Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later.
Tender Overview
Project Description
Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later. - 1 Albumin 2 Microalbumin 3 Gamma Glutamyl Tranferase 4 ( ??- Ggt ) 5 Amylase 6 Lipase 7 Ck 8 Ck-Mb 9 Ldh 10 Total Cholesterol 11 Triglyceride 12 Hdl 13 Ldl 14 Calcium 15 Copper 16 Phosphorus 17 Zinc 18 Parameter 19 Iron 20 Tibc 21 Ada 22 Ada Calibrator 23 G-6-Pd 24 Glycosylated Hb 25 Glycosylated Hb Calibrator 26 Crp 27 Crp Calibrator 28 A-1 Acid Glycoprotein 29 Ammonia 30 Lactate 31 Glutathione Peroxidase 32 Superoxide Dismutase 33 Total Antioxidant Status 34 Homocysteine 35 Aso 36 Rf 37 Lipoprotein ( A ) 38 Lipoprotein ( A ) Calibrator 39 Transferrin 40 Cystatin C 41 Gentamycin 42 Barbiturates 43 Valproic Acid 44 Phenitoin 45 Vma 46 Galactosemia 47 Calcitonin 48 Calcitriol 49 Galactokinase 50 Galactose-1-Phosphate Uridyl Transferase 51 Renin 52 Acth 53 Interleukin 1 54 Interleukin 4 55 Interleukin10 56 Leukotrine A4 57 Leukotrine B4 58 Leukotrine C4 59 Leukotrine D4 60 Leukotrine E4 61 Tnfa 62 Cephalosporin 63 Serum Tryptase 64 Urine Fluoride 65 Anti-Dsdna Antibody 66 Anti Nuclear Antibody 67 Anti-Sm Antibody 68 Sodium Carbonate 69 Potassium Dihydrogen Phosphate 70 Potassium Dihydrogen Phosphate Kh2po4 ( Hplc Grade ) 71 Creatinine Powder 72 Isopropyl Alcohol, Ar Grade 73 Acetone – Ar Grade Ar Grade 74 Ammonium Chloride –Ar Grade, 75 Ammonium Nitrate – Ar Grade, 76 Ammonium Persulphate – Ar Grade, 77 Calcium Chloride Dihydrade – Ar Grade, 78 Dinitro Phenyl Hydrazine Ar Grade, 79 Magnesium Chloride – Ar Grade, 80 Magnesium Sulfate –Ar Grade, 81 Methanol – Acetone Free – Hplc Grade, 82 Methanol ( Hplc Grade ) 83 Potassium Dichromate – Ar Grade, 84 Silver Nitrate – Ar Grade, 85 Sodium Bicarbonate – Ar Grade, 86 Sodium Acetate Dehydrate –Ar Grade, 87 Ammonium Acetate – Ar Grade, 88 Thio Semi Carbazide – Ar Grade, 89 Ethidium Bromide Soln 10Ml– Biotechnology Grade, 90 Guanidium Iso Thiocyanate – Biotechnology Grade, 91 Iptg Ar Grade, 92 100 Bp Dna Ladder 1 Ml X 5 93 Taq Polymerase With Pcr Buffer 3-5 U / Μl, 1000 U Per Vial 94 Dntps 100 Millimolar Each 95 Ecori Restriction Enzyme 0.5 Ml X 1 96 Bamhi 0.5 Ml X 1 97 Hindiii 0.5 Ml X 1 98 Dna Ligase 0.5 Ml X 1 99 Dna Extraction Kit ( Column Based ) For 50 Extraction 100 Rna Extraction Kit ( Column Based ) For 20 Extraction 101 Plasmid Extraction Kit ( Column Based ) For 50 Extraction 102 Oligo Nucleotide Primers ( Hplc Purification ) 103 Rnalater 104 Depc Mol Bio Grade 105 Nuclese K 106 Milipore Prefiltrate Kit Cartridge 107 Milipore Proguard 2 Pack Cat. No. Prog0002 108 Milipore Q Guard 1 Cat. No. Qgard00r1 109 Milipore Tank Vent Filter Cat. No. Tankmpk01 110 Milipore Sanitization Tablet Cat. No. Zwcl01f50 111 Millipore Millicare Elix Cat No Jmbm01747 112 Millipore Quantum Ex Cat. No- Qtum000ex 113 Mx Cart 5 Micron 114 Mx Cart 1 Micron 115 Ro Cartridge 116 Non Sterile Millipak 40 117 Progard Ts 2 118 1 Micron Filter 119 3 Micron Filter 120 Mx Cartridge 5 Μm 121 20 Carbon Cartridge 122 Sanitization Tablets 123 Pm Kit 124 Xl Wash Solution 125 200-1000 Μl Microtips 126 100-200 Μl Microtips 127 5-50 Μl Microtips 128 1-5 Ml Microtips 129 200-1000 Μl Micropipette 130 100-200 Μl Micropipette 131 5-50 Μl Micropipette 132 2-20 Μl Micropipette 133 Microcentrifuge Tube 1.5Ml 134 Ammonium Persulphate Ar 135 Potassium Iodate ( Kio3 ) 136 Toluene Ar 137 Arsenous Acid ( As2o3 ) 138 Arsenic Trioxide 139 Ceric Ammonium Sulphate 140 20Bp Dna Ladder 141 Tris – Base Ar Grade 142 Fok I & Nlaiii Restriction Enzyme 143 Dna Loading Buffer 144 Dna Sample Loading Dye 145 Ethiduim Bromide 146 Primer ( Both Forward & Reverse ) 147 10 X Tbe 148 Heparinised Vial 149 Disposable Syringe 150 Microwave Oven 151 Glucose Kit 152 Bilirubin Kit 153 G6-Pd Kit 154 Vacutainer 155 Disposable Syringe 156 Cystatin C Kit 157 Bilirubin Kit 158 Creatinine Kit 159 Ast Kit 160 Alt Kit 161 Ise Wash 2 Solution 162 Ise Cal-3 Solution 163 Ise Cal -4 Solution 164 Microcentrifuge Tube 2Ml 165 Sp Kit 166 Rep Prep Solution 167 Sample Applicator 168 Disposable Sample Cup 169 Ast 170 Alt 171 Creatinine 172 Albumin 173 Glucose 174 Ggt 175 Bun 176 Hdl Cholesterol 177 Ldl Cholesterol 178 Cholesterol 179 Uibc 180 Rf Rtg Latex 181 Crp 182 Uric Acid 183 Triglyceride 184 Alp 185 Total Bilirubin 186 Igg 187 Direct Bilirubiun 188 Igm 189 Protein 190 Iga 191 Phosphorus 192 C3 193 Calcium 194 Ck-Mb 195 Lipase 196 Aso 197 Iron 198 C4 199 Amylase 200 Ck 201 Acid Phosphatase 202 Transferrin 203 Ldh 204 Magnessium 205 Hb-Dh 206 Haptoglobin 207 Lactate 208 Microalbumin 209 Microalbumin Calibrator 210 Cholinesterase 211 Urine Csf Protein 212 Wash Solution 213 Cleaning Solution 214 Cleaning Solution Weekly Wash 215 Crp Latex Calibrator 