction Forcept for Pedo (set of 16) | Item777 | 1 | Pc |
| 778 | 8.78 | Tweezer | Item778 | 1 | Pc |
| 779 | 8.79 | Diamond Round Bur | Item779 | 1 | Pc |
| 780 | 8.8 | Diamond Straight Fissure Bur | Item780 | 1 | Pc |
| 781 | 8.81 | Diamond Cone Shape Bur | Item781 | 1 | Pc |
| 782 | 8.82 | Contra Angle Hand Piece | Item782 | 1 | Pc |
| 783 | 8.83 | Paper point (15-40 & 45-80) | Item783 | 1 | Pc |
| 784 | 8.84 | Flamed Shaped Diamond Bur (All Sizes) | Item784 | 1 | Pc |
| 785 | 8.85 | Spoon Excavator | Item785 | 1 | Pc |
| 786 | 8.86 | Cold Mold Seal | Item786 | 1 | Pc |
| 787 | 8.87 | Pain Off | Item787 | 1 | Pc |
| 788 | 8.88 | Shade Guide | Item788 | 1 | Pc |
| 789 | 8.89 | Coe- Pack | Item789 | 1 | Pc |
| 790 | 8.9 | Apexit Plus | Item790 | 1 | Pc |
| 791 | 8.91 | Fibre Post (yellow, red , blue) | Item791 | 1 | Pc |
| 792 | 8.92 | Gingival Retraction Cord | Item792 | 1 | Pc |
| 793 | 8.93 | Spreader /Plugger (all sizes) | Item793 | 1 | Pc |
| 794 | 8.94 | Disposable Napkin | Item794 | 1 | Pc |
| 795 | 8.95 | Crown Cutting Kit | Item795 | 1 | Pc |
| 796 | 8.96 | Elevators (straight and periostal) | Item796 | 1 | Pc |
| 797 | 8.97 | Extraction Forcept for pedo adult (set of 14) | Item797 | 1 | Pc |
| 798 | 8.98 | G-coat Plus | Item798 | 1 | Pc |
| 799 | 8.99 | Protemp with tips and gun | Item799 | 1 | Pc |
| 800 | 9 | GIC Type IX | Item800 | 1 | Pc |
| 801 | 9.01 | Durable Flouride Releasing Coating | Item801 | 1 | Pc |
| 802 | 9.02 | Light Curing nano ionomer restorative | Item802 | 1 | Pc |
| 803 | 9.03 | Remin pro (protective dental cream) | Item803 | 1 | Pc |
| 804 | 9.04 | Chair Bulbs (ocero Infinity) | Item804 | 1 | Pc |
| 805 | 9.05 | Cold cure (pink) powder | Item805 | 1 | Pc |
| 806 | 9.06 | Cold cure (White) powder | Item806 | 1 | Pc |
| 807 | 9.07 | Cold Cure Liquid | Item807 | 1 | Pc |
| 808 | 9.08 | Green Sticks | Item808 | 1 | Pc |
| 809 | 9.09 | Mercury | Item809 | 1 | Pc |
| 810 | 9.1 | Disposable Patient Apron | Item810 | 1 | Pc |
| 811 | 9.11 | Bobe Cutter | Item811 | 1 | Pc |
| 812 | 9.12 | Bobe ronger | Item812 | 1 | Pc |
| 813 | 9.13 | Bone file | Item813 | 1 | Pc |
| 814 | 9.14 | Mought Prod Chain | Item814 | 1 | Pc |
| 815 | 9.15 | Macet/Hammer | Item815 | 1 | Pc |
| 816 | 9.16 | Amalgam Condenser | Item816 | 1 | Pc |
| 817 | 9.17 | Amalgam carrier | Item817 | 1 | Pc |
| 818 | 9.18 | Amalgam Curver | Item818 | 1 | Pc |
| 819 | 9.19 | Wax Knife | Item819 | 1 | Pc |
| 820 | 9.2 | Wire Cutter | Item820 | 1 | Pc |
| 821 | 9.21 | Plier | Item821 | 1 | Pc |
| 822 | 9.22 | Rubber dam Kit | Item822 | 1 | Pc |
| 823 | 9.23 | Crown remover | Item823 | 1 | Pc |
| 824 | 9.24 | Micromotor drill bits | Item824 | 1 | Pc |
| 825 | 9.25 | Compo Roller | Item825 | 1 | Pc |
| 826 | 9.26 | GP Holder | Item826 | 1 | Pc |
| 827 | 9.27 | Surgical Micromotor | Item827 | 1 | Pc |
| 828 | 9.28 | Periodontal Probe | Item828 | 1 | Pc |
| 829 | 9.29 | Acrylic Mixing Jar | Item829 | 1 | Pc |
| 830 | 9.3 | Air Polisher | Item830 | 1 | Pc |
| 831 | 9.31 | S.S. Inter maxillary fixation Screws 2.0mm - 12-14mm | Item831 | 1 | Pc |
| 832 | 9.32 | S.S. Inter maxillary fixation Screws 2.5mm - 12-14 mm | Item832 | 1 | Pc |
| 833 | 9.33 | Titanium cranial microplates (0.5mm plate thickness)10-18hole straight | Item833 | 1 | Pc |
| 834 | 9.34 | Titanium mandible miniplates (1mm plate thickness) 4 hole with bar/gap | Item834 | 1 | Pc |
| 835 | 9.35 | Titanium mandible miniplates (1mm plate thickness) 10-12hole straight | Item835 | 1 | Pc |
| 836 | 9.36 | Titanium midfacial miniplates (0.5-0.6mm plate thickness) L plate 90 degree long 4 hole with bar/gap Right side | Item836 | 1 | Pc |
| 837 | 9.37 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 90 degree Long 4 hole with bar/gap left side. | Item837 | 1 | Pc |
| 838 | 9.38 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree short 4 hole with bar/gap Right side | Item838 | 1 | Pc |
| 839 | 9.39 | Titanum Mid Facial Miniplates (0.5-0.6mm plates thickness) L plate 100-110 degree short 4 hole with bar/ gap Left side | Item839 | 1 | Pc |
| 840 | 9.4 | Titannium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree long 4 hole with bar/gap Right side | Item840 | 1 | Pc |
| 841 | 9.41 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree Long 4 hole With bar/gap Left side | Item841 | 1 | Pc |
| 842 | 9.42 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 4 hole With bar/gap | Item842 | 1 | Pc |
| 843 | 9.43 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 6 hole with bar/gap . | Item843 | 1 | Pc |
| 844 | 9.44 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 10 hole | Item844 | 1 | Pc |
| 845 | 9.45 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) T Plates 5 holes | Item845 | 1 | Pc |
| 846 | 9.46 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Y plate 4 holes | Item846 | 1 | Pc |
| 847 | 9.47 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Double Y plate 4 holes | Item847 | 1 | Pc |
| 848 | 9.48 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) X plate 5 holes | Item848 | 1 | Pc |
| 849 | 9.49 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Straight plate 10-12 holes | Item849 | 1 | Pc |
| 850 | 9.5 | Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 12-16 holes | Item850 | 1 | Pc |
| 851 | 9.51 | Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 20-25 holes | Item851 | 1 | Pc |
| 852 | 9.52 | Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 12-16 holes | Item852 | 1 | Pc |
| 853 | 9.53 | Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 20-25 holes | Item853 | 1 | Pc |
| 854 | 9.54 | Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 12-16 holes | Item854 | 1 | Pc |
| 855 | 9.55 | Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 20-25 holes | Item855 | 1 | Pc |
| 856 | 9.56 | Titanium double angled Reconstruction plates (2-2.4mm plate thickness) 20-25 holes | Item856 | 1 | Pc |
| 857 | 9.57 | Titanium Cranial ( outer diameter 1.0-1.2 mm) non self drilling screw- 4-6 mm length | Item857 | 1 | Pc |
| 858 | 9.58 | Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -6mm length | Item858 | 1 | Pc |
| 859 | 9.59 | Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -8 mm length | Item859 | 1 | Pc |
| 860 | 9.6 | Titanium midfacial (outer diameter 1.8/1.9mm) non self- drilling emergency screw -6 mm length | Item860 | 1 | Pc |
| 861 | 9.61 | Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -6mm length | Item861 | 1 | Pc |
| 862 | 9.62 | Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -8mm length | Item862 | 1 | Pc |
| 863 | 9.63 | Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -6mm length | Item863 | 1 | Pc |
| 864 | 9.64 | Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -8 mm length | Item864 | 1 | Pc |
| 865 | 9.65 | Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling screw -10mm length | Item865 | 1 | Pc |
| 866 | 9.66 | Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling Maxi screw -12mm length | Item866 | 1 | Pc |
| 867 | 9.67 | Titanium Reconstruction (2.4mm) non self- drilling Maxi Emergency screw -8-20mm length | Item867 | 1 | Pc |
| 868 | 9.68 | Titanium Lag Screws non self drilling ( outer diameter 2.4/2.5 mm)- 15-20mm length | Item868 | 1 | Pc |
| 869 | 9.69 | Drill bit with 6mm stop for Titanium cranial (1.0/1.2mm,1.0 mm pilot hole diameter) non self- drilling screw | Item869 | 1 | Pc |
| 870 | 9.7 | Drill bit with 6mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw | Item870 | 1 | Pc |
| 871 | 9.71 | Drill bit with 8mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw | Item871 | 1 | Pc |
| 872 | 9.72 | Drill bit with 6mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw | Item872 | 1 | Pc |
| 873 | 9.73 | Drill bit with 8mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw | Item873 | 1 | Pc |
| 874 | 9.74 | Drill bit with 10-12mm stop for Titanium (2.4mm reconstruction, pilot hole diameter 2mm) non self-drilling screw | Item874 | 1 | Pc |
| 875 | 9.75 | Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 4x4 cms | Item875 | 1 | Pc |
| 876 | 9.76 | Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 6x6 cms | Item876 | 1 | Pc |
| 877 | 9.77 | Titanium Mesh for mandible (0.5-0.6mm thickness) approx. dimension 10x8 cms | Item877 | 1 | Pc |
| 878 | 9.78 | Titanium orbital reconstruction mesh plates- Small | Item878 | 1 | Pc |
| 879 | 9.79 | Titanium orbital reconstruction mesh plates- Medium | Item879 | 1 | Pc |
