Health and Family Welfare Statutory Bodies & Commissions/Committees Closing in 0 days TDR #22947207

Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later.

Issued by Statutory Bodies & Commissions/Committees · NEIGRIHMS, Shillong, Meghalaya, Meghalaya
Tender Value
30 Lakhs
Estimated cost
Bid Submission
04 Dec 2020
0 days left
EMD
30000
Bank guarantee accepted
Document Fee
Ref. Documents
Non-refundable
Tender Type
Online

Tender Overview

Competition Type
NCB
Bidding Type
Tender
Location / State
NEIGRIHMS, Shillong, Meghalaya → Meghalaya
EMD Exemption
Not Available
Quantity
Not Available

Project Description

Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later. - 1 Albumin 2 Microalbumin 3 Gamma Glutamyl Tranferase 4 ( ??- Ggt ) 5 Amylase 6 Lipase 7 Ck 8 Ck-Mb 9 Ldh 10 Total Cholesterol 11 Triglyceride 12 Hdl 13 Ldl 14 Calcium 15 Copper 16 Phosphorus 17 Zinc 18 Parameter 19 Iron 20 Tibc 21 Ada 22 Ada Calibrator 23 G-6-Pd 24 Glycosylated Hb 25 Glycosylated Hb Calibrator 26 Crp 27 Crp Calibrator 28 A-1 Acid Glycoprotein 29 Ammonia 30 Lactate 31 Glutathione Peroxidase 32 Superoxide Dismutase 33 Total Antioxidant Status 34 Homocysteine 35 Aso 36 Rf 37 Lipoprotein ( A ) 38 Lipoprotein ( A ) Calibrator 39 Transferrin 40 Cystatin C 41 Gentamycin 42 Barbiturates 43 Valproic Acid 44 Phenitoin 45 Vma 46 Galactosemia 47 Calcitonin 48 Calcitriol 49 Galactokinase 50 Galactose-1-Phosphate Uridyl Transferase 51 Renin 52 Acth 53 Interleukin 1 54 Interleukin 4 55 Interleukin10 56 Leukotrine A4 57 Leukotrine B4 58 Leukotrine C4 59 Leukotrine D4 60 Leukotrine E4 61 Tnfa 62 Cephalosporin 63 Serum Tryptase 64 Urine Fluoride 65 Anti-Dsdna Antibody 66 Anti Nuclear Antibody 67 Anti-Sm Antibody 68 Sodium Carbonate 69 Potassium Dihydrogen Phosphate 70 Potassium Dihydrogen Phosphate Kh2po4 ( Hplc Grade ) 71 Creatinine Powder 72 Isopropyl Alcohol, Ar Grade 73 Acetone – Ar Grade Ar Grade 74 Ammonium Chloride –Ar Grade, 75 Ammonium Nitrate – Ar Grade, 76 Ammonium Persulphate – Ar Grade, 77 Calcium Chloride Dihydrade – Ar Grade, 78 Dinitro Phenyl Hydrazine Ar Grade, 79 Magnesium Chloride – Ar Grade, 80 Magnesium Sulfate –Ar Grade, 81 Methanol – Acetone Free – Hplc Grade, 82 Methanol ( Hplc Grade ) 83 Potassium Dichromate – Ar Grade, 84 Silver Nitrate – Ar Grade, 85 Sodium Bicarbonate – Ar Grade, 86 Sodium Acetate Dehydrate –Ar Grade, 87 Ammonium Acetate – Ar Grade, 88 Thio Semi Carbazide – Ar Grade, 89 Ethidium Bromide Soln 10Ml– Biotechnology Grade, 90 Guanidium Iso Thiocyanate – Biotechnology Grade, 91 Iptg Ar Grade, 92 100 Bp Dna Ladder 1 Ml X 5 93 Taq Polymerase With Pcr Buffer 3-5 U / Μl, 1000 U Per Vial 94 Dntps 100 Millimolar Each 95 Ecori Restriction Enzyme 0.5 Ml X 1 96 Bamhi 0.5 Ml X 1 97 Hindiii 0.5 Ml X 1 98 Dna Ligase 0.5 Ml X 1 99 Dna Extraction Kit ( Column Based ) For 50 Extraction 100 Rna Extraction Kit ( Column Based ) For 20 Extraction 101 Plasmid Extraction Kit ( Column Based ) For 50 Extraction 102 Oligo Nucleotide Primers ( Hplc Purification ) 103 Rnalater 104 Depc Mol Bio Grade 105 Nuclese K 106 Milipore Prefiltrate Kit Cartridge 107 Milipore Proguard 2 Pack Cat. No. Prog0002 108 Milipore Q Guard 1 Cat. No. Qgard00r1 109 Milipore Tank Vent Filter Cat. No. Tankmpk01 110 Milipore Sanitization Tablet Cat. No. Zwcl01f50 111 Millipore Millicare Elix Cat No Jmbm01747 112 Millipore Quantum Ex Cat. No- Qtum000ex 113 Mx Cart 5 Micron 114 Mx Cart 1 Micron 115 Ro Cartridge 116 Non Sterile Millipak 40 117 Progard Ts 2 118 1 Micron Filter 119 3 Micron Filter 120 Mx Cartridge 5 Μm 121 20 Carbon Cartridge 122 Sanitization Tablets 123 Pm Kit 124 Xl Wash Solution 125 200-1000 Μl Microtips 126 100-200 Μl Microtips 127 5-50 Μl Microtips 128 1-5 Ml Microtips 129 200-1000 Μl Micropipette 130 100-200 Μl Micropipette 131 5-50 Μl Micropipette 132 2-20 Μl Micropipette 133 Microcentrifuge Tube 1.5Ml 134 Ammonium Persulphate Ar 135 Potassium Iodate ( Kio3 ) 136 Toluene Ar 137 Arsenous Acid ( As2o3 ) 138 Arsenic Trioxide 139 Ceric Ammonium Sulphate 140 20Bp Dna Ladder 141 Tris – Base Ar Grade 142 Fok I & Nlaiii Restriction Enzyme 143 Dna Loading Buffer 144 Dna Sample Loading Dye 145 Ethiduim Bromide 146 Primer ( Both Forward & Reverse ) 147 10 X Tbe 148 Heparinised Vial 149 Disposable Syringe 150 Microwave Oven 151 Glucose Kit 152 Bilirubin Kit 153 G6-Pd Kit 154 Vacutainer 155 Disposable Syringe 156 Cystatin C Kit 157 Bilirubin Kit 158 Creatinine Kit 159 Ast Kit 160 Alt Kit 161 Ise Wash 2 Solution 162 Ise Cal-3 Solution 163 Ise Cal -4 Solution 164 Microcentrifuge Tube 2Ml 165 Sp Kit 166 Rep Prep Solution 167 Sample Applicator 168 Disposable Sample Cup 169 Ast 170 Alt 171 Creatinine 172 Albumin 173 Glucose 174 Ggt 175 Bun 176 Hdl Cholesterol 177 Ldl Cholesterol 178 Cholesterol 179 Uibc 180 Rf Rtg Latex 181 Crp 182 Uric Acid 183 Triglyceride 184 Alp 185 Total Bilirubin 186 Igg 187 Direct Bilirubiun 188 Igm 189 Protein 190 Iga 191 Phosphorus 192 C3 193 Calcium 194 Ck-Mb 195 Lipase 196 Aso 197 Iron 198 C4 199 Amylase 200 Ck 201 Acid Phosphatase 202 Transferrin 203 Ldh 204 Magnessium 205 Hb-Dh 206 Haptoglobin 207 Lactate 208 Microalbumin 209 Microalbumin Calibrator 210 Cholinesterase 211 Urine Csf Protein 212 Wash Solution 213 Cleaning Solution 214 Cleaning Solution Weekly Wash 215 Crp Latex Calibrator 216 Urine Calibrator 217 System Calibrator 218 Hdl Calibrator 219 Ldl Calibrator 220 Crp Calibrator 221 Rf Calibrator 222 Ck-Mb Calibrator 223 Xl-300 / 600 Cuvette 224 Beckman Coulter Au 2700 Cuvettes 225 Xl-300 / 600 Lamp 226 Beckman Coulter Au 2700 Lamp 227 Eqas ( Bio-Rad ) 228 Apoa1 & Apob Reagent & Calibrator 229 Bio-Rad Lipid Conrol 230 Ethylene Glycol ( Ethandiol 231 Methylene Soluble ( Working Reagent 232 Tissue Capsule Big 233 Tissue Capsule Small 234 Tissue Cassettes Big 235 Tissue Cassettes Small 236 Stock Phloxine B 237 Progesterone Receptor 238 Ana Kit For Sle ( Indirect Immunoflurescence Method ) 239 Hb / Cayanaid Method Standard 240 Nalidixid 10Ug 241 Netilmycin 10Ug 242 Furozotidime 30Ug 243 Antigen And Antibody Hcv Elisa Test Kits 244 Cell Counter Reagents 245 ( Machine Available Is Abx Pentra Which Is A Closed System ) 246 Reagent For Aptt 247 Calcium Chloride For Aptt Estimation 248 Control Plasma N 249 Reaction Tube 250 Ca Clean 251 Owrens Veronal Buffer 252 Standard Human Plasma 253 Sodium Azide ( Nan3 ) 254 Bovine Thrombin 255 1000 Nih Units / Mg Of Protein 256 Anti Dce 257 Sc ( 1 ) 258 Sc ( 2 ) 259 Sc ( 3 ) 260 Yt ( A ) 261 Yt ( B ) 262 Do ( A ) 263 Do ( B ) 264 Pyr Broth 265 Pyr -Pyrolidonyl-ß Naphthylamine 266 Paradimethylaminobenzaldehyde 267 P-Dimethylaminocinamaldehyde 268 P-Nitrophenylglycerol 269 Potassium Telurite 270 Potassium Cyanide ( Kcn ) 271 Para Dimethyl Aminobenzaldehyde 272 Potassium Hydroxide 273 Potassium Hydrogen Sulphate 274 Phenol Crystal ( Powder ) 275 Phosphate Buffer Saline 276 Phenethyl Alcohol 277 Phenol Red Indicator 278 Phenol Red Indicator 279 Phenol Red 280 Phenylpyruvic Acid Reagent 281 Potassium Dichromate Lr 282 Potassium Permanganate Lr 283 Potassium Permanganate Ar 284 Potassium Phosphate Monobasic 285 Potassium Nitrate 286 Phenol ( Crystal ) 287 Peptone 288 Raffinose Ar 289 Rhammnose 290 Sodium / Potassium Dichromate 291 Sodium Citrate 292 Sodium Pyruvate Ar 293 Sodium Biocarbonate Lr 294 Sodium Acetate 295 Sodium Iodide 296 Sulphanilamine-Ar 297 Sugar Assimilation Disc – Cellobiose 298 Sugar Assimilation Disc – Dextrose 299 Sugar Assimilation Disc – Dulcitol 300 Sugar Assimilation Disc – Galactose 301 Sugar Assimilation Disc – Inositol 302 Sugar Assimilation Disc – Lactose 303 Sugar Assimilation Disc – Maltose 304 Sugar Assimilation Disc – Melibiose 305 Sugar Assimilation Disc - Raffinose 306 Sugar Assimilation Disc- Sucrose 307 Sugar Assimilation Disc – Trehalose 308 Sugar Assimilation Disc - Xylose 309 Salicin Ar 310 Tarric Acid 311 Trehalose Ar 312 Triypticase 313 Thiosulphate 314 Tri-Sodium Citrate 315 Voges Proskaeur Reagent 316 Vibriostatic ( 0 / 129 ) Agent 317 Wright’S Stain 318 Xylose Ar 319 Vibrio Cholerae-01 3Ml 320 Vibrio Cholerae-0139 3Ml 321 Vibrio Cholerae-Ogawa 3Ml 322 Vibrio Cholerae-Inaba 3Ml 323 Salmonella Polyvalent O 3Ml 324 Salmonella Polyvalent H 3Ml 325 Salmonella Polyvalent O2 3Ml 326 Salmonella Polyvalent O4 3Ml 327 Salmonella Polyvalent O9 3Ml 328 Salmonella Polyvalent H Phase I A 3Ml 329 Salmonella Polyvalent H Phase Ib 3Ml 330 Salmonella Polyvalent H Phase Ic 3Ml 331 Salmonella Polyvalent H Phase Ii 3Ml 332 Shigella Polyvalent Dysenteriae 3Ml 333 Shigella Polyvalent Flexnerii 3Ml 334 Shigella Polyvalent Sonnei 3Ml 335 Shigella Polyvalent Boydii 3Ml 336 Cryptococcus Antigen Detection Kit ( Latex Agglutination Detection ) 337 Antigen Detection Kit For Meningitis ( H Influenza B, N Meningitis A & C, S. Pneumonia, Gbs, E.Coli ) 338 Amphotericin Powder 339 Benzal Pennicillin Powder 340 Cefoxitin 5Gm / Vial 341 Clindamycin Powder 342 Ciprofloxacin 5Gm / Vial 343 Erythromycin Powder 344 Gentamicin 5Gm / Vial 345 Imipenem 5Gm / Vial 346 Oxacillin 5Gm / Vial 347 Vancomycin 5Gm / Vial 348 Anidulafungin ( 0.015-128Μg / Ml ) 349 Ceftriaxone ( 0.016-256 Ug / Ml. ) 350 Ciprofloxacin ( 0.001-8Ug / Ml. ) 351 Ceftazidime+ Clavulanate ( 0.004-128Ug / Ml. ) 352 Clindamycin E-Test ( 0.016-256 Μg / Ml ) 353 Colistin ( 0.06-0.25Μg / Ml ) 354 Caspofungin ( 0.015-128Μg / Ml 355 Doripenem ( 0.002-32 Μg / Ml ) 356 Ertapenem ( 0.002-32 Μg / Ml ) 357 Fluconazole ( 0.016-256 Μg / Ml ) 358 Imipenem ( 0.004-128Ug / Ml. ) 359 Levofloxacin ( 0.001-8Ug / Ml. ) 360 Meropenem ( 4-256 Μg / Ml ) 361 Meropenem / Edta ( 1-64 Μg / Ml ) 362 Moxifloxacin ( 0.001-8Ug / Ml. ) 363 Candida Albicans Atcc 14053 364 Candida Guilliermondii Atcc 6260 365 Candida Psedotropicalis Tcc 4135 366 Corynebacterium Diptheriae Atcc 13812 Vial 367 Escherichia Coli Atcc 25922 Vial 368 Escherichia Coli Atcc 35218 Vial 369 Enterococcus Faecalis Atcc 29212 Vial 370 Haemophilus Influenzae Atcc-49766 Vial 371 Pseudomonas Aeruginosa Atcc 27853 Vial 372 Positive Control For T.B. ( My.Tb H37rv Strain ) 373 Staphylococcus Aureus Atcc 25923 Vial 374 Streptococcus Pneumoniae Atcc 49619 Vial 375 Staphylococcus Aureus Atcc 33591 Vial 376 Salmonella Enterica Subspecies Enterica Serovar Cholerasuis Atcc-10708 Vial 377 Salmonella Enterica Subspecies Enterica Serovar Paratyphi A Atcc-9150 Vial 378 Salmonella Enterica Subspecies Enterica Serovar Typhimurium Atcc-25241 Vial 379 Shigella Flexneri Atcc- 9199 Vial 380 Ast For Gnb Ast –N280 381 Media For Pediatric Sample -259794, Bact / Alert Pf 382 Media For Aerobic Sample – 259791, Bact / Alert Fa 383 Solution For Inoculum Preparation – V1204, 3X500 Ml 384 Tubes For Inoculum Preparation - 69285 ( Unsensitised Tube ) 385 Identification Of Fermentes And Non-Ferments – 21341 ( Gn Test Kit Vtk ) 386 Dna Ladder / Molecular Weight Marker Size Range : 100 To 1200 Bp ( 50Μg ) 387 Dna Extraction Kit 388 Deoxynucleotide Triphosphate ( Dntp ) Mixture 389 Anaerogas Pack ( 5 Nos / Pack ) 390 Autoclavable Biohazard Plastic Bag: Size 10 Ltr 10Ltr 391 Anaerobic Blood Culture Bottle – Adult ( 50 / Pack ) 392 Anaerobic Blood Culture Bottle – Paediatric ( 50 / Pack ) 393 Anaerobic System Rubber Ring 394 Anaero Indicator Tablet Rt ( 1X10 / Pkt ) 395 Autoclavable Plastic Vial Flat Bottom, Screw Capped 11.5 Mm X53 Mm. 396 Craigie’S Tube 397 Durhams Tube 25 X 6 Mm 398 Durhams Tube 37X 6 Mm 399 Embading Cassette 1X1000 / Box 400 Kline Concavity Slides 75X56x3 Mm Thick & 12 Concavity Code Gw097 401 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 0.1Ul - 20Μl 402 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 2Ul - 200Μl 403 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 50Ul - 1000Μl 404 Microtips ( Autoclavable ) 0.1Ul - 20Μl 405 Microtips ( Autoclavable ) 2Ul - 20Ul 406 Microtips ( Autoclavable ) 5Ul-50Ul 407 Microtips ( Autoclavable ) 20Ul-200Ul 408 Microtips ( Autoclavable ) 200Ul-1000Ul 409 Microtips-1000 Ul 410 Microtips-5000 Ul 411 Microtitre Plate With Round Bottom Wells 96Wells 412 Microtitre Plate With Detachable Wells 96Wells 413 Micro Centrifuge Autoclavable Plastic Tubes With Cap 2Ml 414 Micro Centrifuge Autoclavable Plastic Tubes With Cap 5Ml 415 Micro Centrifuge Autoclavable Plastic Tubes With Cap 10Ml 416 Mac Cartney Bottles Flat Bottom With Aluminium Screw Cap & Rubber Liner. Capacity 30Ml 417 Museum Jar, With Cover 160X110x60mm 418 Museum Jar, With Cover 170X130x210 Mm 419 Screw Capped Tubes 20X150mm 420 Serum Vials Sample Storage Box & Stand For 3Ml Capacity 421 Sample Container -Wide Mouth Bottle, 125Ml Autoclavable ( Polypropylene ) 125Ml 422 Storage Vials ( Autoclavable ) 2Ml 423 Teasing Needles For Moulds 424 Test Tube Stand - Test -Tube Size - 25Mm Diametre 425 Test Tube Stand - Test -Tube Size - 16Mm Diametre 426 Test Tube Stand - Test-Tube Size - 10Mm Diametre 427 Test Tube Basket, Large 428 Test Tube Basket, Small 429 Test Tube Rack To Accommodate 3 Ml. Test Tubes 5X15 430 Test Tube Rack To Accommodate 5 Ml. Test Tubes 5X15 431 Test Tube Racks:4 X 13 432 Test Tube Cleaning Brush ( Polypropylene Filament Bunched Typed Brush For Cleaning 6”, 5” & 4” Tubes ) 433 Test Tube Carrier ( Stainless Steel ) 434 V.D.R.L. Slides ( 75Mmx50mm 1.45Mm ) 435 Wash Bottle Plastic With Delivery Nozzle 200Ml 436 Wash Bottle Plastic With Delivery Nozzle 60Ml 437 Bunsen Burner 438 Bacteriological Loop Holder With Loop ( Ready To Use ) 439 Biological Indicator For Steam 440 Bowie Dicktest Pack Steam 441 Ice Box 5 Litres 442 Labels For Micro Centrifuge Tubes White Size ½” 443 Metaloops ( Changeable Nichrome Loop Embedded In Brass Rod With Heat Resistant Handle With- 444 A. 2 Mm Diameter Nichrome Wire 445 B. 3 Mm Diameter Nichrome Wire 446 C. 4 Mm Diameter Nichrome Wire 447 Metaloops ( Fixed Straight Nichrome Loop Embedded In Ss Rod With Heat Resistant Handle With- 448 Microtome Knife 449 Mops 450 Magnifying Glass, Big Size With Handle 451 Mortar - Pestle 452 Nichrome Loop-4 Mm 453 Nichrome Loop-2 Mm 454 Nichrome Loop-1.3 Mm 455 Pipette Stand ( Vertical & Horizontal ) 4 / 5 Pipettes 456 Staining Rack. 20 Slide Capacity. 457 Sprit Lamp Glass / Metal 458 Screwdrivers -Multipurpose 459 Silver Aluminium Foil 460 Surgical Knife ( Big ) 461 Sterile Swab Sticks 462 Syringe Driven Filters Ptfe ( Hydrophilic ) Pore Size 0.22Μm 463 Thermometer 37Degree C 464 Twine 465 Universal Collection Vials ( Urine Pot ) 466 Universal Wash Reagents 500Ml 467 Anti-Cd 56 468 Anti-61 469 Anti-Cd 68 470 Anti-Cd 33 471 Anti-Ki 67 ( Mib ) 472 Anti Neurofilament Protein 473 Anti-Synaptophysin 474 Anti-Gfap 475 Anti-Cd 99 476 Anti-Cd 31 477 Anti-B Hcg 478 Poly-L.Lysine 479 Anti-Cd 20 ( B Cells ) 480 Anti-Cd 45 ( Lca ) 481 Anti-S 100 482 Anti- Desmin 483 Anti-C-Erb B-2 ( Her-L / Neu ) 484 Anti-Er 485 Anti-Pr 486 Anti-Cd 3 487 Anti-Cd 20 488 Anti-Cd 117 489 Anti-Cd 34 490 Anti-Cd 30 491 Anti-Cyclin D1 492 Anti-Cd 15 493 Anti-Cd 5 494 Fitc-Conjugated Rabbit 495 Anti-Human Iga ( Alpha Chain ) 496 Fitc-Conjugated Rabbit 497 Anti-Human Igg ( Gamma Chain ) 498 Fitc-Conjugated Rabbit 499 Anti-Human Kappa Light Chain 500 Fitc-Conjugated Rabbit 501 Anti-Human C3c Complement 502 Fitc-Conjugated Rabbit 503 Anti-Human Igm ( Mu Chain ) 504 Fitc-Conjugated Rabbit 505 Anti-Human Lambda ( Light Chain ) 506 Ana By Hep-2-Cell-Line Substrate ( Kit With Reagents ) 507 Electrodes For Μph System 361 508 Osmium Tetroxide 509 Chromium Trioxide 510 Zinc Chloride 511 Di-Sodium Hydrogen Phosphate Anhydrous 512 Di-Sodium Hydrogen Orthophosphate Dibasic 513 Sodium Dihydrogen Orthophosphate Monohydrate 514 Sodium Borate 515 Alpha Napthyl Butyrate 516 Anti-Cish Kits-Hpv16 / 18Dna 517 Er / P-R Control 518 Anti-Melanomal ( Hmb45 ) 519 Anti Myeloperoxidase 520 Anti -Nse 521 Anti-Plap 522 Anti-Bc12 Oncoprotein 523 Anti-Cytokeratin7 524 Anti-Cytokeratin20 525 Anti-Brca 1Protein 526 Anti-Iga 527 Anti-Igm 528 Anti-Igg 529 Anti-Compliment Cd3 530 Anti-Rb Gene Protein 531 Anti-P53 Protein 532 Anti-Wt1 Turmor 533 Anti-Vimentin ( V9 ) 534 Anti-Ema ( E29 ) 535 Anti-P169ink4 ) 536 Kappa 537 Lamda 538 Eosine Spirit Soluble 539 Pap Pen Immuno Histochemistry 540 Anti-Cd 1A 541 Anti-Sma 542 Anti-Myogenin 543 Fluorescent Bchiff Reagent 544 Carmine 545 Acriffarine 546 Cresyl Fast Blue 547 Luxol Fast Blue 548 Cresyl Violet 549 Epinephrine ( 3X0.5Ml ) 550 Aggrecetion Ristocetion A Sulfate ( 3X0.5Ml ) 551 A D P ( Adenosine-5L Diphosphate ( 3X0.5Ml ) 552 Arachidonic Acid Lyohillzed Sodium Arachidonate 553 Collagen Soluble Calfskin ( 3X0.5Ml ) 554 Vw Fator Assay Ristocetin Cofactor ( 3X0.5Ml ) 555 Test Tube ( Siliconized, Flate Bottom 7X25x55mm ) 556 Stri Bars Plastic Coaled Micro 557 Cryo Glue ( Tissue Embedding Medium ) For Cryostat Machine 558 Diposables Blades For Cryostat Machine 559 Silicon Tubal Ring 560 Laser Spectacles 561 Fluid Warmer 562 Filter For Suction Machine ( Atmos ) 563 Nibp Monitor With Integrated Cuff Arm 564 Serum Zinc 565 Copper 566 Ceruloplasmin 567 Ammonia 568 Ammonia 569 Alcohol 570 D- Dimer 571 Anti Ds Dna 572 Anti Sn Antibody 573 Vitamin D 574 Vitamin E 575 Ngal 576 Cystatin C 577 G6 Pd 578 Lactate 579 Apo A1 580 Homocysteine 581 Bnp 582 Urinary Vma 583 Blood Ketones 584 Lip A 585 Ana 586 Anti Phospholipid Antibody 587 Vitamin C 588 Ena 589 Vitamin K 590 Iodine 591 Apo B 592 Troponin T 593 Ck Mb1 594 Ck Mb 2 595 Tibc 596 Transferrin 597 Igg 598 Igm 599 Iga 600 Inhibin A 601 ß Trace Protein 602 ?Eta 2 Microgobulin 603 Alpha 1 Antitrypsin 604 A -1 Microglobulin 605 A-2 Macroglobulin 606 Screening Kit For Inborn Error Of Metabolism 607 Eqas For Clinical Chemistry, Immunoassay, Electrolyte, Hba1c. 608 Tpo ( Thyroperoxidase ) Antibody 609 Control For M-Band Electrophoresis 610 Tnf-A 611 Il-2 612 Procalcitonin 613 5Acagcgtcatggcagagcaggtggc3’ 614 5Aaaagctcttcccgcaggatcccgc3’ 615 5Gtggctgttccgggatggccttctg3’ 616 5Cttgaagaagggctcactctgtttg3’ 617 5Cagtacgatgatgcagc3’ 618 5Caggtagaagaggcggt3’ 619 Amikacin , Neomycin & 620 Tobramycin Standard ( Hplc Grade ) 621 Edta Gel ( 15% ) 622 Acrylic - Heat Cure-Clear 623 Acrylic - Heat Cure-Pink 624 Acrylic - Self Cure-Clear 625 Acrylic - Self Cure-Pink 626 Agate Spatula 627 Alginate Impression Material ( Dustless ) 628 Articulation Paper 629 Bur - Airotor-Diamond 630 Bur - Airotor-Tc- Straight Fissure 631 Calcium Hydroxide Paste For Root Canal 632 Dappen Dish 633 Dental Floss – Waxed, 25 M 634 Dental Stone 635 Dentin Bonding Agent 636 Die Stone 637 Disposable Suction Tips With Copper Wire 638 Emery Sheet - 100, 150 And 400 Grade 639 Endodontic Gutta Percha Points ( 15-80 ) 640 Etchant Gel ( 37 % Phosphoric Acid ) 641 Fiber Composite Splint 642 Flexible Composite Polishing Discs 643 Formocresol 644 Gic- High Strength Pacakable For Posteriors 645 Glass Ionomer Cement Type I 646 Glass Ionomer Cement Type Ii 647 Gluma Dentin Desensitizer 648 Gutta Percha Sticks 649 Halogen Bulbs- 12V, 55 W 650 Hydroxyapatite Bone Graft Material 651 K File - All Sizes 652 Light Cure Composite - Flowable - All Shades 653 Light Cure Composite - Nano-Hybrid – All Shades 654 Modelling Wax Sheet No.2 655 Non Eugenol Impression Paste - Standard Pack 656 Pinnacle Tracing Sticks ( Minimum Three Years Shelf Life ) 657 Polishing Brush For Dental Lathe 658 Polymer Reinforced Zinc Oxide Eugenol Cement 659 Pumice Powder For Polishing Dentures 660 Silver Reinforced Glass Ionomer 661 Supernal Base Plate 662 Tissue Conditioner ( Soft Reliner ) 663 Ultrasonic Scaler Tip 664 Vacuum Formed Sheets - Soft And Hard - 2 And 3Mm 665 Vulcanite Trimmer ( Tc ) 666 Zinc Oxide Eugenol Impression Paste 667 Self Cure Acrylic Tooth Colour Temporary Crown Materials ( Powder & Liquid ) 668 Cold - Cure Acrylic Powder With Liquid ( White Colour ) 669 Pits And Fissure Sealant 670 Zinc Oxide Eugenol Impression Paste 671 Irm ( Intermediate Restorative Materials ) 672 Gic Fuji Tupe Ix 673 Gic Type -Ii Restoative Materials 674 Light Cure Composite Nano- Filling Materials 675 Alginate Impression Material ( Dustless ) 676 Dental Stone 677 Wedges 678 Miracle Mix Materials 679 Hand Piece Lubricant 680 Dycal 681 Suction Tips 682 Acrylic Teeth Set 683 Polishing Paste 684 Polishing Rubber Cups And Bristle 685 Disposable Glass 686 Abrasive Strips For Polishing Proximal Areas Of Teeth 687 Cellophene Matrix Strips For Lc Restoration 688 Applicator Tips For Lc 689 Desensitizing Varnish 690 Burs For Tooth Reduction Set 691 Dental Stone Cutting Burs ( Small Size ) 692 H-Files For Both Anterior And Posterior 693 K- File For Both Anterior And Posterior 694 Broaches 695 Reamers For Both Anterior And Posterior 696 Gutta Percha 697 Absorbant Paper Point 698 Titanium Post ( All Sizes ) 699 Protapper Gutta Parcha All Size 700 Alveogel 701 Rc Cal ( Intra Canal Dressing Paste ) 702 Fiber Optics Air Rotor Hand Pieces With Coupling Unit 703 Gp Cutter 704 Tungsten Carbide Burs For Air Rotor And Micro Motor Handpieces 705 Sectional Matrixs 706 Metal Crown 707 Zinc Oxide Powder And Eugenol ( Big Size ) 708 Zinc Oxide Eugenol ( Powder ) 709 Zinc Oxide Eugenol ( Liquid ) 710 Zinc Oxide Eugenol ( Ready Mix ) 711 Zno Impression Paste 712 Dycal Cement 713 Stone Burs ( All Sizes And Shape ) 714 Stone Burs For Polishing ( Fine ) 715 Composit Polishing Disc 716 Composite Cement 717 Composite Filling Kit 718 Composite Finishing And Polishing 719 Composite Polishing Disc 720 Composite Polishing Kit 721 Composite Polishing Paste 722 Endo Wash 5% 450Ml 723 Bristle Brush & Cup 724 Eugenol 15Ml 725 Eugenol 110Ml 726 Dpi Selfcure 727 Ketac Molar 728 Nt Premium 729 One Coat Bond 730 Gic Lc ( Mini ) Gc 731 Pivo Crown & Bridge Kit 732 Protaper Hand Kit 21 / 25Mm 733 Mouth Mith Handle ( Gdc ) 734 Explorer ( Gdc ) 735 Surgical Scissor ( Brp ) 736 Dpi Alloy 737 Tri Hawk 738 Glyde 3Mlx1 739 Gp F4-F5 ( Dentsply ) 740 Gp ( 15 / 35 / 40 ) Dentsply 741 Dtech Etchn 742 H File 15 / 20 / 25 743 Matrix Band No1 744 Diamond Bur 745 Shofu Crown & Bridge Kit 746 Vitrebond 747 Ah 26 748 Ketac Silver 749 Api Needle Holder 750 Nsk Push Button Airotor Handpiece 751 Apex Locator Pixi Dentsply 752 Lightcure Michine Coltene 753 Sealer Machine With Pouch 754 Scaller Tips Satellec 755 Ultrasonic Cleaner 756 Smart Burs 757 Anti Fog Mouth Mirror 758 Flouride Solution With Applicator 759 Luting Cement 760 Silicon Base Impression Materials 761 Base Putty Impression Materials 762 Light Body Impression Materials 763 Re Cap 764 Dvi Self 765 Propopar Band Kit 21 / 25Ml 766 Ghofu Crown & Bridge Kit 767 Alt 26 768 Apl Needle Holder 769 Giyote 3Ml 770 Ia File 15 / 20 / 25 771 Otech 772 Flowable Composite Shade 773 Plastic Filling Instruments 774 Cement Spatula 775 Cement Condenser 776 Ball Burnisher ( Api ) 777 Extraction Forcept For Pedo ( Set Of 16 ) 778 Tweezer 779 Diamond Round Bur 780 Diamond Straight Fissure Bur 781 Diamond Cone Shape Bur 782 Contra Angle Hand Piece 783 Paper Point ( 15-40 & 45-80 ) 784 Flamed Shaped Diamond Bur ( All Sizes ) 785 Spoon Excavator 786 Cold Mold Seal 787 Pain Off 788 Shade Guide 789 Coe- Pack 790 Apexit Plus 791 Fibre Post ( Yellow, Red , Blue ) 792 Gingival Retraction Cord 793 Spreader / Plugger ( All Sizes ) 794 Disposable Napkin 795 Crown Cutting Kit 796 Elevators ( Straight And Periostal ) 797 Extraction Forcept For Pedo Adult ( Set Of 14 ) 798 G-Coat Plus 799 Protemp With Tips And Gun 800 Gic Type Ix 801 Durable Flouride Releasing Coating 802 Light Curing Nano Ionomer Restorative 803 Remin Pro ( Protective Dental Cream ) 804 Chair Bulbs ( Ocero Infinity ) 805 Cold Cure ( Pink ) Powder 806 Cold Cure ( White ) Powder 807 Cold Cure Liquid 808 Green Sticks 809 Mercury 810 Disposable Patient Apron 811 Bobe Cutter 812 Bobe Ronger 813 Bone File 814 Mought Prod Chain 815 Macet / Hammer 816 Amalgam Condenser 817 Amalgam Carrier 818 Amalgam Curver 819 Wax Knife 820 Wire Cutter 821 Plier 822 Rubber Dam Kit 823 Crown Remover 824 Micromotor Drill Bits 825 Compo Roller 826 Gp Holder 827 Surgical Micromotor 828 Periodontal Probe 829 Acrylic Mixing Jar 830 Air Polisher 831 S.S. Inter Maxillary Fixation Screws 2.0Mm - 12-14Mm 832 S.S. Inter Maxillary Fixation Screws 2.5Mm - 12-14 Mm 833 Titanium Cranial Microplates ( 0.5Mm Plate Thickness ) 10-18Hole Straight 834 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 4 Hole With Bar / Gap 835 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 10-12Hole Straight 836 Titanium Midfacial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Right Side 837 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Left Side. 838 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Right Side 839 Titanum Mid Facial Miniplates ( 0.5-0.6Mm Plates Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Left Side 840 Titannium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Right Side 841 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Left Side 842 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 4 Hole With Bar / Gap 843 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 6 Hole With Bar / Gap . 844 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 10 Hole 845 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) T Plates 5 Holes 846 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Y Plate 4 Holes 847 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Double Y Plate 4 Holes 848 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) X Plate 5 Holes 849 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Straight Plate 10-12 Holes 850 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 12-16 Holes 851 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 20-25 Holes 852 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 853 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 854 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 855 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 856 Titanium Double Angled Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 857 Titanium Cranial ( Outer Diameter 1.0-1.2 Mm ) Non Self Drilling Screw- 4-6 Mm Length 858 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -6Mm Length 859 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -8 Mm Length 860 Titanium Midfacial ( Outer Diameter 1.8 / 1.9Mm ) Non Self- Drilling Emergency Screw -6 Mm Length 861 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -6Mm Length 862 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -8Mm Length 863 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -6Mm Length 864 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -8 Mm Length 865 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Screw -10Mm Length 866 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Maxi Screw -12Mm Length 867 Titanium Reconstruction ( 2.4Mm ) Non Self- Drilling Maxi Emergency Screw -8-20Mm Length 868 Titanium Lag Screws Non Self Drilling ( Outer Diameter 2.4 / 2.5 Mm ) - 15-20Mm Length 869 Drill Bit With 6Mm Stop For Titanium Cranial ( 1.0 / 1.2Mm, 1.0 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 870 Drill Bit With 6Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 871 Drill Bit With 8Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 872 Drill Bit With 6Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 873 Drill Bit With 8Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 874 Drill Bit With 10-12Mm Stop For Titanium ( 2.4Mm Reconstruction, Pilot Hole Diameter 2Mm ) Non Self-Drilling Screw 875 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 4X4 Cms 876 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 6X6 Cms 877 Titanium Mesh For Mandible ( 0.5-0.6Mm Thickness ) Approx. Dimension 10X8 Cms 878 Titanium Orbital Reconstruction Mesh Plates- Small 879 Titanium Orbital Reconstruction Mesh Plates- Medium 880 Titanium Orbital Reconstruction Mesh Plates- Large ( With Medial And Lateral Wall Extensions ) 881 Porous Polyethylene Orbital Sheets ( 0.8-1.5 Mm Thickness; 5X5 Cms Approx ) 882 26 Guage Stainless Steel Wire Spool 883 32 Guage Stainless Steel Wire Spool 884 Raney Clips Stainless Steel 885 022 Slot Mbt Brackets With Weldable Convertible Utld First Molar Buccal Tubes And Nc Ii Molar Tubes 886 Crimpable Hooks 887 016 Multistranded Ss Wire 888 Preformed Archwire - 014 Niti U / L 889 Preformed Archwire - 016 Niti U / L 890 Preformed Archwire - 016 X 022 Ss – U / L 891 Preformed Archwire - 017 X 025 Ss– U / L 892 Preformed Archwire - 019 X 025 Ss – U / L 893 Orthodontic Stone 894 Dunaform – Soft And Hard Sheets- 2Mm, 3Mm 895 Dental Surgery 896 Mouth Mirror With Handle 897 Mouth Mirror 898 Dental Probe 899 Periodontal Probe 900 Dental Explorer ( Curved And Pigtail ) 901 Glass Bead Sterilizer 902 Airotor Handpiece - Mini-Head ( 2 Years Warranty ) 903 Medesy / Hu Friedy Maxillary Anterior Extraction Forceps 904 Medesy / Hu Friedy Maxillary Reeds Extraction Forceps 905 Medesy / Hu Friedy Maxillary Premolar Extraction Forceps 906 Medesy / Hu Friedy Maxillary Molar Extraction Forceps Right / Left 907 Medesy / Hu Friedy Maxillary Bayonet Extraction Forceps 908 Medesy / Hu Friedy Maxillarythird Molar Extraction Forceps 909 Medesy / Hu Friedy Mandibular Anterior Extraction Forceps 910 Medesy / Hu Friedy Mandibular Premolar Extraction Forceps 911 Medesy / Hu Friedy Mandibular Molar Extraction Forceps 912 Medesy / Hu Friedy Warwick James Elevator-Straight 913 Medesy / Hu Friedywarwick James Elevator-Right / Left 914 Medesy / Hu Friedycryers Elevator-Small Size- Right / Left 915 Medesy / Hu Friedycryers Elevator-Medium Size- Right / Left 916 Medesy / Hu Friedycryers Elevator- Large Size-Right / Left 917 Double Angled Currette- Medium Size 918 Double Angled Currette- Large Size 919 Molts Perisoteal Elevator 920 Freer Periosteal Elevator 921 Walshams Nasal Forceps- Pair 922 Asche Septal Forceps 923 Haytons Williams Maxillary Forceps 924 Rowes Zygomatic Elevator 925 Sigmoid Notch Retractor ( Left / Right ) 926 Ramal Retractor 927 Wire Cutter 928 Wire Twister 929 Coronoid Retractor 930 Mastoid Self Retaining Retractor 931 Mandibular Lower Border Retractor 932 Condylar Retractor 933 Dingmann Retractor ( Adult ) 934 Vestibular Retractor 935 Swallow Tail Retractor 936 Curved Pterygoid Osteotome 8Mm 937 Curved Pterygoid Osteotome 10Mm 938 Epker Osteotome 4Mm / 6Mm / 8Mm Curved 939 Epker Osteotome 4Mm / 6Mm / 8Mm Straight With Marking 940 Orthodontic Model Boxes 941 Tongue Guard - Medium 942 Dontrix Gauge 943 Extraoral Force Gauge 944 Orthodontic Typodont Set ( With Wax Ridges And Teeth Set ) 945 Plaster Vibrator ( Worktop Area Of At Least 20 X 10 Cm, Adjustable Setting, 2 Years Warranty ) 946 Haematoxylin & Eosin Stain 947 Eosin & Negrosin Stain 948 V.G. Tube 949 Manipulation Pipette 950 Metallic Tvs Needle Guided Bracket 951 Syringe Non Rubber 1Ml 952 Granulocyte Colony Stimulating Factor 953 