216 Urine Calibrator 217 System Calibrator 218 Hdl Calibrator 219 Ldl Calibrator 220 Crp Calibrator 221 Rf Calibrator 222 Ck-Mb Calibrator 223 Xl-300 / 600 Cuvette 224 Beckman Coulter Au 2700 Cuvettes 225 Xl-300 / 600 Lamp 226 Beckman Coulter Au 2700 Lamp 227 Eqas ( Bio-Rad ) 228 Apoa1 & Apob Reagent & Calibrator 229 Bio-Rad Lipid Conrol 230 Ethylene Glycol ( Ethandiol 231 Methylene Soluble ( Working Reagent 232 Tissue Capsule Big 233 Tissue Capsule Small 234 Tissue Cassettes Big 235 Tissue Cassettes Small 236 Stock Phloxine B 237 Progesterone Receptor 238 Ana Kit For Sle ( Indirect Immunoflurescence Method ) 239 Hb / Cayanaid Method Standard 240 Nalidixid 10Ug 241 Netilmycin 10Ug 242 Furozotidime 30Ug 243 Antigen And Antibody Hcv Elisa Test Kits 244 Cell Counter Reagents 245 ( Machine Available Is Abx Pentra Which Is A Closed System ) 246 Reagent For Aptt 247 Calcium Chloride For Aptt Estimation 248 Control Plasma N 249 Reaction Tube 250 Ca Clean 251 Owrens Veronal Buffer 252 Standard Human Plasma 253 Sodium Azide ( Nan3 ) 254 Bovine Thrombin 255 1000 Nih Units / Mg Of Protein 256 Anti Dce 257 Sc ( 1 ) 258 Sc ( 2 ) 259 Sc ( 3 ) 260 Yt ( A ) 261 Yt ( B ) 262 Do ( A ) 263 Do ( B ) 264 Pyr Broth 265 Pyr -Pyrolidonyl-ß Naphthylamine 266 Paradimethylaminobenzaldehyde 267 P-Dimethylaminocinamaldehyde 268 P-Nitrophenylglycerol 269 Potassium Telurite 270 Potassium Cyanide ( Kcn ) 271 Para Dimethyl Aminobenzaldehyde 272 Potassium Hydroxide 273 Potassium Hydrogen Sulphate 274 Phenol Crystal ( Powder ) 275 Phosphate Buffer Saline 276 Phenethyl Alcohol 277 Phenol Red Indicator 278 Phenol Red Indicator 279 Phenol Red 280 Phenylpyruvic Acid Reagent 281 Potassium Dichromate Lr 282 Potassium Permanganate Lr 283 Potassium Permanganate Ar 284 Potassium Phosphate Monobasic 285 Potassium Nitrate 286 Phenol ( Crystal ) 287 Peptone 288 Raffinose Ar 289 Rhammnose 290 Sodium / Potassium Dichromate 291 Sodium Citrate 292 Sodium Pyruvate Ar 293 Sodium Biocarbonate Lr 294 Sodium Acetate 295 Sodium Iodide 296 Sulphanilamine-Ar 297 Sugar Assimilation Disc – Cellobiose 298 Sugar Assimilation Disc – Dextrose 299 Sugar Assimilation Disc – Dulcitol 300 Sugar Assimilation Disc – Galactose 301 Sugar Assimilation Disc – Inositol 302 Sugar Assimilation Disc – Lactose 303 Sugar Assimilation Disc – Maltose 304 Sugar Assimilation Disc – Melibiose 305 Sugar Assimilation Disc - Raffinose 306 Sugar Assimilation Disc- Sucrose 307 Sugar Assimilation Disc – Trehalose 308 Sugar Assimilation Disc - Xylose 309 Salicin Ar 310 Tarric Acid 311 Trehalose Ar 312 Triypticase 313 Thiosulphate 314 Tri-Sodium Citrate 315 Voges Proskaeur Reagent 316 Vibriostatic ( 0 / 129 ) Agent 317 Wright’S Stain 318 Xylose Ar 319 Vibrio Cholerae-01 3Ml 320 Vibrio Cholerae-0139 3Ml 321 Vibrio Cholerae-Ogawa 3Ml 322 Vibrio Cholerae-Inaba 3Ml 323 Salmonella Polyvalent O 3Ml 324 Salmonella Polyvalent H 3Ml 325 Salmonella Polyvalent O2 3Ml 326 Salmonella Polyvalent O4 3Ml 327 Salmonella Polyvalent O9 3Ml 328 Salmonella Polyvalent H Phase I A 3Ml 329 Salmonella Polyvalent H Phase Ib 3Ml 330 Salmonella Polyvalent H Phase Ic 3Ml 331 Salmonella Polyvalent H Phase Ii 3Ml 332 Shigella Polyvalent Dysenteriae 3Ml 333 Shigella Polyvalent Flexnerii 3Ml 334 Shigella Polyvalent Sonnei 3Ml 335 Shigella Polyvalent Boydii 3Ml 336 Cryptococcus Antigen Detection Kit ( Latex Agglutination Detection ) 337 Antigen Detection Kit For Meningitis ( H Influenza B, N Meningitis A & C, S. Pneumonia, Gbs, E.Coli ) 338 Amphotericin Powder 339 Benzal Pennicillin Powder 340 Cefoxitin 5Gm / Vial 341 Clindamycin Powder 342 Ciprofloxacin 5Gm / Vial 343 Erythromycin Powder 344 Gentamicin 5Gm / Vial 345 Imipenem 5Gm / Vial 346 Oxacillin 5Gm / Vial 347 Vancomycin 5Gm / Vial 348 Anidulafungin ( 0.015-128Μg / Ml ) 349 Ceftriaxone ( 0.016-256 Ug / Ml. ) 350 Ciprofloxacin ( 0.001-8Ug / Ml. ) 351 Ceftazidime+ Clavulanate ( 0.004-128Ug / Ml. ) 352 Clindamycin E-Test ( 0.016-256 Μg / Ml ) 353 Colistin ( 0.06-0.25Μg / Ml ) 354 Caspofungin ( 0.015-128Μg / Ml 355 Doripenem ( 0.002-32 Μg / Ml ) 356 Ertapenem ( 0.002-32 Μg / Ml ) 357 Fluconazole ( 0.016-256 Μg / Ml ) 358 Imipenem ( 0.004-128Ug / Ml. ) 359 Levofloxacin ( 0.001-8Ug / Ml. ) 360 Meropenem ( 4-256 Μg / Ml ) 361 Meropenem / Edta ( 1-64 Μg / Ml ) 362 Moxifloxacin ( 0.001-8Ug / Ml. ) 363 Candida Albicans Atcc 14053 364 Candida Guilliermondii Atcc 6260 365 Candida Psedotropicalis Tcc 4135 366 Corynebacterium Diptheriae Atcc 13812 Vial 367 Escherichia Coli Atcc 25922 Vial 368 Escherichia Coli Atcc 35218 Vial 369 Enterococcus Faecalis Atcc 29212 Vial 370 Haemophilus Influenzae Atcc-49766 Vial 371 Pseudomonas Aeruginosa Atcc 27853 Vial 372 Positive Control For T.B. ( My.Tb H37rv Strain ) 373 Staphylococcus Aureus Atcc 25923 Vial 