| 880 | 9.8 | Titanium orbital reconstruction mesh plates- Large ( with medial and lateral wall extensions) | Item880 | 1 | Pc |
| 881 | 9.81 | Porous Polyethylene Orbital sheets ( 0.8-1.5 mm thickness; 5x5 cms approx) | Item881 | 1 | Pc |
| 882 | 9.82 | 26 guage Stainless Steel wire spool | Item882 | 1 | Pc |
| 883 | 9.83 | 32 guage Stainless Steel wire spool | Item883 | 1 | Pc |
| 884 | 9.84 | Raney Clips Stainless Steel | Item884 | 1 | Pc |
| 885 | 9.85 | 022 slot MBT Brackets with weldable convertible UTLD first molar Buccal tubes and NC II molar tubes | Item885 | 1 | Pc |
| 886 | 9.86 | Crimpable hooks | Item886 | 1 | Pc |
| 887 | 9.87 | 016 Multistranded SS wire | Item887 | 1 | Pc |
| 888 | 9.88 | Preformed Archwire - 014 NiTi U/ L | Item888 | 1 | Pc |
| 889 | 9.89 | Preformed Archwire - 016 NiTi U/ L | Item889 | 1 | Pc |
| 890 | 9.9 | Preformed Archwire - 016 x 022 SS – U/L | Item890 | 1 | Pc |
| 891 | 9.91 | Preformed Archwire - 017 x 025 SS– U /L | Item891 | 1 | Pc |
| 892 | 9.92 | Preformed Archwire - 019 x 025 SS – U / L | Item892 | 1 | Pc |
| 893 | 9.93 | Orthodontic stone | Item893 | 1 | Pc |
| 894 | 9.94 | Dunaform – soft and hard sheets- 2mm, 3mm | Item894 | 1 | Pc |
| 895 | 9.95 | Dental Surgery | Item895 | 1 | Pc |
| 896 | 9.96 | Mouth Mirror with Handle | Item896 | 1 | Pc |
| 897 | 9.97 | Mouth mirror | Item897 | 1 | Pc |
| 898 | 9.98 | Dental probe | Item898 | 1 | Pc |
| 899 | 9.99 | Periodontal probe | Item899 | 1 | Pc |
| 900 | 10 | Dental Explorer ( Curved and pigtail) | Item900 | 1 | Pc |
| 901 | 10.01 | Glass Bead Sterilizer | Item901 | 1 | Pc |
| 902 | 10.02 | Airotor handpiece - Mini-head (2 years warranty) | Item902 | 1 | Pc |
| 903 | 10.03 | Medesy/Hu Friedy Maxillary Anterior Extraction forceps | Item903 | 1 | Pc |
| 904 | 10.04 | Medesy/Hu Friedy Maxillary Reed's Extraction forceps | Item904 | 1 | Pc |
| 905 | 10.05 | Medesy/Hu Friedy Maxillary Premolar Extraction forceps | Item905 | 1 | Pc |
| 906 | 10.06 | Medesy/Hu Friedy Maxillary Molar Extraction forceps Right/Left | Item906 | 1 | Pc |
| 907 | 10.07 | Medesy/Hu Friedy Maxillary Bayonet Extraction forceps | Item907 | 1 | Pc |
| 908 | 10.08 | Medesy/Hu Friedy MaxillaryThird molar Extraction forceps | Item908 | 1 | Pc |
| 909 | 10.09 | Medesy/Hu Friedy Mandibular Anterior Extraction forceps | Item909 | 1 | Pc |
| 910 | 10.1 | Medesy/Hu Friedy Mandibular premolar Extraction forceps | Item910 | 1 | Pc |
| 911 | 10.11 | Medesy/Hu Friedy Mandibular molar Extraction forceps | Item911 | 1 | Pc |
| 912 | 10.12 | Medesy/Hu Friedy Warwick James Elevator-Straight | Item912 | 1 | Pc |
| 913 | 10.13 | Medesy/Hu FriedyWarwick James Elevator-Right/Left | Item913 | 1 | Pc |
| 914 | 10.14 | Medesy/Hu FriedyCryer's Elevator-Small size- Right/Left | Item914 | 1 | Pc |
| 915 | 10.15 | Medesy/Hu FriedyCryer's Elevator-Medium size- Right/Left | Item915 | 1 | Pc |
| 916 | 10.16 | Medesy/Hu FriedyCryer's Elevator- Large Size-Right/left | Item916 | 1 | Pc |
| 917 | 10.17 | Double angled Currette- Medium size | Item917 | 1 | Pc |
| 918 | 10.18 | Double angled Currette- Large size | Item918 | 1 | Pc |
| 919 | 10.19 | Molt's Perisoteal Elevator | Item919 | 1 | Pc |
| 920 | 10.2 | Freer Periosteal Elevator | Item920 | 1 | Pc |
| 921 | 10.21 | Walsham's nasal Forceps- Pair | Item921 | 1 | Pc |
| 922 | 10.22 | Asche Septal Forceps | Item922 | 1 | Pc |
| 923 | 10.23 | Hayton's Williams maxillary forceps | Item923 | 1 | Pc |
| 924 | 10.24 | Rowe's zygomatic elevator | Item924 | 1 | Pc |
| 925 | 10.25 | Sigmoid Notch retractor (Left/Right) | Item925 | 1 | Pc |
| 926 | 10.26 | Ramal Retractor | Item926 | 1 | Pc |
| 927 | 10.27 | wire cutter | Item927 | 1 | Pc |
| 928 | 10.28 | wire twister | Item928 | 1 | Pc |
| 929 | 10.29 | Coronoid retractor | Item929 | 1 | Pc |
| 930 | 10.3 | Mastoid self retaining retractor | Item930 | 1 | Pc |
| 931 | 10.31 | Mandibular Lower Border retractor | Item931 | 1 | Pc |
| 932 | 10.32 | Condylar retractor | Item932 | 1 | Pc |
| 933 | 10.33 | Dingmann retractor ( Adult) | Item933 | 1 | Pc |
| 934 | 10.34 | Vestibular retractor | Item934 | 1 | Pc |
| 935 | 10.35 | Swallow Tail retractor | Item935 | 1 | Pc |
| 936 | 10.36 | Curved Pterygoid osteotome 8mm | Item936 | 1 | Pc |
| 937 | 10.37 | Curved Pterygoid osteotome 10mm | Item937 | 1 | Pc |
| 938 | 10.38 | Epker Osteotome 4mm/6mm/8mm Curved | Item938 | 1 | Pc |
| 939 | 10.39 | Epker Osteotome 4mm/6mm/8mm Straight with marking | Item939 | 1 | Pc |
| 940 | 10.4 | Orthodontic model boxes | Item940 | 1 | Pc |
| 941 | 10.41 | Tongue Guard - Medium | Item941 | 1 | Pc |
| 942 | 10.42 | Dontrix gauge | Item942 | 1 | Pc |
| 943 | 10.43 | Extraoral Force gauge | Item943 | 1 | Pc |
| 944 | 10.44 | Orthodontic Typodont set ( With wax ridges and teeth set ) | Item944 | 1 | Pc |
| 945 | 10.45 | Plaster Vibrator (Worktop area of at least 20 X 10 cm, adjustable setting, 2 years warranty) | Item945 | 1 | Pc |
| 946 | 10.46 | Haematoxylin & Eosin Stain | Item946 | 1 | Pc |
| 947 | 10.47 | Eosin & Negrosin stain | Item947 | 1 | Pc |
| 948 | 10.48 | V.G. Tube | Item948 | 1 | Pc |
| 949 | 10.49 | Manipulation Pipette | Item949 | 1 | Pc |
| 950 | 10.5 | Metallic TVS Needle Guided Bracket | Item950 | 1 | Pc |
| 951 | 10.51 | Syringe Non Rubber 1ml | Item951 | 1 | Pc |
| 952 | 10.52 | Granulocyte colony stimulating factor | Item952 | 1 | Pc |
| 953 | 10.53 | Pipelle Aspirator/Vabra Aspirator | Item953 | 1 | Pc |
| 954 | 10.54 | Progesterone gel | Item954 | 1 | Pc |
| 955 | 10.55 | Injectable Progesterone | Item955 | 1 | Pc |
| 956 | 10.56 | Latex Condom without spermicide | Item956 | 1 | Pc |
| 957 | 10.57 | Osafe Incubator and Laminar Floor Cleaning Lotion | Item957 | 1 | Pc |
| 958 | 10.58 | Fersafe Antiseptic Lotion | Item958 | 1 | Pc |
| 959 | 10.59 | Liquid Nitrogen for Cryocan | Item959 | 1 | Pc |
| 960 | 10.6 | Immunobeads Reagents( Rabbit Anti Human IgG | Item960 | 1 | Pc |
| 961 | 10.61 | Immunobeads Reagents( Rabbit Anti Human IgA | Item961 | 1 | Pc |
| 962 | 10.62 | Immunobeads Reagents( Rabbit Anti Human IgM | Item962 | 1 | Pc |
| 963 | 10.63 | Conical Dispo Beaker 3.0ml | Item963 | 1 | Pc |
| 964 | 10.64 | PRP Lens | Item964 | 1 | Each |
| 965 | 10.65 | FAC's Tube (12 x 75mm, 5ml Round Bottom Test Tube, snap, sterile Cat: 352054 | Item965 | 1 | Each |
| 966 | 10.66 | Kymograph Paper (100 sheets) | Item966 | 1 | Each |
| 967 | 10.67 | Perimetric Chart Paper (100 sheets) | Item967 | 1 | Each |
| 968 | 10.68 | Haemocytometer Box | Item968 | 1 | Each |
| 969 | 10.69 | Haemoglobinometer sets | Item969 | 1 | Each |
| 970 | 10.7 | Dewar Tank 11 litre | Item970 | 1 | Each |
| 971 | 10.71 | CRYO PRO - 500ml (Liquid Nitrogen Cryosurgical Equipment | Item971 | 1 | Each |
| 972 | 10.72 | Bulb for Telepack Lamp | Item972 | 1 | Each |
| 973 | 10.73 | Radiofrequency Electrode Round Loop Big | Item973 | 1 | Each |
| 974 | 10.74 | Radiofrequency Electrode Round Loop Small | Item974 | 1 | Each |
| 975 | 10.75 | Bacterial Filter Machine sl No:101122008 | Item975 | 1 | Each |
| 976 | 10.76 | Indirect Ophthalmoscope | Item976 | 1 | Each |
| 977 | 10.77 | 20448-000Hgh Pressure Hose(Erbe Cryo Unit)) | Item977 | 1 | Each |
| 978 | 10.78 | Bone hand Drill Moore - 8448.28 | Item978 | 1 | Each |
| 979 | 10.79 | Hand Drill Jacobs Chuck | Item979 | 1 | Each |
| 980 | 10.8 | Demartel Condf/Wire Sawsflex 350mm | Item980 | 1 | Each |
| 981 | 10.81 | Twist Drill Set of 3mm, 3.5mm 4mm, 4.5mm | Item981 | 1 | Each |
| 982 | 10.82 | Crocodile Forceps (Ear Microsurgery) | Item982 | 1 | Each |
| 983 | 10.83 | Ear Microsuction Tips | Item983 | 1 | Each |
| 984 | 10.84 | Adaptors for Ear Microsuction Tips | Item984 | 1 | Each |
| 985 | 10.85 | Cup Ear Forceps | Item985 | 1 | Each |
| 986 | 10.86 | Perforators for Stopedectomy 0.4mm | Item986 | 1 | Each |
| 987 | 10.87 | Perforators for Stopedectomy 0.5mm | Item987 | 1 | Each |
| 988 | 10.88 | Rigid Pharyngoscope (pediatric) 20cm | Item988 | 1 | Each |
| 989 | 10.89 | Tonsil Holding Forceps | Item989 | 1 | Each |
| 990 | 10.9 | Straight Pick (Tympanyplasty) | Item990 | 1 | Each |
| 991 | 10.91 | Back Biting Forceps for Endoscope Nasal Surgery | Item991 | 1 | Each |
| 992 | 10.92 | Fiberoptic Otoscope with Pneumatic Pump | Item992 | 1 | Each |
| 993 | 10.93 | Bismith lodopyrrophosphate (BIPP) Paste/Powder | Item993 | 1 | Each |
| 994 | 10.94 | Mercurochrome Lotion | Item994 | 1 | Each |
| 995 | 10.95 | Haed Light fot ENT | Item995 | 1 | Each |
| 996 | 10.96 | Endoscopic Biopsy Forceps with Needle | Item996 | 1 | Each |