Pipelle Aspirator / Vabra Aspirator 954 Progesterone Gel 955 Injectable Progesterone 956 Latex Condom Without Spermicide 957 Osafe Incubator And Laminar Floor Cleaning Lotion 958 Fersafe Antiseptic Lotion 959 Liquid Nitrogen For Cryocan 960 Immunobeads Reagents ( Rabbit Anti Human Igg 961 Immunobeads Reagents ( Rabbit Anti Human Iga 962 Immunobeads Reagents ( Rabbit Anti Human Igm 963 Conical Dispo Beaker 3.0Ml 964 Prp Lens 965 Facs Tube ( 12 X 75Mm, 5Ml Round Bottom Test Tube, Snap, Sterile Cat: 352054 966 Kymograph Paper ( 100 Sheets ) 967 Perimetric Chart Paper ( 100 Sheets ) 968 Haemocytometer Box 969 Haemoglobinometer Sets 970 Dewar Tank 11 Litre 971 Cryo Pro - 500Ml ( Liquid Nitrogen Cryosurgical Equipment 972 Bulb For Telepack Lamp 973 Radiofrequency Electrode Round Loop Big 974 Radiofrequency Electrode Round Loop Small 975 Bacterial Filter Machine Sl No:101122008 976 Indirect Ophthalmoscope 977 20448-000Hgh Pressure Hose ( Erbe Cryo Unit ) ) 978 Bone Hand Drill Moore - 8448.28 979 Hand Drill Jacobs Chuck 980 Demartel Condf / Wire Sawsflex 350Mm 981 Twist Drill Set Of 3Mm, 3.5Mm 4Mm, 4.5Mm 982 Crocodile Forceps ( Ear Microsurgery ) 983 Ear Microsuction Tips 984 Adaptors For Ear Microsuction Tips 985 Cup Ear Forceps 986 Perforators For Stopedectomy 0.4Mm 987 Perforators For Stopedectomy 0.5Mm 988 Rigid Pharyngoscope ( Pediatric ) 20Cm 989 Tonsil Holding Forceps 990 Straight Pick ( Tympanyplasty ) 991 Back Biting Forceps For Endoscope Nasal Surgery 992 Fiberoptic Otoscope With Pneumatic Pump 993 Bismith Lodopyrrophosphate ( Bipp ) Paste / Powder 994 Mercurochrome Lotion 995 Haed Light Fot Ent 996 Endoscopic Biopsy Forceps With Needle 997 Cpr Manikin 998 Intubation Manikin 999 Easy Pump 1000 Mri Contrast Media - Gadoterate Meglumine Injection 5Mmmol / Ml. 10 Ml Vial 1001 Mri Contrast Media - Gadobenate Dimeglumine Injection 10Ml Vial 1002 Mri Contrast Media - Gadopentetate Dimeglumine Injection 0.5Mmol / Ml. 10 Ml Vial 1003 Mri Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5Ml 1004 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg - 50 Ml Vial 1005 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg -100Ml Vial 1006 Non -Ionic Contrast Media - Iopromide Injection: Usp 300Mg -100Ml Vial 1007 Non -Ionic Contrast Media -Iobitridol 350Mg -100Ml Vial 1008 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -50Ml Vial 1009 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -100Ml Vial 1010 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -50Ml Vial 1011 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -100Ml Vial 1012 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -50Ml Vial 1013 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -100Ml Vial 1014 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -50Ml Vial 1015 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -100Ml Vial 1016 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20Ml Vial 1017 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50Ml Vial 1018 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100Ml Vial 1019 Coupland All Nos 1020 Elevators ( Cryer ) 1 Pairs 1021 Castrovejo Scissor 1022 Samll Micro Scissor 1023 Light Cure Composite A2 1024 Light Cure Composite A3 1025 Light Cure Composite A3.5 1026 H-Files For Size ( 15-40 ) 21Mm 1027 Tooth Polishing Brush 1028 Glide 1029 Gracy Currette 1030 Polyester Braided Suture * 2 75Cm Hgs-21, Blue 37Mm 1 / 2 Circle Taper Point : Size-2 1031 Polyester Braided Suture * 2 75Cm Hos-10, Blue 26Mm 1 / 2 Circle Reserve Cutting : Size-2 1032 Polyester Braided Suture * 1 75Cm Hos 12, Blue 40Mm 1 / 2 Circle Reserve Cutting Size -1 1033 Polyester Braided Suture * 5 75Cm Hos-14, Blue 57Mm 1 / 2 Circle Reverse Cutting Size-5 1034 Polyester Braided Suture * 25X75cm Kv-37, Blue 40Mm 1 / 2 Circle Tapercutting Size-2 1035 Poleyster Braided Suture * 54X75cm Kv-40, Blue 45Mm 1 / 2 Circle Tapercutting Size-5 1036 Monofilament Knotless Polyglyconate Wound Closure Device, 0 45Cm Gs-21, Green 37Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-0 1037 Monofilament Knotless Polyglyconate Wound Closure Device, 2-0 30Cm Cm V-20, Green 26Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-2-0 1038 Monofilament Knotless Glycomer 631 Wound Closure Device, 3-0 45Cm P-14, Undyed 24Mm 3 / 8 Circle Resverse Cutting, Box Of 12 Foils Size- 3-0 1039 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 60Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1040 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 75Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1041 Polybutester Monifilament Suture With Polytribolate Coating Size-*5-0, 75Cm 2Xcv-11X36, Blue 12Mm 3 / 8 Circle Taper Point 1042 Polybutester Monofilament Suture With Polytribolate Coating Size-*4-0 90Cm 2Xcv-23X36, Blue 17Mm 1 / 2Circle Taper Point Size: 4-0 1043 Polybutester Monofilament Suture With Polytribulate Coating Size-*5-0 90Cm2xcv, Blue 17Mm 1 / 2 Circle Taper Point Size: 5-0 1044 Polybutester Moniofilament Suture With Polytribulate Coating Size-*5-0, 75Cm 2Xkv-11X36, Blue 13Mm 3 / 8 Circle Tapercutting Size: 5-0 1045 Polybutester Monofilament Suture With Polytribolate Coating Size-* 7-0, 60Cm 2Xmv-175-8, Blue 8Mm 3 / 8 Circle Taper Point Size: 7-0 1046 Polybutester Monofilament Suture With Polytribolate Coating Size-*2-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1047 Polybutester Monofilament Suture With Polytribolate Coating Size-*3-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1048 Monofilament Knotless Glycomer 631 Wound Closure Device, 2-0 23Cm , Violet 27Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size- 2-0 1049 Vaccutrend Needle / Syringe 21 X 15 1050 Vaccutrend Needle / Syringe 22 X 15 1051 Vaccutrent Needle / Syringe 1052 Immunohistochemistry: 1053 Anti Pax-5 Ffpe 1054 Anti Ebv Ffpe 1055 Anti Pan Cmv Ffpe 1056 Anti Cd 68 Ffpe 1057 Anti Wti Ffpe 1058 Anti Plap Ffpe 1059 Anti C3 Ffpe 1060 Anti Sma Ffpe 1061 Anti Ar Ffpe 1062 Anti Bc16 Ffpe 1063 Anti Myogenin Ffpe 1064 Anti Idh-1 Ffpe 1065 Anti Atrx Ffpe 1066 Anti P63 Ffpe 1067 Anti Neurofilament Ffpe 1068 Anti Cd 19 Ffpe 1069 Anti Msa Ffpe 1070 Anti Adipophylin Ffpe 1071 Anti Alk D5f3 Ffpe 1072 Anti Arginase-1 Ffpe 1073 Anti B Catenin 1074 Bcl 10 Ffpe 1075 Anti Ber-Ep4 Ffpe 1076 Anti Clauclin 4 Ffpe 1077 Anti D2 - 40 Podolanin Ffpe 1078 Anti Dog 1 Ffpe 1079 Anti Sall 4 Ffpe 1080 Anti Erg Ffpe 1081 Anti Hbmeigg4 1082 Anti Inhilein Ffpe 1083 Anti Insm 1 Ffpe 1084 Anti Mammaglobin Ffpe 1085 Mart 1 Ffpe 1086 Anti Melan A Ffpe 1087 Anti Mdm2 Ffpe 1088 Anti Napsin A Ffpe 1089 Anti P40 Ffpe 1090 Anti Pax-8 Ffpe 1091 Anti Stat-6 Ffpe 1092 Anti Tle-1 Ffpe 1093 Anti Uroplalcin-2 Ffpe 1094 Anti Glycophorin Ffpe 1095 Anti Gcet-1 Ffpe 1096 Anti Cd 38 / 138 Ffpe 1097 Anti Calcitonin Ffpe 1098 Anti Caldermon Ffpe 1099 Anti B Caldermon Ffpe 1100 Anti Cd 56 Ffpe 1101 Anti Nsm Ffpe 1102 Anti Cd 99 Mic-2 , 013 Ffpe 1103 Anti Cd 138 Ffpe 1104 Anti Cdh 17 Cadherin 17 Ffpe 1105 Anti Heparii Ffpe 1106 Anti Glypican-3 Ffpe 1107 Anti Stab 2 Ffpe 1108 Anti Hrp Polymer Kit 1109 Fitc Lambda Light Chain Immunofluorescence 1110 Fitc Igm Immunofluorescence 1111 Fitc Iga Immunofluorescence 1112 Fitc Igg Immunofluorescence 1113 Fitc C3 Immunofluorescence 1114 Mlh1, Msh2, Msh6, Pms2 ( Together ) 1115 Pdl1 Clone Sp142 1116 Egfr Clone 31G7 1117 Cdx2 1118 Gata 3 1119 Ck 18 1120 Mesothelin 1121 Glut 1 1122 Gcdfp 1123 Myb 1124 Plag 1 1125 Hmga 2 1126 Eber In-Situ Hybridization 1127 Pcr 1128 Egfr Rt Pcr Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1129 Msi Detection Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1130 Bcr-Abl1-Pcr Kit Compatible With Qiagen 1131 Fish 1132 Alk Mutation Break Apart Probe In Lung Adenocarcinoma 1133 Myb-Nfib Dual Colour Fusion Probe 1134 Myb Dual Colour Break Apart Probe 1135 Maml2 Dual Colour Break Apart Probe 1136 Etv6 Dual Colour Break Apart Rearrangement Probe 1137 Plag 1 Rearrangement Probe 1138 Hmga 2 Rearrangement Probe 1139 Immunofluorescence 1140 Anti P-Anca Direct Immunofluorescence 1141 Anti C-Anca Direct Immunofluorescence 1142 Anti Ana Direct Immunofluorescence 1143 Anti Aquaporin 4 1144 C1q 1145 Flowcytometry 1146 Cd 16 Apc 1147 Hla B27 Kit ( Should Be Compatible With Bd Facscalibur ) 1148 Elisa ( Mago-4 ) 1149 Anti P-Anca Elisa 1150 Anti C-Anca Elisa 1151 Anti Cyclic Citrulinated Peptide ( Ccp ) Elisa 1152 Anti Smith Elisa 1153 Anti Peroxiredoxin Vi ( Prx Vi ) Elisa 1154 Anti Bmi I Elisa 1155 Anti Matrix Metalloproteinase 7 ( Mmp7 ) Elisa 1156 Anti Ny Eso I 1157 Anti Scl 70 1158 Anti Urnp 1159 Chemicals And Consumables 1160 Proteinase K 1161 Pronase 1162 Fish Reagents : 1163 Poly L Lysine 1164 20X Saline Sodium Citrate ( 20X Ssc ) Salt, Molecular Grade 1165 1 M Nascn ( 1M Sodium Thiocyanate ) Salt, Molecular Grade 1166 Igepal @ Ca 630 1167 Rubber Cement 1168 Dapi 1169 Sodium Chloride ( Nacl ) , 58.44G Mol-1 Molecular Grade 1170 Sodium Citrate ( Na3c6h5o7 ) 258.06G Mol-1 Molecular Grade 1171 Fluorescence Microscopic Immersion Oil 1172 Immunofluorescence Reagents : 1173 Trypsin Powder, Molecular Grade 1174 Additional Consumables / Disposables 1175 15Mm Double Swivel With Port & Extension 1176 72 Hours Closed Ventilation Suction Catheter Must Have Double - Lumen Siliconised Catheter Swivel Connector Un-Coupling Wedge, Lockable Thumb –Valve End Cap, Softer Sleeve Material, 72 Hour Recommended During Of Use. Size: 12F, 14F, 16F 1177 Adjustable Circle Breathing System ( 2 Litre Bag, 2 Metre Length And 1.5 Metre Limb ) 1178 Adjustable Circle Breathing System ( 2 Mts Length ) 1179 Adult Curved Flared Prong With Tube1.8M Length 1180 Adult Curved Nasal Prong With Tube1.8M Length 1181 Adult Respi-Check High Concentration Oxygen Mask With Oxygen Tube 1182 Anti-Microbial Circle Breathing System ( 1.6 Metre Length And 0.8 Metre Limb ) 1183 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 1.6 Metre Length, 0.8 Metre Limb ) 1184 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 2.4 Metre Length, 0.8 Metre Limb ) 1185 Apron Cloth ( Sterile ) 1186 Attest 1292 E Biological Indicator 1187 Attest Biological Indicator ( For Styeam ) 3M 1188 Attest Rapid Auto Reader Incubator ( For Steam ) ( Early Result For Biological Test ) 1189 Balanced Salt Solution ( Bss ) 1190 Bilbao-Dotter Tube With Guide Wire 1191 Bis Electrodes 1192 Bone File 1193 Bone Ronger 1194 Bp Blade With Handle ( No 15 & 17 ) 1195 Cardiac Troponin T Kit 1196 Center Hole Towel 1197 Coban Tm 4 1198 Cols Light Source For Transillumination 1199 Contra Angle Hand Piece 1200 Disposable Face Mask ( Cloth ) 1201 Disposable Head Positioning Device For The Prone Position – Made Of Latex- Free Foam With Mirror For Providing The Clinician A Clear View Of Face, Eye & Endotrachael Tube Plus Sloted Design For Positioning Of Endotracheal On Either Side Of The Patient Face 8000Hdp 1202 Disposable Kellys Pad 1203 Ecg Monitoring Electrode ( Solid Hydrogel ) 1204 Ecg Monitoring Electrode With Foam Backing 2223 1205 Ecg Monitoring Electrode With Foam Backing Large 1206 Elastometric Infusion Pump For Analgesia 5Ml / Hour 1207 Elastometric Infusion Pump For Analgesia 2Ml / Hour Model Sv2 1208 Elevators ( Straight And Periostal ) 1209 Emergency Cricothyrotomy Device Adult 4Mm Id Children 2Mm Id 1210 Eye Wear For Composite Fillings 1211 Face Guard 1212 Fibre Splint 1213 Fluid Warming Cassette ( Disposable ) Wf-250 1214 Fluid Warming Cassette ( Disposable ) Wf-100 1215 Gigly Saw 1216 Glass Bead Sterilizer 1217 Tungsen Carbide Burs For Air Rotor And Micro Motor Hand Pieces 1218 Green Pvc Tubing For Oxygen 6 Mm, Length In Metres 1219 Iodixannol 320 Mg Iodine / Ml-100 Ml. 1220 Iohexol 300 Mg-Iodine / Ml 100 Ml 1221 Iomeron 400 Mg / Ml – 50 Ml. 1222 Ioversol / Iopamide / Iopamidol – 50 Ml. 1223 Iso Green Standard Laryngoscope System ( Disposable Plastic Blades ) 7 Sizes Of Mac And Miller Blades 1224 Jess Fixtators Pediatric / Large 1225 Jobsons Probe 1226 Kinesiology Color Tap / Taping For Orthopaedic Used 1227 Killians Nasal Speculum 1228 K-Wires: 1.8Mm 1229 K-Wires: 4Mm 1230 K-Wires: 1.5 Mm 1231 K-Wires: 2.5 Mm 1232 K-Wires: 2Mm 1233 K-Wires: 3Mm 1234 Macintosh Style Blades 2, 4 1235 Magill’S Forceps Adult Child Infant 1236 Manual Plaster Cutting Saw 1237 Manual Plaster Spreader 1238 Manual Torniquet ( Cuff & Pump ) 1239 Mayo Stand Cover 1240 Miller Style Blades 0, 1241 Miller Style Blades 1 1242 Mortar And Pestle 1243 Mouth & Cheek Retractor 1244 Mouth Mirror 1245 Mri Compatible Laryngoscopes All Sizes 1246 Mri Film 14” X 17” 1247 Neopuff ( Neonatal Resuscitator ) 1248 North Nasal Preformed Cuffed Tubecuffed Must Have Ivory Pvc Profile Soft Seal Cuff, Implantation Tested Black Intubations Depth Marker, 15Mmconnector With 1S0 5356-1 Larger Cuff Resting Diameter Size: 6To 8Mm Id & Length 27Cm To 30.5 Tips To Nares 1249 Ovarian Shield ( Kiran ) 1250 Oxygen Supply Tubing For Heat & Moisture Exchanger Oxygen Supply Tubing For Heat & Moisture Exchanger With Connector To Attach Hme For Tracheostomy Tube Length 15Cm 1251 Oxygen Analyser 1252 Oxygen Blenders 1253 Para Film Roll ( Size 10Cmx125cm ) 3 “ Dia 1254 Parafilm, Roll 1255 Perineural Catheter For Continuous Plexus And Peripheral Nerve Blocks. Content: 118 G Lacoplex Needle With Centimeter Graduation 1 Perinueral Pebax Catheter ( 0.45 X 0.85Mm – 50Cm Long ) With Centimeter Distance Markings And Open Distal Tip 1 0.22 Antibacterial Filter 1 Additional Extension Tube, 50Cm Long, 1.5 X 2.5 Mm Dia, Priming Volume 1.10Ml 1 10Ml Syringe For The Aspiration Test 1 10 X 15 Cm Dermafilm Transparent Adhesive Dressing 1256 Periostal Elevators ( Small And Big ) 1257 Winged Infusion Set- Non Coring Needles With Injection Site To Access Ports, 20G X 1.00 ( Needle ) 1258 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-7Fr, 65Cm Length ( Ped ) 1259 Hickman-Broviac 4.2Fr ( Or Smaller ) Single Lumen Pediatric Cath W Stic Papais 1260 Hickman-Broviac 6.6Fr Single Lumen Pediatric Cath W Stic 90Cm 1261 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-9Fr, 90Cm Length ( Adult ) 1262 Plaster Cutter Electric 1263 Plaster Saw 1264 Plier Long Nose 1265 Pneumatic Compression Stocking 1266 Portable Autoclave Electrically Operated Made Of Aluminium Size:300Mm X 300Mm Capacity 24 Litres 1267 Portable Autoclave Electrically Operated Made Of Aluminium Size:350Mm X 300Mm-325Mm Depth: 1.5 Kw 1268 Pyridin 1269 Reusable Pressure Monitoring Cable With Integrity Check System By 100Mmhg Pressure And With Reusable Modular Clamp 1270 Reusable Pressure Transducer With Integrity Check System By 100Mmhg Pressure, With Microchip Technology, Reusable Cable, And With Reusable Clamp 1271 Ronguers ( Down Cutter ) 1272 Ronguers ( Up Cutter ) 1273 Rubber Macintosh 1274 Russian Forceps 1275 Light Weight Hernia Mesh, Pga Polypropylene 11 X 15 1276 Light Weight Hernia Mesh, Pga Polypropylene 6 X 11 1277 Seldinger Technique Catheter For Arterial Puncture Content: 1 Transparent And Xpo Cathter ( Pe ) / ( Ptfe ) 1 Intruducer Needle 1 Straight Wire 115.092 115.094 115.118 5118.702 5118.703 1278 Self Holding Retractors For Spine Surgery 1279 Single Use Resuscitation Mask For Cpcr ( Non-Return Valve, Integral Bacterial / Viral Filter ) 1280 Slide Mailer 1 Slide 1281 Slide Mailer 2 Slide 1282 Soap Dispenser 1283 Soda Lime ( Imported ) – Changes From White To Violet On Exhaustion 5Kg 1284 Sodium Hypochloride Solution 5Litre 1285 Spreader / Plugger 1286 Steinman Pins:4.5Mm 1287 Steinmann Pins 1288 Sterigage Chemical Indicator ( For Steam ) 3M 1289 Surgical Clipper 1290 Surgical Preparation Razor 1291 Thermal Videographic Printer ( Black & White ) ( Sony, Latest Up Series ) 1292 Tissue Paper For Ultrasound 1293 Ultra Violet Cabinet ( 800 / 500 X 2000 Mm ) 1294 Vacuum Assisted Dressing System 1295 Vascular Debeky Angle ( Medium ) 1296 Vascular Debeky Straight ( Medium ) 1297 Vaseline Gauze 1298 Ventilator 15 Mm Breathing Systems ( With Luer Lock, 1.6 Metre Length And Resealable Water Trap ) For Paediatrics 1299 Ventilator Breathing System With Resealable Water Traps ( Smooth Lumen ) 1300 Waste Management Wheeled Bins. ( 660Lit ; 300Lit; 1100 Lit ) 1301 Wire Cutter 1302 Y-Pieces For Breathing Circuit 1303 Absorbable Gelatin Sponge U.S.P ( Ab-Gel ) 10 X 10 1304 Alginate Impression Materials ( Dust Free ) 1305 Double Swivel With Port 15Mm 1306 Green Pvc Tubing 6Mm For Oxygen / Per Meter 1307 2 Mm Osteotomes 1308 3 Mm Osteotomes 1309 Asepto Pump 1310 Autoclavable Biohazard Plastic Bag 10Liter 1311 Autoclavable Biohazard Plastic Bag 20Liter 1312 Autoclavable Biohazard Plastic Bag 30Liter 1313 Bone Cement ( Plain ) 1314 Bone Cement ( Antibiotics ) 1315 Bougie ( Stylet ) 1316 Burretta 1317 Capd Catheter Tenckhoff With 2 Felt Cuffs Sa 1242 ( 420 Mm ) 1318 Cast Taper Mandrel 1319 Chiesel 1320 Cleaning Brush 1321 Cleaning Solution 1322 Cpr Manikin 1323 Stoma Flatmoldable Small 45Mm 1324 Stoma Flatmoldable Medium 45Mm 1325 Stoma Flatmoldable Regular 57Mm 1326 Stoma Flatmoldable Large 70Mm 1327 Moldable Convex 12 / 22Mm 1328 Moldable Convex 22 / 33Mm 1329 Moldable Convex 33 / 57Mm 1330 Ostomy Appliance Accessories Belt 1331 Coloured Ph Indicator Paper 1332 Dissecting Instrument Box 1333 Double Swivel With Port 15 Mm X 22Mm 1334 Drape Formers Trans Femoral 1335 Drape Formers Trans Tibial 1336 Espocan With Docking System 1337 Eto Chemical Indicator Tape -3M 1338 Eto Packing Sleeves Roll ( 3M ) 12 1339 Eto Packing Sleeves Roll ( 3M ) 4 1340 Eto Packing Sleeves Roll ( 3M ) 6 1341 Surgicel Fibrillar 1963 1342 G- Bone 1343 Gloves Wrapper 1344 Laparoscopic Aspiration Needle 1345 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 3.5Mm 1346 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 4.8Mm 1347 Hose Mount 15Mm Female Male Pair 1348 Hose Mount 22Mm Female Male Pair 1349 Hygrobaby / Hme Filter ( Infant ) 1350 Hygroboy / Hme Filter ( Paediatric ) 1351 Hygrostar / Hme Filter ( Adult ) 1352 Hygrobac S 1353 Intraocular Lense 6Mm Optics Foldable, Square Edge, Hydrophobic 1354 Intraocular Lense Rigid 5.25Mm Optics, Pmma, Square Edge 1355 Intraocular Lense Rigid 5.5Mm Optics 1356 Intraocular Lense Rigid 5.5Mm Optics Foldable 1357 Intraocular Lense Rigid 6Mm Optics 1358 Intraocular Lense Rigid 6Mm Optics Foldable 1359 Intraocular Lense Rigid 6Mm Optics, Pmma, Square Edge 1360 Rigid Anterior Chamber Intraocular Lens: Lens Power +16D ( 6.00Mm ) 1361 Rigid Anterior Chamber Intraocular Lens: Lens Power +19D ( 6.00Mm ) 1362 Rigid Anterior Chamber Intraocular Lens: Lens Power +18D ( 6.00Mm ) 1363 Rigid Anterior Chamber Intraocular Lens: Lens Power +20D ( 6.00Mm ) 1364 Rigid Anterior Chamber Intraocular Lens: Lens Power +21D ( 6.00Mm ) 1365 Rigid Anterior Chamber Intraocular Lens: Lens Power +22D ( 6.00Mm ) 1366 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1367 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.5D ( 5.50Mm ) 1368 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1369 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.0D ( 5.50Mm ) 1370 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.5D ( 5.50Mm ) 1371 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.0D ( 5.50Mm ) 1372 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.5D ( 5.50Mm ) 1373 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.0D ( 5.50Mm ) 1374 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.5D ( 5.50Mm ) 1375 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.0D ( 5.50Mm ) 1376 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.5D ( 5.50Mm ) 1377 ( A ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +10.0D 6.0Mm 1378 ( B ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +113.5D 6.0Mm 1379 ( C ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+14.0D 6.0Mm 1380 ( D ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.0D 6.0Mm 1381 ( E ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.5D 6.0Mm 1382 ( F ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.0D 6.0Mm 1383 ( G ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.5D 6.0Mm 1384 ( H ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.0D 6.0Mm 1385 ( I ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.5D 6.0Mm 1386 ( J ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.0D 6.0Mm 1387 ( K ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.5D 6.0Mm 1388 ( L ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19..0D 6.0Mm 1389 ( M ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19.5D 6.0Mm 1390 ( N ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.0D 6.0Mm 1391 ( O ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.5D 6.0Mm 1392 ( P ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.0D 6.0Mm 1393 ( Q ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.5D 6.0Mm 1394 ( R ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.0D 6.0Mm 1395 ( S ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.5D 6.0Mm 1396 ( T ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+23.0D 6.0Mm 1397 ( U ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +23.5D 6.0Mm 1398 ( V ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.0D 6.0Mm 1399 ( W ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.5D 6.0Mm 1400 ( X ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.0D 6.0Mm 1401 ( Y ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.5D 6.0Mm 1402 ( Z ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+26.0D 6.0Mm 1403 Mayo Trolly Cover ( Disposable ) 1404 Membrane Assembly 1405 Micro Centrifuge Tube 1.5Ml 1406 Micro Centrifuge Tube 15Ml 1407 Micro Centrifuge Tubes-.2Ml ( With Thin Wall For Pcr ) 1408 Micro Centrifuge Tubes-.5Ml ( With Thin Wall For Pcr ) 1409 Micro Centrifuge Tubes-2Ml 1410 Microscope Bulb- 6V 20W 1411 Mini & Micropates With Screw 1412 Nasal Tubing 70Mm 1413 Needle ( Cutting ) Big 1414 Needle ( Cutting ) Medium 1415 Needle ( Cutting ) Small 1416 Needle ( Round Body ) Big 1417 Needle ( Round Body ) Medium 1418 Needle ( Round Body ) Small 1419 Non Invasive Cardiac Output Monitoring Electrode 1420 Non Invasive Cardiac Pacing Electrode 1421 Ostomy Powder 25Gm 1422 Pneumatic Compression Stocking 1423 Pressure Monitoring Kit With Three Way Disposable Pressure ( For Cvp & Atrerial ) 1424 Rae Tub 7.5 1425 Self Adhesive Urine Sample Bag - Pediatric 1426 Spirit Swabs 1427 Sterile Swab Sticks 1428 Steri-Stripes 1429 Esmarch 4 1430 Esmarch 6 1431 Polyester Synthetic Cast Padding 1432 Suction Cannula For Mtp Size Purandre 1433 Ostomy Appliance Accessories Belt 1434 Stomadress Plus Single Pouch - Opaque 1435 Activelife One Pc Drainable Pouch 1436 Tubing Kit 1437 Urianalyser 1438 Urine Control A360 1439 Ventilating Airway Bougies 1440 Ventilator Tubing W / 1 ( Venti Breathing System With Reseable Water Trap ) 1441 Y-Pieces 1442 6Mm Green Pvc Tubing For Oxygen 1443 Alpha Mattress 1444 Analspeculum Size: 25 1445 Ao Universal Clamps 1446 Baby Cradle With Mattress And Net 1447 Blood Gas Quality Control ( 30X1.7Ml ) Level 1 ( Abg ) 1448 Blood Gas Quality Control ( 30X1.7Ml ) Level 2 ( Abg ) 1449 Blood Gas Quality Control ( 30X1.7Ml ) Level 3 ( Abg ) 1450 Bone Cutter 1451 Bone Cutter Big Size 1452 Centrifuge Tube 1453 Centrifuge Tubes, Polypropylene Seal With Capacity 3.5 - 10 Ml 1454 Clavicular Braces 1455 Cider Wood Oil 1456 Debakey’S Bull Dog Clamps, Curved 115Mm ( 4 ½” ) Long 1457 Debakey’S Bull Dog Clamps, Curved 70Mm ( 2 ¾” ) Long 1458 Debakey’S Bull Dog Clamps, Curved 80Mm ( 3 ?” ) Long 1459 Debakey’S Bull Dog Clamps, Straight 120Mm ( 4 ¾” ) 1460 Debakey’S Bull Dog Clamps, Straight 75Mm ( 3” ) 1461 Debakey’S Bull Dog Clamps, Straight 85Mm ( 3 ?” ) 1462 Divided Mattress 1463 Dropper Bottle 250Ml 1464 Dropper Bottle 500Ml 1465 Dropper P.P. 6 Long 1466 Npwt Dressing Kit 1467 Silicone Rubber Heel Cups 1468 Electrodes For Ift ( For Combination Therapy-Ultra Sound Therapy + Electrical Stimulator ) ( Make: Enraf Nonius Sonoplus 491 ) 1469 Episiotomy Scissor Size 15Cm 1470 Fixation Ring ( 904-898 ) 1471 Fixation Ring ( 904-898 ) For Transcutaneous Po2 / Pco2 ( Make: Radiometer, Model: Tcm 40 ) 1472 Fluid Warmer 1473 Fogging Machine 1474 G-Bone 1475 Gigly Saw 1476 Ginevri Capillary Tube ( H ) ( Microbillimeter ) 1477 Glover With Atraumatic Jaws, Curved Jaws, 85Mm ( 3 ?” ) , 45Mm Jaws 1478 Hand Drill 1479 Hand Wash Basin Stand ( Double ) . - Five Legs Base Mounted On 5Cms Dia Castors With One 35Cm S.S Basin.Pre Treated And Epoxy Powder Coated. 1480 Hysterectomy Clamp ‘Faure’ 1481 I.V. Drip Stand 1482 Intra Uterine Cannula ‘Collins’ Plain 3 Size 1483 Intra Uterine Cannula ‘Hayes Provis’ With Rubber Cone 1484 Kidney Wash Machine ( Renatron Ii ) 1485 Knee Immobilizer Oc 2035 1486 Knee Immobilizer Oc 2035 1487 Knee Stabilizer-Dc 2069 1488 Leishmans Stain 1489 Lengenback Retractor 1490 Lengenback Retractor 1491 Lens Cleaning Paper 1492 Lymph Node 1493 Magnet For Ecg 1494 Malleable Stylets With Adjustable Stop, Different Size 1495 Measuring Tape 1496 Measuring Tape ( Clinical ) 1497 Microscope ( For Side Lab ) - Binocular Electric Light Microscope 1498 Molina Sheet 1499 Mosquito Net ( Single Use Patient Specific, Plastic ) 1500 Mouth Gag 1501 Myoma Screw ‘Doyen’ 1502 Na+ - Sensor Casing ( Abg ) 1503 Non Invasive Glucose Monitoring System ( Glucometer ) 1504 Ounce Glass Steel 1505 Oxygen Cylinder Stand / Trolley - B Type 1506 Pad Electrodes For Swd ( Dx 500 Roland ) 1507 Paper Roll ( Abg ) 1508 Patient Breathing Set Infant Reusable ( Galileo Gold ) 1509 Patient Cable For Ift / Mst ( Make / Model: Multidyne 965 ) 1510 Patient Shifting Trolleys With The Facility Of Oxygen Cylinder Carrier 1511 Pelvic Traction Kit With Pulley And Weight 1512 Pile Binder 1513 Plastic Dropping Bottle ( 120Ml ) 1514 Plastic Small Tube 1515 Raos Hand Suction Unit 100 Ml 1516 Ref. - Membrane Shell ( Abg ) 1517 Resucitation Kits Automatics 1518 Resuscitation Kit Emergency 1519 Resuscitation Kit For Neonates 1520 Rubber Sole - 4Mm 1521 Sample Detector 1522 Screw Driver 1523 Sealing Rings 1524 Set Tubing For Roller Pump ( Reagents ) ( Abg ) 1525 Shin Tube Cutting Jig 30Mm 1526 Shin Tube Cutting Jig 35Mm 1527 Short Needle Holder 1528 Side Support ( Meditrin ) 1529 Silicon Tubal Ring 1530 Solid Waste Containers Liners 1531 Solution Valve 1532 Spare Canvas Bag 1533 Spare Lamp For Opthalmoscope 1534 Spare Parts For: Easylyte, 911 , 912 & Others 1535 Spirit Lamp 1536 Stich Scissor 1537 Suture Anchor ( Orthopaedics ) 1538 Syringe Infusion Pump 1539 T- Handle For Orthopaedics 1540 Tailor Thread 1541 Tco2 Sensor 1542 Teleys Forcep 1543 Vortex Mixer 1544 Vulsellum Forceps 1 X 1 Teeth 25Cm 1545 Wire Cutter 1546 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure ) 1547 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Low Pressure ) 1548 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene. 1549 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure With Bacterial Resistance ) 1550 Manual Hub Cutter – With Biohazard Symbol And Which Can Cut The Plastic Hub And Not The Metal Needle With Temporary And Permanent Locking Mechanism On Complete Filling Of The Disposal Hub Cutter With Clear Demarcation Of Fill Line And Which Can Accomadate Upto 400-600 Needles. 1551 Cerebral Reservior ( Omaya Type ) 1552 Extranal Ventricular Drainage Syatem 1553 Lumbar Extranal Drainage System 1554 Poly Propylene Mesh ( Small ) For Duroplasty 1555 Poly Propylene Mesh ( Medium ) For Duroplasty 1556 Poly Propylene Mesh ( Large ) For Duroplasty 1557 G Bone Cement ( For Cranioplasty ) 1558 Kraniotomy Drape 1559 Iodine Drape Large 1560 Balanced Salt Solution With Na / K / Mg & Chloride Levels Similar To Plasma With Acetate & Gluconate / Malate As Buffer, Must Not Contain Calcium ( Eg.Plasmalyte A / Volulyte Etc ) 1561 Bactiseal Impregnated Shunt - Fda Approved, Fixed Pressure Vp Shunts ( Low, Medium, High ) That Are Antibiotic Impregnated And Can Reduce The Potential For Bacterial Colonization In The Lumen As Well As Its Outer Surface. 1562 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1563 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1564 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1565 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1566 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1567 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1568 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1569 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1570 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1571 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1572 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1573 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1574 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1575 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1576 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1577 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1578 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1579 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1580 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1581 Raneys Scalp Disposable Clips - Disposable Raneys Clips 1582 Cranioplasty Kit - Cranioplasty Kit, Sterile, Pack Of Two Packets Of Methyl Methacrylate And Two Vials Of Liquid. 1583 Universal Extremity Drape- Control Plus Fabric, Us Fda Certified 1584 Impervious Split Sheet- 60 X 70, 4 X 21 Split, Polyethylene Sheet, Us Fda Certified 1585 U-Bar-Pack- 1 Back Table Cover-Reinforced 44 X 88, 1 Mayo Stand Cover Reinforced 23 X 54, 1 Suture Bag, 1U Drape 71 X 124, 1 Bar Drape 71 X 124, 1 Bar Drape 41.5 X 82, Us Fda Certified 1586 Back Table Cover Zone Reinforced- 44 X 99, Us Fda Certified 1587 Impervious Stockinette-12 X 58, Uds Fda 1588 Fluid Shield Mask With Visor -Four Layer Mask, Water Resistant With Water Resistant, -Naosh, Osha Approved 1589 Hip Drape With Leg Pockets -Control Plus Fabric, Us Fda Approved 1590 Hip Drape Without Leg Pockets -Control Plus Fabric, Us Fda Approved 1591 Quattro Fx -Full Face Mask Vented 1592 Mirage Fx- Nasal Mask Vented 1593 Transmission Electron Microscope 1594 G011 / 2 Glut Em 25% Amps 1595 Self Closing Tweezer ( Biology ) T-403 1596 O001 Osmium Tetroxide 1597 Eukitt Mouning Media 1598 Taab Araldite 502 / 812 Kit ( E2o2 ) 1599 Dibutyl Phthalate 1600 E069 Embedding Mould Flat C 1601 Z10 Molecular Seive 3Nm For Drying Acetone 1602 Shaving Razor Blade 1603 300 Mesh Cu Grid With Thin Carbon Film ( Cu - 300Cn 1604 300M Mesh Cu Grid With Holey / Dbl Carbon Film ( Cu-300Hd 1605 G062 Grid Storage Box 1606 U007 Uranyl Acetate 1607 L018 Lead Citrate 1608 Truf 2208-100 1609 Octagon Magnetic Stirrer Bar ( 4151 ) 1610 Consumables 1611 Micro Tips ( 10Micro Litre ) 1612 Microcentrifuge Tube