374 Streptococcus Pneumoniae Atcc 49619 Vial 375 Staphylococcus Aureus Atcc 33591 Vial 376 Salmonella Enterica Subspecies Enterica Serovar Cholerasuis Atcc-10708 Vial 377 Salmonella Enterica Subspecies Enterica Serovar Paratyphi A Atcc-9150 Vial 378 Salmonella Enterica Subspecies Enterica Serovar Typhimurium Atcc-25241 Vial 379 Shigella Flexneri Atcc- 9199 Vial 380 Ast For Gnb Ast –N280 381 Media For Pediatric Sample -259794, Bact / Alert Pf 382 Media For Aerobic Sample – 259791, Bact / Alert Fa 383 Solution For Inoculum Preparation – V1204, 3X500 Ml 384 Tubes For Inoculum Preparation - 69285 ( Unsensitised Tube ) 385 Identification Of Fermentes And Non-Ferments – 21341 ( Gn Test Kit Vtk ) 386 Dna Ladder / Molecular Weight Marker Size Range : 100 To 1200 Bp ( 50Μg ) 387 Dna Extraction Kit 388 Deoxynucleotide Triphosphate ( Dntp ) Mixture 389 Anaerogas Pack ( 5 Nos / Pack ) 390 Autoclavable Biohazard Plastic Bag: Size 10 Ltr 10Ltr 391 Anaerobic Blood Culture Bottle – Adult ( 50 / Pack ) 392 Anaerobic Blood Culture Bottle – Paediatric ( 50 / Pack ) 393 Anaerobic System Rubber Ring 394 Anaero Indicator Tablet Rt ( 1X10 / Pkt ) 395 Autoclavable Plastic Vial Flat Bottom, Screw Capped 11.5 Mm X53 Mm. 396 Craigie’S Tube 397 Durhams Tube 25 X 6 Mm 398 Durhams Tube 37X 6 Mm 399 Embading Cassette 1X1000 / Box 400 Kline Concavity Slides 75X56x3 Mm Thick & 12 Concavity Code Gw097 401 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 0.1Ul - 20Μl 402 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 2Ul - 200Μl 403 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 50Ul - 1000Μl 404 Microtips ( Autoclavable ) 0.1Ul - 20Μl 405 Microtips ( Autoclavable ) 2Ul - 20Ul 406 Microtips ( Autoclavable ) 5Ul-50Ul 407 Microtips ( Autoclavable ) 20Ul-200Ul 408 Microtips ( Autoclavable ) 200Ul-1000Ul 409 Microtips-1000 Ul 410 Microtips-5000 Ul 411 Microtitre Plate With Round Bottom Wells 96Wells 412 Microtitre Plate With Detachable Wells 96Wells 413 Micro Centrifuge Autoclavable Plastic Tubes With Cap 2Ml 414 Micro Centrifuge Autoclavable Plastic Tubes With Cap 5Ml 415 Micro Centrifuge Autoclavable Plastic Tubes With Cap 10Ml 416 Mac Cartney Bottles Flat Bottom With Aluminium Screw Cap & Rubber Liner. Capacity 30Ml 417 Museum Jar, With Cover 160X110x60mm 418 Museum Jar, With Cover 170X130x210 Mm 419 Screw Capped Tubes 20X150mm 420 Serum Vials Sample Storage Box & Stand For 3Ml Capacity 421 Sample Container -Wide Mouth Bottle, 125Ml Autoclavable ( Polypropylene ) 125Ml 422 Storage Vials ( Autoclavable ) 2Ml 423 Teasing Needles For Moulds 424 Test Tube Stand - Test -Tube Size - 25Mm Diametre 425 Test Tube Stand - Test -Tube Size - 16Mm Diametre 426 Test Tube Stand - Test-Tube Size - 10Mm Diametre 427 Test Tube Basket, Large 428 Test Tube Basket, Small 429 Test Tube Rack To Accommodate 3 Ml. Test Tubes 5X15 430 Test Tube Rack To Accommodate 5 Ml. Test Tubes 5X15 431 Test Tube Racks:4 X 13 432 Test Tube Cleaning Brush ( Polypropylene Filament Bunched Typed Brush For Cleaning 6”, 5” & 4” Tubes ) 433 Test Tube Carrier ( Stainless Steel ) 434 V.D.R.L. Slides ( 75Mmx50mm 1.45Mm ) 435 Wash Bottle Plastic With Delivery Nozzle 200Ml 436 Wash Bottle Plastic With Delivery Nozzle 60Ml 437 Bunsen Burner 438 Bacteriological Loop Holder With Loop ( Ready To Use ) 439 Biological Indicator For Steam 440 Bowie Dicktest Pack Steam 441 Ice Box 5 Litres 442 Labels For Micro Centrifuge Tubes White Size ½” 443 Metaloops ( Changeable Nichrome Loop Embedded In Brass Rod With Heat Resistant Handle With- 444 A. 2 Mm Diameter Nichrome Wire 445 B. 3 Mm Diameter Nichrome Wire 446 C. 4 Mm Diameter Nichrome Wire 447 Metaloops ( Fixed Straight Nichrome Loop Embedded In Ss Rod With Heat Resistant Handle With- 448 Microtome Knife 449 Mops 450 Magnifying Glass, Big Size With Handle 451 Mortar - Pestle 452 Nichrome Loop-4 Mm 453 Nichrome Loop-2 Mm 454 Nichrome Loop-1.3 Mm 455 Pipette Stand ( Vertical & Horizontal ) 4 / 5 Pipettes 456 Staining Rack. 20 Slide Capacity. 457 Sprit Lamp Glass / Metal 458 Screwdrivers -Multipurpose 459 Silver Aluminium Foil 460 Surgical Knife ( Big ) 461 Sterile Swab Sticks 462 Syringe Driven Filters Ptfe ( Hydrophilic ) Pore Size 0.22Μm 463 Thermometer 37Degree C 464 Twine 465 Universal Collection Vials ( Urine Pot ) 466 Universal Wash Reagents 500Ml 467 Anti-Cd 56 468 Anti-61 469 Anti-Cd 68 470 Anti-Cd 33 471 Anti-Ki 67 ( Mib ) 472 Anti Neurofilament Protein 473 Anti-Synaptophysin 474 Anti-Gfap 475 Anti-Cd 99 476 Anti-Cd 31 477 Anti-B Hcg 478 Poly-L.Lysine 479 Anti-Cd 20 ( B Cells ) 480 Anti-Cd 45 ( Lca ) 481 Anti-S 100 482 Anti- Desmin 483 Anti-C-Erb B-2 ( Her-L / Neu ) 484 Anti-Er 485 Anti-Pr 486 Anti-Cd 3 487 Anti-Cd 20 488 Anti-Cd 117 489 Anti-Cd 34 490 Anti-Cd 30 491 Anti-Cyclin