| 997 | 10.97 | CPR Manikin | Item997 | 1 | Each |
| 998 | 10.98 | Intubation Manikin | Item998 | 1 | Each |
| 999 | 10.99 | Easy Pump | Item999 | 1 | Each |
| 1000 | 11 | MRI Contrast Media - Gadoterate Meglumine Injection 5mmmol /ml. 10 ml vial | Item1000 | 1 | vial |
| 1001 | 11.01 | MRI Contrast Media - Gadobenate Dimeglumine Injection 10ml vial | Item1001 | 1 | vial |
| 1002 | 11.02 | MRI Contrast Media - Gadopentetate Dimeglumine Injection 0.5mmol/ml. 10 ml vial | Item1002 | 1 | vial |
| 1003 | 11.03 | MRI Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5ml | Item1003 | 1 | vial |
| 1004 | 11.04 | Non -Ionic Contrast Media - Iopromide Injection: USP 370mg - 50 ml vial | Item1004 | 1 | vial |
| 1005 | 11.05 | Non -Ionic Contrast Media - Iopromide Injection: USP 370mg -100ml vial | Item1005 | 1 | vial |
| 1006 | 11.06 | Non -Ionic Contrast Media - Iopromide Injection: USP 300mg -100ml vial | Item1006 | 1 | vial |
| 1007 | 11.07 | Non -Ionic Contrast Media -Iobitridol 350mg -100ml vial | Item1007 | 1 | vial |
| 1008 | 11.08 | Non -Ionic Contrast Media -Iomeprol Injection 300mg -50ml vial | Item1008 | 1 | vial |
| 1009 | 11.09 | Non -Ionic Contrast Media -Iomeprol Injection 300mg -100ml vial | Item1009 | 1 | vial |
| 1010 | 11.1 | Non -Ionic Contrast Media -Iomeprol Injection 350mg -50ml vial | Item1010 | 1 | vial |
| 1011 | 11.11 | Non -Ionic Contrast Media -Iomeprol Injection 350mg -100ml vial | Item1011 | 1 | vial |
| 1012 | 11.12 | Non -Ionic Contrast Media -Iomeprol Injection 400mg -50ml vial | Item1012 | 1 | vial |
| 1013 | 11.13 | Non -Ionic Contrast Media -Iomeprol Injection 400mg -100ml vial | Item1013 | 1 | vial |
| 1014 | 11.14 | Non -Ionic Contrast Media -Iopamidol Injection 370mg -50ml vial | Item1014 | 1 | vial |
| 1015 | 11.15 | Non -Ionic Contrast Media -Iopamidol Injection 370mg -100ml vial | Item1015 | 1 | vial |
| 1016 | 11.16 | Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20ml vial | Item1016 | 1 | vial |
| 1017 | 11.17 | Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50ml vial | Item1017 | 1 | vial |
| 1018 | 11.18 | Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100ml vial | Item1018 | 1 | vial |
| 1019 | 11.19 | COUPLAND ALL NOS | Item1019 | 1 | vial |
| 1020 | 11.2 | ELEVATORS (CRYER) 1 PAIRS | Item1020 | 1 | vial |
| 1021 | 11.21 | CASTROVEJO SCISSOR | Item1021 | 1 | vial |
| 1022 | 11.22 | SAMLL MICRO SCISSOR | Item1022 | 1 | vial |
| 1023 | 11.23 | LIGHT CURE COMPOSITE A2 | Item1023 | 1 | vial |
| 1024 | 11.24 | LIGHT CURE COMPOSITE A3 | Item1024 | 1 | vial |
| 1025 | 11.25 | LIGHT CURE COMPOSITE A3.5 | Item1025 | 1 | vial |
| 1026 | 11.26 | H-FILES FOR SIZE (15-40) 21MM | Item1026 | 1 | vial |
| 1027 | 11.27 | TOOTH POLISHING BRUSH | Item1027 | 1 | vial |
| 1028 | 11.28 | GLIDE | Item1028 | 1 | vial |
| 1029 | 11.29 | GRACY CURRETTE | Item1029 | 1 | vial |
| 1030 | 11.3 | Polyester braided suture * 2 75cm HGS-21, Blue 37mm 1/2 circle Taper Point : size-2 | Item1030 | 1 | pc |
| 1031 | 11.31 | Polyester braided suture * 2 75cm HOS-10, Blue 26mm 1/2 circle Reserve Cutting : size-2 | Item1031 | 1 | pc |
| 1032 | 11.32 | Polyester braided suture * 1 75cm HOS 12, Blue 40mm 1/2 Circle Reserve Cutting size -1 | Item1032 | 1 | pc |
| 1033 | 11.33 | Polyester braided suture * 5 75cm HOS-14, Blue 57mm 1/2 Circle Reverse Cutting size-5 | Item1033 | 1 | pc |
| 1034 | 11.34 | Polyester braided suture * 25x75cm KV-37, Blue 40mm 1/2 Circle Tapercutting size-2 | Item1034 | 1 | pc |
| 1035 | 11.35 | Poleyster braided suture * 54x75cm KV-40, Blue 45mm 1/2 Circle Tapercutting size-5 | Item1035 | 1 | pc |
| 1036 | 11.36 | Monofilament Knotless Polyglyconate wound closure device, 0 45cm GS-21, Green 37mm 1/2 Circle Taper Point, box of 12 foils size-0 | Item1036 | 1 | pc |
| 1037 | 11.37 | Monofilament Knotless Polyglyconate wound closure device, 2-0 30cm cm V-20, Green 26mm 1/2 Circle Taper Point, box of 12 foils size-2-0 | Item1037 | 1 | pc |
| 1038 | 11.38 | Monofilament Knotless Glycomer 631 wound closure device, 3-0 45cm P-14, UNDYED 24mm 3/8 Circle Resverse Cutting, box of 12 foils size- 3-0 | Item1038 | 1 | pc |
| 1039 | 11.39 | Polybutester monofilament suture with polytribolate coating size-*6-0 60cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0 | Item1039 | 1 | pc |
| 1040 | 11.4 | Polybutester monofilament suture with polytribolate coating size-*6-0 75cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0 | Item1040 | 1 | pc |
| 1041 | 11.41 | Polybutester monifilament suture with polytribolate coating Size-*5-0, 75cm 2XCV-11X36, Blue 12mm 3/8 Circle Taper Point | Item1041 | 1 | pc |
| 1042 | 11.42 | Polybutester monofilament suture with polytribolate coating Size-*4-0 90cm 2XCV-23X36, Blue 17mm 1/2Circle Taper Point size: 4-0 | Item1042 | 1 | pc |
| 1043 | 11.43 | Polybutester monofilament suture with polytribulate coating Size-*5-0 90cm2XCV, Blue 17mm 1/2 Circle Taper Point size: 5-0 | Item1043 | 1 | pc |
| 1044 | 11.44 | Polybutester moniofilament suture with polytribulate coating Size-*5-0, 75cm 2XKV-11X36, Blue 13mm 3/8 Circle Tapercutting size: 5-0 | Item1044 | 1 | pc |
| 1045 | 11.45 | Polybutester monofilament suture with polytribolate coating Size-* 7-0, 60cm 2XMV-175-8, Blue 8mm 3/8 Circle Taper Point size: 7-0 | Item1045 | 1 | pc |
| 1046 | 11.46 | Polybutester monofilament suture with polytribolate coating Size-*2-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point | Item1046 | 1 | pc |
| 1047 | 11.47 | Polybutester monofilament suture with polytribolate coating Size-*3-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point | Item1047 | 1 | pc |
| 1048 | 11.48 | Monofilament Knotless Glycomer 631 wound closure device, 2-0 23cm , VIOLET 27mm 1/2 Circle Taper Point, box of 12 foils size- 2-0 | Item1048 | 1 | pc |
| 1049 | 11.49 | Vaccutrend Needle/Syringe 21" x 15" | Item1049 | 1 | Each |
| 1050 | 11.5 | Vaccutrend Needle/Syringe 22" x 15" | Item1050 | 1 | Each |
| 1051 | 11.51 | Vaccutrent Needle /Syringe | Item1051 | 1 | Each |
| 1052 | 11.52 | Immunohistochemistry: | Item1052 | 1 | Each |
| 1053 | 11.53 | Anti Pax-5 FFPE | Item1053 | 1 | per ml |
| 1054 | 11.54 | Anti EBV FFPE | Item1054 | 1 | per ml |
| 1055 | 11.55 | Anti Pan CMV FFPE | Item1055 | 1 | per ml |
| 1056 | 11.56 | Anti CD 68 FFPE | Item1056 | 1 | per ml |
| 1057 | 11.57 | Anti WTI FFPE | Item1057 | 1 | per ml |
| 1058 | 11.58 | Anti PLAP FFPE | Item1058 | 1 | per ml |
| 1059 | 11.59 | Anti C3 FFPE | Item1059 | 1 | per ml |
| 1060 | 11.6 | Anti SMA FFPE | Item1060 | 1 | per ml |
| 1061 | 11.61 | Anti AR FFPE | Item1061 | 1 | per ml |
| 1062 | 11.62 | Anti BC16 FFPE | Item1062 | 1 | per ml |
| 1063 | 11.63 | Anti Myogenin FFPE | Item1063 | 1 | per ml |
| 1064 | 11.64 | Anti IDH-1 FFPE | Item1064 | 1 | per ml |
| 1065 | 11.65 | Anti ATRX FFPE | Item1065 | 1 | per ml |
| 1066 | 11.66 | Anti P63 FFPE | Item1066 | 1 | per ml |
| 1067 | 11.67 | Anti Neurofilament FFPE | Item1067 | 1 | per ml |
| 1068 | 11.68 | Anti CD 19 FFPE | Item1068 | 1 | per ml |
| 1069 | 11.69 | Anti MSA FFPE | Item1069 | 1 | per ml |
| 1070 | 11.7 | Anti Adipophylin FFPE | Item1070 | 1 | per ml |
| 1071 | 11.71 | Anti ALK D5F3 FFPE | Item1071 | 1 | per ml |
| 1072 | 11.72 | Anti Arginase-1 FFPE | Item1072 | 1 | per ml |
| 1073 | 11.73 | Anti B Catenin | Item1073 | 1 | per ml |
| 1074 | 11.74 | Bcl 10 FFPE | Item1074 | 1 | per ml |
| 1075 | 11.75 | Anti BER-EP4 FFPE | Item1075 | 1 | per ml |
| 1076 | 11.76 | Anti Clauclin 4 FFPE | Item1076 | 1 | per ml |
| 1077 | 11.77 | Anti D2 - 40 Podolanin FFPE | Item1077 | 1 | per ml |
| 1078 | 11.78 | Anti DOG 1 FFPE | Item1078 | 1 | per ml |
| 1079 | 11.79 | Anti SALL 4 FFPE | Item1079 | 1 | per ml |
| 1080 | 11.8 | Anti ERG FFPE | Item1080 | 1 | per ml |
| 1081 | 11.81 | Anti HBMEIgG4 | Item1081 | 1 | per ml |
| 1082 | 11.82 | Anti Inhilein FFPE | Item1082 | 1 | per ml |
| 1083 | 11.83 | Anti INSM 1 FFPE | Item1083 | 1 | per ml |
| 1084 | 11.84 | Anti Mammaglobin FFPE | Item1084 | 1 | per ml |
| 1085 | 11.85 | MART 1 FFPE | Item1085 | 1 | per ml |
| 1086 | 11.86 | Anti Melan A FFPE | Item1086 | 1 | per ml |
| 1087 | 11.87 | Anti MDM2 FFPE | Item1087 | 1 | per ml |
| 1088 | 11.88 | Anti Napsin A FFPE | Item1088 | 1 | per ml |
| 1089 | 11.89 | Anti P40 FFPE | Item1089 | 1 | per ml |
| 1090 | 11.9 | Anti PAX-8 FFPE | Item1090 | 1 | per ml |
| 1091 | 11.91 | Anti STAT-6 FFPE | Item1091 | 1 | per ml |