Corrigendum

Sr No Corrigendum Date Corrigendum Type New Submission Date
1 20-Jan-2020 Extension Date 21-Feb-2020
2 13-Feb-2020 Date Extensionn2 Date 05-Mar-2020
3 03-Mar-2020 Extension2 Date 17-Apr-2020
4 10-Nov-2020 Date Extension November Date 04-Dec-2020
5 27-Nov-2020 Amendment Fee 04-Dec-2020

BOQ

Description of Stores /Items: Open e-Tender for processing of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, etc for the Institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later.
Sl.No.Item DescriptionItem Code / MakeQuantityUnits
11.01AlbuminItem11per ml
21.02MicroalbuminItem21per ml
31.03Gamma Glutamyl TranferaseItem31per ml
41.04(??- GGT)Item41per ml
51.05AmylaseItem51per ml
61.06LipaseItem61per ml
71.07CKItem71per ml
81.08CK-MBItem81per ml
91.09LDHItem91per ml
101.1Total CholesterolItem101per ml
111.11TriglycerideItem111per ml
121.12HDLItem121per ml
131.13LDLItem131per ml
141.14CalciumItem141per ml
151.15CopperItem151per ml
161.16PhosphorusItem161per ml
171.17ZincItem171per ml
181.18ParameterItem181per ml
191.19IronItem191per ml
201.2TIBCItem201per ml
211.21ADAItem211per ml
221.22ADA CalibratorItem221per ml
231.23G-6-PDItem231per ml
241.24Glycosylated HbItem241per ml
251.25Glycosylated Hb CalibratorItem251per ml
261.26CRPItem261per ml
271.27CRP CalibratorItem271per ml
281.28a-1 Acid GlycoproteinItem281per ml
291.29AmmoniaItem291per ml
301.3LactateItem301per ml
311.31Glutathione PeroxidaseItem311per ml
321.32Superoxide dismutaseItem321per ml
331.33Total Antioxidant StatusItem331per ml
341.34HomocysteineItem341per ml
351.35ASOItem351per ml
361.36RFItem361per ml
371.37Lipoprotein (a)Item371per ml
381.38Lipoprotein (a) CalibratorItem381per ml
391.39TransferrinItem391per ml
401.4Cystatin CItem401per ml
411.41GentamycinItem411per ml
421.42BarbituratesItem421per ml
431.43Valproic AcidItem431per ml
441.44PhenitoinItem441per ml
451.45VMAItem451per ml
461.46GalactosemiaItem461per ml
471.47CalcitoninItem471per ml
481.48CalcitriolItem481per ml
491.49GalactokinaseItem491per ml
501.5Galactose-1-phosphate uridyl transferaseItem501per ml
511.51ReninItem511per ml
521.52ACTHItem521per ml
531.53Interleukin 1Item531per ml
541.54Interleukin 4Item541per ml
551.55Interleukin10Item551per ml
561.56Leukotrine A4Item561per ml
571.57Leukotrine B4Item571per ml
581.58Leukotrine C4Item581per ml
591.59Leukotrine D4Item591per ml
601.6Leukotrine E4Item601per ml
611.61TNFaItem611per ml
621.62CephalosporinItem621per ml
631.63Serum tryptaseItem631per ml
641.64Urine fluorideItem641per ml
651.65Anti-dsDNA AntibodyItem651per ml
661.66Anti nuclear antibodyItem661per ml
671.67Anti-sm AntibodyItem671per ml
681.68Sodium carbonateItem681per gm
691.69Potassium Dihydrogen PhosphateItem691per gm
701.7Potassium Dihydrogen Phosphate KH2PO4 (HPLC grade)Item701per gm
711.71Creatinine powderItem711per gm
721.72Isopropyl alcohol, AR GradeItem721per ml
731.73Acetone – AR grade AR gradeItem731per ml
741.74Ammonium chloride –AR grade,Item741per gm
751.75Ammonium nitrate – AR grade,Item751per gm
761.76Ammonium persulphate – AR grade,Item761per gm
771.77Calcium chloride dihydrade – AR grade,Item771per gm
781.78Dinitro phenyl hydrazine AR grade,Item781per gm
791.79Magnesium chloride – AR grade,Item791per gm
801.8Magnesium sulfate –AR grade,Item801per gm
811.81Methanol – Acetone free – HPLC grade,Item811per ml
821.82Methanol (HPLC grade)Item821per ml
831.83Potassium dichromate – AR grade,Item831per gm
841.84Silver nitrate – AR grade,Item841per gm
851.85Sodium bicarbonate – AR grade,Item851per gm
861.86Sodium acetate dehydrate –AR grade,Item861per gm
871.87Ammonium acetate – AR grade,Item871per gm
881.88Thio semi carbazide – AR grade,Item881per gm
891.89Ethidium bromide soln 10ml– Biotechnology grade,Item891per ml
901.9Guanidium iso thiocyanate – Biotechnology grade,Item901per gm
911.91IPTG AR grade,Item911per gm
921.92100 bp DNA ladder 1 ml X 5Item921per gm
931.93Taq Polymerase with PCR buffer 3-5 U/µl, 1000 U per vialItem931per gm
941.94dNTPs 100 millimolar eachItem941per ml
951.95EcoRI restriction enzyme 0.5 ml X 1Item951per ml
961.96BamHI 0.5 ml X 1Item961per ml
971.97HinDIII 0.5 ml X 1Item971per ml
981.98DNA ligase 0.5 ml X 1Item981per ml
991.99DNA extraction kit(column based) for 50 extractionItem991per ml
1002RNA extraction kit(column based) for 20 extractionItem1001per ml
1012.01Plasmid extraction kit(column based) for 50 extractionItem1011per ml
1022.02Oligo nucleotide primers (HPLC purification)Item1021per ml
1032.03RNAlaterItem1031per ml
1042.04DEPC mol bio gradeItem1041per ml
1052.05Nuclese KItem1051per ml
1062.06Milipore Prefiltrate Kit CartridgeItem1061pc
1072.07Milipore Proguard 2 Pack Cat. No. PROG0002Item1071pc
1082.08Milipore Q Guard 1 Cat. No. QGARD00R1Item1081pc
1092.09Milipore Tank Vent Filter Cat. No. TANKMPK01Item1091pc
1102.1Milipore Sanitization Tablet Cat. No. ZWCL01F50Item1101pc
1112.11Millipore millicare Elix cat no JMBM01747Item1111pc
1122.12Millipore Quantum Ex cat. No- QTUM000ExItem1121pc
1132.13MX cart 5 micronItem1131pc
1142.14MX cart 1 micronItem1141pc
1152.15RO cartridgeItem1151pc
1162.16Non sterile millipak 40Item1161pc
1172.17Progard TS 2Item1171pc
1182.181 micron filterItem1181pc
1192.193 micron filterItem1191pc
1202.2MX cartridge 5 µmItem1201pc
1212.2120 '' carbon cartridgeItem1211pc
1222.22Sanitization tabletsItem1221pc
1232.23PM kitItem1231pc
1242.24XL wash solutionItem1241per ml
1252.25200-1000 µl microtipsItem1251pc
1262.26100-200 µl microtipsItem1261pc
1272.275-50 µl microtipsItem1271pc
1282.281-5 ml microtipsItem1281pc
1292.29200-1000 µl micropipetteItem1291pc
1302.3100-200 µl micropipetteItem1301pc
1312.315-50 µl micropipetteItem1311pc
1322.322-20 µl micropipetteItem1321pc
1332.33Microcentrifuge tube 1.5mlItem1331pc
1342.34Ammonium persulphate ARItem1341per gm
1352.35Potassium iodate (KIO3)Item1351per gm
1362.36Toluene ARItem1361per ml
1372.37Arsenous acid(As2O3)Item1371per ml
1382.38Arsenic trioxideItem1381per ml
1392.39Ceric ammonium sulphateItem1391per gm
1402.420bp DNA ladderItem1401pc
1412.41TRIS – base AR gradeItem1411per gm
1422.42Fok I & NlaIII restriction enzymeItem1421pc
1432.43DNA loading bufferItem1431pc
1442.44DNA sample loading dyeItem1441pc
1452.45Ethiduim bromideItem1451pc
1462.46Primer (Both forward & reverse)Item1461pc
1472.4710 X TBEItem1471pc
1482.48Heparinised vialItem1481pc
1492.49Disposable syringeItem1491pc
1502.5Microwave ovenItem1501pc
1512.51Glucose kitItem1511per kit
1522.52Bilirubin KitItem1521per kit
1532.53G6-PD kitItem1531per kit
1542.54VacutainerItem1541pc
1552.55Disposable syringeItem1551pc
1562.56Cystatin C kitItem1561per kit
1572.57Bilirubin KitItem1571per kit
1582.58Creatinine kitItem1581per kit
1592.59AST kitItem1591per kit
1602.6ALT kitItem1601per kit
1612.61ISE wash 2 solutionItem1611per ml
1622.62ISE cal-3 solutionItem1621per ml
1632.63ISE cal -4 solutionItem1631per ml
1642.64Microcentrifuge tube 2mlItem1641pc
1652.65SP kitItem1651per kit
1662.66Rep prep solutionItem1661per ml
1672.67Sample applicatorItem1671pc
1682.68Disposable sample cupItem1681pc
1692.69ASTItem1691per test
1702.7ALTItem1701per test
1712.71CreatinineItem1711per test
1722.72AlbuminItem1721per test
1732.73GlucoseItem1731per test
1742.74GGTItem1741per test
1752.75BUNItem1751per test
1762.76HDL cholesterolItem1761per test
1772.77LDL cholesterolItem1771per test
1782.78CholesterolItem1781per test
1792.79UIBCItem1791per test
1802.8RF RTG latexItem1801per test
1812.81CRPItem1811per test
1822.82Uric acidItem1821per test
1832.83TriglycerideItem1831per test
1842.84ALPItem1841per test
1852.85Total bilirubinItem1851per test
1862.86IgGItem1861per test
1872.87Direct bilirubiunItem1871per test
1882.88IgMItem1881per test
1892.89ProteinItem1891per test
1902.9IgAItem1901per test
1912.91PhosphorusItem1911per test
1922.92C3Item1921per test
1932.93CalciumItem1931per test
1942.94CK-MBItem1941per test
1952.95LipaseItem1951per test
1962.96ASOItem1961per test
1972.97IronItem1971per test
1982.98C4Item1981per test
1992.99AmylaseItem1991per test
2003CKItem2001per test
2013.01Acid phosphataseItem2011per test
2023.02TransferrinItem2021per test
2033.03LDHItem2031per test
2043.04MagnessiumItem2041per test
2053.05HB-DHItem2051per test
2063.06HaptoglobinItem2061per test
2073.07LactateItem2071per test
2083.08MicroalbuminItem2081per test
2093.09Microalbumin calibratorItem2091per test
2103.1CholinesteraseItem2101per test
2113.11Urine CSF proteinItem2111per test
2123.12Wash solutionItem2121per ml
2133.13Cleaning solutionItem2131per ml
2143.14Cleaning solution weekly washItem2141per ml
2153.15CRP latex calibratorItem2151per test
2163.16Urine calibratorItem2161per test
2173.17System calibratorItem2171per test
2183.18HDL calibratorItem2181per test
2193.19LDL calibratorItem2191per test
2203.2CRP calibratorItem2201per test
2213.21RF calibratorItem2211per test
2223.22CK-MB calibratorItem2221per test
2233.23Xl-300/600 cuvetteItem2231pc
2243.24Beckman coulter AU 2700 cuvettesItem2241pc
2253.25Xl-300/600 LampItem2251pc
2263.26Beckman coulter AU 2700 lampItem2261pc
2273.27EQAS (Bio-Rad)Item2271per test
2283.28ApoA1 & ApoB reagent & calibratorItem2281per test
2293.29Bio-Rad lipid conrolItem2291per test
2303.3Ethylene Glycol (EthandiolItem2301pc
2313.31Methylene Soluble (working ReagentItem2311pc
2323.32Tissue Capsule BigItem2321pc
2333.33Tissue Capsule SmallItem2331pc
2343.34Tissue Cassettes BigItem2341pc
2353.35Tissue Cassettes SmallItem2351pc
2363.36Stock Phloxine BItem2361pc
2373.37Progesterone ReceptorItem2371pc
2383.38ANA Kit for SLE (Indirect Immunoflurescence Method)Item2381per test
2393.39Hb/Cayanaid Method standardItem2391pc
2403.4Nalidixid 10ugItem2401per disc
2413.41Netilmycin 10ugItem2411per disc
2423.42Furozotidime 30ugItem2421per disc
2433.43Antigen and antibody HCV ELISA test kitsItem2431per test
2443.44Cell counter reagentsItem2441pc
2453.45(Machine available is ABX pentra which is a closed system)Item2451per gm
2463.46Reagent for APTTItem2461per test
2473.47Calcium Chloride for APTT estimationItem2471per test
2483.48Control plasma NItem2481per test
2493.49Reaction tubeItem2491per test
2503.5CA CLEANItem2501per test
2513.51OWRENS Veronal bufferItem2511per test
2523.52Standard Human PlasmaItem2521per test
2533.53Sodium Azide (NaN3)Item2531per test
2543.54Bovine thrombinItem2541per test
2553.551000 NIH units/ mg of proteinItem2551per test
2563.56Anti DCEItem2561per test
2573.57Sc(1)Item2571per test
2583.58Sc(2)Item2581per test
2593.59Sc(3)Item2591per test
2603.6Yt(a)Item2601per test
2613.61Yt(b)Item2611per test
2623.62Do(a)Item2621per test
2633.63Do(b)Item2631per test
2643.64PYR BrothItem2641per gm
2653.65PYR -Pyrolidonyl-ß naphthylamineItem2651per test
2663.66ParadimethylaminobenzaldehydeItem2661per ml
2673.67P-dimethylaminocinamaldehydeItem2671pc
2683.68p-nitrophenylglycerolItem2681pc
2693.69Potassium TeluriteItem2691pc
2703.7Potassium Cyanide (KCN)Item2701per gm
2713.71Para dimethyl aminobenzaldehydeItem2711per ml
2723.72Potassium hydroxideItem2721per gm
2733.73Potassium Hydrogen SulphateItem2731per gm
2743.74Phenol Crystal (powder)Item2741per gm
2753.75Phosphate Buffer SalineItem2751per ml
2763.76Phenethyl alcoholItem2761per ml
2773.77Phenol red indicatorItem2771per ml
2783.78Phenol red indicatorItem2781per gm
2793.79Phenol redItem2791per gm
2803.8Phenylpyruvic acid ReagentItem2801pc
2813.81Potassium dichromate LRItem2811per gm
2823.82Potassium permanganate LRItem2821per gm
2833.83Potassium permanganate ARItem2831per gm
2843.84Potassium Phosphate monobasicItem2841per gm
2853.85Potassium NitrateItem2851per gm
2863.86Phenol (Crystal)Item2861per gm
2873.87PeptoneItem2871per gm
2883.88Raffinose ARItem2881per gm
2893.89RhammnoseItem2891per gm
2903.9Sodium/ Potassium DichromateItem2901pc
2913.91Sodium citrateItem2911per ml
2923.92Sodium Pyruvate ARItem2921per gm
2933.93Sodium Biocarbonate LRItem2931per gm
2943.94Sodium acetateItem2941per gm
2953.95Sodium IodideItem2951per gm
2963.96Sulphanilamine-ARItem2961per gm
2973.97Sugar assimilation disc – CellobioseItem2971pc
2983.98Sugar assimilation disc – DextroseItem2981pc
2993.99Sugar assimilation disc – DulcitolItem2991pc
3004Sugar assimilation disc – GalactoseItem3001pc
3014.01Sugar assimilation disc – InositolItem3011pc
3024.02Sugar assimilation disc – LactoseItem3021pc
3034.03Sugar assimilation disc – MaltoseItem3031pc
3044.04Sugar assimilation disc – MelibioseItem3041pc
3054.05Sugar assimilation disc - RaffinoseItem3051pc
3064.06Sugar assimilation disc- SucroseItem3061pc
3074.07Sugar assimilation disc – TrehaloseItem3071pc
3084.08Sugar assimilation disc - XyloseItem3081pc
3094.09Salicin ARItem3091per gm
3104.1Tarric AcidItem3101per gm
3114.11Trehalose ArItem3111per gm
3124.12TriypticaseItem3121per gm
3134.13ThiosulphateItem3131per ml
3144.14Tri-Sodium CitrateItem3141per gm
3154.15Voges proskaeur reagentItem3151pc
3164.16Vibriostatic (0/129) AgentItem3161per ml
3174.17Wright’s StainItem3171per gm
3184.18Xylose ARItem3181per gm
3194.19Vibrio cholerae-01 3mlItem3191per ml
3204.2Vibrio cholerae-0139 3mlItem3201per ml
3214.21Vibrio cholerae-Ogawa 3mlItem3211per ml
3224.22Vibrio cholerae-Inaba 3mlItem3221per ml
3234.23Salmonella Polyvalent O 3mlItem3231per ml
3244.24Salmonella Polyvalent H 3mlItem3241per ml
3254.25Salmonella Polyvalent O2 3mlItem3251per ml
3264.26Salmonella Polyvalent O4 3mlItem3261per ml
3274.27Salmonella Polyvalent O9 3mlItem3271per ml
3284.28Salmonella Polyvalent H Phase I a 3mlItem3281per ml
3294.29Salmonella Polyvalent H Phase Ib 3mlItem3291per ml
3304.3Salmonella Polyvalent H Phase Ic 3mlItem3301per ml
3314.31Salmonella Polyvalent H Phase Ii 3mlItem3311per ml
3324.32Shigella Polyvalent dysenteriae 3mlItem3321per ml
3334.33Shigella Polyvalent flexnerii 3mlItem3331per ml
3344.34Shigella Polyvalent sonnei 3mlItem3341per ml
3354.35Shigella Polyvalent boydii 3mlItem3351per ml
3364.36Cryptococcus antigen detection kit (latex Agglutination detection)Item3361per test
3374.37Antigen detection kit for Meningitis (H influenza b, N meningitis A & C, S. pneumonia, GBS, E.coli)Item3371per test
3384.38Amphotericin PowderItem3381per gm
3394.39Benzal Pennicillin PowderItem3391per gm
3404.4Cefoxitin 5gm/vialItem3401vial
3414.41Clindamycin PowderItem3411per gm
3424.42Ciprofloxacin 5gm/vialItem3421vial
3434.43Erythromycin PowderItem3431per gm
3444.44Gentamicin 5gm/vialItem3441vial
3454.45Imipenem 5gm/vialItem3451vial
3464.46Oxacillin 5gm/vialItem3461vial
3474.47Vancomycin 5gm/vialItem3471vial
3484.48Anidulafungin (0.015-128µg/ml)Item3481per strip
3494.49Ceftriaxone (0.016-256 ug /ml.)Item3491per strip
3504.5Ciprofloxacin (0.001-8ug / ml.)Item3501per strip
3514.51Ceftazidime+ Clavulanate(0.004-128ug / ml.)Item3511per strip
3524.52Clindamycin E-test (0.016-256 µg/ml)Item3521per strip
3534.53Colistin (0.06-0.25µg/ml)Item3531per strip
3544.54Caspofungin (0.015-128µg/mlItem3541per strip
3554.55Doripenem(0.002-32 µg/ml)Item3551per strip
3564.56Ertapenem (0.002-32 µg/ml)Item3561per strip
3574.57Fluconazole (0.016-256 µg/ml)Item3571per strip
3584.58Imipenem(0.004-128ug / ml.)Item3581per strip
3594.59Levofloxacin (0.001-8ug / ml.)Item3591per strip
3604.6Meropenem (4-256 µg/ml)Item3601per strip
3614.61Meropenem/EDTA (1-64 µg/ml)Item3611per strip
3624.62Moxifloxacin (0.001-8ug / ml.)Item3621per strip
3634.63Candida albicans ATCC 14053Item3631vial
3644.64Candida guilliermondii ATCC 6260Item3641vial
3654.65Candida Psedotropicalis TCC 4135Item3651vial
3664.66Corynebacterium diptheriae ATCC 13812 VialItem3661vial
3674.67Escherichia coli ATCC 25922 VialItem3671vial
3684.68Escherichia coli ATCC 35218 VialItem3681vial
3694.69Enterococcus faecalis ATCC 29212 VialItem3691vial
3704.7Haemophilus influenzae ATCC-49766 VialItem3701vial
3714.71Pseudomonas aeruginosa ATCC 27853 VialItem3711vial
3724.72Positive Control for T.B. (My.TB H37rv strain)Item3721vial
3734.73Staphylococcus aureus ATCC 25923 VialItem3731vial
3744.74Streptococcus pneumoniae ATCC 49619 VialItem3741vial
3754.75Staphylococcus aureus ATCC 33591 VialItem3751vial
3764.76Salmonella enterica subspecies enterica serovar cholerasuis ATCC-10708 VialItem3761vial
3774.77Salmonella enterica subspecies enterica serovar paratyphi A ATCC-9150 VialItem3771vial
3784.78Salmonella enterica subspecies enterica serovar typhimurium ATCC-25241 VialItem3781vial
3794.79Shigella flexneri ATCC- 9199 VialItem3791vial
3804.8AST for GNB AST –N280Item3801per test
3814.81Media for Pediatric Sample -259794,BACT/ALERT PFItem3811per test
3824.82Media for Aerobic Sample – 259791, BACT/ALERT FAItem3821per test
3834.83Solution for Inoculum Preparation – V1204, 3x500 mlItem3831per test
3844.84Tubes for Inoculum Preparation - 69285(unsensitised tube)Item3841per test
3854.85Identification of Fermentes and Non-ferments – 21341(GN TEST KIT VTK)Item3851per test
3864.86DNA ladder / molecular weight marker size range : 100 to 1200 bp (50µg)Item3861per test
3874.87DNA Extraction kitItem3871per test
3884.88Deoxynucleotide triphosphate (dNTP) mixtureItem3881per test
3894.89Anaerogas pack (5 nos/pack)Item3891pc
3904.9Autoclavable Biohazard plastic bag: size 10 ltr 10ltrItem3901pc
3914.91Anaerobic Blood Culture bottle – Adult (50/ pack)Item3911pc
3924.92Anaerobic Blood Culture bottle – Paediatric (50/ pack)Item3921pc
3934.93Anaerobic System Rubber RingItem3931pc
3944.94Anaero Indicator Tablet RT (1x10/pkt)Item3941pc
3954.95Autoclavable Plastic Vial Flat Bottom,screw capped 11.5 mm x53 mm.Item3951pc
3964.96Craigie’s tubeItem3961pc
3974.97Durham's tube 25 x 6 mmItem3971pc
3984.98Durham's tube 37x 6 mmItem3981pc
3994.99Embading Cassette 1x1000/boxItem3991pc
4005Kline Concavity Slides 75x56x3 mm thick & 12 concavity code GW097Item4001pc
4015.01Microtips (Autoclavable) with box (96’s/pack) 0.1ul - 20µlItem4011pc
4025.02Microtips (Autoclavable) with box (96’s/pack) 2ul - 200µlItem4021pc
4035.03Microtips (Autoclavable) with box (96’s/pack) 50ul - 1000µlItem4031pc
4045.04Microtips (Autoclavable) 0.1ul - 20µlItem4041pc
4055.05Microtips (Autoclavable) 2ul - 20ulItem4051pc
4065.06Microtips (Autoclavable) 5ul-50ulItem4061pc
4075.07Microtips (Autoclavable) 20ul-200ulItem4071pc
4085.08Microtips (Autoclavable) 200ul-1000ulItem4081pc
4095.09Microtips-1000 ulItem4091pc
4105.1Microtips-5000 ulItem4101pc
4115.11Microtitre plate with round bottom wells 96wellsItem4111pc
4125.12Microtitre plate with detachable wells 96wellsItem4121pc
4135.13Micro centrifuge Autoclavable Plastic Tubes with cap 2mlItem4131pc
4145.14Micro centrifuge Autoclavable Plastic Tubes with cap 5mlItem4141pc
4155.15Micro centrifuge Autoclavable Plastic Tubes with cap 10mlItem4151pc
4165.16Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. Capacity 30mlItem4161pc
4175.17Museum Jar, With Cover 160x110x60mmItem4171pc
4185.18Museum Jar, With Cover 170x130x210 mmItem4181pc
4195.19Screw capped tubes 20x150mmItem4191pc
4205.2Serum vials sample storage box & stand for 3ml capacityItem4201pc
4215.21Sample Container -Wide mouth bottle,125ml Autoclavable (Polypropylene) 125mlItem4211pc
4225.22Storage vials (autoclavable) 2mlItem4221pc
4235.23Teasing Needles for mouldsItem4231pc
4245.24Test Tube Stand - Test -tube size - 25mm diametreItem4241pc
4255.25Test Tube Stand - test -tube size - 16mm diametreItem4251pc
4265.26Test Tube Stand - Test-tube size - 10mm diametreItem4261pc
4275.27Test tube basket, largeItem4271pc
4285.28Test tube basket, smallItem4281pc
4295.29Test tube rack to accommodate 3 ml. test tubes 5X15Item4291pc
4305.3Test tube rack to accommodate 5 ml. test tubes 5X15Item4301pc
4315.31Test tube racks:4 x 13Item4311pc
4325.32Test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes)Item4321pc
4335.33Test Tube Carrier (stainless steel)Item4331pc
4345.34V.D.R.L. Slides (75mmx50mm 1.45mm)Item4341pc
4355.35Wash bottle plastic with delivery Nozzle 200mlItem4351pc
4365.36Wash bottle plastic with delivery Nozzle 60mlItem4361pc
4375.37Bunsen burnerItem4371pc
4385.38Bacteriological loop holder with loop (ready to use)Item4381pc
4395.39Biological indicator for steamItem4391pc
4405.4Bowie DickTest Pack SteamItem4401pc
4415.41Ice box 5 litresItem4411pc
4425.42Labels for Micro centrifuge tubes white Size ½”Item4421pc
4435.43Metaloops (Changeable Nichrome loop embedded in Brass rod with heat resistant handle with-Item4431pc
4445.44a. 2 mm diameter Nichrome wireItem4441pc
4455.45b. 3 mm diameter Nichrome wireItem4451pc
4465.46c. 4 mm diameter Nichrome wireItem4461pc
4475.47Metaloops (Fixed straight Nichrome loop embedded in SS rod with heat resistant handle with-Item4471pc
4485.48Microtome KnifeItem4481pc
4495.49MopsItem4491pc
4505.5Magnifying glass, big size with handleItem4501pc
4515.51Mortar - PestleItem4511pc
4525.52Nichrome loop-4 mmItem4521pc
4535.53Nichrome loop-2 mmItem4531pc
4545.54Nichrome loop-1.3 mmItem4541pc
4555.55Pipette stand( vertical & horizontal) 4/5 pipettesItem4551pc
4565.56Staining rack. 20 slide capacity.Item4561pc
4575.57Sprit Lamp glass/ metalItem4571pc
4585.58Screwdrivers -multipurposeItem4581pc
4595.59Silver aluminium foilItem4591pc
4605.6Surgical Knife (Big)Item4601pc
4615.61Sterile swab sticksItem4611pc
4625.62Syringe driven filters PTFE (hydrophilic) pore size 0.22µmItem4621pc
4635.63Thermometer 37degree CItem4631pc
4645.64TwineItem4641pc
4655.65Universal collection vials (Urine pot)Item4651pc
4665.66Universal Wash Reagents 500mlItem4661pc
4675.67Anti-CD 56Item4671per ml
4685.68Anti-61Item4681per ml
4695.69Anti-CD 68Item4691per ml
4705.7Anti-CD 33Item4701per ml
4715.71Anti-Ki 67 (Mib)Item4711per ml
4725.72Anti Neurofilament ProteinItem4721per ml
4735.73Anti-SynaptophysinItem4731per ml
4745.74Anti-GFAPItem4741per ml
4755.75Anti-CD 99Item4751per ml
4765.76Anti-CD 31Item4761per ml
4775.77Anti-B HCGItem4771per ml
4785.78Poly-L.LysineItem4781per ml
4795.79Anti-CD 20 (B cells)Item4791per ml
4805.8Anti-CD 45 (LCA)Item4801per ml
4815.81Anti-S 100Item4811per ml
4825.82Anti- DesminItem4821per ml
4835.83Anti-C-erb B-2 (Her-L/Neu)Item4831per ml
4845.84Anti-ERItem4841per ml
4855.85Anti-PRItem4851per ml
4865.86Anti-CD 3Item4861per ml
4875.87Anti-CD 20Item4871per ml
4885.88Anti-CD 117Item4881per ml
4895.89Anti-CD 34Item4891per ml
4905.9Anti-CD 30Item4901per ml
4915.91Anti-Cyclin D1Item4911per ml
4925.92Anti-CD 15Item4921per ml
4935.93Anti-CD 5Item4931per ml
4945.94FITC-Conjugated RabbitItem4941per ml
4955.95Anti-Human IgA (alpha chain)Item4951per ml
4965.96FITC-Conjugated RabbitItem4961per ml
4975.97Anti-Human IgG (Gamma chain)Item4971per ml
4985.98FITC-Conjugated RabbitItem4981per ml
4995.99Anti-Human Kappa Light chainItem4991per ml
5006FITC-Conjugated RabbitItem5001per ml
5016.01Anti-Human C3c ComplementItem5011per ml
5026.02FITC-Conjugated RabbitItem5021per ml
5036.03Anti-Human IgM (Mu chain)Item5031per ml
5046.04FITC-Conjugated RabbitItem5041per ml
5056.05Anti-Human Lambda (Light chain)Item5051per ml
5066.06ANA by Hep-2-cell-line substrate(kit with reagents)Item5061pc
5076.07Electrodes for µpH System 361Item5071pc
5086.08Osmium TetroxideItem5081pc
5096.09Chromium trioxideItem5091pc
5106.1Zinc ChlorideItem5101pc
5116.11Di-Sodium hydrogen phosphate anhydrousItem5111per gm
5126.12Di-Sodium hydrogen Orthophosphate DibasicItem5121per gm
5136.13Sodium dihydrogen orthophosphate monohydrateItem5131per gm
5146.14Sodium borateItem5141per gm
5156.15Alpha napthyl butyrateItem5151per gm
5166.16Anti-CISH kits-HPV16/18DNAItem5161per ml
5176.17ER/P-R controlItem5171per ml
5186.18Anti-Melanomal(HMB45)Item5181per ml
5196.19Anti MyeloperoxidaseItem5191per ml
5206.2Anti -NSEItem5201per ml
5216.21Anti-PLAPItem5211per ml
5226.22Anti-bc12 oncoproteinItem5221per ml
5236.23Anti-Cytokeratin7Item5231per ml
5246.24Anti-Cytokeratin20Item5241per ml
5256.25Anti-BRCA 1ProteinItem5251per ml
5266.26Anti-IgAItem5261per ml
5276.27Anti-IgMItem5271per ml
5286.28Anti-IgGItem5281per ml
5296.29Anti-compliment CD3Item5291per ml
5306.3Anti-Rb gene proteinItem5301per ml
5316.31Anti-P53 proteinItem5311per ml
5326.32Anti-WT1 turmorItem5321per ml
5336.33Anti-Vimentin (V9)Item5331per ml
5346.34Anti-EMA(E29)Item5341per ml
5356.35Anti-p169INK4)Item5351per ml
5366.36KappaItem5361per ml
5376.37LamdaItem5371per ml
5386.38Eosine spirit solubleItem5381per ml
5396.39PAP Pen Immuno histochemistryItem5391per ml
5406.4Anti-CD 1aItem5401per ml
5416.41Anti-SMAItem5411per ml
5426.42Anti-MyogeninItem5421per ml
5436.43Fluorescent bchiff reagentItem5431per ml
5446.44CarmineItem5441per ml
5456.45AcriffarineItem5451per ml
5466.46Cresyl fast blueItem5461per ml
5476.47Luxol fast blueItem5471per ml
5486.48Cresyl violetItem5481per ml
5496.49Epinephrine (3x0.5ml)Item5491pc
5506.5Aggrecetion ristocetion A Sulfate (3x0.5ml)Item5501pc
5516.51A D P(Adenosine-5l Diphosphate(3x0.5ml)Item5511pc
5526.52Arachidonic acid lyohillzed sodium ArachidonateItem5521pc
5536.53Collagen Soluble Calfskin(3x0.5ml)Item5531pc
5546.54Vw Fator Assay ristocetin cofactor (3x0.5ml)Item5541pc
5556.55Test tube( siliconized,flate bottom 7x25x55mm)Item5551pc
5566.56Stri Bars plastic coaled MICROItem5561pc
5576.57Cryo Glue (Tissue Embedding Medium)for Cryostat MachineItem5571pc
5586.58Diposables blades for Cryostat MachineItem5581pc
5596.59Silicon Tubal RingItem5591pc
5606.6Laser SpectaclesItem5601pc
5616.61Fluid WarmerItem5611pc
5626.62Filter for Suction Machine( Atmos)Item5621pc
5636.63NIBP Monitor with integrated cuff armItem5631pc
5646.64Serum ZincItem5641per ml
5656.65CopperItem5651per ml
5666.66CeruloplasminItem5661per ml
5676.67AmmoniaItem5671per ml
5686.68AmmoniaItem5681per ml
5696.69AlcoholItem5691per ml
5706.7D- DimerItem5701per ml
5716.71Anti ds DNAItem5711per ml
5726.72Anti sn AntibodyItem5721per ml
5736.73Vitamin DItem5731per ml
5746.74Vitamin EItem5741per ml
5756.75NGALItem5751per ml
5766.76Cystatin CItem5761per ml
5776.77G6 PDItem5771per ml
5786.78LactateItem5781per ml
5796.79Apo A1Item5791per ml
5806.8HomocysteineItem5801per ml
5816.81BNPItem5811per ml
5826.82Urinary VMAItem5821per ml
5836.83Blood ketonesItem5831per ml
5846.84Lip aItem5841per ml
5856.85ANAItem5851per ml
5866.86Anti phospholipid antibodyItem5861per ml
5876.87Vitamin CItem5871per ml
5886.88ENAItem5881per ml
5896.89Vitamin KItem5891per ml
5906.9IodineItem5901per ml
5916.91APO BItem5911per ml
5926.92Troponin TItem5921per ml
5936.93CK MB1Item5931per ml
5946.94CK MB 2Item5941per ml
5956.95TIBCItem5951per ml
5966.96TransferrinItem5961per ml
5976.97IgGItem5971per ml
5986.98IgMItem5981per ml
5996.99IgAItem5991per ml
6007Inhibin AItem6001per ml
6017.01ß trace proteinItem6011per ml
6027.02?eta 2 microgobulinItem6021per ml
6037.03Alpha 1 AntitrypsinItem6031per ml
6047.04a -1 MicroglobulinItem6041per ml
6057.05a-2 MacroglobulinItem6051per ml
6067.06Screening kit for inborn error of metabolismItem6061per ml
6077.07EQAS for clinical chemistry,Immunoassay, electrolyte, HbA1C.Item6071per ml
6087.08TPO (Thyroperoxidase) antibodyItem6081per ml
6097.09Control for M-band electrophoresisItem6091per ml
6107.1TNF-aItem6101per ml
6117.11IL-2Item6111per ml
6127.12ProcalcitoninItem6121per ml
6137.135'ACAGCGTCATGGCAGAGCAGGTGGC3’Item6131per ml
6147.145'AAAAGCTCTTCCCGCAGGATCCCGC3’Item6141per ml
6157.155'GTGGCTGTTCCGGGATGGCCTTCTG3’Item6151per ml
6167.165'CTTGAAGAAGGGCTCACTCTGTTTG3’Item6161per ml
6177.175'CAGTACGATGATGCAGC3’Item6171per ml
6187.185'CAGGTAGAAGAGGCGGT3’Item6181per ml
6197.19amikacin ,neomycin &Item6191per ml
6207.2tobramycin standard (HPLC grade)Item6201per ml
6217.21EDTA gel (15%)Item6211Per gm
6227.22Acrylic - Heat cure-clearItem6221Pc
6237.23Acrylic - Heat cure-pinkItem6231Pc
6247.24Acrylic - Self cure-clearItem6241Pc
6257.25Acrylic - Self cure-pinkItem6251Pc
6267.26Agate SpatulaItem6261Pc
6277.27Alginate impression material ( Dustless)Item6271Pc
6287.28Articulation paperItem6281Pc
6297.29Bur - Airotor-DiamondItem6291Pc
6307.3Bur - Airotor-TC- straight fissureItem6301Pc
6317.31Calcium Hydroxide paste for root canalItem6311Pc
6327.32Dappen dishItem6321Pc
6337.33Dental Floss – waxed, 25 mItem6331Pc
6347.34Dental StoneItem6341Pc
6357.35Dentin bonding agentItem6351Pc
6367.36Die stoneItem6361Pc
6377.37Disposable Suction Tips with copper wireItem6371Pc
6387.38Emery Sheet - 100, 150 and 400 GradeItem6381Pc
6397.39Endodontic Gutta Percha Points(15-80)Item6391Pc
6407.4Etchant gel ( 37 % Phosphoric Acid)Item6401Pc
6417.41Fiber Composite splintItem6411Pc
6427.42Flexible Composite polishing discsItem6421Pc
6437.43FormocresolItem6431Pc
6447.44GIC- High strength pacakable for posteriorsItem6441Pc
6457.45Glass Ionomer Cement Type IItem6451Pc
6467.46Glass Ionomer Cement Type IIItem6461Pc
6477.47Gluma Dentin DesensitizerItem6471Pc
6487.48Gutta Percha SticksItem6481Pc
6497.49Halogen bulbs- 12V, 55 WItem6491Pc
6507.5Hydroxyapatite Bone graft MaterialItem6501Pc
6517.51K File - all sizesItem6511Pc