D1 492 Anti-Cd 15 493 Anti-Cd 5 494 Fitc-Conjugated Rabbit 495 Anti-Human Iga ( Alpha Chain ) 496 Fitc-Conjugated Rabbit 497 Anti-Human Igg ( Gamma Chain ) 498 Fitc-Conjugated Rabbit 499 Anti-Human Kappa Light Chain 500 Fitc-Conjugated Rabbit 501 Anti-Human C3c Complement 502 Fitc-Conjugated Rabbit 503 Anti-Human Igm ( Mu Chain ) 504 Fitc-Conjugated Rabbit 505 Anti-Human Lambda ( Light Chain ) 506 Ana By Hep-2-Cell-Line Substrate ( Kit With Reagents ) 507 Electrodes For Μph System 361 508 Osmium Tetroxide 509 Chromium Trioxide 510 Zinc Chloride 511 Di-Sodium Hydrogen Phosphate Anhydrous 512 Di-Sodium Hydrogen Orthophosphate Dibasic 513 Sodium Dihydrogen Orthophosphate Monohydrate 514 Sodium Borate 515 Alpha Napthyl Butyrate 516 Anti-Cish Kits-Hpv16 / 18Dna 517 Er / P-R Control 518 Anti-Melanomal ( Hmb45 ) 519 Anti Myeloperoxidase 520 Anti -Nse 521 Anti-Plap 522 Anti-Bc12 Oncoprotein 523 Anti-Cytokeratin7 524 Anti-Cytokeratin20 525 Anti-Brca 1Protein 526 Anti-Iga 527 Anti-Igm 528 Anti-Igg 529 Anti-Compliment Cd3 530 Anti-Rb Gene Protein 531 Anti-P53 Protein 532 Anti-Wt1 Turmor 533 Anti-Vimentin ( V9 ) 534 Anti-Ema ( E29 ) 535 Anti-P169ink4 ) 536 Kappa 537 Lamda 538 Eosine Spirit Soluble 539 Pap Pen Immuno Histochemistry 540 Anti-Cd 1A 541 Anti-Sma 542 Anti-Myogenin 543 Fluorescent Bchiff Reagent 544 Carmine 545 Acriffarine 546 Cresyl Fast Blue 547 Luxol Fast Blue 548 Cresyl Violet 549 Epinephrine ( 3X0.5Ml ) 550 Aggrecetion Ristocetion A Sulfate ( 3X0.5Ml ) 551 A D P ( Adenosine-5L Diphosphate ( 3X0.5Ml ) 552 Arachidonic Acid Lyohillzed Sodium Arachidonate 553 Collagen Soluble Calfskin ( 3X0.5Ml ) 554 Vw Fator Assay Ristocetin Cofactor ( 3X0.5Ml ) 555 Test Tube ( Siliconized, Flate Bottom 7X25x55mm ) 556 Stri Bars Plastic Coaled Micro 557 Cryo Glue ( Tissue Embedding Medium ) For Cryostat Machine 558 Diposables Blades For Cryostat Machine 559 Silicon Tubal Ring 560 Laser Spectacles 561 Fluid Warmer 562 Filter For Suction Machine ( Atmos ) 563 Nibp Monitor With Integrated Cuff Arm 564 Serum Zinc 565 Copper 566 Ceruloplasmin 567 Ammonia 568 Ammonia 569 Alcohol 570 D- Dimer 571 Anti Ds Dna 572 Anti Sn Antibody 573 Vitamin D 574 Vitamin E 575 Ngal 576 Cystatin C 577 G6 Pd 578 Lactate 579 Apo A1 580 Homocysteine 581 Bnp 582 Urinary Vma 583 Blood Ketones 584 Lip A 585 Ana 586 Anti Phospholipid Antibody 587 Vitamin C 588 Ena 589 Vitamin K 590 Iodine 591 Apo B 592 Troponin T 593 Ck Mb1 594 Ck Mb 2 595 Tibc 596 Transferrin 597 Igg 598 Igm 599 Iga 600 Inhibin A 601 ß Trace Protein 602 ?Eta 2 Microgobulin 603 Alpha 1 Antitrypsin 604 A -1 Microglobulin 605 A-2 Macroglobulin 606 Screening Kit For Inborn Error Of Metabolism 607 Eqas For Clinical Chemistry, Immunoassay, Electrolyte, Hba1c. 608 Tpo ( Thyroperoxidase ) Antibody 609 Control For M-Band Electrophoresis 610 Tnf-A 611 Il-2 612 Procalcitonin 613 5Acagcgtcatggcagagcaggtggc3’ 614 5Aaaagctcttcccgcaggatcccgc3’ 615 5Gtggctgttccgggatggccttctg3’ 616 5Cttgaagaagggctcactctgtttg3’ 617 5Cagtacgatgatgcagc3’ 618 5Caggtagaagaggcggt3’ 619 Amikacin , Neomycin & 620 Tobramycin Standard ( Hplc Grade ) 621 Edta Gel ( 15% ) 622 Acrylic - Heat Cure-Clear 623 Acrylic - Heat Cure-Pink 624 Acrylic - Self Cure-Clear 625 Acrylic - Self Cure-Pink 626 Agate Spatula 627 Alginate Impression Material ( Dustless ) 628 Articulation Paper 629 Bur - Airotor-Diamond 630 Bur - Airotor-Tc- Straight Fissure 631 Calcium Hydroxide Paste For Root Canal 632 Dappen Dish 633 Dental Floss – Waxed, 25 M 634 Dental Stone 635 Dentin Bonding Agent 636 Die Stone 637 Disposable Suction Tips With Copper Wire 638 Emery Sheet - 100, 150 And 400 Grade 639 Endodontic Gutta Percha Points ( 15-80 ) 640 Etchant Gel ( 37 % Phosphoric Acid ) 641 Fiber Composite Splint 642 Flexible Composite Polishing Discs 643 Formocresol 644 Gic- High Strength Pacakable For Posteriors 645 Glass Ionomer Cement Type I 646 Glass Ionomer Cement Type Ii 647 Gluma Dentin Desensitizer 648 Gutta Percha Sticks 649 Halogen Bulbs- 12V, 55 W 650 Hydroxyapatite Bone Graft Material 651 K File - All Sizes 652 Light Cure Composite - Flowable - All Shades 653 Light Cure Composite - Nano-Hybrid – All Shades 654 Modelling Wax Sheet No.2 655 Non Eugenol Impression Paste - Standard Pack 656 Pinnacle Tracing Sticks ( Minimum Three Years Shelf Life ) 657 Polishing Brush For Dental Lathe 658 Polymer Reinforced Zinc Oxide Eugenol Cement 659 Pumice Powder For Polishing Dentures 660 Silver Reinforced Glass Ionomer 661 Supernal Base Plate 662 Tissue Conditioner ( Soft Reliner ) 663 Ultrasonic Scaler Tip 664 Vacuum Formed Sheets - Soft And Hard - 2 And 3Mm 665 Vulcanite Trimmer ( Tc ) 666 Zinc Oxide Eugenol Impression Paste 667 Self Cure Acrylic Tooth Colour Temporary Crown Materials ( Powder & Liquid ) 668 Cold - Cure