| 1092 | 11.92 | Anti TLE-1 FFPE | Item1092 | 1 | per ml |
| 1093 | 11.93 | Anti Uroplalcin-2 FFPE | Item1093 | 1 | per ml |
| 1094 | 11.94 | Anti Glycophorin FFPE | Item1094 | 1 | per ml |
| 1095 | 11.95 | Anti GCET-1 FFPE | Item1095 | 1 | per ml |
| 1096 | 11.96 | Anti CD 38/138 FFPE | Item1096 | 1 | per ml |
| 1097 | 11.97 | Anti Calcitonin FFPE | Item1097 | 1 | per ml |
| 1098 | 11.98 | Anti Caldermon FFPE | Item1098 | 1 | per ml |
| 1099 | 11.99 | Anti B Caldermon FFPE | Item1099 | 1 | per ml |
| 1100 | 12 | Anti CD 56 FFPE | Item1100 | 1 | per ml |
| 1101 | 12.01 | Anti NSM FFPE | Item1101 | 1 | per ml |
| 1102 | 12.02 | Anti CD 99 MIC-2 , 013 FFPE | Item1102 | 1 | per ml |
| 1103 | 12.03 | Anti CD 138 FFPE | Item1103 | 1 | per ml |
| 1104 | 12.04 | Anti CDH 17 Cadherin 17 FFPE | Item1104 | 1 | per ml |
| 1105 | 12.05 | Anti HeparII FFPE | Item1105 | 1 | per ml |
| 1106 | 12.06 | Anti Glypican-3 FFPE | Item1106 | 1 | per ml |
| 1107 | 12.07 | Anti STAB 2 FFPE | Item1107 | 1 | per ml |
| 1108 | 12.08 | Anti HRP Polymer Kit | Item1108 | 1 | per ml |
| 1109 | 12.09 | FITC Lambda light chain Immunofluorescence | Item1109 | 1 | per ml |
| 1110 | 12.1 | FITC IgM Immunofluorescence | Item1110 | 1 | per ml |
| 1111 | 12.11 | FITC IgA Immunofluorescence | Item1111 | 1 | per ml |
| 1112 | 12.12 | FITC IgG Immunofluorescence | Item1112 | 1 | per ml |
| 1113 | 12.13 | FITC C3 Immunofluorescence | Item1113 | 1 | per ml |
| 1114 | 12.14 | MLH1, MSH2, MSH6, PMS2 (Together) | Item1114 | 1 | per ml |
| 1115 | 12.15 | PDL1 Clone SP142 | Item1115 | 1 | per ml |
| 1116 | 12.16 | EGFR Clone 31G7 | Item1116 | 1 | per ml |
| 1117 | 12.17 | CDX2 | Item1117 | 1 | per ml |
| 1118 | 12.18 | GATA 3 | Item1118 | 1 | per ml |
| 1119 | 12.19 | CK 18 | Item1119 | 1 | per ml |
| 1120 | 12.2 | Mesothelin | Item1120 | 1 | per ml |
| 1121 | 12.21 | Glut 1 | Item1121 | 1 | per ml |
| 1122 | 12.22 | GCDFP | Item1122 | 1 | per ml |
| 1123 | 12.23 | MYB | Item1123 | 1 | per ml |
| 1124 | 12.24 | PLAG 1 | Item1124 | 1 | per ml |
| 1125 | 12.25 | HMGA 2 | Item1125 | 1 | per ml |
| 1126 | 12.26 | EBER in-situ Hybridization | Item1126 | 1 | Kit |
| 1127 | 12.27 | PCR | Item1127 | 1 | Each |
| 1128 | 12.28 | EGFR RT PCR Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue | Item1128 | 1 | Kit |
| 1129 | 12.29 | MSI detection Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue | Item1129 | 1 | Kit |
| 1130 | 12.3 | BCR-Abl1-PCR Kit compatible With Qiagen | Item1130 | 1 | Kit |
| 1131 | 12.31 | FISH | Item1131 | 1 | Each |
| 1132 | 12.32 | ALK mutation break apart probe in lung adenocarcinoma | Item1132 | 1 | Kit |
| 1133 | 12.33 | MYB-NFIB dual colour fusion probe | Item1133 | 1 | Kit |
| 1134 | 12.34 | MYB dual colour break apart probe | Item1134 | 1 | Kit |
| 1135 | 12.35 | MAML2 dual colour break apart probe | Item1135 | 1 | Kit |
| 1136 | 12.36 | ETV6 dual colour break apart rearrangement probe | Item1136 | 1 | Kit |
| 1137 | 12.37 | PLAG 1 rearrangement probe | Item1137 | 1 | Kit |
| 1138 | 12.38 | HMGA 2 rearrangement probe | Item1138 | 1 | Kit |
| 1139 | 12.39 | Immunofluorescence | Item1139 | 1 | Each |
| 1140 | 12.4 | Anti p-ANCA direct Immunofluorescence | Item1140 | 1 | Kit |
| 1141 | 12.41 | Anti c-ANCA direct Immunofluorescence | Item1141 | 1 | Kit |
| 1142 | 12.42 | Anti ANA direct Immunofluorescence | Item1142 | 1 | Kit |
| 1143 | 12.43 | Anti Aquaporin 4 | Item1143 | 1 | Kit |
| 1144 | 12.44 | C1q | Item1144 | 1 | Kit |
| 1145 | 12.45 | Flowcytometry | Item1145 | 1 | Each |
| 1146 | 12.46 | CD 16 APC | Item1146 | 1 | Kit |
| 1147 | 12.47 | HLA B27 Kit (should be compatible with BD Facscalibur) | Item1147 | 1 | Kit |
| 1148 | 12.48 | Elisa (MAGO-4) | Item1148 | 1 | Each |
| 1149 | 12.49 | Anti P-ANCA Elisa | Item1149 | 1 | Sets |
| 1150 | 12.5 | Anti c-ANCA Elisa | Item1150 | 1 | Sets |
| 1151 | 12.51 | Anti Cyclic Citrulinated peptide (CCP) Elisa | Item1151 | 1 | Sets |
| 1152 | 12.52 | Anti Smith Elisa | Item1152 | 1 | Sets |
| 1153 | 12.53 | Anti Peroxiredoxin VI (Prx VI) Elisa | Item1153 | 1 | Sets |
| 1154 | 12.54 | Anti Bmi I Elisa | Item1154 | 1 | Sets |
| 1155 | 12.55 | Anti Matrix Metalloproteinase 7 (MMP7) Elisa | Item1155 | 1 | Sets |
| 1156 | 12.56 | Anti NY ESO I | Item1156 | 1 | Sets |
| 1157 | 12.57 | Anti Scl 70 | Item1157 | 1 | Sets |
| 1158 | 12.58 | Anti URNP | Item1158 | 1 | Sets |
| 1159 | 12.59 | Chemicals and Consumables | Item1159 | 1 | Each |
| 1160 | 12.6 | Proteinase K | Item1160 | 1 | Sets |
| 1161 | 12.61 | Pronase | Item1161 | 1 | Sets |
| 1162 | 12.62 | FISH Reagents : | Item1162 | 1 | Each |
| 1163 | 12.63 | Poly L Lysine | Item1163 | 1 | ml |
| 1164 | 12.64 | 20X Saline Sodium Citrate (20X SSC) Salt, Molecular Grade | Item1164 | 1 | gm |
| 1165 | 12.65 | 1 M NaSCN ( 1M Sodium Thiocyanate) Salt, Molecular Grade | Item1165 | 1 | gm |
| 1166 | 12.66 | IGEPAL @ CA 630 | Item1166 | 1 | gm |
| 1167 | 12.67 | Rubber Cement | Item1167 | 1 | tube |
| 1168 | 12.68 | DAPI | Item1168 | 1 | ml |
| 1169 | 12.69 | Sodium Chloride (NaCL), 58.44g mol-1 Molecular Grade | Item1169 | 1 | gm |
| 1170 | 12.7 | Sodium Citrate (Na3C6H5O7) 258.06g mol-1 Molecular Grade | Item1170 | 1 | gm |
| 1171 | 12.71 | Fluorescence microscopic immersion oil | Item1171 | 1 | ml |
| 1172 | 12.72 | Immunofluorescence Reagents : | Item1172 | 1 | Each |
| 1173 | 12.73 | Trypsin Powder,Molecular Grade | Item1173 | 1 | gm |
| 1174 | 12.74 | Additional Consumables / Disposables | Item1174 | 1 | Each |
| 1175 | 12.75 | 15mm double swivel with port & extension | Item1175 | 1 | Each |
| 1176 | 12.76 | 72 hours CLOSED VENTILATION SUCTION CATHETER Must have double - lumen siliconised catheter Swivel connector un-coupling wedge, Lockable thumb –Valve end Cap, Softer Sleeve material, 72 hour recommended during of use. Size: 12F, 14F, 16F | Item1176 | 1 | Each |
| 1177 | 12.77 | Adjustable circle breathing system (2 Litre bag, 2 metre length and 1.5 metre limb) | Item1177 | 1 | Each |
| 1178 | 12.78 | Adjustable circle breathing system (2 mts length) | Item1178 | 1 | Each |
| 1179 | 12.79 | Adult curved flared prong with tube1.8m length | Item1179 | 1 | Each |
| 1180 | 12.8 | Adult curved nasal prong with tube1.8m length | Item1180 | 1 | Each |
| 1181 | 12.81 | Adult Respi-Check high concentration oxygen mask with oxygen tube | Item1181 | 1 | Each |
| 1182 | 12.82 | Anti-microbial circle breathing system (1.6 metre length and 0.8 metre limb) | Item1182 | 1 | Each |
| 1183 | 12.83 | Anti-microbial circle breathing system (2 litre bag, 1.6 metre Length, 0.8 metre limb) | Item1183 | 1 | Each |
| 1184 | 12.84 | Anti-microbial circle breathing system (2 litre bag, 2.4 metre Length, 0.8 metre limb) | Item1184 | 1 | Each |
| 1185 | 12.85 | Apron Cloth (Sterile) | Item1185 | 1 | Each |
| 1186 | 12.86 | Attest 1292 E Biological Indicator | Item1186 | 1 | Each |
| 1187 | 12.87 | Attest Biological Indicator (for styeam) 3M | Item1187 | 1 | Each |
| 1188 | 12.88 | Attest Rapid Auto Reader Incubator (For Steam) (Early result for biological test) | Item1188 | 1 | Each |
| 1189 | 12.89 | Balanced Salt Solution (BSS) | Item1189 | 1 | Each |
| 1190 | 12.9 | Bilbao-Dotter tube with guide wire | Item1190 | 1 | Each |
| 1191 | 12.91 | BIS Electrodes | Item1191 | 1 | Each |
| 1192 | 12.92 | Bone file | Item1192 | 1 | Each |
| 1193 | 12.93 | Bone ronger | Item1193 | 1 | Each |
| 1194 | 12.94 | BP blade with handle (no 15 & 17) | Item1194 | 1 | Each |
| 1195 | 12.95 | Cardiac Troponin T kit | Item1195 | 1 | Each |
| 1196 | 12.96 | Center hole towel | Item1196 | 1 | Each |
| 1197 | 12.97 | COBAN Tm 4" | Item1197 | 1 | Each |
| 1198 | 12.98 | Cols light source for transillumination | Item1198 | 1 | Each |
| 1199 | 12.99 | Contra angle hand piece | Item1199 | 1 | Each |
| 1200 | 13 | Disposable Face Mask (Cloth) | Item1200 | 1 | Each |
| 1201 | 13.01 | Disposable Head Positioning Device for the Prone Position – Made of latex- free foam with mirror for providing the clinician a clear view of face, eye & endotrachael tube plus sloted design for positioning of Endotracheal on either side of the patient face 8000HDP | Item1201 | 1 | Each |
| 1202 | 13.02 | Disposable Kelly's Pad | Item1202 | 1 | Each |
| 1203 | 13.03 | ECG monitoring Electrode (Solid Hydrogel) | Item1203 | 1 | Each |
| 1204 | 13.04 | ECG monitoring Electrode with foam backing 2223 | Item1204 | 1 | Each |
| 1205 | 13.05 | ECG monitoring Electrode with foam backing Large | Item1205 | 1 | Each |