6527.52Light cure composite - Flowable - All shadesItem6521Pc
6537.53Light cure composite - nano-hybrid – all shadesItem6531Pc
6547.54Modelling wax sheet no.2Item6541Pc
6557.55Non Eugenol Impression Paste - standard packItem6551Pc
6567.56Pinnacle tracing sticks ( minimum three years shelf life)Item6561Pc
6577.57Polishing brush for dental latheItem6571Pc
6587.58Polymer Reinforced Zinc oxide Eugenol cementItem6581Pc
6597.59Pumice powder for polishing denturesItem6591Pc
6607.6Silver reinforced Glass IonomerItem6601Pc
6617.61Supernal Base PlateItem6611Pc
6627.62Tissue conditioner ( Soft reliner)Item6621Pc
6637.63Ultrasonic scaler tipItem6631Pc
6647.64Vacuum formed sheets - Soft and hard - 2 and 3mmItem6641Pc
6657.65Vulcanite Trimmer ( TC)Item6651Pc
6667.66Zinc oxide Eugenol impression pasteItem6661Pc
6677.67Self Cure Acrylic Tooth Colour Temporary Crown Materials (Powder & Liquid)Item6671Pc
6687.68Cold - Cure Acrylic Powder With Liquid (White Colour)Item6681Pc
6697.69Pits and Fissure SealantItem6691Pc
6707.7Zinc oxide Eugenol impression pasteItem6701Pc
6717.71IRM (Intermediate Restorative Materials)Item6711Pc
6727.72GIC Fuji Tupe IXItem6721Pc
6737.73GIC Type -II Restoative MaterialsItem6731Pc
6747.74Light Cure Composite Nano- Filling MaterialsItem6741Pc
6757.75Alginate impression material ( Dustless)Item6751Pc
6767.76Dental StoneItem6761Pc
6777.77WedgesItem6771Pc
6787.78Miracle Mix MaterialsItem6781Pc
6797.79Hand Piece LubricantItem6791Pc
6807.8DycalItem6801Pc
6817.81Suction TipsItem6811Pc
6827.82Acrylic Teeth SetItem6821Pc
6837.83Polishing PasteItem6831Pc
6847.84Polishing Rubber Cups and BristleItem6841Pc
6857.85Disposable GlassItem6851Pc
6867.86Abrasive Strips for Polishing Proximal Areas of TeethItem6861Pc
6877.87Cellophene Matrix Strips for LC RestorationItem6871Pc
6887.88Applicator Tips for LCItem6881Pc
6897.89Desensitizing VarnishItem6891Pc
6907.9Burs For Tooth Reduction SetItem6901Pc
6917.91Dental stone cutting Burs (Small Size)Item6911Pc
6927.92H-Files for Both Anterior and PosteriorItem6921Pc
6937.93K- File for Both Anterior and PosteriorItem6931Pc
6947.94BroachesItem6941Pc
6957.95Reamers for Both Anterior and PosteriorItem6951Pc
6967.96Gutta PerchaItem6961Pc
6977.97Absorbant Paper PointItem6971Pc
6987.98Titanium Post (All Sizes)Item6981Pc
6997.99Protapper Gutta Parcha All SizeItem6991Pc
7008AlveogelItem7001Pc
7018.01RC CAL (Intra Canal Dressing Paste)Item7011Pc
7028.02Fiber Optics Air Rotor Hand Pieces with Coupling UnitItem7021Pc
7038.03GP CutterItem7031Pc
7048.04Tungsten Carbide Burs For Air Rotor and Micro Motor HandPiecesItem7041Pc
7058.05Sectional MatrixsItem7051Pc
7068.06Metal CrownItem7061Pc
7078.07Zinc oxide powder and eugenol (Big Size)Item7071Pc
7088.08Zinc oxide eugenol (Powder )Item7081Pc
7098.09Zinc oxide eugenol (Liquid)Item7091Pc
7108.1Zinc oxide eugenol (ready mix)Item7101Pc
7118.11ZnO Impression pasteItem7111Pc
7128.12Dycal CementItem7121Pc
7138.13Stone burs (all sizes and shape)Item7131Pc
7148.14Stone burs for polishing (fine)Item7141Pc
7158.15Composit polishing discItem7151Pc
7168.16Composite CementItem7161Pc
7178.17Composite filling kitItem7171Pc
7188.18Composite finishing and polishingItem7181Pc
7198.19Composite polishing discItem7191Pc
7208.2Composite polishing kitItem7201Pc
7218.21Composite polishing pasteItem7211Pc
7228.22Endo Wash 5% 450mlItem7221Pc
7238.23Bristle Brush & CupItem7231Pc
7248.24Eugenol 15mlItem7241Pc
7258.25Eugenol 110mlItem7251Pc
7268.26DPI SelfcureItem7261Pc
7278.27Ketac MolarItem7271Pc
7288.28NT PremiumItem7281Pc
7298.29One Coat BondItem7291Pc
7308.3GIC LC (Mini) GCItem7301Pc
7318.31PIVO Crown & Bridge KitItem7311Pc
7328.32Protaper Hand Kit 21/25mmItem7321Pc
7338.33Mouth Mith Handle (GDC)Item7331Pc
7348.34Explorer (GDC)Item7341Pc
7358.35Surgical scissor (BRP)Item7351Pc
7368.36DPI AlloyItem7361Pc
7378.37Tri HawkItem7371Pc
7388.38Glyde 3mlx1Item7381Pc
7398.39GP F4-F5 (Dentsply)Item7391Pc
7408.4GP (15/35/40 ) DentsplyItem7401Pc
7418.41Dtech EtchnItem7411Pc
7428.42H File 15/20/25Item7421Pc
7438.43Matrix Band No1Item7431Pc
7448.44Diamond BurItem7441Pc
7458.45Shofu Crown & Bridge KitItem7451Pc
7468.46VitrebondItem7461Pc
7478.47AH 26Item7471Pc
7488.48Ketac SilverItem7481Pc
7498.49API Needle HolderItem7491Pc
7508.5NSK Push Button Airotor HandpieceItem7501Pc
7518.51Apex Locator Pixi DentsplyItem7511Pc
7528.52Lightcure Michine ColteneItem7521Pc
7538.53Sealer Machine with PouchItem7531Pc
7548.54Scaller Tips SatellecItem7541Pc
7558.55Ultrasonic CleanerItem7551Pc
7568.56Smart BursItem7561Pc
7578.57Anti Fog Mouth MirrorItem7571Pc
7588.58Flouride Solution with ApplicatorItem7581Pc
7598.59Luting CementItem7591Pc
7608.6Silicon Base Impression MaterialsItem7601Pc
7618.61Base Putty Impression MaterialsItem7611Pc
7628.62Light Body Impression MaterialsItem7621Pc
7638.63Re CapItem7631Pc
7648.64DVI SelfItem7641Pc
7658.65Propopar Band Kit 21/25mlItem7651Pc
7668.66GHOFU Crown & Bridge KitItem7661Pc
7678.67ALT 26Item7671Pc
7688.68APL Needle HolderItem7681Pc
7698.69Giyote 3mlItem7691Pc
7708.7IA File 15/20/25Item7701Pc
7718.71OtechItem7711Pc
7728.72Flowable Composite ShadeItem7721Pc
7738.73Plastic Filling InstrumentsItem7731Pc
7748.74Cement SpatulaItem7741Pc
7758.75Cement CondenserItem7751Pc
7768.76Ball Burnisher (API)Item7761Pc
7778.77Extraction Forcept for Pedo (set of 16)Item7771Pc
7788.78TweezerItem7781Pc
7798.79Diamond Round BurItem7791Pc
7808.8Diamond Straight Fissure BurItem7801Pc
7818.81Diamond Cone Shape BurItem7811Pc
7828.82Contra Angle Hand PieceItem7821Pc
7838.83Paper point (15-40 & 45-80)Item7831Pc
7848.84Flamed Shaped Diamond Bur (All Sizes)Item7841Pc
7858.85Spoon ExcavatorItem7851Pc
7868.86Cold Mold SealItem7861Pc
7878.87Pain OffItem7871Pc
7888.88Shade GuideItem7881Pc
7898.89Coe- PackItem7891Pc
7908.9Apexit PlusItem7901Pc
7918.91Fibre Post (yellow, red , blue)Item7911Pc
7928.92Gingival Retraction CordItem7921Pc
7938.93Spreader /Plugger (all sizes)Item7931Pc
7948.94Disposable NapkinItem7941Pc
7958.95Crown Cutting KitItem7951Pc
7968.96Elevators (straight and periostal)Item7961Pc
7978.97Extraction Forcept for pedo adult (set of 14)Item7971Pc
7988.98G-coat PlusItem7981Pc
7998.99Protemp with tips and gunItem7991Pc
8009GIC Type IXItem8001Pc
8019.01Durable Flouride Releasing CoatingItem8011Pc
8029.02Light Curing nano ionomer restorativeItem8021Pc
8039.03Remin pro (protective dental cream)Item8031Pc
8049.04Chair Bulbs (ocero Infinity)Item8041Pc
8059.05Cold cure (pink) powderItem8051Pc
8069.06Cold cure (White) powderItem8061Pc
8079.07Cold Cure LiquidItem8071Pc
8089.08Green SticksItem8081Pc
8099.09MercuryItem8091Pc
8109.1Disposable Patient ApronItem8101Pc
8119.11Bobe CutterItem8111Pc
8129.12Bobe rongerItem8121Pc
8139.13Bone fileItem8131Pc
8149.14Mought Prod ChainItem8141Pc
8159.15Macet/HammerItem8151Pc
8169.16Amalgam CondenserItem8161Pc
8179.17Amalgam carrierItem8171Pc
8189.18Amalgam CurverItem8181Pc
8199.19Wax KnifeItem8191Pc
8209.2Wire CutterItem8201Pc
8219.21PlierItem8211Pc
8229.22Rubber dam KitItem8221Pc
8239.23Crown removerItem8231Pc
8249.24Micromotor drill bitsItem8241Pc
8259.25Compo RollerItem8251Pc
8269.26GP HolderItem8261Pc
8279.27Surgical MicromotorItem8271Pc
8289.28Periodontal ProbeItem8281Pc
8299.29Acrylic Mixing JarItem8291Pc
8309.3Air PolisherItem8301Pc
8319.31S.S. Inter maxillary fixation Screws 2.0mm - 12-14mmItem8311Pc
8329.32S.S. Inter maxillary fixation Screws 2.5mm - 12-14 mmItem8321Pc
8339.33Titanium cranial microplates (0.5mm plate thickness)10-18hole straightItem8331Pc
8349.34Titanium mandible miniplates (1mm plate thickness) 4 hole with bar/gapItem8341Pc
8359.35Titanium mandible miniplates (1mm plate thickness) 10-12hole straightItem8351Pc
8369.36Titanium midfacial miniplates (0.5-0.6mm plate thickness) L plate 90 degree long 4 hole with bar/gap Right sideItem8361Pc
8379.37Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 90 degree Long 4 hole with bar/gap left side.Item8371Pc
8389.38Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree short 4 hole with bar/gap Right sideItem8381Pc
8399.39Titanum Mid Facial Miniplates (0.5-0.6mm plates thickness) L plate 100-110 degree short 4 hole with bar/ gap Left sideItem8391Pc
8409.4Titannium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree long 4 hole with bar/gap Right sideItem8401Pc
8419.41Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree Long 4 hole With bar/gap Left sideItem8411Pc
8429.42Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 4 hole With bar/gapItem8421Pc
8439.43Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 6 hole with bar/gap .Item8431Pc
8449.44Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 10 holeItem8441Pc
8459.45Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) T Plates 5 holesItem8451Pc
8469.46Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Y plate 4 holesItem8461Pc
8479.47Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Double Y plate 4 holesItem8471Pc
8489.48Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) X plate 5 holesItem8481Pc
8499.49Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Straight plate 10-12 holesItem8491Pc
8509.5Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 12-16 holesItem8501Pc
8519.51Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 20-25 holesItem8511Pc
8529.52Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 12-16 holesItem8521Pc
8539.53Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 20-25 holesItem8531Pc
8549.54Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 12-16 holesItem8541Pc
8559.55Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 20-25 holesItem8551Pc
8569.56Titanium double angled Reconstruction plates (2-2.4mm plate thickness) 20-25 holesItem8561Pc
8579.57Titanium Cranial ( outer diameter 1.0-1.2 mm) non self drilling screw- 4-6 mm lengthItem8571Pc
8589.58Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -6mm lengthItem8581Pc
8599.59Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -8 mm lengthItem8591Pc
8609.6Titanium midfacial (outer diameter 1.8/1.9mm) non self- drilling emergency screw -6 mm lengthItem8601Pc
8619.61Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -6mm lengthItem8611Pc
8629.62Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -8mm lengthItem8621Pc
8639.63Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -6mm lengthItem8631Pc
8649.64Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -8 mm lengthItem8641Pc
8659.65Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling screw -10mm lengthItem8651Pc
8669.66Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling Maxi screw -12mm lengthItem8661Pc
8679.67Titanium Reconstruction (2.4mm) non self- drilling Maxi Emergency screw -8-20mm lengthItem8671Pc
8689.68Titanium Lag Screws non self drilling ( outer diameter 2.4/2.5 mm)- 15-20mm lengthItem8681Pc
8699.69Drill bit with 6mm stop for Titanium cranial (1.0/1.2mm,1.0 mm pilot hole diameter) non self- drilling screwItem8691Pc
8709.7Drill bit with 6mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screwItem8701Pc
8719.71Drill bit with 8mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screwItem8711Pc
8729.72Drill bit with 6mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screwItem8721Pc
8739.73Drill bit with 8mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screwItem8731Pc
8749.74Drill bit with 10-12mm stop for Titanium (2.4mm reconstruction, pilot hole diameter 2mm) non self-drilling screwItem8741Pc
8759.75Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 4x4 cmsItem8751Pc
8769.76Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 6x6 cmsItem8761Pc
8779.77Titanium Mesh for mandible (0.5-0.6mm thickness) approx. dimension 10x8 cmsItem8771Pc
8789.78Titanium orbital reconstruction mesh plates- SmallItem8781Pc
8799.79Titanium orbital reconstruction mesh plates- MediumItem8791Pc
8809.8Titanium orbital reconstruction mesh plates- Large ( with medial and lateral wall extensions)Item8801Pc
8819.81Porous Polyethylene Orbital sheets ( 0.8-1.5 mm thickness; 5x5 cms approx)Item8811Pc
8829.8226 guage Stainless Steel wire spoolItem8821Pc
8839.8332 guage Stainless Steel wire spoolItem8831Pc
8849.84Raney Clips Stainless SteelItem8841Pc
8859.85022 slot MBT Brackets with weldable convertible UTLD first molar Buccal tubes and NC II molar tubesItem8851Pc
8869.86Crimpable hooksItem8861Pc
8879.87016 Multistranded SS wireItem8871Pc
8889.88Preformed Archwire - 014 NiTi U/ LItem8881Pc
8899.89Preformed Archwire - 016 NiTi U/ LItem8891Pc
8909.9Preformed Archwire - 016 x 022 SS – U/LItem8901Pc
8919.91Preformed Archwire - 017 x 025 SS– U /LItem8911Pc
8929.92Preformed Archwire - 019 x 025 SS – U / LItem8921Pc
8939.93Orthodontic stoneItem8931Pc
8949.94Dunaform – soft and hard sheets- 2mm, 3mmItem8941Pc
8959.95Dental SurgeryItem8951Pc
8969.96Mouth Mirror with HandleItem8961Pc
8979.97Mouth mirrorItem8971Pc
8989.98Dental probeItem8981Pc
8999.99Periodontal probeItem8991Pc
90010Dental Explorer ( Curved and pigtail)Item9001Pc
90110.01Glass Bead SterilizerItem9011Pc
90210.02Airotor handpiece - Mini-head (2 years warranty)Item9021Pc
90310.03Medesy/Hu Friedy Maxillary Anterior Extraction forcepsItem9031Pc
90410.04Medesy/Hu Friedy Maxillary Reed's Extraction forcepsItem9041Pc
90510.05Medesy/Hu Friedy Maxillary Premolar Extraction forcepsItem9051Pc
90610.06Medesy/Hu Friedy Maxillary Molar Extraction forceps Right/LeftItem9061Pc
90710.07Medesy/Hu Friedy Maxillary Bayonet Extraction forcepsItem9071Pc
90810.08Medesy/Hu Friedy MaxillaryThird molar Extraction forcepsItem9081Pc
90910.09Medesy/Hu Friedy Mandibular Anterior Extraction forcepsItem9091Pc
91010.1Medesy/Hu Friedy Mandibular premolar Extraction forcepsItem9101Pc
91110.11Medesy/Hu Friedy Mandibular molar Extraction forcepsItem9111Pc
91210.12Medesy/Hu Friedy Warwick James Elevator-StraightItem9121Pc
91310.13Medesy/Hu FriedyWarwick James Elevator-Right/LeftItem9131Pc
91410.14Medesy/Hu FriedyCryer's Elevator-Small size- Right/LeftItem9141Pc
91510.15Medesy/Hu FriedyCryer's Elevator-Medium size- Right/LeftItem9151Pc
91610.16Medesy/Hu FriedyCryer's Elevator- Large Size-Right/leftItem9161Pc
91710.17Double angled Currette- Medium sizeItem9171Pc
91810.18Double angled Currette- Large sizeItem9181Pc
91910.19Molt's Perisoteal ElevatorItem9191Pc
92010.2Freer Periosteal ElevatorItem9201Pc
92110.21Walsham's nasal Forceps- PairItem9211Pc
92210.22Asche Septal ForcepsItem9221Pc
92310.23Hayton's Williams maxillary forcepsItem9231Pc
92410.24Rowe's zygomatic elevatorItem9241Pc
92510.25Sigmoid Notch retractor (Left/Right)Item9251Pc
92610.26Ramal RetractorItem9261Pc
92710.27wire cutterItem9271Pc
92810.28wire twisterItem9281Pc
92910.29Coronoid retractorItem9291Pc
93010.3Mastoid self retaining retractorItem9301Pc
93110.31Mandibular Lower Border retractorItem9311Pc
93210.32Condylar retractorItem9321Pc
93310.33Dingmann retractor ( Adult)Item9331Pc
93410.34Vestibular retractorItem9341Pc
93510.35Swallow Tail retractorItem9351Pc
93610.36Curved Pterygoid osteotome 8mmItem9361Pc
93710.37Curved Pterygoid osteotome 10mmItem9371Pc
93810.38Epker Osteotome 4mm/6mm/8mm CurvedItem9381Pc
93910.39Epker Osteotome 4mm/6mm/8mm Straight with markingItem9391Pc
94010.4Orthodontic model boxesItem9401Pc
94110.41Tongue Guard - MediumItem9411Pc
94210.42Dontrix gaugeItem9421Pc
94310.43Extraoral Force gaugeItem9431Pc
94410.44Orthodontic Typodont set ( With wax ridges and teeth set )Item9441Pc
94510.45Plaster Vibrator (Worktop area of at least 20 X 10 cm, adjustable setting, 2 years warranty)Item9451Pc
94610.46Haematoxylin & Eosin StainItem9461Pc
94710.47Eosin & Negrosin stainItem9471Pc
94810.48V.G. TubeItem9481Pc
94910.49Manipulation PipetteItem9491Pc
95010.5Metallic TVS Needle Guided BracketItem9501Pc
95110.51Syringe Non Rubber 1mlItem9511Pc
95210.52Granulocyte colony stimulating factorItem9521Pc
95310.53Pipelle Aspirator/Vabra AspiratorItem9531Pc
95410.54Progesterone gelItem9541Pc
95510.55Injectable ProgesteroneItem9551Pc
95610.56Latex Condom without spermicideItem9561Pc
95710.57Osafe Incubator and Laminar Floor Cleaning LotionItem9571Pc
95810.58Fersafe Antiseptic LotionItem9581Pc
95910.59Liquid Nitrogen for CryocanItem9591Pc
96010.6Immunobeads Reagents( Rabbit Anti Human IgGItem9601Pc
96110.61Immunobeads Reagents( Rabbit Anti Human IgAItem9611Pc
96210.62Immunobeads Reagents( Rabbit Anti Human IgMItem9621Pc
96310.63Conical Dispo Beaker 3.0mlItem9631Pc
96410.64PRP LensItem9641Each
96510.65FAC's Tube (12 x 75mm, 5ml Round Bottom Test Tube, snap, sterile Cat: 352054Item9651Each
96610.66Kymograph Paper (100 sheets)Item9661Each
96710.67Perimetric Chart Paper (100 sheets)Item9671Each
96810.68Haemocytometer BoxItem9681Each
96910.69Haemoglobinometer setsItem9691Each
97010.7Dewar Tank 11 litreItem9701Each
97110.71CRYO PRO - 500ml (Liquid Nitrogen Cryosurgical EquipmentItem9711Each
97210.72Bulb for Telepack LampItem9721Each
97310.73Radiofrequency Electrode Round Loop BigItem9731Each
97410.74Radiofrequency Electrode Round Loop SmallItem9741Each
97510.75Bacterial Filter Machine sl No:101122008Item9751Each
97610.76Indirect OphthalmoscopeItem9761Each
97710.7720448-000Hgh Pressure Hose(Erbe Cryo Unit))Item9771Each
97810.78Bone hand Drill Moore - 8448.28Item9781Each
97910.79Hand Drill Jacobs ChuckItem9791Each
98010.8Demartel Condf/Wire Sawsflex 350mmItem9801Each
98110.81Twist Drill Set of 3mm, 3.5mm 4mm, 4.5mmItem9811Each
98210.82Crocodile Forceps (Ear Microsurgery)Item9821Each
98310.83Ear Microsuction TipsItem9831Each
98410.84Adaptors for Ear Microsuction TipsItem9841Each
98510.85Cup Ear ForcepsItem9851Each
98610.86Perforators for Stopedectomy 0.4mmItem9861Each
98710.87Perforators for Stopedectomy 0.5mmItem9871Each
98810.88Rigid Pharyngoscope (pediatric) 20cmItem9881Each
98910.89Tonsil Holding ForcepsItem9891Each
99010.9Straight Pick (Tympanyplasty)Item9901Each
99110.91Back Biting Forceps for Endoscope Nasal SurgeryItem9911Each
99210.92Fiberoptic Otoscope with Pneumatic PumpItem9921Each
99310.93Bismith lodopyrrophosphate (BIPP) Paste/PowderItem9931Each
99410.94Mercurochrome LotionItem9941Each
99510.95Haed Light fot ENTItem9951Each
99610.96Endoscopic Biopsy Forceps with NeedleItem9961Each
99710.97CPR ManikinItem9971Each
99810.98Intubation ManikinItem9981Each
99910.99Easy PumpItem9991Each
100011MRI Contrast Media - Gadoterate Meglumine Injection 5mmmol /ml. 10 ml vialItem10001vial
100111.01MRI Contrast Media - Gadobenate Dimeglumine Injection 10ml vialItem10011vial
100211.02MRI Contrast Media - Gadopentetate Dimeglumine Injection 0.5mmol/ml. 10 ml vialItem10021vial
100311.03MRI Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5mlItem10031vial
100411.04Non -Ionic Contrast Media - Iopromide Injection: USP 370mg - 50 ml vialItem10041vial
100511.05Non -Ionic Contrast Media - Iopromide Injection: USP 370mg -100ml vialItem10051vial
100611.06Non -Ionic Contrast Media - Iopromide Injection: USP 300mg -100ml vialItem10061vial
100711.07Non -Ionic Contrast Media -Iobitridol 350mg -100ml vialItem10071vial
100811.08Non -Ionic Contrast Media -Iomeprol Injection 300mg -50ml vialItem10081vial
100911.09Non -Ionic Contrast Media -Iomeprol Injection 300mg -100ml vialItem10091vial
101011.1Non -Ionic Contrast Media -Iomeprol Injection 350mg -50ml vialItem10101vial
101111.11Non -Ionic Contrast Media -Iomeprol Injection 350mg -100ml vialItem10111vial
101211.12Non -Ionic Contrast Media -Iomeprol Injection 400mg -50ml vialItem10121vial
101311.13Non -Ionic Contrast Media -Iomeprol Injection 400mg -100ml vialItem10131vial
101411.14Non -Ionic Contrast Media -Iopamidol Injection 370mg -50ml vialItem10141vial
101511.15Non -Ionic Contrast Media -Iopamidol Injection 370mg -100ml vialItem10151vial
101611.16Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20ml vialItem10161vial
101711.17Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50ml vialItem10171vial
101811.18Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100ml vialItem10181vial
101911.19COUPLAND ALL NOSItem10191vial
102011.2ELEVATORS (CRYER) 1 PAIRSItem10201vial
102111.21CASTROVEJO SCISSORItem10211vial
102211.22SAMLL MICRO SCISSORItem10221vial
102311.23LIGHT CURE COMPOSITE A2Item10231vial
102411.24LIGHT CURE COMPOSITE A3Item10241vial
102511.25LIGHT CURE COMPOSITE A3.5Item10251vial
102611.26H-FILES FOR SIZE (15-40) 21MMItem10261vial
102711.27TOOTH POLISHING BRUSHItem10271vial
102811.28GLIDEItem10281vial
102911.29GRACY CURRETTEItem10291vial
103011.3Polyester braided suture * 2 75cm HGS-21, Blue 37mm 1/2 circle Taper Point : size-2Item10301pc
103111.31Polyester braided suture * 2 75cm HOS-10, Blue 26mm 1/2 circle Reserve Cutting : size-2Item10311pc
103211.32Polyester braided suture * 1 75cm HOS 12, Blue 40mm 1/2 Circle Reserve Cutting size -1Item10321pc
103311.33Polyester braided suture * 5 75cm HOS-14, Blue 57mm 1/2 Circle Reverse Cutting size-5Item10331pc
103411.34Polyester braided suture * 25x75cm KV-37, Blue 40mm 1/2 Circle Tapercutting size-2Item10341pc
103511.35Poleyster braided suture * 54x75cm KV-40, Blue 45mm 1/2 Circle Tapercutting size-5Item10351pc
103611.36Monofilament Knotless Polyglyconate wound closure device, 0 45cm GS-21, Green 37mm 1/2 Circle Taper Point, box of 12 foils size-0Item10361pc
103711.37Monofilament Knotless Polyglyconate wound closure device, 2-0 30cm cm V-20, Green 26mm 1/2 Circle Taper Point, box of 12 foils size-2-0Item10371pc
103811.38Monofilament Knotless Glycomer 631 wound closure device, 3-0 45cm P-14, UNDYED 24mm 3/8 Circle Resverse Cutting, box of 12 foils size- 3-0Item10381pc
103911.39Polybutester monofilament suture with polytribolate coating size-*6-0 60cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0Item10391pc
104011.4Polybutester monofilament suture with polytribolate coating size-*6-0 75cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0Item10401pc
104111.41Polybutester monifilament suture with polytribolate coating Size-*5-0, 75cm 2XCV-11X36, Blue 12mm 3/8 Circle Taper PointItem10411pc
104211.42Polybutester monofilament suture with polytribolate coating Size-*4-0 90cm 2XCV-23X36, Blue 17mm 1/2Circle Taper Point size: 4-0Item10421pc
104311.43Polybutester monofilament suture with polytribulate coating Size-*5-0 90cm2XCV, Blue 17mm 1/2 Circle Taper Point size: 5-0Item10431pc
104411.44Polybutester moniofilament suture with polytribulate coating Size-*5-0, 75cm 2XKV-11X36, Blue 13mm 3/8 Circle Tapercutting size: 5-0Item10441pc
104511.45Polybutester monofilament suture with polytribolate coating Size-* 7-0, 60cm 2XMV-175-8, Blue 8mm 3/8 Circle Taper Point size: 7-0Item10451pc
104611.46Polybutester monofilament suture with polytribolate coating Size-*2-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper PointItem10461pc
104711.47Polybutester monofilament suture with polytribolate coating Size-*3-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper PointItem10471pc
104811.48Monofilament Knotless Glycomer 631 wound closure device, 2-0 23cm , VIOLET 27mm 1/2 Circle Taper Point, box of 12 foils size- 2-0Item10481pc
104911.49Vaccutrend Needle/Syringe 21\" x 15\"Item10491Each
105011.5Vaccutrend Needle/Syringe 22\" x 15\"Item10501Each
105111.51Vaccutrent Needle /SyringeItem10511Each
105211.52Immunohistochemistry:Item10521Each
105311.53Anti Pax-5 FFPEItem10531per ml
105411.54Anti EBV FFPEItem10541per ml
105511.55Anti Pan CMV FFPEItem10551per ml
105611.56Anti CD 68 FFPEItem10561per ml
105711.57Anti WTI FFPEItem10571per ml
105811.58Anti PLAP FFPEItem10581per ml
105911.59Anti C3 FFPEItem10591per ml
106011.6Anti SMA FFPEItem10601per ml
106111.61Anti AR FFPEItem10611per ml
106211.62Anti BC16 FFPEItem10621per ml
106311.63Anti Myogenin FFPEItem10631per ml
106411.64Anti IDH-1 FFPEItem10641per ml
106511.65Anti ATRX FFPEItem10651per ml
106611.66Anti P63 FFPEItem10661per ml
106711.67Anti Neurofilament FFPEItem10671per ml
106811.68Anti CD 19 FFPEItem10681per ml
106911.69Anti MSA FFPEItem10691per ml
107011.7Anti Adipophylin FFPEItem10701per ml
107111.71Anti ALK D5F3 FFPEItem10711per ml
107211.72Anti Arginase-1 FFPEItem10721per ml
107311.73Anti B CateninItem10731per ml
107411.74Bcl 10 FFPEItem10741per ml
107511.75Anti BER-EP4 FFPEItem10751per ml
107611.76Anti Clauclin 4 FFPEItem10761per ml
107711.77Anti D2 - 40 Podolanin FFPEItem10771per ml
107811.78Anti DOG 1 FFPEItem10781per ml
107911.79Anti SALL 4 FFPEItem10791per ml
108011.8Anti ERG FFPEItem10801per ml
108111.81Anti HBMEIgG4Item10811per ml
108211.82Anti Inhilein FFPEItem10821per ml
108311.83Anti INSM 1 FFPEItem10831per ml
108411.84Anti Mammaglobin FFPEItem10841per ml
108511.85MART 1 FFPEItem10851per ml
108611.86Anti Melan A FFPEItem10861per ml
108711.87Anti MDM2 FFPEItem10871per ml
108811.88Anti Napsin A FFPEItem10881per ml
108911.89Anti P40 FFPEItem10891per ml
109011.9Anti PAX-8 FFPEItem10901per ml
109111.91Anti STAT-6 FFPEItem10911per ml
109211.92Anti TLE-1 FFPEItem10921per ml
109311.93Anti Uroplalcin-2 FFPEItem10931per ml
109411.94Anti Glycophorin FFPEItem10941per ml
109511.95Anti GCET-1 FFPEItem10951per ml
109611.96Anti CD 38/138 FFPEItem10961per ml
109711.97Anti Calcitonin FFPEItem10971per ml
109811.98Anti Caldermon FFPEItem10981per ml
109911.99Anti B Caldermon FFPEItem10991per ml
110012Anti CD 56 FFPEItem11001per ml
110112.01Anti NSM FFPEItem11011per ml
110212.02Anti CD 99 MIC-2 , 013 FFPEItem11021per ml
110312.03Anti CD 138 FFPEItem11031per ml
110412.04Anti CDH 17 Cadherin 17 FFPEItem11041per ml
110512.05Anti HeparII FFPEItem11051per ml
110612.06Anti Glypican-3 FFPEItem11061per ml
110712.07Anti STAB 2 FFPEItem11071per ml
110812.08Anti HRP Polymer KitItem11081per ml
110912.09FITC Lambda light chain ImmunofluorescenceItem11091per ml
111012.1FITC IgM ImmunofluorescenceItem11101per ml
111112.11FITC IgA ImmunofluorescenceItem11111per ml
111212.12FITC IgG ImmunofluorescenceItem11121per ml
111312.13FITC C3 ImmunofluorescenceItem11131per ml
111412.14MLH1, MSH2, MSH6, PMS2 (Together)Item11141per ml
111512.15PDL1 Clone SP142Item11151per ml
111612.16EGFR Clone 31G7Item11161per ml
111712.17CDX2Item11171per ml
111812.18GATA 3Item11181per ml
111912.19CK 18Item11191per ml
112012.2MesothelinItem11201per ml
112112.21Glut 1Item11211per ml
112212.22GCDFPItem11221per ml
112312.23MYBItem11231per ml
112412.24PLAG 1Item11241per ml
112512.25HMGA 2Item11251per ml
112612.26EBER in-situ HybridizationItem11261Kit
112712.27PCRItem11271Each
112812.28EGFR RT PCR Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE TissueItem11281Kit
112912.29MSI detection Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE TissueItem11291Kit
113012.3BCR-Abl1-PCR Kit compatible With QiagenItem11301Kit
113112.31FISHItem11311Each
113212.32ALK mutation break apart probe in lung adenocarcinomaItem11321Kit
113312.33MYB-NFIB dual colour fusion probeItem11331Kit
113412.34MYB dual colour break apart probeItem11341Kit
113512.35MAML2 dual colour break apart probeItem11351Kit
113612.36ETV6 dual colour break apart rearrangement probeItem11361Kit
113712.37PLAG 1 rearrangement probeItem11371Kit
113812.38HMGA 2 rearrangement probeItem11381Kit
113912.39ImmunofluorescenceItem11391Each
114012.4Anti p-ANCA direct ImmunofluorescenceItem11401Kit
114112.41Anti c-ANCA direct ImmunofluorescenceItem11411Kit
114212.42Anti ANA direct ImmunofluorescenceItem11421Kit
114312.43Anti Aquaporin 4Item11431Kit
114412.44C1qItem11441Kit
114512.45FlowcytometryItem11451Each
114612.46CD 16 APCItem11461Kit
114712.47HLA B27 Kit (should be compatible with BD Facscalibur)Item11471Kit
114812.48Elisa (MAGO-4)Item11481Each
114912.49Anti P-ANCA ElisaItem11491Sets
115012.5Anti c-ANCA ElisaItem11501Sets
115112.51Anti Cyclic Citrulinated peptide (CCP) ElisaItem11511Sets
115212.52Anti Smith ElisaItem11521Sets
115312.53Anti Peroxiredoxin VI (Prx VI) ElisaItem11531Sets
115412.54Anti Bmi I ElisaItem11541Sets
115512.55Anti Matrix Metalloproteinase 7 (MMP7) ElisaItem11551Sets
115612.56Anti NY ESO IItem11561Sets
115712.57Anti Scl 70Item11571Sets
115812.58Anti URNPItem11581Sets
115912.59Chemicals and ConsumablesItem11591Each
116012.6Proteinase KItem11601Sets
116112.61PronaseItem11611Sets
116212.62FISH Reagents :Item11621Each
116312.63Poly L LysineItem11631ml
116412.6420X Saline Sodium Citrate (20X SSC) Salt, Molecular GradeItem11641gm
116512.651 M NaSCN ( 1M Sodium Thiocyanate) Salt, Molecular GradeItem11651gm
116612.66IGEPAL @ CA 630Item11661gm
116712.67Rubber CementItem11671tube
116812.68DAPIItem11681ml
116912.69Sodium Chloride (NaCL), 58.44g mol-1 Molecular GradeItem11691gm
117012.7Sodium Citrate (Na3C6H5O7) 258.06g mol-1 Molecular GradeItem11701gm
117112.71Fluorescence microscopic immersion oilItem11711ml
117212.72Immunofluorescence Reagents :Item11721Each
117312.73Trypsin Powder,Molecular GradeItem11731gm
117412.74Additional Consumables / DisposablesItem11741Each