Acrylic Powder With Liquid ( White Colour ) 669 Pits And Fissure Sealant 670 Zinc Oxide Eugenol Impression Paste 671 Irm ( Intermediate Restorative Materials ) 672 Gic Fuji Tupe Ix 673 Gic Type -Ii Restoative Materials 674 Light Cure Composite Nano- Filling Materials 675 Alginate Impression Material ( Dustless ) 676 Dental Stone 677 Wedges 678 Miracle Mix Materials 679 Hand Piece Lubricant 680 Dycal 681 Suction Tips 682 Acrylic Teeth Set 683 Polishing Paste 684 Polishing Rubber Cups And Bristle 685 Disposable Glass 686 Abrasive Strips For Polishing Proximal Areas Of Teeth 687 Cellophene Matrix Strips For Lc Restoration 688 Applicator Tips For Lc 689 Desensitizing Varnish 690 Burs For Tooth Reduction Set 691 Dental Stone Cutting Burs ( Small Size ) 692 H-Files For Both Anterior And Posterior 693 K- File For Both Anterior And Posterior 694 Broaches 695 Reamers For Both Anterior And Posterior 696 Gutta Percha 697 Absorbant Paper Point 698 Titanium Post ( All Sizes ) 699 Protapper Gutta Parcha All Size 700 Alveogel 701 Rc Cal ( Intra Canal Dressing Paste ) 702 Fiber Optics Air Rotor Hand Pieces With Coupling Unit 703 Gp Cutter 704 Tungsten Carbide Burs For Air Rotor And Micro Motor Handpieces 705 Sectional Matrixs 706 Metal Crown 707 Zinc Oxide Powder And Eugenol ( Big Size ) 708 Zinc Oxide Eugenol ( Powder ) 709 Zinc Oxide Eugenol ( Liquid ) 710 Zinc Oxide Eugenol ( Ready Mix ) 711 Zno Impression Paste 712 Dycal Cement 713 Stone Burs ( All Sizes And Shape ) 714 Stone Burs For Polishing ( Fine ) 715 Composit Polishing Disc 716 Composite Cement 717 Composite Filling Kit 718 Composite Finishing And Polishing 719 Composite Polishing Disc 720 Composite Polishing Kit 721 Composite Polishing Paste 722 Endo Wash 5% 450Ml 723 Bristle Brush & Cup 724 Eugenol 15Ml 725 Eugenol 110Ml 726 Dpi Selfcure 727 Ketac Molar 728 Nt Premium 729 One Coat Bond 730 Gic Lc ( Mini ) Gc 731 Pivo Crown & Bridge Kit 732 Protaper Hand Kit 21 / 25Mm 733 Mouth Mith Handle ( Gdc ) 734 Explorer ( Gdc ) 735 Surgical Scissor ( Brp ) 736 Dpi Alloy 737 Tri Hawk 738 Glyde 3Mlx1 739 Gp F4-F5 ( Dentsply ) 740 Gp ( 15 / 35 / 40 ) Dentsply 741 Dtech Etchn 742 H File 15 / 20 / 25 743 Matrix Band No1 744 Diamond Bur 745 Shofu Crown & Bridge Kit 746 Vitrebond 747 Ah 26 748 Ketac Silver 749 Api Needle Holder 750 Nsk Push Button Airotor Handpiece 751 Apex Locator Pixi Dentsply 752 Lightcure Michine Coltene 753 Sealer Machine With Pouch 754 Scaller Tips Satellec 755 Ultrasonic Cleaner 756 Smart Burs 757 Anti Fog Mouth Mirror 758 Flouride Solution With Applicator 759 Luting Cement 760 Silicon Base Impression Materials 761 Base Putty Impression Materials 762 Light Body Impression Materials 763 Re Cap 764 Dvi Self 765 Propopar Band Kit 21 / 25Ml 766 Ghofu Crown & Bridge Kit 767 Alt 26 768 Apl Needle Holder 769 Giyote 3Ml 770 Ia File 15 / 20 / 25 771 Otech 772 Flowable Composite Shade 773 Plastic Filling Instruments 774 Cement Spatula 775 Cement Condenser 776 Ball Burnisher ( Api ) 777 Extraction Forcept For Pedo ( Set Of 16 ) 778 Tweezer 779 Diamond Round Bur 780 Diamond Straight Fissure Bur 781 Diamond Cone Shape Bur 782 Contra Angle Hand Piece 783 Paper Point ( 15-40 & 45-80 ) 784 Flamed Shaped Diamond Bur ( All Sizes ) 785 Spoon Excavator 786 Cold Mold Seal 787 Pain Off 788 Shade Guide 789 Coe- Pack 790 Apexit Plus 791 Fibre Post ( Yellow, Red , Blue ) 792 Gingival Retraction Cord 793 Spreader / Plugger ( All Sizes ) 794 Disposable Napkin 795 Crown Cutting Kit 796 Elevators ( Straight And Periostal ) 797 Extraction Forcept For Pedo Adult ( Set Of 14 ) 798 G-Coat Plus 799 Protemp With Tips And Gun 800 Gic Type Ix 801 Durable Flouride Releasing Coating 802 Light Curing Nano Ionomer Restorative 803 Remin Pro ( Protective Dental Cream ) 804 Chair Bulbs ( Ocero Infinity ) 805 Cold Cure ( Pink ) Powder 806 Cold Cure ( White ) Powder 807 Cold Cure Liquid 808 Green Sticks 809 Mercury 810 Disposable Patient Apron 811 Bobe Cutter 812 Bobe Ronger 813 Bone File 814 Mought Prod Chain 815 Macet / Hammer 816 Amalgam Condenser 817 Amalgam Carrier 818 Amalgam Curver 819 Wax Knife 820 Wire Cutter 821 Plier 822 Rubber Dam Kit 823 Crown Remover 824 Micromotor Drill Bits 825 Compo Roller 826 Gp Holder 827 Surgical Micromotor 828 Periodontal Probe 829 Acrylic Mixing Jar 830 Air Polisher 831 S.S. Inter Maxillary Fixation Screws 2.0Mm - 12-14Mm 832 S.S. Inter Maxillary Fixation Screws 2.5Mm - 12-14 Mm 833 Titanium Cranial Microplates ( 0.5Mm Plate Thickness ) 10-18Hole Straight 834 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 4 Hole With Bar / Gap 835 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 10-12Hole Straight 836 Titanium Midfacial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Right Side 837 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Left Side. 838 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Right Side 839 Titanum Mid Facial Miniplates ( 0.5-0.6Mm Plates Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Left Side 840 Titannium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Right Side 841 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Left Side 842 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 4 Hole With Bar / Gap 843 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 6 Hole With Bar / Gap . 