| 1206 | 13.06 | Elastometric Infusion Pump for Analgesia 5ml/hour | Item1206 | 1 | Each |
| 1207 | 13.07 | Elastometric Infusion Pump for Analgesia 2ml/hour Model SV2 | Item1207 | 1 | Each |
| 1208 | 13.08 | Elevators (Straight and Periostal) | Item1208 | 1 | Each |
| 1209 | 13.09 | Emergency Cricothyrotomy Device Adult 4mm ID Children 2mm ID | Item1209 | 1 | Each |
| 1210 | 13.1 | Eye wear for composite fillings | Item1210 | 1 | Each |
| 1211 | 13.11 | Face guard | Item1211 | 1 | Each |
| 1212 | 13.12 | Fibre splint | Item1212 | 1 | Each |
| 1213 | 13.13 | Fluid Warming Cassette (Disposable) WF-250 | Item1213 | 1 | Each |
| 1214 | 13.14 | Fluid Warming Cassette (Disposable) WF-100 | Item1214 | 1 | Each |
| 1215 | 13.15 | Gigly Saw | Item1215 | 1 | Each |
| 1216 | 13.16 | Glass bead sterilizer | Item1216 | 1 | Each |
| 1217 | 13.17 | Tungsen Carbide Burs for Air Rotor and Micro Motor Hand Pieces | Item1217 | 1 | Each |
| 1218 | 13.18 | Green PVC tubing for oxygen 6 mm, Length in metres | Item1218 | 1 | Each |
| 1219 | 13.19 | Iodixannol 320 mg Iodine/ml-100 ml. | Item1219 | 1 | Each |
| 1220 | 13.2 | Iohexol 300 mg-Iodine/ml 100 ml | Item1220 | 1 | Each |
| 1221 | 13.21 | Iomeron 400 mg/ml – 50 ml. | Item1221 | 1 | Each |
| 1222 | 13.22 | Ioversol/Iopamide/Iopamidol – 50 ml. | Item1222 | 1 | Each |
| 1223 | 13.23 | ISO Green Standard Laryngoscope System (Disposable plastic blades) 7 sizes of MAC and Miller blades | Item1223 | 1 | Each |
| 1224 | 13.24 | JESS fixtators pediatric/large | Item1224 | 1 | Each |
| 1225 | 13.25 | Jobson's Probe | Item1225 | 1 | Each |
| 1226 | 13.26 | Kinesiology Color Tap/Taping for Orthopaedic used | Item1226 | 1 | Each |
| 1227 | 13.27 | Killian's Nasal Speculum | Item1227 | 1 | Each |
| 1228 | 13.28 | K-Wires: 1.8mm | Item1228 | 1 | Each |
| 1229 | 13.29 | K-Wires: 4mm | Item1229 | 1 | Each |
| 1230 | 13.3 | K-Wires: 1.5 mm | Item1230 | 1 | Each |
| 1231 | 13.31 | K-Wires: 2.5 mm | Item1231 | 1 | Each |
| 1232 | 13.32 | K-Wires: 2mm | Item1232 | 1 | Each |
| 1233 | 13.33 | K-Wires: 3mm | Item1233 | 1 | Each |
| 1234 | 13.34 | Macintosh Style blades 2, 4 | Item1234 | 1 | Each |
| 1235 | 13.35 | Magill’s forceps Adult child infant | Item1235 | 1 | Each |
| 1236 | 13.36 | Manual Plaster cutting saw | Item1236 | 1 | Each |
| 1237 | 13.37 | Manual Plaster spreader | Item1237 | 1 | Each |
| 1238 | 13.38 | Manual Torniquet (cuff & Pump) | Item1238 | 1 | Each |
| 1239 | 13.39 | Mayo stand cover | Item1239 | 1 | Each |
| 1240 | 13.4 | Miller style blades 0, | Item1240 | 1 | Each |
| 1241 | 13.41 | Miller style blades 1 | Item1241 | 1 | Each |
| 1242 | 13.42 | Mortar and Pestle | Item1242 | 1 | Each |
| 1243 | 13.43 | Mouth & Cheek retractor | Item1243 | 1 | Each |
| 1244 | 13.44 | Mouth mirror | Item1244 | 1 | Each |
| 1245 | 13.45 | MRI compatible Laryngoscopes All sizes | Item1245 | 1 | Each |
| 1246 | 13.46 | MRI Film 14” x 17” | Item1246 | 1 | Each |
| 1247 | 13.47 | Neopuff (Neonatal Resuscitator) | Item1247 | 1 | Each |
| 1248 | 13.48 | North Nasal Preformed Cuffed TubeCuffed Must have IVORY PVC Profile Soft Seal Cuff, implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 6To 8mm ID & length 27cm to 30.5 tips to nares | Item1248 | 1 | Each |
| 1249 | 13.49 | OVARIAN SHIELD (Kiran) | Item1249 | 1 | Each |
| 1250 | 13.5 | Oxygen Supply Tubing for Heat & Moisture Exchanger Oxygen Supply Tubing for Heat & Moisture Exchanger with Connector to attach HME for Tracheostomy Tube Length 15cm | Item1250 | 1 | Each |
| 1251 | 13.51 | Oxygen Analyser | Item1251 | 1 | Each |
| 1252 | 13.52 | Oxygen Blenders | Item1252 | 1 | Each |
| 1253 | 13.53 | Para film roll (size 10cmx125cm) 3 “ dia | Item1253 | 1 | Each |
| 1254 | 13.54 | Parafilm, roll | Item1254 | 1 | Each |
| 1255 | 13.55 | Perineural catheter for continuous plexus and peripheral nerve blocks. Content: 118 G lacoplex needle with centimeter graduation 1 perinueral Pebax catheter (0.45 x 0.85mm – 50cm long) with centimeter distance markings and open distal tip 1 0.22 antibacterial filter 1 additional extension tube, 50cm long, 1.5 x 2.5 mm dia, priming volume 1.10ml 1 10ml syringe for the aspiration test 1 10 x 15 cm Dermafilm transparent adhesive dressing | Item1255 | 1 | Each |
| 1256 | 13.56 | Periostal elevators (small and big) | Item1256 | 1 | Each |
| 1257 | 13.57 | Winged infusion set- Non coring needles with injection site to access ports,20G X 1.00(needle) | Item1257 | 1 | Each |
| 1258 | 13.58 | Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-7fr,65cm length(Ped) | Item1258 | 1 | Each |
| 1259 | 13.59 | Hickman-Broviac 4.2Fr(or smaller) single lumen pediatric cath w STIC PAPAIS | Item1259 | 1 | Each |
| 1260 | 13.6 | Hickman-Broviac 6.6Fr single lumen pediatric cath w STIC 90cm | Item1260 | 1 | Each |
| 1261 | 13.61 | Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-9fr,90cm length(Adult) | Item1261 | 1 | Each |
| 1262 | 13.62 | Plaster Cutter Electric | Item1262 | 1 | Each |
| 1263 | 13.63 | Plaster saw | Item1263 | 1 | Each |
| 1264 | 13.64 | Plier long nose | Item1264 | 1 | Each |
| 1265 | 13.65 | Pneumatic Compression Stocking | Item1265 | 1 | Each |
| 1266 | 13.66 | Portable Autoclave Electrically Operated Made of Aluminium size:300mm x 300mm capacity 24 litres | Item1266 | 1 | Each |
| 1267 | 13.67 | Portable Autoclave Electrically Operated Made of Aluminium size:350mm x 300mm-325mm Depth: 1.5 Kw | Item1267 | 1 | Each |
| 1268 | 13.68 | Pyridin | Item1268 | 1 | Each |
| 1269 | 13.69 | Reusable Pressure Monitoring cable With integrity check system by 100mmhg pressure and with reusable modular clamp | Item1269 | 1 | Each |
| 1270 | 13.7 | Reusable Pressure Transducer With integrity check system by 100mmhg pressure, with microchip technology, Reusable cable, and with reusable clamp | Item1270 | 1 | Each |
| 1271 | 13.71 | Ronguers(down cutter) | Item1271 | 1 | Each |
| 1272 | 13.72 | Ronguers(up cutter) | Item1272 | 1 | Each |
| 1273 | 13.73 | Rubber Macintosh | Item1273 | 1 | Each |
| 1274 | 13.74 | Russian Forceps | Item1274 | 1 | Each |
| 1275 | 13.75 | Light Weight Hernia Mesh,PGA Polypropylene 11 x 15 | Item1275 | 1 | Each |
| 1276 | 13.76 | Light Weight Hernia Mesh,PGA Polypropylene 6 x 11 | Item1276 | 1 | Each |
| 1277 | 13.77 | Seldinger technique catheter for arterial puncture Content: 1 Transparent and XPO cathter (PE) /(PTFE) 1 Intruducer needle 1 straight wire 115.092 115.094 115.118 5118.702 5118.703 | Item1277 | 1 | Each |
| 1278 | 13.78 | Self Holding retractors for Spine surgery | Item1278 | 1 | Each |
| 1279 | 13.79 | Single Use Resuscitation Mask for CPCR (Non-return valve, Integral Bacterial/Viral filter) | Item1279 | 1 | Each |
| 1280 | 13.8 | Slide Mailer 1 slide | Item1280 | 1 | Each |
| 1281 | 13.81 | Slide Mailer 2 slide | Item1281 | 1 | Each |
| 1282 | 13.82 | Soap Dispenser | Item1282 | 1 | Each |
| 1283 | 13.83 | Soda Lime (Imported) – changes from White to Violet on exhaustion 5kg | Item1283 | 1 | Each |
| 1284 | 13.84 | Sodium hypochloride solution 5Litre | Item1284 | 1 | Each |
| 1285 | 13.85 | Spreader /Plugger | Item1285 | 1 | Each |
| 1286 | 13.86 | Steinman pins:4.5mm | Item1286 | 1 | Each |
| 1287 | 13.87 | Steinmann Pins | Item1287 | 1 | Each |
| 1288 | 13.88 | Sterigage Chemical Indicator (for Steam) 3M | Item1288 | 1 | Each |
| 1289 | 13.89 | Surgical Clipper | Item1289 | 1 | Each |
| 1290 | 13.9 | Surgical Preparation Razor | Item1290 | 1 | Each |
| 1291 | 13.91 | Thermal Videographic Printer (Black & White) (Sony, Latest UP series) | Item1291 | 1 | Each |
| 1292 | 13.92 | Tissue paper for Ultrasound | Item1292 | 1 | Each |
| 1293 | 13.93 | Ultra violet cabinet (800/500 x 2000 mm) | Item1293 | 1 | Each |
| 1294 | 13.94 | Vacuum assisted dressing system | Item1294 | 1 | Each |
| 1295 | 13.95 | Vascular Debeky Angle (Medium) | Item1295 | 1 | Each |
| 1296 | 13.96 | Vascular Debeky Straight (Medium) | Item1296 | 1 | Each |
| 1297 | 13.97 | Vaseline gauze | Item1297 | 1 | Each |
| 1298 | 13.98 | Ventilator 15 mm breathing systems (with luer lock, 1.6 metre length and resealable water trap) for Paediatrics | Item1298 | 1 | Each |
| 1299 | 13.99 | Ventilator Breathing System with resealable water traps (smooth lumen) | Item1299 | 1 | Each |
| 1300 | 14 | Waste Management Wheeled Bins. (660Lit ; 300lit; 1100 lit) | Item1300 | 1 | Each |
| 1301 | 14.01 | Wire cutter | Item1301 | 1 | Each |
| 1302 | 14.02 | Y-pieces for Breathing Circuit | Item1302 | 1 | Each |