117512.7515mm double swivel with port & extensionItem11751Each
117612.7672 hours CLOSED VENTILATION SUCTION CATHETER Must have double - lumen siliconised catheter Swivel connector un-coupling wedge, Lockable thumb –Valve end Cap, Softer Sleeve material, 72 hour recommended during of use. Size: 12F, 14F, 16FItem11761Each
117712.77Adjustable circle breathing system (2 Litre bag, 2 metre length and 1.5 metre limb)Item11771Each
117812.78Adjustable circle breathing system (2 mts length)Item11781Each
117912.79Adult curved flared prong with tube1.8m lengthItem11791Each
118012.8Adult curved nasal prong with tube1.8m lengthItem11801Each
118112.81Adult Respi-Check high concentration oxygen mask with oxygen tubeItem11811Each
118212.82Anti-microbial circle breathing system (1.6 metre length and 0.8 metre limb)Item11821Each
118312.83Anti-microbial circle breathing system (2 litre bag, 1.6 metre Length, 0.8 metre limb)Item11831Each
118412.84Anti-microbial circle breathing system (2 litre bag, 2.4 metre Length, 0.8 metre limb)Item11841Each
118512.85Apron Cloth (Sterile)Item11851Each
118612.86Attest 1292 E Biological IndicatorItem11861Each
118712.87Attest Biological Indicator (for styeam) 3MItem11871Each
118812.88Attest Rapid Auto Reader Incubator (For Steam) (Early result for biological test)Item11881Each
118912.89Balanced Salt Solution (BSS)Item11891Each
119012.9Bilbao-Dotter tube with guide wireItem11901Each
119112.91BIS ElectrodesItem11911Each
119212.92Bone fileItem11921Each
119312.93Bone rongerItem11931Each
119412.94BP blade with handle (no 15 & 17)Item11941Each
119512.95Cardiac Troponin T kitItem11951Each
119612.96Center hole towelItem11961Each
119712.97COBAN Tm 4\"Item11971Each
119812.98Cols light source for transilluminationItem11981Each
119912.99Contra angle hand pieceItem11991Each
120013Disposable Face Mask (Cloth)Item12001Each
120113.01Disposable Head Positioning Device for the Prone Position – Made of latex- free foam with mirror for providing the clinician a clear view of face, eye & endotrachael tube plus sloted design for positioning of Endotracheal on either side of the patient face 8000HDPItem12011Each
120213.02Disposable Kelly's PadItem12021Each
120313.03ECG monitoring Electrode (Solid Hydrogel)Item12031Each
120413.04ECG monitoring Electrode with foam backing 2223Item12041Each
120513.05ECG monitoring Electrode with foam backing LargeItem12051Each
120613.06Elastometric Infusion Pump for Analgesia 5ml/hourItem12061Each
120713.07Elastometric Infusion Pump for Analgesia 2ml/hour Model SV2Item12071Each
120813.08Elevators (Straight and Periostal)Item12081Each
120913.09Emergency Cricothyrotomy Device Adult 4mm ID Children 2mm IDItem12091Each
121013.1Eye wear for composite fillingsItem12101Each
121113.11Face guardItem12111Each
121213.12Fibre splintItem12121Each
121313.13Fluid Warming Cassette (Disposable) WF-250Item12131Each
121413.14Fluid Warming Cassette (Disposable) WF-100Item12141Each
121513.15Gigly SawItem12151Each
121613.16Glass bead sterilizerItem12161Each
121713.17Tungsen Carbide Burs for Air Rotor and Micro Motor Hand PiecesItem12171Each
121813.18Green PVC tubing for oxygen 6 mm, Length in metresItem12181Each
121913.19Iodixannol 320 mg Iodine/ml-100 ml.Item12191Each
122013.2Iohexol 300 mg-Iodine/ml 100 mlItem12201Each
122113.21Iomeron 400 mg/ml – 50 ml.Item12211Each
122213.22Ioversol/Iopamide/Iopamidol – 50 ml.Item12221Each
122313.23ISO Green Standard Laryngoscope System (Disposable plastic blades) 7 sizes of MAC and Miller bladesItem12231Each
122413.24JESS fixtators pediatric/largeItem12241Each
122513.25Jobson's ProbeItem12251Each
122613.26Kinesiology Color Tap/Taping for Orthopaedic usedItem12261Each
122713.27Killian's Nasal SpeculumItem12271Each
122813.28K-Wires: 1.8mmItem12281Each
122913.29K-Wires: 4mmItem12291Each
123013.3K-Wires: 1.5 mmItem12301Each
123113.31K-Wires: 2.5 mmItem12311Each
123213.32K-Wires: 2mmItem12321Each
123313.33K-Wires: 3mmItem12331Each
123413.34Macintosh Style blades 2, 4Item12341Each
123513.35Magill’s forceps Adult child infantItem12351Each
123613.36Manual Plaster cutting sawItem12361Each
123713.37Manual Plaster spreaderItem12371Each
123813.38Manual Torniquet (cuff & Pump)Item12381Each
123913.39Mayo stand coverItem12391Each
124013.4Miller style blades 0,Item12401Each
124113.41Miller style blades 1Item12411Each
124213.42Mortar and PestleItem12421Each
124313.43Mouth & Cheek retractorItem12431Each
124413.44Mouth mirrorItem12441Each
124513.45MRI compatible Laryngoscopes All sizesItem12451Each
124613.46MRI Film 14” x 17”Item12461Each
124713.47Neopuff (Neonatal Resuscitator)Item12471Each
124813.48North Nasal Preformed Cuffed TubeCuffed Must have IVORY PVC Profile Soft Seal Cuff, implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 6To 8mm ID & length 27cm to 30.5 tips to naresItem12481Each
124913.49OVARIAN SHIELD (Kiran)Item12491Each
125013.5Oxygen Supply Tubing for Heat & Moisture Exchanger Oxygen Supply Tubing for Heat & Moisture Exchanger with Connector to attach HME for Tracheostomy Tube Length 15cmItem12501Each
125113.51Oxygen AnalyserItem12511Each
125213.52Oxygen BlendersItem12521Each
125313.53Para film roll (size 10cmx125cm) 3 “ diaItem12531Each
125413.54Parafilm, rollItem12541Each
125513.55Perineural catheter for continuous plexus and peripheral nerve blocks. Content: 118 G lacoplex needle with centimeter graduation 1 perinueral Pebax catheter (0.45 x 0.85mm – 50cm long) with centimeter distance markings and open distal tip 1 0.22 antibacterial filter 1 additional extension tube, 50cm long, 1.5 x 2.5 mm dia, priming volume 1.10ml 1 10ml syringe for the aspiration test 1 10 x 15 cm Dermafilm transparent adhesive dressingItem12551Each
125613.56Periostal elevators (small and big)Item12561Each
125713.57Winged infusion set- Non coring needles with injection site to access ports,20G X 1.00(needle)Item12571Each
125813.58Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-7fr,65cm length(Ped)Item12581Each
125913.59Hickman-Broviac 4.2Fr(or smaller) single lumen pediatric cath w STIC PAPAISItem12591Each
126013.6Hickman-Broviac 6.6Fr single lumen pediatric cath w STIC 90cmItem12601Each
126113.61Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-9fr,90cm length(Adult)Item12611Each
126213.62Plaster Cutter ElectricItem12621Each
126313.63Plaster sawItem12631Each
126413.64Plier long noseItem12641Each
126513.65Pneumatic Compression StockingItem12651Each
126613.66Portable Autoclave Electrically Operated Made of Aluminium size:300mm x 300mm capacity 24 litresItem12661Each
126713.67Portable Autoclave Electrically Operated Made of Aluminium size:350mm x 300mm-325mm Depth: 1.5 KwItem12671Each
126813.68PyridinItem12681Each
126913.69Reusable Pressure Monitoring cable With integrity check system by 100mmhg pressure and with reusable modular clampItem12691Each
127013.7Reusable Pressure Transducer With integrity check system by 100mmhg pressure, with microchip technology, Reusable cable, and with reusable clampItem12701Each
127113.71Ronguers(down cutter)Item12711Each
127213.72Ronguers(up cutter)Item12721Each
127313.73Rubber MacintoshItem12731Each
127413.74Russian ForcepsItem12741Each
127513.75Light Weight Hernia Mesh,PGA Polypropylene 11 x 15Item12751Each
127613.76Light Weight Hernia Mesh,PGA Polypropylene 6 x 11Item12761Each
127713.77Seldinger technique catheter for arterial puncture Content: 1 Transparent and XPO cathter (PE) /(PTFE) 1 Intruducer needle 1 straight wire 115.092 115.094 115.118 5118.702 5118.703Item12771Each
127813.78Self Holding retractors for Spine surgeryItem12781Each
127913.79Single Use Resuscitation Mask for CPCR (Non-return valve, Integral Bacterial/Viral filter)Item12791Each
128013.8Slide Mailer 1 slideItem12801Each
128113.81Slide Mailer 2 slideItem12811Each
128213.82Soap DispenserItem12821Each
128313.83Soda Lime (Imported) – changes from White to Violet on exhaustion 5kgItem12831Each
128413.84Sodium hypochloride solution 5LitreItem12841Each
128513.85Spreader /PluggerItem12851Each
128613.86Steinman pins:4.5mmItem12861Each
128713.87Steinmann PinsItem12871Each
128813.88Sterigage Chemical Indicator (for Steam) 3MItem12881Each
128913.89Surgical ClipperItem12891Each
129013.9Surgical Preparation RazorItem12901Each
129113.91Thermal Videographic Printer (Black & White) (Sony, Latest UP series)Item12911Each
129213.92Tissue paper for UltrasoundItem12921Each
129313.93Ultra violet cabinet (800/500 x 2000 mm)Item12931Each
129413.94Vacuum assisted dressing systemItem12941Each
129513.95Vascular Debeky Angle (Medium)Item12951Each
129613.96Vascular Debeky Straight (Medium)Item12961Each
129713.97Vaseline gauzeItem12971Each
129813.98Ventilator 15 mm breathing systems (with luer lock, 1.6 metre length and resealable water trap) for PaediatricsItem12981Each
129913.99Ventilator Breathing System with resealable water traps (smooth lumen)Item12991Each
130014Waste Management Wheeled Bins. (660Lit ; 300lit; 1100 lit)Item13001Each
130114.01Wire cutterItem13011Each
130214.02Y-pieces for Breathing CircuitItem13021Each
130314.03Absorbable Gelatin Sponge U.S.P (Ab-Gel) 10 X 10Item13031Each
130414.04Alginate impression materials(Dust free)Item13041Each
130514.05Double swivel with port 15mmItem13051Each
130614.06Green PVC tubing 6mm for oxygen / per meterItem13061Each
130714.072 mm OsteotomesItem13071Each
130814.083 mm OsteotomesItem13081Each
130914.09Asepto PumpItem13091Each
131014.1Autoclavable biohazard plastic bag 10literItem13101Each
131114.11Autoclavable biohazard plastic bag 20literItem13111Each
131214.12Autoclavable biohazard plastic bag 30literItem13121Each
131314.13Bone Cement(Plain)Item13131Each
131414.14Bone Cement(Antibiotics)Item13141Each
131514.15Bougie(stylet)Item13151Each
131614.16BurrettaItem13161Each
131714.17CAPD Catheter Tenckhoff with 2 felt cuffs SA 1242 (420 mm)Item13171Each
131814.18Cast Taper MandrelItem13181Each
131914.19ChieselItem13191Each
132014.2Cleaning BrushItem13201Each
132114.21Cleaning solutionItem13211Each
132214.22CPR manikinItem13221Each
132314.23Stoma Flatmoldable Small 45MMItem13231Each
132414.24Stoma Flatmoldable Medium 45MMItem13241Each
132514.25Stoma Flatmoldable Regular 57MMItem13251Each
132614.26Stoma Flatmoldable Large 70MMItem13261Each
132714.27Moldable convex 12/22MMItem13271Each
132814.28Moldable convex 22/33MMItem13281Each
132914.29Moldable convex 33/57MMItem13291Each
133014.3Ostomy Appliance Accessories BeltItem13301Each
133114.31Coloured Ph indicator PaperItem13311Each
133214.32Dissecting Instrument BoxItem13321Each
133314.33Double swivel with port 15 mm x 22mmItem13331Each
133414.34Drape Formers Trans femoralItem13341Each
133514.35Drape Formers Trans tibialItem13351Each
133614.36Espocan with Docking SystemItem13361Each
133714.37ETO chemical Indicator tape -3MItem13371Each
133814.38ETO packing sleeves roll (3M) 12'Item13381Each
133914.39ETO packing sleeves roll (3M) 4'Item13391Each
134014.4ETO packing sleeves roll (3M) 6'Item13401Each
134114.41Surgicel Fibrillar 1963Item13411Each
134214.42G- BoneItem13421Each
134314.43Gloves wrapperItem13431Each
134414.44Laparoscopic Aspiration needleItem13441Each
134514.45Hemorrhoids and Prolapsed Stapler with Detachable Anvil 3.5mmItem13451Each
134614.46Hemorrhoids and Prolapsed Stapler with Detachable Anvil 4.8mmItem13461Each
134714.47Hose Mount 15mm female male pairItem13471Each
134814.48Hose Mount 22mm female male pairItem13481Each
134914.49Hygrobaby/HME Filter (Infant)Item13491Each
135014.5Hygroboy/HME Filter (Paediatric)Item13501Each
135114.51Hygrostar/HME Filter (Adult)Item13511Each
135214.52hygrobac SItem13521Each
135314.53Intraocular lense 6mm optics foldable, square edge, HydrophobicItem13531Each
135414.54Intraocular lense rigid 5.25mm optics,PMMA, square edgeItem13541Each
135514.55Intraocular lense rigid 5.5mm opticsItem13551Each
135614.56Intraocular lense rigid 5.5mm optics foldableItem13561Each
135714.57Intraocular lense rigid 6mm opticsItem13571Each
135814.58Intraocular lense rigid 6mm optics foldableItem13581Each
135914.59Intraocular lense rigid 6mm optics, PMMA, square edgeItem13591Each
136014.6Rigid Anterior Chamber Intraocular Lens: Lens Power +16D(6.00mm)Item13601Each
136114.61Rigid Anterior Chamber Intraocular Lens: Lens Power +19D(6.00mm)Item13611Each
136214.62Rigid Anterior Chamber Intraocular Lens: Lens Power +18D(6.00mm)Item13621Each
136314.63Rigid Anterior Chamber Intraocular Lens: Lens Power +20D(6.00mm)Item13631Each
136414.64Rigid Anterior Chamber Intraocular Lens: Lens Power +21D(6.00mm)Item13641Each
136514.65Rigid Anterior Chamber Intraocular Lens: Lens Power +22D(6.00mm)Item13651Each
136614.66Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm)Item13661Each
136714.67Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.5D(5.50mm)Item13671Each
136814.68Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm)Item13681Each
136914.69Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.0D(5.50mm)Item13691Each
137014.7Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.5D(5.50mm)Item13701Each
137114.71Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.0D(5.50mm)Item13711Each
137214.72Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.5D(5.50mm)Item13721Each
137314.73Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.0D(5.50mm)Item13731Each
137414.74Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.5D(5.50mm)Item13741Each
137514.75Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.0D(5.50mm)Item13751Each
137614.76Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.5D(5.50mm)Item13761Each
137714.77(a) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +10.0D 6.0mmItem13771Each
137814.78(b) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +113.5D 6.0mmItem13781Each
137914.79(c) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+14.0D 6.0mmItem13791Each
138014.8(d) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.0D 6.0mmItem13801Each
138114.81(e) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.5D 6.0mmItem13811Each
138214.82(f) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.0D 6.0mmItem13821Each
138314.83(g) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.5D 6.0mmItem13831Each
138414.84(h) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.0D 6.0mmItem13841Each
138514.85(i) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.5D 6.0mmItem13851Each
138614.86(j) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.0D 6.0mmItem13861Each
138714.87(k) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.5D 6.0mmItem13871Each
138814.88(l) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19..0D 6.0mmItem13881Each
138914.89(m) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19.5D 6.0mmItem13891Each
139014.9(n) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.0D 6.0mmItem13901Each
139114.91(o) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.5D 6.0mmItem13911Each
139214.92(p) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.0D 6.0mmItem13921Each
139314.93(q) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.5D 6.0mmItem13931Each
139414.94(r) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.0D 6.0mmItem13941Each
139514.95(s) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.5D 6.0mmItem13951Each
139614.96(t) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+23.0D 6.0mmItem13961Each
139714.97(u)Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +23.5D 6.0mmItem13971Each
139814.98(v) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.0D 6.0mmItem13981Each
139914.99(w) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.5D 6.0mmItem13991Each
140015(x) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.0D 6.0mmItem14001Each
140115.01(y) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.5D 6.0mmItem14011Each
140215.02(z) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+26.0D 6.0mmItem14021Each
140315.03Mayo trolly cover (disposable)Item14031Each
140415.04Membrane AssemblyItem14041Each
140515.05Micro Centrifuge Tube 1.5mlItem14051Each
140615.06Micro Centrifuge Tube 15mlItem14061Each
140715.07micro centrifuge tubes-.2ml (with thin wall for PCR)Item14071Each
140815.08micro centrifuge tubes-.5ml (with thin wall for PCR)Item14081Each
140915.09micro centrifuge tubes-2mlItem14091Each
141015.1Microscope Bulb- 6V 20WItem14101Each
141115.11Mini & micropates with screwItem14111Each
141215.12Nasal Tubing 70mmItem14121Each
141315.13Needle (cutting) bigItem14131Each
141415.14Needle (cutting) mediumItem14141Each
141515.15Needle (cutting) smallItem14151Each
141615.16Needle (round body) bigItem14161Each
141715.17Needle (round body) mediumItem14171Each
141815.18Needle (round body) smallItem14181Each
141915.19Non invasive cardiac output monitoring electrodeItem14191Each
142015.2Non invasive cardiac pacing electrodeItem14201Each
142115.21Ostomy powder 25gmItem14211Each
142215.22Pneumatic Compression StockingItem14221Each
142315.23Pressure monitoring kit with three way disposable pressure( For CVP & Atrerial)Item14231Each
142415.24RAE tub 7.5Item14241Each
142515.25Self adhesive urine sample bag - PediatricItem14251Each
142615.26Spirit swabsItem14261Each
142715.27Sterile swab sticksItem14271Each
142815.28Steri-StripesItem14281Each
142915.29Esmarch 4\"Item14291Each
143015.3Esmarch 6\"Item14301Each
143115.31Polyester Synthetic Cast paddingItem14311Each
143215.32Suction cannula for MTP size purandreItem14321Each
143315.33Ostomy Appliance Accessories BeltItem14331Each
143415.34Stomadress Plus Single Pouch - OpaqueItem14341Each
143515.35ActiveLife One Pc Drainable PouchItem14351Each
143615.36Tubing KitItem14361Each
143715.37urianalyserItem14371Each
143815.38Urine Control A360Item14381Each
143915.39Ventilating Airway BougiesItem14391Each
144015.4Ventilator Tubing W/1 (venti breathing system with reseable water trap)Item14401Each
144115.41Y-piecesItem14411Each
144215.426mm Green PVC tubing for oxygenItem14421Each
144315.43Alpha mattressItem14431Each
144415.44Analspeculum Size: 25Item14441Each
144515.45AO universal clampsItem14451Each
144615.46Baby Cradle with mattress and NetItem14461Each
144715.47Blood Gas Quality Control (30x1.7ml) Level 1 (ABG)Item14471Each
144815.48Blood Gas Quality Control (30x1.7ml) Level 2 (ABG)Item14481Each
144915.49Blood Gas Quality Control (30x1.7ml) Level 3 (ABG)Item14491Each
145015.5Bone CutterItem14501Each
145115.51Bone cutter Big sizeItem14511Each
145215.52Centrifuge TubeItem14521Each
145315.53Centrifuge tubes, polypropylene seal with capacity 3.5 - 10 mlItem14531Each
145415.54Clavicular BracesItem14541Each
145515.55Cider wood oilItem14551Each
145615.56DeBakey’s Bull Dog Clamps, Curved 115mm (4 ½”) longItem14561Each
145715.57DeBakey’s Bull Dog Clamps, Curved 70mm (2 ¾”) longItem14571Each
145815.58DeBakey’s Bull Dog Clamps, Curved 80mm (3 ?”) longItem14581Each
145915.59DeBakey’s Bull Dog Clamps, Straight 120mm (4 ¾”)Item14591Each
146015.6DeBakey’s Bull Dog Clamps, Straight 75mm (3”)Item14601Each
146115.61DeBakey’s Bull Dog Clamps, Straight 85mm (3 ?”)Item14611Each
146215.62Divided MattressItem14621Each
146315.63Dropper bottle 250mlItem14631Each
146415.64Dropper bottle 500mlItem14641Each
146515.65Dropper p.p. 6 longItem14651Each
146615.66NPWT dressing kitItem14661Each
146715.67Silicone Rubber heel cupsItem14671Each
146815.68Electrodes for IFT (For Combination therapy-Ultra sound therapy + Electrical Stimulator) (Make: Enraf nonius Sonoplus 491)Item14681Each
146915.69Episiotomy scissor size 15cmItem14691Each
147015.7Fixation Ring (904-898)Item14701Each
147115.71Fixation Ring (904-898) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40)Item14711Each
147215.72Fluid warmerItem14721Each
147315.73Fogging MachineItem14731Each
147415.74G-BoneItem14741Each
147515.75Gigly SawItem14751Each
147615.76Ginevri Capillary tube (H) (Microbillimeter)Item14761Each
147715.77Glover with Atraumatic jaws, Curved jaws, 85mm (3 ?”), 45mm jawsItem14771Each
147815.78Hand DrillItem14781Each
147915.79Hand wash basin stand (double). - Five legs base mounted on 5cms dia castors with one 35cm s.s basin.Pre treated and epoxy powder coated.Item14791Each
148015.8Hysterectomy clamp ‘FAURE’Item14801Each
148115.81I.V. drip standItem14811Each
148215.82Intra uterine cannula ‘COLLINS’ plain 3 sizeItem14821Each
148315.83Intra uterine cannula ‘HAYES PROVIS’ with rubber coneItem14831Each
148415.84Kidney Wash Machine (Renatron II)Item14841Each
148515.85Knee Immobilizer OC 2035Item14851Each
148615.86Knee Immobilizer OC 2035Item14861Each
148715.87Knee Stabilizer-DC 2069Item14871Each
148815.88Leishmans stainItem14881Each
148915.89Lengenback retractorItem14891Each
149015.9Lengenback retractorItem14901Each
149115.91Lens cleaning paperItem14911Each
149215.92Lymph nodeItem14921Each
149315.93Magnet for ECGItem14931Each
149415.94Malleable stylets with adjustable stop, different sizeItem14941Each
149515.95MEASURING TAPEItem14951Each
149615.96Measuring Tape (Clinical)Item14961Each
149715.97Microscope ( for side lab) - Binocular electric light microscopeItem14971Each
149815.98Molina SheetItem14981Each
149915.99Mosquito Net (Single use patient specific, plastic)Item14991Each
150016Mouth gagItem15001Each
150116.01Myoma screw ‘DOYEN’Item15011Each
150216.02Na+ - sensor casing (ABG)Item15021Each
150316.03Non Invasive Glucose monitoring system (Glucometer)Item15031Each
150416.04Ounce glass steelItem15041Each
150516.05Oxygen cylinder stand /trolley - B TypeItem15051Each
150616.06Pad Electrodes for SWD (DX 500 roland)Item15061Each
150716.07Paper Roll (ABG)Item15071Each
150816.08Patient Breathing Set Infant Reusable (Galileo Gold)Item15081Each
150916.09Patient cable for IFT/MST (Make/Model: Multidyne 965)Item15091Each
151016.1Patient shifting trolleys with the facility of Oxygen Cylinder carrierItem15101Each
151116.11Pelvic traction kit with pulley and weightItem15111Each
151216.12Pile BinderItem15121Each
151316.13Plastic dropping bottle (120ml)Item15131Each
151416.14Plastic small tubeItem15141Each
151516.15RAOS hand suction unit 100 mlItem15151Each
151616.16Ref. - membrane shell (ABG)Item15161Each
151716.17Resucitation kits AutomaticsItem15171Each
151816.18Resuscitation kit EmergencyItem15181Each
151916.19Resuscitation kit for neonatesItem15191Each
152016.2Rubber Sole - 4mmItem15201Each
152116.21Sample detectorItem15211Each
152216.22Screw driverItem15221Each
152316.23Sealing ringsItem15231Each
152416.24Set tubing for roller pump (reagents) (ABG)Item15241Each
152516.25Shin tube cutting jig 30mmItem15251Each
152616.26Shin tube cutting jig 35mmItem15261Each
152716.27Short needle HolderItem15271Each
152816.28Side Support (Meditrin)Item15281Each
152916.29Silicon Tubal RingItem15291Each
153016.3Solid waste containers linersItem15301Each
153116.31Solution ValveItem15311Each
153216.32Spare canvas bagItem15321Each
153316.33Spare lamp for OpthalmoscopeItem15331Each
153416.34Spare parts for: Easylyte,911 , 912 & othersItem15341Each
153516.35Spirit lampItem15351Each
153616.36Stich scissorItem15361Each
153716.37Suture anchor (orthopaedics)Item15371Each
153816.38Syringe Infusion pumpItem15381Each
153916.39T- handle for OrthopaedicsItem15391Each
154016.4Tailor ThreadItem15401Each
154116.41TCO2 sensorItem15411Each
154216.42Teley's ForcepItem15421Each
154316.43Vortex mixerItem15431Each
154416.44Vulsellum forceps 1 x 1 teeth 25cmItem15441Each
154516.45Wire CutterItem15451Each
154616.46Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure)Item15461Each
154716.47Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Low Pressure)Item15471Each
154816.48Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene.Item15481Each
154916.49Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure with bacterial resistance)Item15491Each
155016.5Manual Hub Cutter – with biohazard symbol and which can cut the plastic hub and NOT the metal needle with temporary and permanent locking mechanism on complete filling of the disposal hub cutter with clear demarcation of fill line and which can accomadate upto 400-600 needles.Item15501Each
155116.51Cerebral Reservior (Omaya Type)Item15511Each
155216.52Extranal Ventricular Drainage SyatemItem15521Each
155316.53Lumbar Extranal Drainage SystemItem15531Each
155416.54Poly Propylene mesh (small) for DuroplastyItem15541Each
155516.55Poly Propylene Mesh (Medium) for DuroplastyItem15551Each
155616.56Poly Propylene Mesh (Large) for DuroplastyItem15561Each
155716.57G Bone Cement (for Cranioplasty)Item15571Each
155816.58Kraniotomy DrapeItem15581Each
155916.59Iodine Drape LargeItem15591Each
156016.6Balanced Salt Solution with Na/K/Mg & chloride levels similar to plasma with acetate & gluconate/malate as buffer, must not contain calcium ( eg.Plasmalyte A /Volulyte etc)Item15601Each
156116.61Bactiseal Impregnated Shunt - FDA Approved, fixed pressure VP Shunts (low,medium, high) that are antibiotic impregnated and can reduce the potential for bacterial colonization in the lumen as well as its outer surface.Item15611Each
156216.62Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.Item15621Each
156316.63Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.Item15631Each
156416.64Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.Item15641Each
156516.65Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.Item15651Each
156616.66Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.Item15661Each
156716.67Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.Item15671Each
156816.68Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.Item15681Each
156916.69Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology.Item15691Each
157016.7Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology.Item15701Each
157116.71Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology.Item15711Each
157216.72Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .Item15721Each
157316.73Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .Item15731Each
157416.74Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .Item15741Each
157516.75Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .Item15751Each
157616.76Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.Item15761Each
157716.77Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.Item15771Each
157816.78Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.Item15781Each
157916.79Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.Item15791Each
158016.8Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.Item15801Each
158116.81Raneys scalp disposable clips - Disposable Raney's ClipsItem15811Each
158216.82Cranioplasty kit - Cranioplasty kit, sterile, pack of two packets of Methyl methacrylate and two vials of liquid.Item15821Each
158316.83Universal Extremity Drape- Control plus fabric,US FDA certifiedItem15831Each
158416.84Impervious Split Sheet- 60\" x 70\", 4\" x 21\" split, Polyethylene Sheet, US FDA certifiedItem15841Each
158516.85U-Bar-Pack- 1 back table cover-Reinforced 44\" x 88\",1 mayo stand cover reinforced 23\" x 54\",1 suture bag, 1U drape 71\" x 124\", 1 Bar Drape 71\" x 124\", 1 Bar Drape 41.5\" x 82\",US FDA certifiedItem15851Each
158616.86Back Table Cover Zone Reinforced- 44\" x 99\", US FDA certifiedItem15861Each
158716.87Impervious Stockinette-12\" x 58\", UDS FDAItem15871Each
158816.88Fluid shield Mask with Visor -Four Layer Mask, water resistant with water resistant,-NAOSH, OSHA approvedItem15881Each
158916.89HIP Drape with LEG Pockets -control plus fabric, US FDA approvedItem15891Each
159016.9HIP Drape without LEG Pockets -Control plus fabric, US FDA approvedItem15901Each
159116.91Quattro FX -Full Face Mask VentedItem15911Each
159216.92Mirage FX- Nasal Mask VentedItem15921Each
159316.93Transmission Electron MicroscopeItem15931Each
159416.94G011/2 Glut Em 25% AMPSItem1594110x2ml
159516.95Self Closing Tweezer (biology) T-403Item15951Each
159616.96O001 Osmium TetroxideItem159611vial/1gm
159716.97EUKITT Mouning MediaItem159711bottle/100ml
159816.98TAAB Araldite 502/812 Kit (E2O2)Item15981Kit
159916.99Dibutyl PhthalateItem15991Bottle
160017E069 Embedding Mould Flat CItem160011 Piece
160117.01Z10 Molecular Seive 3NM for Drying AcetoneItem160111bottle/Jar
160217.02Shaving Razor BladeItem160211Packet
160317.03300 mesh Cu Grid with thin carbon film (Cu - 300CNItem1603125grids/pkg
160417.04300M mesh Cu Grid with holey/dbl Carbon film (Cu-300HDItem1604125grids/Pkg
160517.05G062 Grid Storage BoxItem160511x10pcs
160617.06U007 Uranyl AcetateItem160611 bottle
160717.07L018 Lead CitrateItem160711 bottle
160817.08TRUF 2208-100Item160811 Packet
160917.09Octagon Magnetic Stirrer Bar (4151)Item160911packet (8x22mm)
161017.1ConsumablesItem16101Each
161117.11Micro tips(10micro litre)Item161111x1000pcs
161217.12Microcentrifuge TubeItem161211.5/2.0ml capacity