844 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 10 Hole 845 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) T Plates 5 Holes 846 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Y Plate 4 Holes 847 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Double Y Plate 4 Holes 848 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) X Plate 5 Holes 849 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Straight Plate 10-12 Holes 850 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 12-16 Holes 851 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 20-25 Holes 852 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 853 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 854 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 855 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 856 Titanium Double Angled Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 857 Titanium Cranial ( Outer Diameter 1.0-1.2 Mm ) Non Self Drilling Screw- 4-6 Mm Length 858 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -6Mm Length 859 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -8 Mm Length 860 Titanium Midfacial ( Outer Diameter 1.8 / 1.9Mm ) Non Self- Drilling Emergency Screw -6 Mm Length 861 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -6Mm Length 862 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -8Mm Length 863 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -6Mm Length 864 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -8 Mm Length 865 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Screw -10Mm Length 866 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Maxi Screw -12Mm Length 867 Titanium Reconstruction ( 2.4Mm ) Non Self- Drilling Maxi Emergency Screw -8-20Mm Length 868 Titanium Lag Screws Non Self Drilling ( Outer Diameter 2.4 / 2.5 Mm ) - 15-20Mm Length 869 Drill Bit With 6Mm Stop For Titanium Cranial ( 1.0 / 1.2Mm, 1.0 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 870 Drill Bit With 6Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 871 Drill Bit With 8Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 872 Drill Bit With 6Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 873 Drill Bit With 8Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 874 Drill Bit With 10-12Mm Stop For Titanium ( 2.4Mm Reconstruction, Pilot Hole Diameter 2Mm ) Non Self-Drilling Screw 875 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 4X4 Cms 876 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 6X6 Cms 877 Titanium Mesh For Mandible ( 0.5-0.6Mm Thickness ) Approx. Dimension 10X8 Cms 878 Titanium Orbital Reconstruction Mesh Plates- Small 879 Titanium Orbital Reconstruction Mesh Plates- Medium 880 Titanium Orbital Reconstruction Mesh Plates- Large ( With Medial And Lateral Wall Extensions ) 881 Porous Polyethylene Orbital Sheets ( 0.8-1.5 Mm Thickness; 5X5 Cms Approx ) 882 26 Guage Stainless Steel Wire Spool 883 32 Guage Stainless Steel Wire Spool 884 Raney Clips Stainless Steel 885 022 Slot Mbt Brackets With Weldable Convertible Utld First Molar Buccal Tubes And Nc Ii Molar Tubes 886 Crimpable Hooks 887 016 Multistranded Ss Wire 888 Preformed Archwire - 014 Niti U / L 889 Preformed Archwire - 016 Niti U / L 890 Preformed Archwire - 016 X 022 Ss – U / L 891 Preformed Archwire - 017 X 025 Ss– U / L 892 Preformed Archwire - 019 X 025 Ss – U / L 893 Orthodontic Stone 894 Dunaform – Soft And Hard Sheets- 2Mm, 3Mm 895 Dental Surgery 896 Mouth Mirror With Handle 897 Mouth Mirror 898 Dental Probe 899 Periodontal Probe 900 Dental Explorer ( Curved And Pigtail ) 901 Glass Bead Sterilizer 902 Airotor Handpiece - Mini-Head ( 2 Years Warranty ) 903 Medesy / Hu Friedy Maxillary Anterior Extraction Forceps 904 Medesy / Hu Friedy Maxillary Reeds Extraction Forceps 905 Medesy / Hu Friedy Maxillary Premolar Extraction Forceps 906 Medesy / Hu Friedy Maxillary Molar Extraction Forceps Right / Left 907 Medesy / Hu Friedy Maxillary Bayonet Extraction Forceps 908 Medesy / Hu Friedy Maxillarythird Molar Extraction Forceps 909 Medesy / Hu Friedy Mandibular Anterior Extraction Forceps 910 Medesy / Hu Friedy Mandibular Premolar Extraction Forceps 911 Medesy / Hu Friedy Mandibular Molar