| 1303 | 14.03 | Absorbable Gelatin Sponge U.S.P (Ab-Gel) 10 X 10 | Item1303 | 1 | Each |
| 1304 | 14.04 | Alginate impression materials(Dust free) | Item1304 | 1 | Each |
| 1305 | 14.05 | Double swivel with port 15mm | Item1305 | 1 | Each |
| 1306 | 14.06 | Green PVC tubing 6mm for oxygen / per meter | Item1306 | 1 | Each |
| 1307 | 14.07 | 2 mm Osteotomes | Item1307 | 1 | Each |
| 1308 | 14.08 | 3 mm Osteotomes | Item1308 | 1 | Each |
| 1309 | 14.09 | Asepto Pump | Item1309 | 1 | Each |
| 1310 | 14.1 | Autoclavable biohazard plastic bag 10liter | Item1310 | 1 | Each |
| 1311 | 14.11 | Autoclavable biohazard plastic bag 20liter | Item1311 | 1 | Each |
| 1312 | 14.12 | Autoclavable biohazard plastic bag 30liter | Item1312 | 1 | Each |
| 1313 | 14.13 | Bone Cement(Plain) | Item1313 | 1 | Each |
| 1314 | 14.14 | Bone Cement(Antibiotics) | Item1314 | 1 | Each |
| 1315 | 14.15 | Bougie(stylet) | Item1315 | 1 | Each |
| 1316 | 14.16 | Burretta | Item1316 | 1 | Each |
| 1317 | 14.17 | CAPD Catheter Tenckhoff with 2 felt cuffs SA 1242 (420 mm) | Item1317 | 1 | Each |
| 1318 | 14.18 | Cast Taper Mandrel | Item1318 | 1 | Each |
| 1319 | 14.19 | Chiesel | Item1319 | 1 | Each |
| 1320 | 14.2 | Cleaning Brush | Item1320 | 1 | Each |
| 1321 | 14.21 | Cleaning solution | Item1321 | 1 | Each |
| 1322 | 14.22 | CPR manikin | Item1322 | 1 | Each |
| 1323 | 14.23 | Stoma Flatmoldable Small 45MM | Item1323 | 1 | Each |
| 1324 | 14.24 | Stoma Flatmoldable Medium 45MM | Item1324 | 1 | Each |
| 1325 | 14.25 | Stoma Flatmoldable Regular 57MM | Item1325 | 1 | Each |
| 1326 | 14.26 | Stoma Flatmoldable Large 70MM | Item1326 | 1 | Each |
| 1327 | 14.27 | Moldable convex 12/22MM | Item1327 | 1 | Each |
| 1328 | 14.28 | Moldable convex 22/33MM | Item1328 | 1 | Each |
| 1329 | 14.29 | Moldable convex 33/57MM | Item1329 | 1 | Each |
| 1330 | 14.3 | Ostomy Appliance Accessories Belt | Item1330 | 1 | Each |
| 1331 | 14.31 | Coloured Ph indicator Paper | Item1331 | 1 | Each |
| 1332 | 14.32 | Dissecting Instrument Box | Item1332 | 1 | Each |
| 1333 | 14.33 | Double swivel with port 15 mm x 22mm | Item1333 | 1 | Each |
| 1334 | 14.34 | Drape Formers Trans femoral | Item1334 | 1 | Each |
| 1335 | 14.35 | Drape Formers Trans tibial | Item1335 | 1 | Each |
| 1336 | 14.36 | Espocan with Docking System | Item1336 | 1 | Each |
| 1337 | 14.37 | ETO chemical Indicator tape -3M | Item1337 | 1 | Each |
| 1338 | 14.38 | ETO packing sleeves roll (3M) 12' | Item1338 | 1 | Each |
| 1339 | 14.39 | ETO packing sleeves roll (3M) 4' | Item1339 | 1 | Each |
| 1340 | 14.4 | ETO packing sleeves roll (3M) 6' | Item1340 | 1 | Each |
| 1341 | 14.41 | Surgicel Fibrillar 1963 | Item1341 | 1 | Each |
| 1342 | 14.42 | G- Bone | Item1342 | 1 | Each |
| 1343 | 14.43 | Gloves wrapper | Item1343 | 1 | Each |
| 1344 | 14.44 | Laparoscopic Aspiration needle | Item1344 | 1 | Each |
| 1345 | 14.45 | Hemorrhoids and Prolapsed Stapler with Detachable Anvil 3.5mm | Item1345 | 1 | Each |
| 1346 | 14.46 | Hemorrhoids and Prolapsed Stapler with Detachable Anvil 4.8mm | Item1346 | 1 | Each |
| 1347 | 14.47 | Hose Mount 15mm female male pair | Item1347 | 1 | Each |
| 1348 | 14.48 | Hose Mount 22mm female male pair | Item1348 | 1 | Each |
| 1349 | 14.49 | Hygrobaby/HME Filter (Infant) | Item1349 | 1 | Each |
| 1350 | 14.5 | Hygroboy/HME Filter (Paediatric) | Item1350 | 1 | Each |
| 1351 | 14.51 | Hygrostar/HME Filter (Adult) | Item1351 | 1 | Each |
| 1352 | 14.52 | hygrobac S | Item1352 | 1 | Each |
| 1353 | 14.53 | Intraocular lense 6mm optics foldable, square edge, Hydrophobic | Item1353 | 1 | Each |
| 1354 | 14.54 | Intraocular lense rigid 5.25mm optics,PMMA, square edge | Item1354 | 1 | Each |
| 1355 | 14.55 | Intraocular lense rigid 5.5mm optics | Item1355 | 1 | Each |
| 1356 | 14.56 | Intraocular lense rigid 5.5mm optics foldable | Item1356 | 1 | Each |
| 1357 | 14.57 | Intraocular lense rigid 6mm optics | Item1357 | 1 | Each |
| 1358 | 14.58 | Intraocular lense rigid 6mm optics foldable | Item1358 | 1 | Each |
| 1359 | 14.59 | Intraocular lense rigid 6mm optics, PMMA, square edge | Item1359 | 1 | Each |
| 1360 | 14.6 | Rigid Anterior Chamber Intraocular Lens: Lens Power +16D(6.00mm) | Item1360 | 1 | Each |
| 1361 | 14.61 | Rigid Anterior Chamber Intraocular Lens: Lens Power +19D(6.00mm) | Item1361 | 1 | Each |
| 1362 | 14.62 | Rigid Anterior Chamber Intraocular Lens: Lens Power +18D(6.00mm) | Item1362 | 1 | Each |
| 1363 | 14.63 | Rigid Anterior Chamber Intraocular Lens: Lens Power +20D(6.00mm) | Item1363 | 1 | Each |
| 1364 | 14.64 | Rigid Anterior Chamber Intraocular Lens: Lens Power +21D(6.00mm) | Item1364 | 1 | Each |
| 1365 | 14.65 | Rigid Anterior Chamber Intraocular Lens: Lens Power +22D(6.00mm) | Item1365 | 1 | Each |
| 1366 | 14.66 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) | Item1366 | 1 | Each |
| 1367 | 14.67 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.5D(5.50mm) | Item1367 | 1 | Each |
| 1368 | 14.68 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) | Item1368 | 1 | Each |
| 1369 | 14.69 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.0D(5.50mm) | Item1369 | 1 | Each |
| 1370 | 14.7 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.5D(5.50mm) | Item1370 | 1 | Each |
| 1371 | 14.71 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.0D(5.50mm) | Item1371 | 1 | Each |
| 1372 | 14.72 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.5D(5.50mm) | Item1372 | 1 | Each |
| 1373 | 14.73 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.0D(5.50mm) | Item1373 | 1 | Each |
| 1374 | 14.74 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.5D(5.50mm) | Item1374 | 1 | Each |
| 1375 | 14.75 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.0D(5.50mm) | Item1375 | 1 | Each |
| 1376 | 14.76 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.5D(5.50mm) | Item1376 | 1 | Each |
| 1377 | 14.77 | (a) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +10.0D 6.0mm | Item1377 | 1 | Each |
| 1378 | 14.78 | (b) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +113.5D 6.0mm | Item1378 | 1 | Each |
| 1379 | 14.79 | (c) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+14.0D 6.0mm | Item1379 | 1 | Each |
| 1380 | 14.8 | (d) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.0D 6.0mm | Item1380 | 1 | Each |
| 1381 | 14.81 | (e) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.5D 6.0mm | Item1381 | 1 | Each |
| 1382 | 14.82 | (f) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.0D 6.0mm | Item1382 | 1 | Each |
| 1383 | 14.83 | (g) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.5D 6.0mm | Item1383 | 1 | Each |
| 1384 | 14.84 | (h) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.0D 6.0mm | Item1384 | 1 | Each |
| 1385 | 14.85 | (i) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.5D 6.0mm | Item1385 | 1 | Each |
| 1386 | 14.86 | (j) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.0D 6.0mm | Item1386 | 1 | Each |
| 1387 | 14.87 | (k) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.5D 6.0mm | Item1387 | 1 | Each |
| 1388 | 14.88 | (l) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19..0D 6.0mm | Item1388 | 1 | Each |
| 1389 | 14.89 | (m) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19.5D 6.0mm | Item1389 | 1 | Each |
| 1390 | 14.9 | (n) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.0D 6.0mm | Item1390 | 1 | Each |
| 1391 | 14.91 | (o) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.5D 6.0mm | Item1391 | 1 | Each |
| 1392 | 14.92 | (p) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.0D 6.0mm | Item1392 | 1 | Each |
| 1393 | 14.93 | (q) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.5D 6.0mm | Item1393 | 1 | Each |
| 1394 | 14.94 | (r) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.0D 6.0mm | Item1394 | 1 | Each |
| 1395 | 14.95 | (s) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.5D 6.0mm | Item1395 | 1 | Each |
| 1396 | 14.96 | (t) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+23.0D 6.0mm | Item1396 | 1 | Each |
| 1397 | 14.97 | (u)Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +23.5D 6.0mm | Item1397 | 1 | Each |
| 1398 | 14.98 | (v) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.0D 6.0mm | Item1398 | 1 | Each |
| 1399 | 14.99 | (w) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.5D 6.0mm | Item1399 | 1 | Each |
| 1400 | 15 | (x) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.0D 6.0mm | Item1400 | 1 | Each |