AI Tender Summary

OUR REF NO 22947207
AUTHORITY Statutory Bodies & Commissions/Committees
TENDER VALUE 30 Lakhs
LAST DATE 04-12-2020
Authority
Authority Name Ministry Of Health And Family Welfare
Work Description Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later. - 1 Albumin 2 Microalbumin 3 Gamma Glutamyl Tranferase 4 ( ??- Ggt ) 5 Amylase 6 Lipase 7 Ck 8 Ck-Mb 9 Ldh 10 Total Cholesterol 11 Triglyceride 12 Hdl 13 Ldl 14 Calcium 15 Copper 16 Phosphorus 17 Zinc 18 Parameter 19 Iron 20 Tibc 21 Ada 22 Ada Calibrator 23 G-6-Pd 24 Glycosylated Hb 25 Glycosylated Hb Calibrator 26 Crp 27 Crp Calibrator 28 A-1 Acid Glycoprotein 29 Ammonia 30 Lactate 31 Glutathione Peroxidase 32 Superoxide Dismutase 33 Total Antioxidant Status 34 Homocysteine 35 Aso 36 Rf 37 Lipoprotein ( A ) 38 Lipoprotein ( A ) Calibrator 39 Transferrin 40 Cystatin C 41 Gentamycin 42 Barbiturates 43 Valproic Acid 44 Phenitoin 45 Vma 46 Galactosemia 47 Calcitonin 48 Calcitriol 49 Galactokinase 50 Galactose-1-Phosphate Uridyl Transferase 51 Renin 52 Acth 53 Interleukin 1 54 Interleukin 4 55 Interleukin10 56 Leukotrine A4 57 Leukotrine B4 58 Leukotrine C4 59 Leukotrine D4 60 Leukotrine E4 61 Tnfa 62 Cephalosporin 63 Serum Tryptase 64 Urine Fluoride 65 Anti-Dsdna Antibody 66 Anti Nuclear Antibody 67 Anti-Sm Antibody 68 Sodium Carbonate 69 Potassium Dihydrogen Phosphate 70 Potassium Dihydrogen Phosphate Kh2po4 ( Hplc Grade ) 71 Creatinine Powder 72 Isopropyl Alcohol, Ar Grade 73 Acetone – Ar Grade Ar Grade 74 Ammonium Chloride –Ar Grade, 75 Ammonium Nitrate – Ar Grade, 76 Ammonium Persulphate – Ar Grade, 77 Calcium Chloride Dihydrade – Ar Grade, 78 Dinitro Phenyl Hydrazine Ar Grade, 79 Magnesium Chloride – Ar Grade, 80 Magnesium Sulfate –Ar Grade, 81 Methanol – Acetone Free – Hplc Grade, 82 Methanol ( Hplc Grade ) 83 Potassium Dichromate – Ar Grade, 84 Silver Nitrate – Ar Grade, 85 Sodium Bicarbonate – Ar Grade, 86 Sodium Acetate Dehydrate –Ar Grade, 87 Ammonium Acetate – Ar Grade, 88 Thio Semi Carbazide – Ar Grade, 89 Ethidium Bromide Soln 10Ml– Biotechnology Grade, 90 Guanidium Iso Thiocyanate – Biotechnology Grade, 91 Iptg Ar Grade, 92 100 Bp Dna Ladder 1 Ml X 5 93 Taq Polymerase With Pcr Buffer 3-5 U / Μl, 1000 U Per Vial 94 Dntps 100 Millimolar Each 95 Ecori Restriction Enzyme 0.5 Ml X 1 96 Bamhi 0.5 Ml X 1 97 Hindiii 0.5 Ml X 1 98 Dna Ligase 0.5 Ml X 1 99 Dna Extraction Kit ( Column Based ) For 50 Extraction 100 Rna Extraction Kit ( Column Based ) For 20 Extraction 101 Plasmid Extraction Kit ( Column Based ) For 50 Extraction 102 Oligo Nucleotide Primers ( Hplc Purification ) 103 Rnalater 104 Depc Mol Bio Grade 105 Nuclese K 106 Milipore Prefiltrate Kit Cartridge 107 Milipore Proguard 2 Pack Cat. No. Prog0002 108 Milipore Q Guard 1 Cat. No. Qgard00r1 109 Milipore Tank Vent Filter Cat. No. Tankmpk01 110 Milipore Sanitization Tablet Cat. No. Zwcl01f50 111 Millipore Millicare Elix Cat No Jmbm01747 112 Millipore Quantum Ex Cat. No- Qtum000ex 113 Mx Cart 5 Micron 114 Mx Cart 1 Micron 115 Ro Cartridge 116 Non Sterile Millipak 40 117 Progard Ts 2 118 1 Micron Filter 119 3 Micron Filter 120 Mx Cartridge 5 Μm 121 20 Carbon Cartridge 122 Sanitization Tablets 123 Pm Kit 124 Xl Wash Solution 125 200-1000 Μl Microtips 126 100-200 Μl Microtips 127 5-50 Μl Microtips 128 1-5 Ml Microtips 129 200-1000 Μl Micropipette 130 100-200 Μl Micropipette 131 5-50 Μl Micropipette 132 2-20 Μl Micropipette 133 Microcentrifuge Tube 1.5Ml 134 Ammonium Persulphate Ar 135 Potassium Iodate ( Kio3 ) 136 Toluene Ar 137 Arsenous Acid ( As2o3 ) 138 Arsenic Trioxide 139 Ceric Ammonium Sulphate 140 20Bp Dna Ladder 141 Tris – Base Ar Grade 142 Fok I & Nlaiii Restriction Enzyme 143 Dna Loading Buffer 144 Dna Sample Loading Dye 145 Ethiduim Bromide 146 Primer ( Both Forward & Reverse ) 147 10 X Tbe 148 Heparinised Vial 149 Disposable Syringe 150 Microwave Oven 151 Glucose Kit 152 Bilirubin Kit 153 G6-Pd Kit 154 Vacutainer 155 Disposable Syringe 156 Cystatin C Kit 157 Bilirubin Kit 158 Creatinine Kit 159 Ast Kit 160 Alt Kit 161 Ise Wash 2 Solution 162 Ise Cal-3 Solution 163 Ise Cal -4 Solution 164 Microcentrifuge Tube 2Ml 165 Sp Kit 166 Rep Prep Solution 167 Sample Applicator 168 Disposable Sample Cup 169 Ast 170 Alt 171 Creatinine 172 Albumin 173 Glucose 174 Ggt 175 Bun 176 Hdl Cholesterol 177 Ldl Cholesterol 178 Cholesterol 179 Uibc 180 Rf Rtg Latex 181 Crp 182 Uric Acid 183 Triglyceride 184 Alp 185 Total Bilirubin 186 Igg 187 Direct Bilirubiun 188 Igm 189 Protein 190 Iga 191 Phosphorus 192 C3 193 Calcium 194 Ck-Mb 195 Lipase 196 Aso 197 Iron 198 C4 199 Amylase 200 Ck 201 Acid Phosphatase 202 Transferrin 203 Ldh 204 Magnessium 205 Hb-Dh 206 Haptoglobin 207 Lactate 208 Microalbumin 209 Microalbumin Calibrator 210 Cholinesterase 211 Urine Csf Protein 212 Wash Solution 213 Cleaning Solution 214 Cleaning Solution Weekly Wash 215 Crp Latex Calibrator 216 Urine Calibrator 217 System Calibrator 218 Hdl Calibrator 219 Ldl Calibrator 220 Crp Calibrator 221 Rf Calibrator 222 Ck-Mb Calibrator 223 Xl-300 / 600 Cuvette 224 Beckman Coulter Au 2700 Cuvettes 225 Xl-300 / 600 Lamp 226 Beckman Coulter Au 2700 Lamp 227 Eqas ( Bio-Rad ) 228 Apoa1 & Apob Reagent & Calibrator 229 Bio-Rad Lipid Conrol 230 Ethylene Glycol ( Ethandiol 231 Methylene Soluble ( Working Reagent 232 Tissue Capsule Big 233 Tissue Capsule Small 234 Tissue Cassettes Big 235 Tissue Cassettes Small 236 Stock Phloxine B 237 Progesterone Receptor 238 Ana Kit For Sle ( Indirect Immunoflurescence Method ) 239 Hb / Cayanaid Method Standard 240 Nalidixid 10Ug 241 Netilmycin 10Ug 242 Furozotidime 30Ug 243 Antigen And Antibody Hcv Elisa Test Kits 244 Cell Counter Reagents 245 ( Machine Available Is Abx Pentra Which Is A Closed System ) 246 Reagent For Aptt 247 Calcium Chloride For Aptt Estimation 248 Control Plasma N 249 Reaction Tube 250 Ca Clean 251 Owrens Veronal Buffer 252 Standard Human Plasma 253 Sodium Azide ( Nan3 ) 254 Bovine Thrombin 255 1000 Nih Units / Mg Of Protein 256 Anti Dce 257 Sc ( 1 ) 258 Sc ( 2 ) 259 Sc ( 3 ) 260 Yt ( A ) 261 Yt ( B ) 262 Do ( A ) 263 Do ( B ) 264 Pyr Broth 265 Pyr -Pyrolidonyl-ß Naphthylamine 266 Paradimethylaminobenzaldehyde 267 P-Dimethylaminocinamaldehyde 268 P-Nitrophenylglycerol 269 Potassium Telurite 270 Potassium Cyanide ( Kcn ) 271 Para Dimethyl Aminobenzaldehyde 272 Potassium Hydroxide 273 Potassium Hydrogen Sulphate 274 Phenol Crystal ( Powder ) 275 Phosphate Buffer Saline 276 Phenethyl Alcohol 277 Phenol Red Indicator 278 Phenol Red Indicator 279 Phenol Red 280 Phenylpyruvic Acid Reagent 281 Potassium Dichromate Lr 282 Potassium Permanganate Lr 283 Potassium Permanganate Ar 284 Potassium Phosphate Monobasic 285 Potassium Nitrate 286 Phenol ( Crystal ) 287 Peptone 288 Raffinose Ar 289 Rhammnose 290 Sodium / Potassium Dichromate 291 Sodium Citrate 292 Sodium Pyruvate Ar 293 Sodium Biocarbonate Lr 294 Sodium Acetate 295 Sodium Iodide 296 Sulphanilamine-Ar 297 Sugar Assimilation Disc – Cellobiose 298 Sugar Assimilation Disc – Dextrose 299 Sugar Assimilation Disc – Dulcitol 300 Sugar Assimilation Disc – Galactose 301 Sugar Assimilation Disc – Inositol 302 Sugar Assimilation Disc – Lactose 303 Sugar Assimilation Disc – Maltose 304 Sugar Assimilation Disc – Melibiose 305 Sugar Assimilation Disc - Raffinose 306 Sugar Assimilation Disc- Sucrose 307 Sugar Assimilation Disc – Trehalose 308 Sugar Assimilation Disc - Xylose 309 Salicin Ar 310 Tarric Acid 311 Trehalose Ar 312 Triypticase 313 Thiosulphate 314 Tri-Sodium Citrate 315 Voges Proskaeur Reagent 316 Vibriostatic ( 0 / 129 ) Agent 317 Wright’S Stain 318 Xylose Ar 319 Vibrio Cholerae-01 3Ml 320 Vibrio Cholerae-0139 3Ml 321 Vibrio Cholerae-Ogawa 3Ml 322 Vibrio Cholerae-Inaba 3Ml 323 Salmonella Polyvalent O 3Ml 324 Salmonella Polyvalent H 3Ml 325 Salmonella Polyvalent O2 3Ml 326 Salmonella Polyvalent O4 3Ml 327 Salmonella Polyvalent O9 3Ml 328 Salmonella Polyvalent H Phase I A 3Ml 329 Salmonella Polyvalent H Phase Ib 3Ml 330 Salmonella Polyvalent H Phase Ic 3Ml 331 Salmonella Polyvalent H Phase Ii 3Ml 332 Shigella Polyvalent Dysenteriae 3Ml 333 Shigella Polyvalent Flexnerii 3Ml 334 Shigella Polyvalent Sonnei 3Ml 335 Shigella Polyvalent Boydii 3Ml 336 Cryptococcus Antigen Detection Kit ( Latex Agglutination Detection ) 337 Antigen Detection Kit For Meningitis ( H Influenza B, N Meningitis A & C, S. Pneumonia, Gbs, E.Coli ) 338 Amphotericin Powder 339 Benzal Pennicillin Powder 340 Cefoxitin 5Gm / Vial 341 Clindamycin Powder 342 Ciprofloxacin 5Gm / Vial 343 Erythromycin Powder 344 Gentamicin 5Gm / Vial 345 Imipenem 5Gm / Vial 346 Oxacillin 5Gm / Vial 347 Vancomycin 5Gm / Vial 348 Anidulafungin ( 0.015-128Μg / Ml ) 349 Ceftriaxone ( 0.016-256 Ug / Ml. ) 350 Ciprofloxacin ( 0.001-8Ug / Ml. ) 351 Ceftazidime+ Clavulanate ( 0.004-128Ug / Ml. ) 352 Clindamycin E-Test ( 0.016-256 Μg / Ml ) 353 Colistin ( 0.06-0.25Μg / Ml ) 354 Caspofungin ( 0.015-128Μg / Ml 355 Doripenem ( 0.002-32 Μg / Ml ) 356 Ertapenem ( 0.002-32 Μg / Ml ) 357 Fluconazole ( 0.016-256 Μg / Ml ) 358 Imipenem ( 0.004-128Ug / Ml. ) 359 Levofloxacin ( 0.001-8Ug / Ml. ) 360 Meropenem ( 4-256 Μg / Ml ) 361 Meropenem / Edta ( 1-64 Μg / Ml ) 362 Moxifloxacin ( 0.001-8Ug / Ml. ) 363 Candida Albicans Atcc 14053 364 Candida Guilliermondii Atcc 6260 365 Candida Psedotropicalis Tcc 4135 366 Corynebacterium Diptheriae Atcc 13812 Vial 367 Escherichia Coli Atcc 25922 Vial 368 Escherichia Coli Atcc 35218 Vial 369 Enterococcus Faecalis Atcc 29212 Vial 370 Haemophilus Influenzae Atcc-49766 Vial 371 Pseudomonas Aeruginosa Atcc 27853 Vial 372 Positive Control For T.B. ( My.Tb H37rv Strain ) 373 Staphylococcus Aureus Atcc 25923 Vial 374 Streptococcus Pneumoniae Atcc 49619 Vial 375 Staphylococcus Aureus Atcc 33591 Vial 376 Salmonella Enterica Subspecies Enterica Serovar Cholerasuis Atcc-10708 Vial 377 Salmonella Enterica Subspecies Enterica Serovar Paratyphi A Atcc-9150 Vial 378 Salmonella Enterica Subspecies Enterica Serovar Typhimurium Atcc-25241 Vial 379 Shigella Flexneri Atcc- 9199 Vial 380 Ast For Gnb Ast –N280 381 Media For Pediatric Sample -259794, Bact / Alert Pf 382 Media For Aerobic Sample – 259791, Bact / Alert Fa 383 Solution For Inoculum Preparation – V1204, 3X500 Ml 384 Tubes For Inoculum Preparation - 69285 ( Unsensitised Tube ) 385 Identification Of Fermentes And Non-Ferments – 21341 ( Gn Test Kit Vtk ) 386 Dna Ladder / Molecular Weight Marker Size Range : 100 To 1200 Bp ( 50Μg ) 387 Dna Extraction Kit 388 Deoxynucleotide Triphosphate ( Dntp ) Mixture 389 Anaerogas Pack ( 5 Nos / Pack ) 390 Autoclavable Biohazard Plastic Bag: Size 10 Ltr 10Ltr 391 Anaerobic Blood Culture Bottle – Adult ( 50 / Pack ) 392 Anaerobic Blood Culture Bottle – Paediatric ( 50 / Pack ) 393 Anaerobic System Rubber Ring 394 Anaero Indicator Tablet Rt ( 1X10 / Pkt ) 395 Autoclavable Plastic Vial Flat Bottom, Screw Capped 11.5 Mm X53 Mm. 396 Craigie’S Tube 397 Durhams Tube 25 X 6 Mm 398 Durhams Tube 37X 6 Mm 399 Embading Cassette 1X1000 / Box 400 Kline Concavity Slides 75X56x3 Mm Thick & 12 Concavity Code Gw097 401 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 0.1Ul - 20Μl 402 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 2Ul - 200Μl 403 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 50Ul - 1000Μl 404 Microtips ( Autoclavable ) 0.1Ul - 20Μl 405 Microtips ( Autoclavable ) 2Ul - 20Ul 406 Microtips ( Autoclavable ) 5Ul-50Ul 407 Microtips ( Autoclavable ) 20Ul-200Ul 408 Microtips ( Autoclavable ) 200Ul-1000Ul 409 Microtips-1000 Ul 410 Microtips-5000 Ul 411 Microtitre Plate With Round Bottom Wells 96Wells 412 Microtitre Plate With Detachable Wells 96Wells 413 Micro Centrifuge Autoclavable Plastic Tubes With Cap 2Ml 414 Micro Centrifuge Autoclavable Plastic Tubes With Cap 5Ml 415 Micro Centrifuge Autoclavable Plastic Tubes With Cap 10Ml 416 Mac Cartney Bottles Flat Bottom With Aluminium Screw Cap & Rubber Liner. Capacity 30Ml 417 Museum Jar, With Cover 160X110x60mm 418 Museum Jar, With Cover 170X130x210 Mm 419 Screw Capped Tubes 20X150mm 420 Serum Vials Sample Storage Box & Stand For 3Ml Capacity 421 Sample Container -Wide Mouth Bottle, 125Ml Autoclavable ( Polypropylene ) 125Ml 422 Storage Vials ( Autoclavable ) 2Ml 423 Teasing Needles For Moulds 424 Test Tube Stand - Test -Tube Size - 25Mm Diametre 425 Test Tube Stand - Test -Tube Size - 16Mm Diametre 426 Test Tube Stand - Test-Tube Size - 10Mm Diametre 427 Test Tube Basket, Large 428 Test Tube Basket, Small 429 Test Tube Rack To Accommodate 3 Ml. Test Tubes 5X15 430 Test Tube Rack To Accommodate 5 Ml. Test Tubes 5X15 431 Test Tube Racks:4 X 13 432 Test Tube Cleaning Brush ( Polypropylene Filament Bunched Typed Brush For Cleaning 6”, 5” & 4” Tubes ) 433 Test Tube Carrier ( Stainless Steel ) 434 V.D.R.L. Slides ( 75Mmx50mm 1.45Mm ) 435 Wash Bottle Plastic With Delivery Nozzle 200Ml 436 Wash Bottle Plastic With Delivery Nozzle 60Ml 437 Bunsen Burner 438 Bacteriological Loop Holder With Loop ( Ready To Use ) 439 Biological Indicator For Steam 440 Bowie Dicktest Pack Steam 441 Ice Box 5 Litres 442 Labels For Micro Centrifuge Tubes White Size ½” 443 Metaloops ( Changeable Nichrome Loop Embedded In Brass Rod With Heat Resistant Handle With- 444 A. 2 Mm Diameter Nichrome Wire 445 B. 3 Mm Diameter Nichrome Wire 446 C. 4 Mm Diameter Nichrome Wire 447 Metaloops ( Fixed Straight Nichrome Loop Embedded In Ss Rod With Heat Resistant Handle With- 448 Microtome Knife 449 Mops 450 Magnifying Glass, Big Size With Handle 451 Mortar - Pestle 452 Nichrome Loop-4 Mm 453 Nichrome Loop-2 Mm 454 Nichrome Loop-1.3 Mm 455 Pipette Stand ( Vertical & Horizontal ) 4 / 5 Pipettes 456 Staining Rack. 20 Slide Capacity. 457 Sprit Lamp Glass / Metal 458 Screwdrivers -Multipurpose 459 Silver Aluminium Foil 460 Surgical Knife ( Big ) 461 Sterile Swab Sticks 462 Syringe Driven Filters Ptfe ( Hydrophilic ) Pore Size 0.22Μm 463 Thermometer 37Degree C 464 Twine 465 Universal Collection Vials ( Urine Pot ) 466 Universal Wash Reagents 500Ml 467 Anti-Cd 56 468 Anti-61 469 Anti-Cd 68 470 Anti-Cd 33 471 Anti-Ki 67 ( Mib ) 472 Anti Neurofilament Protein 473 Anti-Synaptophysin 474 Anti-Gfap 475 Anti-Cd 99 476 Anti-Cd 31 477 Anti-B Hcg 478 Poly-L.Lysine 479 Anti-Cd 20 ( B Cells ) 480 Anti-Cd 45 ( Lca ) 481 Anti-S 100 482 Anti- Desmin 483 Anti-C-Erb B-2 ( Her-L / Neu ) 484 Anti-Er 485 Anti-Pr 486 Anti-Cd 3 487 Anti-Cd 20 488 Anti-Cd 117 489 Anti-Cd 34 490 Anti-Cd 30 491 Anti-Cyclin D1 492 Anti-Cd 15 493 Anti-Cd 5 494 Fitc-Conjugated Rabbit 495 Anti-Human Iga ( Alpha Chain ) 496 Fitc-Conjugated Rabbit 497 Anti-Human Igg ( Gamma Chain ) 498 Fitc-Conjugated Rabbit 499 Anti-Human Kappa Light Chain 500 Fitc-Conjugated Rabbit 501 Anti-Human C3c Complement 502 Fitc-Conjugated Rabbit 503 Anti-Human Igm ( Mu Chain ) 504 Fitc-Conjugated Rabbit 505 Anti-Human Lambda ( Light Chain ) 506 Ana By Hep-2-Cell-Line Substrate ( Kit With Reagents ) 507 Electrodes For Μph System 361 508 Osmium Tetroxide 509 Chromium Trioxide 510 Zinc Chloride 511 Di-Sodium Hydrogen Phosphate Anhydrous 512 Di-Sodium Hydrogen Orthophosphate Dibasic 513 Sodium Dihydrogen Orthophosphate Monohydrate 514 Sodium Borate 515 Alpha Napthyl Butyrate 516 Anti-Cish Kits-Hpv16 / 18Dna 517 Er / P-R Control 518 Anti-Melanomal ( Hmb45 ) 519 Anti Myeloperoxidase 520 Anti -Nse 521 Anti-Plap 522 Anti-Bc12 Oncoprotein 523 Anti-Cytokeratin7 524 Anti-Cytokeratin20 525 Anti-Brca 1Protein 526 Anti-Iga 527 Anti-Igm 528 Anti-Igg 529 Anti-Compliment Cd3 530 Anti-Rb Gene Protein 531 Anti-P53 Protein 532 Anti-Wt1 Turmor 533 Anti-Vimentin ( V9 ) 534 Anti-Ema ( E29 ) 535 Anti-P169ink4 ) 536 Kappa 537 Lamda 538 Eosine Spirit Soluble 539 Pap Pen Immuno Histochemistry 540 Anti-Cd 1A 541 Anti-Sma 542 Anti-Myogenin 543 Fluorescent Bchiff Reagent 544 Carmine 545 Acriffarine 546 Cresyl Fast Blue 547 Luxol Fast Blue 548 Cresyl Violet 549 Epinephrine ( 3X0.5Ml ) 550 Aggrecetion Ristocetion A Sulfate ( 3X0.5Ml ) 551 A D P ( Adenosine-5L Diphosphate ( 3X0.5Ml ) 552 Arachidonic Acid Lyohillzed Sodium Arachidonate 553 Collagen Soluble Calfskin ( 3X0.5Ml ) 554 Vw Fator Assay Ristocetin Cofactor ( 3X0.5Ml ) 555 Test Tube ( Siliconized, Flate Bottom 7X25x55mm ) 556 Stri Bars Plastic Coaled Micro 557 Cryo Glue ( Tissue Embedding Medium ) For Cryostat Machine 558 Diposables Blades For Cryostat Machine 559 Silicon Tubal Ring 560 Laser Spectacles 561 Fluid Warmer 562 Filter For Suction Machine ( Atmos ) 563 Nibp Monitor With Integrated Cuff Arm 564 Serum Zinc 565 Copper 566 Ceruloplasmin 567 Ammonia 568 Ammonia 569 Alcohol 570 D- Dimer 571 Anti Ds Dna 572 Anti Sn Antibody 573 Vitamin D 574 Vitamin E 575 Ngal 576 Cystatin C 577 G6 Pd 578 Lactate 579 Apo A1 580 Homocysteine 581 Bnp 582 Urinary Vma 583 Blood Ketones 584 Lip A 585 Ana 586 Anti Phospholipid Antibody 587 Vitamin C 588 Ena 589 Vitamin K 590 Iodine 591 Apo B 592 Troponin T 593 Ck Mb1 594 Ck Mb 2 595 Tibc 596 Transferrin 597 Igg 598 Igm 599 Iga 600 Inhibin A 601 ß Trace Protein 602 ?Eta 2 Microgobulin 603 Alpha 1 Antitrypsin 604 A -1 Microglobulin 605 A-2 Macroglobulin 606 Screening Kit For Inborn Error Of Metabolism 607 Eqas For Clinical Chemistry, Immunoassay, Electrolyte, Hba1c. 608 Tpo ( Thyroperoxidase ) Antibody 609 Control For M-Band Electrophoresis 610 Tnf-A 611 Il-2 612 Procalcitonin 613 5Acagcgtcatggcagagcaggtggc3’ 614 5Aaaagctcttcccgcaggatcccgc3’ 615 5Gtggctgttccgggatggccttctg3’ 616 5Cttgaagaagggctcactctgtttg3’ 617 5Cagtacgatgatgcagc3’ 618 5Caggtagaagaggcggt3’ 619 Amikacin , Neomycin & 620 Tobramycin Standard ( Hplc Grade ) 621 Edta Gel ( 15% ) 622 Acrylic - Heat Cure-Clear 623 Acrylic - Heat Cure-Pink 624 Acrylic - Self Cure-Clear 625 Acrylic - Self Cure-Pink 626 Agate Spatula 627 Alginate Impression Material ( Dustless ) 628 Articulation Paper 629 Bur - Airotor-Diamond 630 Bur - Airotor-Tc- Straight Fissure 631 Calcium Hydroxide Paste For Root Canal 632 Dappen Dish 633 Dental Floss – Waxed, 25 M 634 Dental Stone 635 Dentin Bonding Agent 636 Die Stone 637 Disposable Suction Tips With Copper Wire 638 Emery Sheet - 100, 150 And 400 Grade 639 Endodontic Gutta Percha Points ( 15-80 ) 640 Etchant Gel ( 37 % Phosphoric Acid ) 641 Fiber Composite Splint 642 Flexible Composite Polishing Discs 643 Formocresol 644 Gic- High Strength Pacakable For Posteriors 645 Glass Ionomer Cement Type I 646 Glass Ionomer Cement Type Ii 647 Gluma Dentin Desensitizer 648 Gutta Percha Sticks 649 Halogen Bulbs- 12V, 55 W 650 Hydroxyapatite Bone Graft Material 651 K File - All Sizes 652 Light Cure Composite - Flowable - All Shades 653 Light Cure Composite - Nano-Hybrid – All Shades 654 Modelling Wax Sheet No.2 655 Non Eugenol Impression Paste - Standard Pack 656 Pinnacle Tracing Sticks ( Minimum Three Years Shelf Life ) 657 Polishing Brush For Dental Lathe 658 Polymer Reinforced Zinc Oxide Eugenol Cement 659 Pumice Powder For Polishing Dentures 660 Silver Reinforced Glass Ionomer 661 Supernal Base Plate 662 Tissue Conditioner ( Soft Reliner ) 663 Ultrasonic Scaler Tip 664 Vacuum Formed Sheets - Soft And Hard - 2 And 3Mm 665 Vulcanite Trimmer ( Tc ) 666 Zinc Oxide Eugenol Impression Paste 667 Self Cure Acrylic Tooth Colour Temporary Crown Materials ( Powder & Liquid ) 668 Cold - Cure Acrylic Powder With Liquid ( White Colour ) 669 Pits And Fissure Sealant 670 Zinc Oxide Eugenol Impression Paste 671 Irm ( Intermediate Restorative Materials ) 672 Gic Fuji Tupe Ix 673 Gic Type -Ii Restoative Materials 674 Light Cure Composite Nano- Filling Materials 675 Alginate Impression Material ( Dustless ) 676 Dental Stone 677 Wedges 678 Miracle Mix Materials 679 Hand Piece Lubricant 680 Dycal 681 Suction Tips 682 Acrylic Teeth Set 683 Polishing Paste 684 Polishing Rubber Cups And Bristle 685 Disposable Glass 686 Abrasive Strips For Polishing Proximal Areas Of Teeth 687 Cellophene Matrix Strips For Lc Restoration 688 Applicator Tips For Lc 689 Desensitizing Varnish 690 Burs For Tooth Reduction Set 691 Dental Stone Cutting Burs ( Small Size ) 692 H-Files For Both Anterior And Posterior 693 K- File For Both Anterior And Posterior 694 Broaches 695 Reamers For Both Anterior And Posterior 696 Gutta Percha 697 Absorbant Paper Point 698 Titanium Post ( All Sizes ) 699 Protapper Gutta Parcha All Size 700 Alveogel 701 Rc Cal ( Intra Canal Dressing Paste ) 702 Fiber Optics Air Rotor Hand Pieces With Coupling Unit 703 Gp Cutter 704 Tungsten Carbide Burs For Air Rotor And Micro Motor Handpieces 705 Sectional Matrixs 706 Metal Crown 707 Zinc Oxide Powder And Eugenol ( Big Size ) 708 Zinc Oxide Eugenol ( Powder ) 709 Zinc Oxide Eugenol ( Liquid ) 710 Zinc Oxide Eugenol ( Ready Mix ) 711 Zno Impression Paste 712 Dycal Cement 713 Stone Burs ( All Sizes And Shape ) 714 Stone Burs For Polishing ( Fine ) 715 Composit Polishing Disc 716 Composite Cement 717 Composite Filling Kit 718 Composite Finishing And Polishing 719 Composite Polishing Disc 720 Composite Polishing Kit 721 Composite Polishing Paste 722 Endo Wash 5% 450Ml 723 Bristle Brush & Cup 724 Eugenol 15Ml 725 Eugenol 110Ml 726 Dpi Selfcure 727 Ketac Molar 728 Nt Premium 729 One Coat Bond 730 Gic Lc ( Mini ) Gc 731 Pivo Crown & Bridge Kit 732 Protaper Hand Kit 21 / 25Mm 733 Mouth Mith Handle ( Gdc ) 734 Explorer ( Gdc ) 735 Surgical Scissor ( Brp ) 736 Dpi Alloy 737 Tri Hawk 738 Glyde 3Mlx1 739 Gp F4-F5 ( Dentsply ) 740 Gp ( 15 / 35 / 40 ) Dentsply 741 Dtech Etchn 742 H File 15 / 20 / 25 743 Matrix Band No1 744 Diamond Bur 745 Shofu Crown & Bridge Kit 746 Vitrebond 747 Ah 26 748 Ketac Silver 749 Api Needle Holder 750 Nsk Push Button Airotor Handpiece 751 Apex Locator Pixi Dentsply 752 Lightcure Michine Coltene 753 Sealer Machine With Pouch 754 Scaller Tips Satellec 755 Ultrasonic Cleaner 756 Smart Burs 757 Anti Fog Mouth Mirror 758 Flouride Solution With Applicator 759 Luting Cement 760 Silicon Base Impression Materials 761 Base Putty Impression Materials 762 Light Body Impression Materials 763 Re Cap 764 Dvi Self 765 Propopar Band Kit 21 / 25Ml 766 Ghofu Crown & Bridge Kit 767 Alt 26 768 Apl Needle Holder 769 Giyote 3Ml 770 Ia File 15 / 20 / 25 771 Otech 772 Flowable Composite Shade 773 Plastic Filling Instruments 774 Cement Spatula 775 Cement Condenser 776 Ball Burnisher ( Api ) 777 Extraction Forcept For Pedo ( Set Of 16 ) 778 Tweezer 779 Diamond Round Bur 780 Diamond Straight Fissure Bur 781 Diamond Cone Shape Bur 782 Contra Angle Hand Piece 783 Paper Point ( 15-40 & 45-80 ) 784 Flamed Shaped Diamond Bur ( All Sizes ) 785 Spoon Excavator 786 Cold Mold Seal 787 Pain Off 788 Shade Guide 789 Coe- Pack 790 Apexit Plus 791 Fibre Post ( Yellow, Red , Blue ) 792 Gingival Retraction Cord 793 Spreader / Plugger ( All Sizes ) 794 Disposable Napkin 795 Crown Cutting Kit 796 Elevators ( Straight And Periostal ) 797 Extraction Forcept For Pedo Adult ( Set Of 14 ) 798 G-Coat Plus 799 Protemp With Tips And Gun 800 Gic Type Ix 801 Durable Flouride Releasing Coating 802 Light Curing Nano Ionomer Restorative 803 Remin Pro ( Protective Dental Cream ) 804 Chair Bulbs ( Ocero Infinity ) 805 Cold Cure ( Pink ) Powder 806 Cold Cure ( White ) Powder 807 Cold Cure Liquid 808 Green Sticks 809 Mercury 810 Disposable Patient Apron 811 Bobe Cutter 812 Bobe Ronger 813 Bone File 814 Mought Prod Chain 815 Macet / Hammer 816 Amalgam Condenser 817 Amalgam Carrier 818 Amalgam Curver 819 Wax Knife 820 Wire Cutter 821 Plier 822 Rubber Dam Kit 823 Crown Remover 824 Micromotor Drill Bits 825 Compo Roller 826 Gp Holder 827 Surgical Micromotor 828 Periodontal Probe 829 Acrylic Mixing Jar 830 Air Polisher 831 S.S. Inter Maxillary Fixation Screws 2.0Mm - 12-14Mm 832 S.S. Inter Maxillary Fixation Screws 2.5Mm - 12-14 Mm 833 Titanium Cranial Microplates ( 0.5Mm Plate Thickness ) 10-18Hole Straight 834 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 4 Hole With Bar / Gap 835 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 10-12Hole Straight 836 Titanium Midfacial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Right Side 837 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Left Side. 838 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Right Side 839 Titanum Mid Facial Miniplates ( 0.5-0.6Mm Plates Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Left Side 840 Titannium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Right Side 841 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Left Side 842 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 4 Hole With Bar / Gap 843 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 6 Hole With Bar / Gap . 844 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 10 Hole 845 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) T Plates 5 Holes 846 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Y Plate 4 Holes 847 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Double Y Plate 4 Holes 848 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) X Plate 5 Holes 849 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Straight Plate 10-12 Holes 850 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 12-16 Holes 851 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 20-25 Holes 852 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 853 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 854 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 855 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 856 Titanium Double Angled Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 857 Titanium Cranial ( Outer Diameter 1.0-1.2 Mm ) Non Self Drilling Screw- 4-6 Mm Length 858 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -6Mm Length 859 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -8 Mm Length 860 Titanium Midfacial ( Outer Diameter 1.8 / 1.9Mm ) Non Self- Drilling Emergency Screw -6 Mm Length 861 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -6Mm Length 862 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -8Mm Length 863 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -6Mm Length 864 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -8 Mm Length 865 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Screw -10Mm Length 866 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Maxi Screw -12Mm Length 867 Titanium Reconstruction ( 2.4Mm ) Non Self- Drilling Maxi Emergency Screw -8-20Mm Length 868 Titanium Lag Screws Non Self Drilling ( Outer Diameter 2.4 / 2.5 Mm ) - 15-20Mm Length 869 Drill Bit With 6Mm Stop For Titanium Cranial ( 1.0 / 1.2Mm, 1.0 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 870 Drill Bit With 6Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 871 Drill Bit With 8Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 872 Drill Bit With 6Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 873 Drill Bit With 8Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 874 Drill Bit With 10-12Mm Stop For Titanium ( 2.4Mm Reconstruction, Pilot Hole Diameter 2Mm ) Non Self-Drilling Screw 875 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 4X4 Cms 876 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 6X6 Cms 877 Titanium Mesh For Mandible ( 0.5-0.6Mm Thickness ) Approx. Dimension 10X8 Cms 878 Titanium Orbital Reconstruction Mesh Plates- Small 879 Titanium Orbital Reconstruction Mesh Plates- Medium 880 Titanium Orbital Reconstruction Mesh Plates- Large ( With Medial And Lateral Wall Extensions ) 881 Porous Polyethylene Orbital Sheets ( 0.8-1.5 Mm Thickness; 5X5 Cms Approx ) 882 26 Guage Stainless Steel Wire Spool 883 32 Guage Stainless Steel Wire Spool 884 Raney Clips Stainless Steel 885 022 Slot Mbt Brackets With Weldable Convertible Utld First Molar Buccal Tubes And Nc Ii Molar Tubes 886 Crimpable Hooks 887 016 Multistranded Ss Wire 888 Preformed Archwire - 014 Niti U / L 889 Preformed Archwire - 016 Niti U / L 890 Preformed Archwire - 016 X 022 Ss – U / L 891 Preformed Archwire - 017 X 025 Ss– U / L 892 Preformed Archwire - 019 X 025 Ss – U / L 893 Orthodontic Stone 894 Dunaform – Soft And Hard Sheets- 2Mm, 3Mm 895 Dental Surgery 896 Mouth Mirror With Handle 897 Mouth Mirror 898 Dental Probe 899 Periodontal Probe 900 Dental Explorer ( Curved And Pigtail ) 901 Glass Bead Sterilizer 902 Airotor Handpiece - Mini-Head ( 2 Years Warranty ) 903 Medesy / Hu Friedy Maxillary Anterior Extraction Forceps 904 Medesy / Hu Friedy Maxillary Reeds Extraction Forceps 905 Medesy / Hu Friedy Maxillary Premolar Extraction Forceps 906 Medesy / Hu Friedy Maxillary Molar Extraction Forceps Right / Left 907 Medesy / Hu Friedy Maxillary Bayonet Extraction Forceps 908 Medesy / Hu Friedy Maxillarythird Molar Extraction Forceps 909 Medesy / Hu Friedy Mandibular Anterior Extraction Forceps 910 Medesy / Hu Friedy Mandibular Premolar Extraction Forceps 911 Medesy / Hu Friedy Mandibular Molar Extraction Forceps 912 Medesy / Hu Friedy Warwick James Elevator-Straight 913 Medesy / Hu Friedywarwick James Elevator-Right / Left 914 Medesy / Hu Friedycryers Elevator-Small Size- Right / Left 915 Medesy / Hu Friedycryers Elevator-Medium Size- Right / Left 916 Medesy / Hu Friedycryers Elevator- Large Size-Right / Left 917 Double Angled Currette- Medium Size 918 Double Angled Currette- Large Size 919 Molts Perisoteal Elevator 920 Freer Periosteal Elevator 921 Walshams Nasal Forceps- Pair 922 Asche Septal Forceps 923 Haytons Williams Maxillary Forceps 924 Rowes Zygomatic Elevator 925 Sigmoid Notch Retractor ( Left / Right ) 926 Ramal Retractor 927 Wire Cutter 928 Wire Twister 929 Coronoid Retractor 930 Mastoid Self Retaining Retractor 931 Mandibular Lower Border Retractor 932 Condylar Retractor 933 Dingmann Retractor ( Adult ) 934 Vestibular Retractor 935 Swallow Tail Retractor 936 Curved Pterygoid Osteotome 8Mm 937 Curved Pterygoid Osteotome 10Mm 938 Epker Osteotome 4Mm / 6Mm / 8Mm Curved 939 Epker Osteotome 4Mm / 6Mm / 8Mm Straight With Marking 940 Orthodontic Model Boxes 941 Tongue Guard - Medium 942 Dontrix Gauge 943 Extraoral Force Gauge 944 Orthodontic Typodont Set ( With Wax Ridges And Teeth Set ) 945 Plaster Vibrator ( Worktop Area Of At Least 20 X 10 Cm, Adjustable Setting, 2 Years Warranty ) 946 Haematoxylin & Eosin Stain 947 Eosin & Negrosin Stain 948 V.G. Tube 949 Manipulation Pipette 950 Metallic Tvs Needle Guided Bracket 951 Syringe Non Rubber 1Ml 952 Granulocyte Colony Stimulating Factor 953 Pipelle Aspirator / Vabra Aspirator 954 Progesterone Gel 955 Injectable Progesterone 956 Latex Condom Without Spermicide 957 Osafe Incubator And Laminar Floor Cleaning Lotion 958 Fersafe Antiseptic Lotion 959 Liquid Nitrogen For Cryocan 960 Immunobeads Reagents ( Rabbit Anti Human Igg 961 Immunobeads Reagents ( Rabbit Anti Human Iga 962 Immunobeads Reagents ( Rabbit Anti Human Igm 963 Conical Dispo