Extraction Forceps 912 Medesy / Hu Friedy Warwick James Elevator-Straight 913 Medesy / Hu Friedywarwick James Elevator-Right / Left 914 Medesy / Hu Friedycryers Elevator-Small Size- Right / Left 915 Medesy / Hu Friedycryers Elevator-Medium Size- Right / Left 916 Medesy / Hu Friedycryers Elevator- Large Size-Right / Left 917 Double Angled Currette- Medium Size 918 Double Angled Currette- Large Size 919 Molts Perisoteal Elevator 920 Freer Periosteal Elevator 921 Walshams Nasal Forceps- Pair 922 Asche Septal Forceps 923 Haytons Williams Maxillary Forceps 924 Rowes Zygomatic Elevator 925 Sigmoid Notch Retractor ( Left / Right ) 926 Ramal Retractor 927 Wire Cutter 928 Wire Twister 929 Coronoid Retractor 930 Mastoid Self Retaining Retractor 931 Mandibular Lower Border Retractor 932 Condylar Retractor 933 Dingmann Retractor ( Adult ) 934 Vestibular Retractor 935 Swallow Tail Retractor 936 Curved Pterygoid Osteotome 8Mm 937 Curved Pterygoid Osteotome 10Mm 938 Epker Osteotome 4Mm / 6Mm / 8Mm Curved 939 Epker Osteotome 4Mm / 6Mm / 8Mm Straight With Marking 940 Orthodontic Model Boxes 941 Tongue Guard - Medium 942 Dontrix Gauge 943 Extraoral Force Gauge 944 Orthodontic Typodont Set ( With Wax Ridges And Teeth Set ) 945 Plaster Vibrator ( Worktop Area Of At Least 20 X 10 Cm, Adjustable Setting, 2 Years Warranty ) 946 Haematoxylin & Eosin Stain 947 Eosin & Negrosin Stain 948 V.G. Tube 949 Manipulation Pipette 950 Metallic Tvs Needle Guided Bracket 951 Syringe Non Rubber 1Ml 952 Granulocyte Colony Stimulating Factor 953 Pipelle Aspirator / Vabra Aspirator 954 Progesterone Gel 955 Injectable Progesterone 956 Latex Condom Without Spermicide 957 Osafe Incubator And Laminar Floor Cleaning Lotion 958 Fersafe Antiseptic Lotion 959 Liquid Nitrogen For Cryocan 960 Immunobeads Reagents ( Rabbit Anti Human Igg 961 Immunobeads Reagents ( Rabbit Anti Human Iga 962 Immunobeads Reagents ( Rabbit Anti Human Igm 963 Conical Dispo Beaker 3.0Ml 964 Prp Lens 965 Facs Tube ( 12 X 75Mm, 5Ml Round Bottom Test Tube, Snap, Sterile Cat: 352054 966 Kymograph Paper ( 100 Sheets ) 967 Perimetric Chart Paper ( 100 Sheets ) 968 Haemocytometer Box 969 Haemoglobinometer Sets 970 Dewar Tank 11 Litre 971 Cryo Pro - 500Ml ( Liquid Nitrogen Cryosurgical Equipment 972 Bulb For Telepack Lamp 973 Radiofrequency Electrode Round Loop Big 974 Radiofrequency Electrode Round Loop Small 975 Bacterial Filter Machine Sl No:101122008 976 Indirect Ophthalmoscope 977 20448-000Hgh Pressure Hose ( Erbe Cryo Unit ) ) 978 Bone Hand Drill Moore - 8448.28 979 Hand Drill Jacobs Chuck 980 Demartel Condf / Wire Sawsflex 350Mm 981 Twist Drill Set Of 3Mm, 3.5Mm 4Mm, 4.5Mm 982 Crocodile Forceps ( Ear Microsurgery ) 983 Ear Microsuction Tips 984 Adaptors For Ear Microsuction Tips 985 Cup Ear Forceps 986 Perforators For Stopedectomy 0.4Mm 987 Perforators For Stopedectomy 0.5Mm 988 Rigid Pharyngoscope ( Pediatric ) 20Cm 989 Tonsil Holding Forceps 990 Straight Pick ( Tympanyplasty ) 991 Back Biting Forceps For Endoscope Nasal Surgery 992 Fiberoptic Otoscope With Pneumatic Pump 993 Bismith Lodopyrrophosphate ( Bipp ) Paste / Powder 994 Mercurochrome Lotion 995 Haed Light Fot Ent 996 Endoscopic Biopsy Forceps With Needle 997 Cpr Manikin 998 Intubation Manikin 999 Easy Pump 1000 Mri Contrast Media - Gadoterate Meglumine Injection 5Mmmol / Ml. 10 Ml Vial 1001 Mri Contrast Media - Gadobenate Dimeglumine Injection 10Ml Vial 1002 Mri Contrast Media - Gadopentetate Dimeglumine Injection 0.5Mmol / Ml. 10 Ml Vial 1003 Mri Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5Ml 1004 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg - 50 Ml Vial 1005 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg -100Ml Vial 1006 Non -Ionic Contrast Media - Iopromide Injection: Usp 300Mg -100Ml Vial 1007 Non -Ionic Contrast Media -Iobitridol 350Mg -100Ml Vial 1008 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -50Ml Vial 1009 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -100Ml Vial 1010 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -50Ml Vial 1011 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -100Ml Vial 1012 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -50Ml Vial 1013 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -100Ml Vial 1014 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -50Ml Vial 1015 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -100Ml Vial 1016 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20Ml Vial 1017 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50Ml Vial 1018 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100Ml Vial 1019 Coupland All Nos 1020 Elevators ( Cryer ) 1 Pairs 1021 Castrovejo Scissor 1022 Samll Micro Scissor 1023 Light Cure Composite A2 1024 Light Cure