| 1401 | 15.01 | (y) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.5D 6.0mm | Item1401 | 1 | Each |
| 1402 | 15.02 | (z) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+26.0D 6.0mm | Item1402 | 1 | Each |
| 1403 | 15.03 | Mayo trolly cover (disposable) | Item1403 | 1 | Each |
| 1404 | 15.04 | Membrane Assembly | Item1404 | 1 | Each |
| 1405 | 15.05 | Micro Centrifuge Tube 1.5ml | Item1405 | 1 | Each |
| 1406 | 15.06 | Micro Centrifuge Tube 15ml | Item1406 | 1 | Each |
| 1407 | 15.07 | micro centrifuge tubes-.2ml (with thin wall for PCR) | Item1407 | 1 | Each |
| 1408 | 15.08 | micro centrifuge tubes-.5ml (with thin wall for PCR) | Item1408 | 1 | Each |
| 1409 | 15.09 | micro centrifuge tubes-2ml | Item1409 | 1 | Each |
| 1410 | 15.1 | Microscope Bulb- 6V 20W | Item1410 | 1 | Each |
| 1411 | 15.11 | Mini & micropates with screw | Item1411 | 1 | Each |
| 1412 | 15.12 | Nasal Tubing 70mm | Item1412 | 1 | Each |
| 1413 | 15.13 | Needle (cutting) big | Item1413 | 1 | Each |
| 1414 | 15.14 | Needle (cutting) medium | Item1414 | 1 | Each |
| 1415 | 15.15 | Needle (cutting) small | Item1415 | 1 | Each |
| 1416 | 15.16 | Needle (round body) big | Item1416 | 1 | Each |
| 1417 | 15.17 | Needle (round body) medium | Item1417 | 1 | Each |
| 1418 | 15.18 | Needle (round body) small | Item1418 | 1 | Each |
| 1419 | 15.19 | Non invasive cardiac output monitoring electrode | Item1419 | 1 | Each |
| 1420 | 15.2 | Non invasive cardiac pacing electrode | Item1420 | 1 | Each |
| 1421 | 15.21 | Ostomy powder 25gm | Item1421 | 1 | Each |
| 1422 | 15.22 | Pneumatic Compression Stocking | Item1422 | 1 | Each |
| 1423 | 15.23 | Pressure monitoring kit with three way disposable pressure( For CVP & Atrerial) | Item1423 | 1 | Each |
| 1424 | 15.24 | RAE tub 7.5 | Item1424 | 1 | Each |
| 1425 | 15.25 | Self adhesive urine sample bag - Pediatric | Item1425 | 1 | Each |
| 1426 | 15.26 | Spirit swabs | Item1426 | 1 | Each |
| 1427 | 15.27 | Sterile swab sticks | Item1427 | 1 | Each |
| 1428 | 15.28 | Steri-Stripes | Item1428 | 1 | Each |
| 1429 | 15.29 | Esmarch 4" | Item1429 | 1 | Each |
| 1430 | 15.3 | Esmarch 6" | Item1430 | 1 | Each |
| 1431 | 15.31 | Polyester Synthetic Cast padding | Item1431 | 1 | Each |
| 1432 | 15.32 | Suction cannula for MTP size purandre | Item1432 | 1 | Each |
| 1433 | 15.33 | Ostomy Appliance Accessories Belt | Item1433 | 1 | Each |
| 1434 | 15.34 | Stomadress Plus Single Pouch - Opaque | Item1434 | 1 | Each |
| 1435 | 15.35 | ActiveLife One Pc Drainable Pouch | Item1435 | 1 | Each |
| 1436 | 15.36 | Tubing Kit | Item1436 | 1 | Each |
| 1437 | 15.37 | urianalyser | Item1437 | 1 | Each |
| 1438 | 15.38 | Urine Control A360 | Item1438 | 1 | Each |
| 1439 | 15.39 | Ventilating Airway Bougies | Item1439 | 1 | Each |
| 1440 | 15.4 | Ventilator Tubing W/1 (venti breathing system with reseable water trap) | Item1440 | 1 | Each |
| 1441 | 15.41 | Y-pieces | Item1441 | 1 | Each |
| 1442 | 15.42 | 6mm Green PVC tubing for oxygen | Item1442 | 1 | Each |
| 1443 | 15.43 | Alpha mattress | Item1443 | 1 | Each |
| 1444 | 15.44 | Analspeculum Size: 25 | Item1444 | 1 | Each |
| 1445 | 15.45 | AO universal clamps | Item1445 | 1 | Each |
| 1446 | 15.46 | Baby Cradle with mattress and Net | Item1446 | 1 | Each |
| 1447 | 15.47 | Blood Gas Quality Control (30x1.7ml) Level 1 (ABG) | Item1447 | 1 | Each |
| 1448 | 15.48 | Blood Gas Quality Control (30x1.7ml) Level 2 (ABG) | Item1448 | 1 | Each |
| 1449 | 15.49 | Blood Gas Quality Control (30x1.7ml) Level 3 (ABG) | Item1449 | 1 | Each |
| 1450 | 15.5 | Bone Cutter | Item1450 | 1 | Each |
| 1451 | 15.51 | Bone cutter Big size | Item1451 | 1 | Each |
| 1452 | 15.52 | Centrifuge Tube | Item1452 | 1 | Each |
| 1453 | 15.53 | Centrifuge tubes, polypropylene seal with capacity 3.5 - 10 ml | Item1453 | 1 | Each |
| 1454 | 15.54 | Clavicular Braces | Item1454 | 1 | Each |
| 1455 | 15.55 | Cider wood oil | Item1455 | 1 | Each |
| 1456 | 15.56 | DeBakey’s Bull Dog Clamps, Curved 115mm (4 ½”) long | Item1456 | 1 | Each |
| 1457 | 15.57 | DeBakey’s Bull Dog Clamps, Curved 70mm (2 ¾”) long | Item1457 | 1 | Each |
| 1458 | 15.58 | DeBakey’s Bull Dog Clamps, Curved 80mm (3 ?”) long | Item1458 | 1 | Each |
| 1459 | 15.59 | DeBakey’s Bull Dog Clamps, Straight 120mm (4 ¾”) | Item1459 | 1 | Each |
| 1460 | 15.6 | DeBakey’s Bull Dog Clamps, Straight 75mm (3”) | Item1460 | 1 | Each |
| 1461 | 15.61 | DeBakey’s Bull Dog Clamps, Straight 85mm (3 ?”) | Item1461 | 1 | Each |
| 1462 | 15.62 | Divided Mattress | Item1462 | 1 | Each |
| 1463 | 15.63 | Dropper bottle 250ml | Item1463 | 1 | Each |
| 1464 | 15.64 | Dropper bottle 500ml | Item1464 | 1 | Each |
| 1465 | 15.65 | Dropper p.p. 6 long | Item1465 | 1 | Each |
| 1466 | 15.66 | NPWT dressing kit | Item1466 | 1 | Each |
| 1467 | 15.67 | Silicone Rubber heel cups | Item1467 | 1 | Each |
| 1468 | 15.68 | Electrodes for IFT (For Combination therapy-Ultra sound therapy + Electrical Stimulator) (Make: Enraf nonius Sonoplus 491) | Item1468 | 1 | Each |
| 1469 | 15.69 | Episiotomy scissor size 15cm | Item1469 | 1 | Each |
| 1470 | 15.7 | Fixation Ring (904-898) | Item1470 | 1 | Each |
| 1471 | 15.71 | Fixation Ring (904-898) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40) | Item1471 | 1 | Each |
| 1472 | 15.72 | Fluid warmer | Item1472 | 1 | Each |
| 1473 | 15.73 | Fogging Machine | Item1473 | 1 | Each |
| 1474 | 15.74 | G-Bone | Item1474 | 1 | Each |
| 1475 | 15.75 | Gigly Saw | Item1475 | 1 | Each |
| 1476 | 15.76 | Ginevri Capillary tube (H) (Microbillimeter) | Item1476 | 1 | Each |
| 1477 | 15.77 | Glover with Atraumatic jaws, Curved jaws, 85mm (3 ?”), 45mm jaws | Item1477 | 1 | Each |
| 1478 | 15.78 | Hand Drill | Item1478 | 1 | Each |
| 1479 | 15.79 | Hand wash basin stand (double). - Five legs base mounted on 5cms dia castors with one 35cm s.s basin.Pre treated and epoxy powder coated. | Item1479 | 1 | Each |
| 1480 | 15.8 | Hysterectomy clamp ‘FAURE’ | Item1480 | 1 | Each |
| 1481 | 15.81 | I.V. drip stand | Item1481 | 1 | Each |
| 1482 | 15.82 | Intra uterine cannula ‘COLLINS’ plain 3 size | Item1482 | 1 | Each |
| 1483 | 15.83 | Intra uterine cannula ‘HAYES PROVIS’ with rubber cone | Item1483 | 1 | Each |
| 1484 | 15.84 | Kidney Wash Machine (Renatron II) | Item1484 | 1 | Each |
| 1485 | 15.85 | Knee Immobilizer OC 2035 | Item1485 | 1 | Each |
| 1486 | 15.86 | Knee Immobilizer OC 2035 | Item1486 | 1 | Each |
| 1487 | 15.87 | Knee Stabilizer-DC 2069 | Item1487 | 1 | Each |
| 1488 | 15.88 | Leishmans stain | Item1488 | 1 | Each |
| 1489 | 15.89 | Lengenback retractor | Item1489 | 1 | Each |
| 1490 | 15.9 | Lengenback retractor | Item1490 | 1 | Each |
| 1491 | 15.91 | Lens cleaning paper | Item1491 | 1 | Each |
| 1492 | 15.92 | Lymph node | Item1492 | 1 | Each |
| 1493 | 15.93 | Magnet for ECG | Item1493 | 1 | Each |
| 1494 | 15.94 | Malleable stylets with adjustable stop, different size | Item1494 | 1 | Each |
| 1495 | 15.95 | MEASURING TAPE | Item1495 | 1 | Each |
| 1496 | 15.96 | Measuring Tape (Clinical) | Item1496 | 1 | Each |
| 1497 | 15.97 | Microscope ( for side lab) - Binocular electric light microscope | Item1497 | 1 | Each |
| 1498 | 15.98 | Molina Sheet | Item1498 | 1 | Each |
| 1499 | 15.99 | Mosquito Net (Single use patient specific, plastic) | Item1499 | 1 | Each |
| 1500 | 16 | Mouth gag | Item1500 | 1 | Each |
| 1501 | 16.01 | Myoma screw ‘DOYEN’ | Item1501 | 1 | Each |
| 1502 | 16.02 | Na+ - sensor casing (ABG) | Item1502 | 1 | Each |
| 1503 | 16.03 | Non Invasive Glucose monitoring system (Glucometer) | Item1503 | 1 | Each |
| 1504 | 16.04 | Ounce glass steel | Item1504 | 1 | Each |
| 1505 | 16.05 | Oxygen cylinder stand /trolley - B Type | Item1505 | 1 | Each |
| 1506 | 16.06 | Pad Electrodes for SWD (DX 500 roland) | Item1506 | 1 | Each |
| 1507 | 16.07 | Paper Roll (ABG) | Item1507 | 1 | Each |
| 1508 | 16.08 | Patient Breathing Set Infant Reusable (Galileo Gold) | Item1508 | 1 | Each |
| 1509 | 16.09 | Patient cable for IFT/MST (Make/Model: Multidyne 965) | Item1509 | 1 | Each |
| 1510 | 16.1 | Patient shifting trolleys with the facility of Oxygen Cylinder carrier | Item1510 | 1 | Each |
| 1511 | 16.11 | Pelvic traction kit with pulley and weight | Item1511 | 1 | Each |
| 1512 | 16.12 | Pile Binder | Item1512 | 1 | Each |
| 1513 | 16.13 | Plastic dropping bottle (120ml) | Item1513 | 1 | Each |
| 1514 | 16.14 | Plastic small tube | Item1514 | 1 | Each |
| 1515 | 16.15 | RAOS hand suction unit 100 ml | Item1515 | 1 | Each |