Beaker 3.0Ml 964 Prp Lens 965 Facs Tube ( 12 X 75Mm, 5Ml Round Bottom Test Tube, Snap, Sterile Cat: 352054 966 Kymograph Paper ( 100 Sheets ) 967 Perimetric Chart Paper ( 100 Sheets ) 968 Haemocytometer Box 969 Haemoglobinometer Sets 970 Dewar Tank 11 Litre 971 Cryo Pro - 500Ml ( Liquid Nitrogen Cryosurgical Equipment 972 Bulb For Telepack Lamp 973 Radiofrequency Electrode Round Loop Big 974 Radiofrequency Electrode Round Loop Small 975 Bacterial Filter Machine Sl No:101122008 976 Indirect Ophthalmoscope 977 20448-000Hgh Pressure Hose ( Erbe Cryo Unit ) ) 978 Bone Hand Drill Moore - 8448.28 979 Hand Drill Jacobs Chuck 980 Demartel Condf / Wire Sawsflex 350Mm 981 Twist Drill Set Of 3Mm, 3.5Mm 4Mm, 4.5Mm 982 Crocodile Forceps ( Ear Microsurgery ) 983 Ear Microsuction Tips 984 Adaptors For Ear Microsuction Tips 985 Cup Ear Forceps 986 Perforators For Stopedectomy 0.4Mm 987 Perforators For Stopedectomy 0.5Mm 988 Rigid Pharyngoscope ( Pediatric ) 20Cm 989 Tonsil Holding Forceps 990 Straight Pick ( Tympanyplasty ) 991 Back Biting Forceps For Endoscope Nasal Surgery 992 Fiberoptic Otoscope With Pneumatic Pump 993 Bismith Lodopyrrophosphate ( Bipp ) Paste / Powder 994 Mercurochrome Lotion 995 Haed Light Fot Ent 996 Endoscopic Biopsy Forceps With Needle 997 Cpr Manikin 998 Intubation Manikin 999 Easy Pump 1000 Mri Contrast Media - Gadoterate Meglumine Injection 5Mmmol / Ml. 10 Ml Vial 1001 Mri Contrast Media - Gadobenate Dimeglumine Injection 10Ml Vial 1002 Mri Contrast Media - Gadopentetate Dimeglumine Injection 0.5Mmol / Ml. 10 Ml Vial 1003 Mri Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5Ml 1004 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg - 50 Ml Vial 1005 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg -100Ml Vial 1006 Non -Ionic Contrast Media - Iopromide Injection: Usp 300Mg -100Ml Vial 1007 Non -Ionic Contrast Media -Iobitridol 350Mg -100Ml Vial 1008 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -50Ml Vial 1009 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -100Ml Vial 1010 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -50Ml Vial 1011 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -100Ml Vial 1012 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -50Ml Vial 1013 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -100Ml Vial 1014 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -50Ml Vial 1015 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -100Ml Vial 1016 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20Ml Vial 1017 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50Ml Vial 1018 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100Ml Vial 1019 Coupland All Nos 1020 Elevators ( Cryer ) 1 Pairs 1021 Castrovejo Scissor 1022 Samll Micro Scissor 1023 Light Cure Composite A2 1024 Light Cure Composite A3 1025 Light Cure Composite A3.5 1026 H-Files For Size ( 15-40 ) 21Mm 1027 Tooth Polishing Brush 1028 Glide 1029 Gracy Currette 1030 Polyester Braided Suture * 2 75Cm Hgs-21, Blue 37Mm 1 / 2 Circle Taper Point : Size-2 1031 Polyester Braided Suture * 2 75Cm Hos-10, Blue 26Mm 1 / 2 Circle Reserve Cutting : Size-2 1032 Polyester Braided Suture * 1 75Cm Hos 12, Blue 40Mm 1 / 2 Circle Reserve Cutting Size -1 1033 Polyester Braided Suture * 5 75Cm Hos-14, Blue 57Mm 1 / 2 Circle Reverse Cutting Size-5 1034 Polyester Braided Suture * 25X75cm Kv-37, Blue 40Mm 1 / 2 Circle Tapercutting Size-2 1035 Poleyster Braided Suture * 54X75cm Kv-40, Blue 45Mm 1 / 2 Circle Tapercutting Size-5 1036 Monofilament Knotless Polyglyconate Wound Closure Device, 0 45Cm Gs-21, Green 37Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-0 1037 Monofilament Knotless Polyglyconate Wound Closure Device, 2-0 30Cm Cm V-20, Green 26Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-2-0 1038 Monofilament Knotless Glycomer 631 Wound Closure Device, 3-0 45Cm P-14, Undyed 24Mm 3 / 8 Circle Resverse Cutting, Box Of 12 Foils Size- 3-0 1039 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 60Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1040 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 75Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1041 Polybutester Monifilament Suture With Polytribolate Coating Size-*5-0, 75Cm 2Xcv-11X36, Blue 12Mm 3 / 8 Circle Taper Point 1042 Polybutester Monofilament Suture With Polytribolate Coating Size-*4-0 90Cm 2Xcv-23X36, Blue 17Mm 1 / 2Circle Taper Point Size: 4-0 1043 Polybutester Monofilament Suture With Polytribulate Coating Size-*5-0 90Cm2xcv, Blue 17Mm 1 / 2 Circle Taper Point Size: 5-0 1044 Polybutester Moniofilament Suture With Polytribulate Coating Size-*5-0, 75Cm 2Xkv-11X36, Blue 13Mm 3 / 8 Circle Tapercutting Size: 5-0 1045 Polybutester Monofilament Suture With Polytribolate Coating Size-* 7-0, 60Cm 2Xmv-175-8, Blue 8Mm 3 / 8 Circle Taper Point Size: 7-0 1046 Polybutester Monofilament Suture With Polytribolate Coating Size-*2-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1047 Polybutester Monofilament Suture With Polytribolate Coating Size-*3-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1048 Monofilament Knotless Glycomer 631 Wound Closure Device, 2-0 23Cm , Violet 27Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size- 2-0 1049 Vaccutrend Needle / Syringe 21 X 15 1050 Vaccutrend Needle / Syringe 22 X 15 1051 Vaccutrent Needle / Syringe 1052 Immunohistochemistry: 1053 Anti Pax-5 Ffpe 1054 Anti Ebv Ffpe 1055 Anti Pan Cmv Ffpe 1056 Anti Cd 68 Ffpe 1057 Anti Wti Ffpe 1058 Anti Plap Ffpe 1059 Anti C3 Ffpe 1060 Anti Sma Ffpe 1061 Anti Ar Ffpe 1062 Anti Bc16 Ffpe 1063 Anti Myogenin Ffpe 1064 Anti Idh-1 Ffpe 1065 Anti Atrx Ffpe 1066 Anti P63 Ffpe 1067 Anti Neurofilament Ffpe 1068 Anti Cd 19 Ffpe 1069 Anti Msa Ffpe 1070 Anti Adipophylin Ffpe 1071 Anti Alk D5f3 Ffpe 1072 Anti Arginase-1 Ffpe 1073 Anti B Catenin 1074 Bcl 10 Ffpe 1075 Anti Ber-Ep4 Ffpe 1076 Anti Clauclin 4 Ffpe 1077 Anti D2 - 40 Podolanin Ffpe 1078 Anti Dog 1 Ffpe 1079 Anti Sall 4 Ffpe 1080 Anti Erg Ffpe 1081 Anti Hbmeigg4 1082 Anti Inhilein Ffpe 1083 Anti Insm 1 Ffpe 1084 Anti Mammaglobin Ffpe 1085 Mart 1 Ffpe 1086 Anti Melan A Ffpe 1087 Anti Mdm2 Ffpe 1088 Anti Napsin A Ffpe 1089 Anti P40 Ffpe 1090 Anti Pax-8 Ffpe 1091 Anti Stat-6 Ffpe 1092 Anti Tle-1 Ffpe 1093 Anti Uroplalcin-2 Ffpe 1094 Anti Glycophorin Ffpe 1095 Anti Gcet-1 Ffpe 1096 Anti Cd 38 / 138 Ffpe 1097 Anti Calcitonin Ffpe 1098 Anti Caldermon Ffpe 1099 Anti B Caldermon Ffpe 1100 Anti Cd 56 Ffpe 1101 Anti Nsm Ffpe 1102 Anti Cd 99 Mic-2 , 013 Ffpe 1103 Anti Cd 138 Ffpe 1104 Anti Cdh 17 Cadherin 17 Ffpe 1105 Anti Heparii Ffpe 1106 Anti Glypican-3 Ffpe 1107 Anti Stab 2 Ffpe 1108 Anti Hrp Polymer Kit 1109 Fitc Lambda Light Chain Immunofluorescence 1110 Fitc Igm Immunofluorescence 1111 Fitc Iga Immunofluorescence 1112 Fitc Igg Immunofluorescence 1113 Fitc C3 Immunofluorescence 1114 Mlh1, Msh2, Msh6, Pms2 ( Together ) 1115 Pdl1 Clone Sp142 1116 Egfr Clone 31G7 1117 Cdx2 1118 Gata 3 1119 Ck 18 1120 Mesothelin 1121 Glut 1 1122 Gcdfp 1123 Myb 1124 Plag 1 1125 Hmga 2 1126 Eber In-Situ Hybridization 1127 Pcr 1128 Egfr Rt Pcr Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1129 Msi Detection Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1130 Bcr-Abl1-Pcr Kit Compatible With Qiagen 1131 Fish 1132 Alk Mutation Break Apart Probe In Lung Adenocarcinoma 1133 Myb-Nfib Dual Colour Fusion Probe 1134 Myb Dual Colour Break Apart Probe 1135 Maml2 Dual Colour Break Apart Probe 1136 Etv6 Dual Colour Break Apart Rearrangement Probe 1137 Plag 1 Rearrangement Probe 1138 Hmga 2 Rearrangement Probe 1139 Immunofluorescence 1140 Anti P-Anca Direct Immunofluorescence 1141 Anti C-Anca Direct Immunofluorescence 1142 Anti Ana Direct Immunofluorescence 1143 Anti Aquaporin 4 1144 C1q 1145 Flowcytometry 1146 Cd 16 Apc 1147 Hla B27 Kit ( Should Be Compatible With Bd Facscalibur ) 1148 Elisa ( Mago-4 ) 1149 Anti P-Anca Elisa 1150 Anti C-Anca Elisa 1151 Anti Cyclic Citrulinated Peptide ( Ccp ) Elisa 1152 Anti Smith Elisa 1153 Anti Peroxiredoxin Vi ( Prx Vi ) Elisa 1154 Anti Bmi I Elisa 1155 Anti Matrix Metalloproteinase 7 ( Mmp7 ) Elisa 1156 Anti Ny Eso I 1157 Anti Scl 70 1158 Anti Urnp 1159 Chemicals And Consumables 1160 Proteinase K 1161 Pronase 1162 Fish Reagents : 1163 Poly L Lysine 1164 20X Saline Sodium Citrate ( 20X Ssc ) Salt, Molecular Grade 1165 1 M Nascn ( 1M Sodium Thiocyanate ) Salt, Molecular Grade 1166 Igepal @ Ca 630 1167 Rubber Cement 1168 Dapi 1169 Sodium Chloride ( Nacl ) , 58.44G Mol-1 Molecular Grade 1170 Sodium Citrate ( Na3c6h5o7 ) 258.06G Mol-1 Molecular Grade 1171 Fluorescence Microscopic Immersion Oil 1172 Immunofluorescence Reagents : 1173 Trypsin Powder, Molecular Grade 1174 Additional Consumables / Disposables 1175 15Mm Double Swivel With Port & Extension 1176 72 Hours Closed Ventilation Suction Catheter Must Have Double - Lumen Siliconised Catheter Swivel Connector Un-Coupling Wedge, Lockable Thumb –Valve End Cap, Softer Sleeve Material, 72 Hour Recommended During Of Use. Size: 12F, 14F, 16F 1177 Adjustable Circle Breathing System ( 2 Litre Bag, 2 Metre Length And 1.5 Metre Limb ) 1178 Adjustable Circle Breathing System ( 2 Mts Length ) 1179 Adult Curved Flared Prong With Tube1.8M Length 1180 Adult Curved Nasal Prong With Tube1.8M Length 1181 Adult Respi-Check High Concentration Oxygen Mask With Oxygen Tube 1182 Anti-Microbial Circle Breathing System ( 1.6 Metre Length And 0.8 Metre Limb ) 1183 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 1.6 Metre Length, 0.8 Metre Limb ) 1184 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 2.4 Metre Length, 0.8 Metre Limb ) 1185 Apron Cloth ( Sterile ) 1186 Attest 1292 E Biological Indicator 1187 Attest Biological Indicator ( For Styeam ) 3M 1188 Attest Rapid Auto Reader Incubator ( For Steam ) ( Early Result For Biological Test ) 1189 Balanced Salt Solution ( Bss ) 1190 Bilbao-Dotter Tube With Guide Wire 1191 Bis Electrodes 1192 Bone File 1193 Bone Ronger 1194 Bp Blade With Handle ( No 15 & 17 ) 1195 Cardiac Troponin T Kit 1196 Center Hole Towel 1197 Coban Tm 4 1198 Cols Light Source For Transillumination 1199 Contra Angle Hand Piece 1200 Disposable Face Mask ( Cloth ) 1201 Disposable Head Positioning Device For The Prone Position – Made Of Latex- Free Foam With Mirror For Providing The Clinician A Clear View Of Face, Eye & Endotrachael Tube Plus Sloted Design For Positioning Of Endotracheal On Either Side Of The Patient Face 8000Hdp 1202 Disposable Kellys Pad 1203 Ecg Monitoring Electrode ( Solid Hydrogel ) 1204 Ecg Monitoring Electrode With Foam Backing 2223 1205 Ecg Monitoring Electrode With Foam Backing Large 1206 Elastometric Infusion Pump For Analgesia 5Ml / Hour 1207 Elastometric Infusion Pump For Analgesia 2Ml / Hour Model Sv2 1208 Elevators ( Straight And Periostal ) 1209 Emergency Cricothyrotomy Device Adult 4Mm Id Children 2Mm Id 1210 Eye Wear For Composite Fillings 1211 Face Guard 1212 Fibre Splint 1213 Fluid Warming Cassette ( Disposable ) Wf-250 1214 Fluid Warming Cassette ( Disposable ) Wf-100 1215 Gigly Saw 1216 Glass Bead Sterilizer 1217 Tungsen Carbide Burs For Air Rotor And Micro Motor Hand Pieces 1218 Green Pvc Tubing For Oxygen 6 Mm, Length In Metres 1219 Iodixannol 320 Mg Iodine / Ml-100 Ml. 1220 Iohexol 300 Mg-Iodine / Ml 100 Ml 1221 Iomeron 400 Mg / Ml – 50 Ml. 1222 Ioversol / Iopamide / Iopamidol – 50 Ml. 1223 Iso Green Standard Laryngoscope System ( Disposable Plastic Blades ) 7 Sizes Of Mac And Miller Blades 1224 Jess Fixtators Pediatric / Large 1225 Jobsons Probe 1226 Kinesiology Color Tap / Taping For Orthopaedic Used 1227 Killians Nasal Speculum 1228 K-Wires: 1.8Mm 1229 K-Wires: 4Mm 1230 K-Wires: 1.5 Mm 1231 K-Wires: 2.5 Mm 1232 K-Wires: 2Mm 1233 K-Wires: 3Mm 1234 Macintosh Style Blades 2, 4 1235 Magill’S Forceps Adult Child Infant 1236 Manual Plaster Cutting Saw 1237 Manual Plaster Spreader 1238 Manual Torniquet ( Cuff & Pump ) 1239 Mayo Stand Cover 1240 Miller Style Blades 0, 1241 Miller Style Blades 1 1242 Mortar And Pestle 1243 Mouth & Cheek Retractor 1244 Mouth Mirror 1245 Mri Compatible Laryngoscopes All Sizes 1246 Mri Film 14” X 17” 1247 Neopuff ( Neonatal Resuscitator ) 1248 North Nasal Preformed Cuffed Tubecuffed Must Have Ivory Pvc Profile Soft Seal Cuff, Implantation Tested Black Intubations Depth Marker, 15Mmconnector With 1S0 5356-1 Larger Cuff Resting Diameter Size: 6To 8Mm Id & Length 27Cm To 30.5 Tips To Nares 1249 Ovarian Shield ( Kiran ) 1250 Oxygen Supply Tubing For Heat & Moisture Exchanger Oxygen Supply Tubing For Heat & Moisture Exchanger With Connector To Attach Hme For Tracheostomy Tube Length 15Cm 1251 Oxygen Analyser 1252 Oxygen Blenders 1253 Para Film Roll ( Size 10Cmx125cm ) 3 “ Dia 1254 Parafilm, Roll 1255 Perineural Catheter For Continuous Plexus And Peripheral Nerve Blocks. Content: 118 G Lacoplex Needle With Centimeter Graduation 1 Perinueral Pebax Catheter ( 0.45 X 0.85Mm – 50Cm Long ) With Centimeter Distance Markings And Open Distal Tip 1 0.22 Antibacterial Filter 1 Additional Extension Tube, 50Cm Long, 1.5 X 2.5 Mm Dia, Priming Volume 1.10Ml 1 10Ml Syringe For The Aspiration Test 1 10 X 15 Cm Dermafilm Transparent Adhesive Dressing 1256 Periostal Elevators ( Small And Big ) 1257 Winged Infusion Set- Non Coring Needles With Injection Site To Access Ports, 20G X 1.00 ( Needle ) 1258 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-7Fr, 65Cm Length ( Ped ) 1259 Hickman-Broviac 4.2Fr ( Or Smaller ) Single Lumen Pediatric Cath W Stic Papais 1260 Hickman-Broviac 6.6Fr Single Lumen Pediatric Cath W Stic 90Cm 1261 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-9Fr, 90Cm Length ( Adult ) 1262 Plaster Cutter Electric 1263 Plaster Saw 1264 Plier Long Nose 1265 Pneumatic Compression Stocking 1266 Portable Autoclave Electrically Operated Made Of Aluminium Size:300Mm X 300Mm Capacity 24 Litres 1267 Portable Autoclave Electrically Operated Made Of Aluminium Size:350Mm X 300Mm-325Mm Depth: 1.5 Kw 1268 Pyridin 1269 Reusable Pressure Monitoring Cable With Integrity Check System By 100Mmhg Pressure And With Reusable Modular Clamp 1270 Reusable Pressure Transducer With Integrity Check System By 100Mmhg Pressure, With Microchip Technology, Reusable Cable, And With Reusable Clamp 1271 Ronguers ( Down Cutter ) 1272 Ronguers ( Up Cutter ) 1273 Rubber Macintosh 1274 Russian Forceps 1275 Light Weight Hernia Mesh, Pga Polypropylene 11 X 15 1276 Light Weight Hernia Mesh, Pga Polypropylene 6 X 11 1277 Seldinger Technique Catheter For Arterial Puncture Content: 1 Transparent And Xpo Cathter ( Pe ) / ( Ptfe ) 1 Intruducer Needle 1 Straight Wire 115.092 115.094 115.118 5118.702 5118.703 1278 Self Holding Retractors For Spine Surgery 1279 Single Use Resuscitation Mask For Cpcr ( Non-Return Valve, Integral Bacterial / Viral Filter ) 1280 Slide Mailer 1 Slide 1281 Slide Mailer 2 Slide 1282 Soap Dispenser 1283 Soda Lime ( Imported ) – Changes From White To Violet On Exhaustion 5Kg 1284 Sodium Hypochloride Solution 5Litre 1285 Spreader / Plugger 1286 Steinman Pins:4.5Mm 1287 Steinmann Pins 1288 Sterigage Chemical Indicator ( For Steam ) 3M 1289 Surgical Clipper 1290 Surgical Preparation Razor 1291 Thermal Videographic Printer ( Black & White ) ( Sony, Latest Up Series ) 1292 Tissue Paper For Ultrasound 1293 Ultra Violet Cabinet ( 800 / 500 X 2000 Mm ) 1294 Vacuum Assisted Dressing System 1295 Vascular Debeky Angle ( Medium ) 1296 Vascular Debeky Straight ( Medium ) 1297 Vaseline Gauze 1298 Ventilator 15 Mm Breathing Systems ( With Luer Lock, 1.6 Metre Length And Resealable Water Trap ) For Paediatrics 1299 Ventilator Breathing System With Resealable Water Traps ( Smooth Lumen ) 1300 Waste Management Wheeled Bins. ( 660Lit ; 300Lit; 1100 Lit ) 1301 Wire Cutter 1302 Y-Pieces For Breathing Circuit 1303 Absorbable Gelatin Sponge U.S.P ( Ab-Gel ) 10 X 10 1304 Alginate Impression Materials ( Dust Free ) 1305 Double Swivel With Port 15Mm 1306 Green Pvc Tubing 6Mm For Oxygen / Per Meter 1307 2 Mm Osteotomes 1308 3 Mm Osteotomes 1309 Asepto Pump 1310 Autoclavable Biohazard Plastic Bag 10Liter 1311 Autoclavable Biohazard Plastic Bag 20Liter 1312 Autoclavable Biohazard Plastic Bag 30Liter 1313 Bone Cement ( Plain ) 1314 Bone Cement ( Antibiotics ) 1315 Bougie ( Stylet ) 1316 Burretta 1317 Capd Catheter Tenckhoff With 2 Felt Cuffs Sa 1242 ( 420 Mm ) 1318 Cast Taper Mandrel 1319 Chiesel 1320 Cleaning Brush 1321 Cleaning Solution 1322 Cpr Manikin 1323 Stoma Flatmoldable Small 45Mm 1324 Stoma Flatmoldable Medium 45Mm 1325 Stoma Flatmoldable Regular 57Mm 1326 Stoma Flatmoldable Large 70Mm 1327 Moldable Convex 12 / 22Mm 1328 Moldable Convex 22 / 33Mm 1329 Moldable Convex 33 / 57Mm 1330 Ostomy Appliance Accessories Belt 1331 Coloured Ph Indicator Paper 1332 Dissecting Instrument Box 1333 Double Swivel With Port 15 Mm X 22Mm 1334 Drape Formers Trans Femoral 1335 Drape Formers Trans Tibial 1336 Espocan With Docking System 1337 Eto Chemical Indicator Tape -3M 1338 Eto Packing Sleeves Roll ( 3M ) 12 1339 Eto Packing Sleeves Roll ( 3M ) 4 1340 Eto Packing Sleeves Roll ( 3M ) 6 1341 Surgicel Fibrillar 1963 1342 G- Bone 1343 Gloves Wrapper 1344 Laparoscopic Aspiration Needle 1345 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 3.5Mm 1346 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 4.8Mm 1347 Hose Mount 15Mm Female Male Pair 1348 Hose Mount 22Mm Female Male Pair 1349 Hygrobaby / Hme Filter ( Infant ) 1350 Hygroboy / Hme Filter ( Paediatric ) 1351 Hygrostar / Hme Filter ( Adult ) 1352 Hygrobac S 1353 Intraocular Lense 6Mm Optics Foldable, Square Edge, Hydrophobic 1354 Intraocular Lense Rigid 5.25Mm Optics, Pmma, Square Edge 1355 Intraocular Lense Rigid 5.5Mm Optics 1356 Intraocular Lense Rigid 5.5Mm Optics Foldable 1357 Intraocular Lense Rigid 6Mm Optics 1358 Intraocular Lense Rigid 6Mm Optics Foldable 1359 Intraocular Lense Rigid 6Mm Optics, Pmma, Square Edge 1360 Rigid Anterior Chamber Intraocular Lens: Lens Power +16D ( 6.00Mm ) 1361 Rigid Anterior Chamber Intraocular Lens: Lens Power +19D ( 6.00Mm ) 1362 Rigid Anterior Chamber Intraocular Lens: Lens Power +18D ( 6.00Mm ) 1363 Rigid Anterior Chamber Intraocular Lens: Lens Power +20D ( 6.00Mm ) 1364 Rigid Anterior Chamber Intraocular Lens: Lens Power +21D ( 6.00Mm ) 1365 Rigid Anterior Chamber Intraocular Lens: Lens Power +22D ( 6.00Mm ) 1366 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1367 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.5D ( 5.50Mm ) 1368 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1369 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.0D ( 5.50Mm ) 1370 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.5D ( 5.50Mm ) 1371 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.0D ( 5.50Mm ) 1372 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.5D ( 5.50Mm ) 1373 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.0D ( 5.50Mm ) 1374 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.5D ( 5.50Mm ) 1375 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.0D ( 5.50Mm ) 1376 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.5D ( 5.50Mm ) 1377 ( A ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +10.0D 6.0Mm 1378 ( B ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +113.5D 6.0Mm 1379 ( C ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+14.0D 6.0Mm 1380 ( D ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.0D 6.0Mm 1381 ( E ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.5D 6.0Mm 1382 ( F ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.0D 6.0Mm 1383 ( G ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.5D 6.0Mm 1384 ( H ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.0D 6.0Mm 1385 ( I ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.5D 6.0Mm 1386 ( J ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.0D 6.0Mm 1387 ( K ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.5D 6.0Mm 1388 ( L ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19..0D 6.0Mm 1389 ( M ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19.5D 6.0Mm 1390 ( N ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.0D 6.0Mm 1391 ( O ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.5D 6.0Mm 1392 ( P ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.0D 6.0Mm 1393 ( Q ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.5D 6.0Mm 1394 ( R ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.0D 6.0Mm 1395 ( S ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.5D 6.0Mm 1396 ( T ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+23.0D 6.0Mm 1397 ( U ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +23.5D 6.0Mm 1398 ( V ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.0D 6.0Mm 1399 ( W ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.5D 6.0Mm 1400 ( X ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.0D 6.0Mm 1401 ( Y ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.5D 6.0Mm 1402 ( Z ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+26.0D 6.0Mm 1403 Mayo Trolly Cover ( Disposable ) 1404 Membrane Assembly 1405 Micro Centrifuge Tube 1.5Ml 1406 Micro Centrifuge Tube 15Ml 1407 Micro Centrifuge Tubes-.2Ml ( With Thin Wall For Pcr ) 1408 Micro Centrifuge Tubes-.5Ml ( With Thin Wall For Pcr ) 1409 Micro Centrifuge Tubes-2Ml 1410 Microscope Bulb- 6V 20W 1411 Mini & Micropates With Screw 1412 Nasal Tubing 70Mm 1413 Needle ( Cutting ) Big 1414 Needle ( Cutting ) Medium 1415 Needle ( Cutting ) Small 1416 Needle ( Round Body ) Big 1417 Needle ( Round Body ) Medium 1418 Needle ( Round Body ) Small 1419 Non Invasive Cardiac Output Monitoring Electrode 1420 Non Invasive Cardiac Pacing Electrode 1421 Ostomy Powder 25Gm 1422 Pneumatic Compression Stocking 1423 Pressure Monitoring Kit With Three Way Disposable Pressure ( For Cvp & Atrerial ) 1424 Rae Tub 7.5 1425 Self Adhesive Urine Sample Bag - Pediatric 1426 Spirit Swabs 1427 Sterile Swab Sticks 1428 Steri-Stripes 1429 Esmarch 4 1430 Esmarch 6 1431 Polyester Synthetic Cast Padding 1432 Suction Cannula For Mtp Size Purandre 1433 Ostomy Appliance Accessories Belt 1434 Stomadress Plus Single Pouch - Opaque 1435 Activelife One Pc Drainable Pouch 1436 Tubing Kit 1437 Urianalyser 1438 Urine Control A360 1439 Ventilating Airway Bougies 1440 Ventilator Tubing W / 1 ( Venti Breathing System With Reseable Water Trap ) 1441 Y-Pieces 1442 6Mm Green Pvc Tubing For Oxygen 1443 Alpha Mattress 1444 Analspeculum Size: 25 1445 Ao Universal Clamps 1446 Baby Cradle With Mattress And Net 1447 Blood Gas Quality Control ( 30X1.7Ml ) Level 1 ( Abg ) 1448 Blood Gas Quality Control ( 30X1.7Ml ) Level 2 ( Abg ) 1449 Blood Gas Quality Control ( 30X1.7Ml ) Level 3 ( Abg ) 1450 Bone Cutter 1451 Bone Cutter Big Size 1452 Centrifuge Tube 1453 Centrifuge Tubes, Polypropylene Seal With Capacity 3.5 - 10 Ml 1454 Clavicular Braces 1455 Cider Wood Oil 1456 Debakey’S Bull Dog Clamps, Curved 115Mm ( 4 ½” ) Long 1457 Debakey’S Bull Dog Clamps, Curved 70Mm ( 2 ¾” ) Long 1458 Debakey’S Bull Dog Clamps, Curved 80Mm ( 3 ?” ) Long 1459 Debakey’S Bull Dog Clamps, Straight 120Mm ( 4 ¾” ) 1460 Debakey’S Bull Dog Clamps, Straight 75Mm ( 3” ) 1461 Debakey’S Bull Dog Clamps, Straight 85Mm ( 3 ?” ) 1462 Divided Mattress 1463 Dropper Bottle 250Ml 1464 Dropper Bottle 500Ml 1465 Dropper P.P. 6 Long 1466 Npwt Dressing Kit 1467 Silicone Rubber Heel Cups 1468 Electrodes For Ift ( For Combination Therapy-Ultra Sound Therapy + Electrical Stimulator ) ( Make: Enraf Nonius Sonoplus 491 ) 1469 Episiotomy Scissor Size 15Cm 1470 Fixation Ring ( 904-898 ) 1471 Fixation Ring ( 904-898 ) For Transcutaneous Po2 / Pco2 ( Make: Radiometer, Model: Tcm 40 ) 1472 Fluid Warmer 1473 Fogging Machine 1474 G-Bone 1475 Gigly Saw 1476 Ginevri Capillary Tube ( H ) ( Microbillimeter ) 1477 Glover With Atraumatic Jaws, Curved Jaws, 85Mm ( 3 ?” ) , 45Mm Jaws 1478 Hand Drill 1479 Hand Wash Basin Stand ( Double ) . - Five Legs Base Mounted On 5Cms Dia Castors With One 35Cm S.S Basin.Pre Treated And Epoxy Powder Coated. 1480 Hysterectomy Clamp ‘Faure’ 1481 I.V. Drip Stand 1482 Intra Uterine Cannula ‘Collins’ Plain 3 Size 1483 Intra Uterine Cannula ‘Hayes Provis’ With Rubber Cone 1484 Kidney Wash Machine ( Renatron Ii ) 1485 Knee Immobilizer Oc 2035 1486 Knee Immobilizer Oc 2035 1487 Knee Stabilizer-Dc 2069 1488 Leishmans Stain 1489 Lengenback Retractor 1490 Lengenback Retractor 1491 Lens Cleaning Paper 1492 Lymph Node 1493 Magnet For Ecg 1494 Malleable Stylets With Adjustable Stop, Different Size 1495 Measuring Tape 1496 Measuring Tape ( Clinical ) 1497 Microscope ( For Side Lab ) - Binocular Electric Light Microscope 1498 Molina Sheet 1499 Mosquito Net ( Single Use Patient Specific, Plastic ) 1500 Mouth Gag 1501 Myoma Screw ‘Doyen’ 1502 Na+ - Sensor Casing ( Abg ) 1503 Non Invasive Glucose Monitoring System ( Glucometer ) 1504 Ounce Glass Steel 1505 Oxygen Cylinder Stand / Trolley - B Type 1506 Pad Electrodes For Swd ( Dx 500 Roland ) 1507 Paper Roll ( Abg ) 1508 Patient Breathing Set Infant Reusable ( Galileo Gold ) 1509 Patient Cable For Ift / Mst ( Make / Model: Multidyne 965 ) 1510 Patient Shifting Trolleys With The Facility Of Oxygen Cylinder Carrier 1511 Pelvic Traction Kit With Pulley And Weight 1512 Pile Binder 1513 Plastic Dropping Bottle ( 120Ml ) 1514 Plastic Small Tube 1515 Raos Hand Suction Unit 100 Ml 1516 Ref. - Membrane Shell ( Abg ) 1517 Resucitation Kits Automatics 1518 Resuscitation Kit Emergency 1519 Resuscitation Kit For Neonates 1520 Rubber Sole - 4Mm 1521 Sample Detector 1522 Screw Driver 1523 Sealing Rings 1524 Set Tubing For Roller Pump ( Reagents ) ( Abg ) 1525 Shin Tube Cutting Jig 30Mm 1526 Shin Tube Cutting Jig 35Mm 1527 Short Needle Holder 1528 Side Support ( Meditrin ) 1529 Silicon Tubal Ring 1530 Solid Waste Containers Liners 1531 Solution Valve 1532 Spare Canvas Bag 1533 Spare Lamp For Opthalmoscope 1534 Spare Parts For: Easylyte, 911 , 912 & Others 1535 Spirit Lamp 1536 Stich Scissor 1537 Suture Anchor ( Orthopaedics ) 1538 Syringe Infusion Pump 1539 T- Handle For Orthopaedics 1540 Tailor Thread 1541 Tco2 Sensor 1542 Teleys Forcep 1543 Vortex Mixer 1544 Vulsellum Forceps 1 X 1 Teeth 25Cm 1545 Wire Cutter 1546 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure ) 1547 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Low Pressure ) 1548 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene. 1549 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure With Bacterial Resistance ) 1550 Manual Hub Cutter – With Biohazard Symbol And Which Can Cut The Plastic Hub And Not The Metal Needle With Temporary And Permanent Locking Mechanism On Complete Filling Of The Disposal Hub Cutter With Clear Demarcation Of Fill Line And Which Can Accomadate Upto 400-600 Needles. 1551 Cerebral Reservior ( Omaya Type ) 1552 Extranal Ventricular Drainage Syatem 1553 Lumbar Extranal Drainage System 1554 Poly Propylene Mesh ( Small ) For Duroplasty 1555 Poly Propylene Mesh ( Medium ) For Duroplasty 1556 Poly Propylene Mesh ( Large ) For Duroplasty 1557 G Bone Cement ( For Cranioplasty ) 1558 Kraniotomy Drape 1559 Iodine Drape Large 1560 Balanced Salt Solution With Na / K / Mg & Chloride Levels Similar To Plasma With Acetate & Gluconate / Malate As Buffer, Must Not Contain Calcium ( Eg.Plasmalyte A / Volulyte Etc ) 1561 Bactiseal Impregnated Shunt - Fda Approved, Fixed Pressure Vp Shunts ( Low, Medium, High ) That Are Antibiotic Impregnated And Can Reduce The Potential For Bacterial Colonization In The Lumen As Well As Its Outer Surface. 1562 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1563 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1564 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1565 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1566 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1567 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1568 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1569 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1570 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1571 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1572 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1573 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1574 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1575 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1576 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1577 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1578 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1579 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1580 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1581 Raneys Scalp Disposable Clips - Disposable Raneys Clips 1582 Cranioplasty Kit - Cranioplasty Kit, Sterile, Pack Of Two Packets Of Methyl Methacrylate And Two Vials Of Liquid. 1583 Universal Extremity Drape- Control Plus Fabric, Us Fda Certified 1584 Impervious Split Sheet- 60 X 70, 4 X 21 Split, Polyethylene Sheet, Us Fda Certified 1585 U-Bar-Pack- 1 Back Table Cover-Reinforced 44 X 88, 1 Mayo Stand Cover Reinforced 23 X 54, 1 Suture Bag, 1U Drape 71 X 124, 1 Bar Drape 71 X 124, 1 Bar Drape 41.5 X 82, Us Fda Certified 1586 Back Table Cover Zone Reinforced- 44 X 99, Us Fda Certified 1587 Impervious Stockinette-12 X 58, Uds Fda 1588 Fluid Shield Mask With Visor -Four Layer Mask, Water Resistant With Water Resistant, -Naosh, Osha Approved 1589 Hip Drape With Leg Pockets -Control Plus Fabric, Us Fda Approved 1590 Hip Drape Without Leg Pockets -Control Plus Fabric, Us Fda Approved 1591 Quattro Fx -Full Face Mask Vented 1592 Mirage Fx- Nasal Mask Vented 1593 Transmission Electron Microscope 1594 G011 / 2 Glut Em 25% Amps 1595 Self Closing Tweezer ( Biology ) T-403 1596 O001 Osmium Tetroxide 1597 Eukitt Mouning Media 1598 Taab Araldite 502 / 812 Kit ( E2o2 ) 1599 Dibutyl Phthalate 1600 E069 Embedding Mould Flat C 1601 Z10 Molecular Seive 3Nm For Drying Acetone 1602 Shaving Razor Blade 1603 300 Mesh Cu Grid With Thin Carbon Film ( Cu - 300Cn 1604 300M Mesh Cu Grid With Holey / Dbl Carbon Film ( Cu-300Hd 1605 G062 Grid Storage Box 1606 U007 Uranyl Acetate 1607 L018 Lead Citrate 1608 Truf 2208-100 1609 Octagon Magnetic Stirrer Bar ( 4151 ) 1610 Consumables 1611 Micro Tips ( 10Micro Litre ) 1612 Microcentrifuge Tube
Basic Detail
Tender No NEIGR/SP/OT/E -51D/2019 -20
Bidding Type Tender
Location
City NEIGRIHMS, Shillong, Meghalaya
State Meghalaya
Key Dates
Publish Date 27 Nov 2020
Submission Date 04 Dec 2020
Open Date 04 Dec 2020
Finance
Tender Value 30 Lakhs
Tender Fee Ref. Documents
EMD 30000
Exemption Not Available
Document List
Tendernotice_1.pdf
BOQ_553588.xls
2160C2B6-D9D1-4347-86C9-B3447213C61F.html

Unlock Full AI Tender Summary

Get instant access to the complete AI-generated analysis — scope, eligibility, timeline & more.

Instant Access Secure Free
Your details are secure and used only for document delivery.

Tender Timeline

Nov 27, 2020
11:30 IST

Tender Published

Tender notice published.

Completed
Feb 21, 2020
18:00 IST

Corrigendum-1 Issued

Clarifications on tender conditions and amendments issued.

Completed
Mar 05, 2020
18:00 IST

Corrigendum-2 Issued

Clarifications on tender conditions and amendments issued.

Completed
Apr 17, 2020
18:00 IST

Corrigendum-3 Issued

Clarifications on tender conditions and amendments issued.

Completed
Dec 04, 2020
18:00 IST

Corrigendum-4 Issued

Clarifications on tender conditions and amendments issued.

Completed
Dec 04, 2020
18:00 IST

Corrigendum-5 Issued

Clarifications on tender conditions and amendments issued.

Completed
Dec 04, 2020
17:00 IST

Bid Submission Deadline

Online submission via eProcurement portal.

Completed
Dec 04, 2020

Bid Opening Date

Technical bids will be opened and evaluated.

Completed

Tender Documents

Download All (ZIP) ↓
pdf

Tendernotice_1.pdf

xls

BOQ_553588.xls

html

2160C2B6-D9D1-4347-86C9-B3447213C61F.html

TenderDetail
Loading tenders