| 1516 | 16.16 | Ref. - membrane shell (ABG) | Item1516 | 1 | Each |
| 1517 | 16.17 | Resucitation kits Automatics | Item1517 | 1 | Each |
| 1518 | 16.18 | Resuscitation kit Emergency | Item1518 | 1 | Each |
| 1519 | 16.19 | Resuscitation kit for neonates | Item1519 | 1 | Each |
| 1520 | 16.2 | Rubber Sole - 4mm | Item1520 | 1 | Each |
| 1521 | 16.21 | Sample detector | Item1521 | 1 | Each |
| 1522 | 16.22 | Screw driver | Item1522 | 1 | Each |
| 1523 | 16.23 | Sealing rings | Item1523 | 1 | Each |
| 1524 | 16.24 | Set tubing for roller pump (reagents) (ABG) | Item1524 | 1 | Each |
| 1525 | 16.25 | Shin tube cutting jig 30mm | Item1525 | 1 | Each |
| 1526 | 16.26 | Shin tube cutting jig 35mm | Item1526 | 1 | Each |
| 1527 | 16.27 | Short needle Holder | Item1527 | 1 | Each |
| 1528 | 16.28 | Side Support (Meditrin) | Item1528 | 1 | Each |
| 1529 | 16.29 | Silicon Tubal Ring | Item1529 | 1 | Each |
| 1530 | 16.3 | Solid waste containers liners | Item1530 | 1 | Each |
| 1531 | 16.31 | Solution Valve | Item1531 | 1 | Each |
| 1532 | 16.32 | Spare canvas bag | Item1532 | 1 | Each |
| 1533 | 16.33 | Spare lamp for Opthalmoscope | Item1533 | 1 | Each |
| 1534 | 16.34 | Spare parts for: Easylyte,911 , 912 & others | Item1534 | 1 | Each |
| 1535 | 16.35 | Spirit lamp | Item1535 | 1 | Each |
| 1536 | 16.36 | Stich scissor | Item1536 | 1 | Each |
| 1537 | 16.37 | Suture anchor (orthopaedics) | Item1537 | 1 | Each |
| 1538 | 16.38 | Syringe Infusion pump | Item1538 | 1 | Each |
| 1539 | 16.39 | T- handle for Orthopaedics | Item1539 | 1 | Each |
| 1540 | 16.4 | Tailor Thread | Item1540 | 1 | Each |
| 1541 | 16.41 | TCO2 sensor | Item1541 | 1 | Each |
| 1542 | 16.42 | Teley's Forcep | Item1542 | 1 | Each |
| 1543 | 16.43 | Vortex mixer | Item1543 | 1 | Each |
| 1544 | 16.44 | Vulsellum forceps 1 x 1 teeth 25cm | Item1544 | 1 | Each |
| 1545 | 16.45 | Wire Cutter | Item1545 | 1 | Each |
| 1546 | 16.46 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure) | Item1546 | 1 | Each |
| 1547 | 16.47 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Low Pressure) | Item1547 | 1 | Each |
| 1548 | 16.48 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene. | Item1548 | 1 | Each |
| 1549 | 16.49 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure with bacterial resistance) | Item1549 | 1 | Each |
| 1550 | 16.5 | Manual Hub Cutter – with biohazard symbol and which can cut the plastic hub and NOT the metal needle with temporary and permanent locking mechanism on complete filling of the disposal hub cutter with clear demarcation of fill line and which can accomadate upto 400-600 needles. | Item1550 | 1 | Each |
| 1551 | 16.51 | Cerebral Reservior (Omaya Type) | Item1551 | 1 | Each |
| 1552 | 16.52 | Extranal Ventricular Drainage Syatem | Item1552 | 1 | Each |
| 1553 | 16.53 | Lumbar Extranal Drainage System | Item1553 | 1 | Each |
| 1554 | 16.54 | Poly Propylene mesh (small) for Duroplasty | Item1554 | 1 | Each |
| 1555 | 16.55 | Poly Propylene Mesh (Medium) for Duroplasty | Item1555 | 1 | Each |
| 1556 | 16.56 | Poly Propylene Mesh (Large) for Duroplasty | Item1556 | 1 | Each |
| 1557 | 16.57 | G Bone Cement (for Cranioplasty) | Item1557 | 1 | Each |
| 1558 | 16.58 | Kraniotomy Drape | Item1558 | 1 | Each |
| 1559 | 16.59 | Iodine Drape Large | Item1559 | 1 | Each |
| 1560 | 16.6 | Balanced Salt Solution with Na/K/Mg & chloride levels similar to plasma with acetate & gluconate/malate as buffer, must not contain calcium ( eg.Plasmalyte A /Volulyte etc) | Item1560 | 1 | Each |
| 1561 | 16.61 | Bactiseal Impregnated Shunt - FDA Approved, fixed pressure VP Shunts (low,medium, high) that are antibiotic impregnated and can reduce the potential for bacterial colonization in the lumen as well as its outer surface. | Item1561 | 1 | Each |
| 1562 | 16.62 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1562 | 1 | Each |
| 1563 | 16.63 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1563 | 1 | Each |
| 1564 | 16.64 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1564 | 1 | Each |
| 1565 | 16.65 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1565 | 1 | Each |
| 1566 | 16.66 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1566 | 1 | Each |
| 1567 | 16.67 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1567 | 1 | Each |
| 1568 | 16.68 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1568 | 1 | Each |
| 1569 | 16.69 | Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. | Item1569 | 1 | Each |
| 1570 | 16.7 | Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. | Item1570 | 1 | Each |
| 1571 | 16.71 | Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. | Item1571 | 1 | Each |
| 1572 | 16.72 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1572 | 1 | Each |
| 1573 | 16.73 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1573 | 1 | Each |
| 1574 | 16.74 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1574 | 1 | Each |
| 1575 | 16.75 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1575 | 1 | Each |
| 1576 | 16.76 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1576 | 1 | Each |
| 1577 | 16.77 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1577 | 1 | Each |
| 1578 | 16.78 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1578 | 1 | Each |
| 1579 | 16.79 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1579 | 1 | Each |
| 1580 | 16.8 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1580 | 1 | Each |
| 1581 | 16.81 | Raneys scalp disposable clips - Disposable Raney's Clips | Item1581 | 1 | Each |
| 1582 | 16.82 | Cranioplasty kit - Cranioplasty kit, sterile, pack of two packets of Methyl methacrylate and two vials of liquid. | Item1582 | 1 | Each |
| 1583 | 16.83 | Universal Extremity Drape- Control plus fabric,US FDA certified | Item1583 | 1 | Each |
| 1584 | 16.84 | Impervious Split Sheet- 60" x 70", 4" x 21" split, Polyethylene Sheet, US FDA certified | Item1584 | 1 | Each |
| 1585 | 16.85 | U-Bar-Pack- 1 back table cover-Reinforced 44" x 88",1 mayo stand cover reinforced 23" x 54",1 suture bag, 1U drape 71" x 124", 1 Bar Drape 71" x 124", 1 Bar Drape 41.5" x 82",US FDA certified | Item1585 | 1 | Each |
| 1586 | 16.86 | Back Table Cover Zone Reinforced- 44" x 99", US FDA certified | Item1586 | 1 | Each |
| 1587 | 16.87 | Impervious Stockinette-12" x 58", UDS FDA | Item1587 | 1 | Each |
| 1588 | 16.88 | Fluid shield Mask with Visor -Four Layer Mask, water resistant with water resistant,-NAOSH, OSHA approved | Item1588 | 1 | Each |
| 1589 | 16.89 | HIP Drape with LEG Pockets -control plus fabric, US FDA approved | Item1589 | 1 | Each |
| 1590 | 16.9 | HIP Drape without LEG Pockets -Control plus fabric, US FDA approved | Item1590 | 1 | Each |
| 1591 | 16.91 | Quattro FX -Full Face Mask Vented | Item1591 | 1 | Each |
| 1592 | 16.92 | Mirage FX- Nasal Mask Vented | Item1592 | 1 | Each |
| 1593 | 16.93 | Transmission Electron Microscope | Item1593 | 1 | Each |
| 1594 | 16.94 | G011/2 Glut Em 25% AMPS | Item1594 | 1 | 10x2ml |
| 1595 | 16.95 | Self Closing Tweezer (biology) T-403 | Item1595 | 1 | Each |
| 1596 | 16.96 | O001 Osmium Tetroxide | Item1596 | 1 | 1vial/1gm |
| 1597 | 16.97 | EUKITT Mouning Media | Item1597 | 1 | 1bottle/100ml |
| 1598 | 16.98 | TAAB Araldite 502/812 Kit (E2O2) | Item1598 | 1 | Kit |
| 1599 | 16.99 | Dibutyl Phthalate | Item1599 | 1 | Bottle |
| 1600 | 17 | E069 Embedding Mould Flat C | Item1600 | 1 | 1 Piece |
| 1601 | 17.01 | Z10 Molecular Seive 3NM for Drying Acetone | Item1601 | 1 | 1bottle/Jar |
| 1602 | 17.02 | Shaving Razor Blade | Item1602 | 1 | 1Packet |
| 1603 | 17.03 | 300 mesh Cu Grid with thin carbon film (Cu - 300CN | Item1603 | 1 | 25grids/pkg |
| 1604 | 17.04 | 300M mesh Cu Grid with holey/dbl Carbon film (Cu-300HD | Item1604 | 1 | 25grids/Pkg |
| 1605 | 17.05 | G062 Grid Storage Box | Item1605 | 1 | 1x10pcs |
| 1606 | 17.06 | U007 Uranyl Acetate | Item1606 | 1 | 1 bottle |
| 1607 | 17.07 | L018 Lead Citrate | Item1607 | 1 | 1 bottle |
| 1608 | 17.08 | TRUF 2208-100 | Item1608 | 1 | 1 Packet |
| 1609 | 17.09 | Octagon Magnetic Stirrer Bar (4151) | Item1609 | 1 | 1packet (8x22mm) |
| 1610 | 17.1 | Consumables | Item1610 | 1 | Each |
| 1611 | 17.11 | Micro tips(10micro litre) | Item1611 | 1 | 1x1000pcs |
| 1612 | 17.12 | Microcentrifuge Tube | Item1612 | 1 | 1.5/2.0ml capacity |
Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy
For Tender Information Services Visit : TenderDetail