Composite A3 1025 Light Cure Composite A3.5 1026 H-Files For Size ( 15-40 ) 21Mm 1027 Tooth Polishing Brush 1028 Glide 1029 Gracy Currette 1030 Polyester Braided Suture * 2 75Cm Hgs-21, Blue 37Mm 1 / 2 Circle Taper Point : Size-2 1031 Polyester Braided Suture * 2 75Cm Hos-10, Blue 26Mm 1 / 2 Circle Reserve Cutting : Size-2 1032 Polyester Braided Suture * 1 75Cm Hos 12, Blue 40Mm 1 / 2 Circle Reserve Cutting Size -1 1033 Polyester Braided Suture * 5 75Cm Hos-14, Blue 57Mm 1 / 2 Circle Reverse Cutting Size-5 1034 Polyester Braided Suture * 25X75cm Kv-37, Blue 40Mm 1 / 2 Circle Tapercutting Size-2 1035 Poleyster Braided Suture * 54X75cm Kv-40, Blue 45Mm 1 / 2 Circle Tapercutting Size-5 1036 Monofilament Knotless Polyglyconate Wound Closure Device, 0 45Cm Gs-21, Green 37Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-0 1037 Monofilament Knotless Polyglyconate Wound Closure Device, 2-0 30Cm Cm V-20, Green 26Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-2-0 1038 Monofilament Knotless Glycomer 631 Wound Closure Device, 3-0 45Cm P-14, Undyed 24Mm 3 / 8 Circle Resverse Cutting, Box Of 12 Foils Size- 3-0 1039 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 60Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1040 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 75Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1041 Polybutester Monifilament Suture With Polytribolate Coating Size-*5-0, 75Cm 2Xcv-11X36, Blue 12Mm 3 / 8 Circle Taper Point 1042 Polybutester Monofilament Suture With Polytribolate Coating Size-*4-0 90Cm 2Xcv-23X36, Blue 17Mm 1 / 2Circle Taper Point Size: 4-0 1043 Polybutester Monofilament Suture With Polytribulate Coating Size-*5-0 90Cm2xcv, Blue 17Mm 1 / 2 Circle Taper Point Size: 5-0 1044 Polybutester Moniofilament Suture With Polytribulate Coating Size-*5-0, 75Cm 2Xkv-11X36, Blue 13Mm 3 / 8 Circle Tapercutting Size: 5-0 1045 Polybutester Monofilament Suture With Polytribolate Coating Size-* 7-0, 60Cm 2Xmv-175-8, Blue 8Mm 3 / 8 Circle Taper Point Size: 7-0 1046 Polybutester Monofilament Suture With Polytribolate Coating Size-*2-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1047 Polybutester Monofilament Suture With Polytribolate Coating Size-*3-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1048 Monofilament Knotless Glycomer 631 Wound Closure Device, 2-0 23Cm , Violet 27Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size- 2-0 1049 Vaccutrend Needle / Syringe 21 X 15 1050 Vaccutrend Needle / Syringe 22 X 15 1051 Vaccutrent Needle / Syringe 1052 Immunohistochemistry: 1053 Anti Pax-5 Ffpe 1054 Anti Ebv Ffpe 1055 Anti Pan Cmv Ffpe 1056 Anti Cd 68 Ffpe 1057 Anti Wti Ffpe 1058 Anti Plap Ffpe 1059 Anti C3 Ffpe 1060 Anti Sma Ffpe 1061 Anti Ar Ffpe 1062 Anti Bc16 Ffpe 1063 Anti Myogenin Ffpe 1064 Anti Idh-1 Ffpe 1065 Anti Atrx Ffpe 1066 Anti P63 Ffpe 1067 Anti Neurofilament Ffpe 1068 Anti Cd 19 Ffpe 1069 Anti Msa Ffpe 1070 Anti Adipophylin Ffpe 1071 Anti Alk D5f3 Ffpe 1072 Anti Arginase-1 Ffpe 1073 Anti B Catenin 1074 Bcl 10 Ffpe 1075 Anti Ber-Ep4 Ffpe 1076 Anti Clauclin 4 Ffpe 1077 Anti D2 - 40 Podolanin Ffpe 1078 Anti Dog 1 Ffpe 1079 Anti Sall 4 Ffpe 1080 Anti Erg Ffpe 1081 Anti Hbmeigg4 1082 Anti Inhilein Ffpe 1083 Anti Insm 1 Ffpe 1084 Anti Mammaglobin Ffpe 1085 Mart 1 Ffpe 1086 Anti Melan A Ffpe 1087 Anti Mdm2 Ffpe 1088 Anti Napsin A Ffpe 1089 Anti P40 Ffpe 1090 Anti Pax-8 Ffpe 1091 Anti Stat-6 Ffpe 1092 Anti Tle-1 Ffpe 1093 Anti Uroplalcin-2 Ffpe 1094 Anti Glycophorin Ffpe 1095 Anti Gcet-1 Ffpe 1096 Anti Cd 38 / 138 Ffpe 1097 Anti Calcitonin Ffpe 1098 Anti Caldermon Ffpe 1099 Anti B Caldermon Ffpe 1100 Anti Cd 56 Ffpe 1101 Anti Nsm Ffpe 1102 Anti Cd 99 Mic-2 , 013 Ffpe 1103 Anti Cd 138 Ffpe 1104 Anti Cdh 17 Cadherin 17 Ffpe 1105 Anti Heparii Ffpe 1106 Anti Glypican-3 Ffpe 1107 Anti Stab 2 Ffpe 1108 Anti Hrp Polymer Kit 1109 Fitc Lambda Light Chain Immunofluorescence 1110 Fitc Igm Immunofluorescence 1111 Fitc Iga Immunofluorescence 1112 Fitc Igg Immunofluorescence 1113 Fitc C3 Immunofluorescence 1114 Mlh1, Msh2, Msh6, Pms2 ( Together ) 1115 Pdl1 Clone Sp142 1116 Egfr Clone 31G7 1117 Cdx2 1118 Gata 3 1119 Ck 18 1120 Mesothelin 1121 Glut 1 1122 Gcdfp 1123 Myb 1124 Plag 1 1125 Hmga 2 1126 Eber In-Situ Hybridization 1127 Pcr 1128 Egfr Rt Pcr Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1129 Msi Detection Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1130 Bcr-Abl1-Pcr Kit Compatible With Qiagen 1131 Fish 1132 Alk Mutation Break Apart Probe In Lung Adenocarcinoma 1133 Myb-Nfib Dual Colour Fusion Probe 1134 Myb Dual Colour Break Apart Probe 1135 Maml2 Dual Colour Break Apart Probe 1136 Etv6 Dual Colour Break Apart Rearrangement Probe 1137 Plag 1 Rearrangement Probe 1138 Hmga 2 Rearrangement Probe 1139 Immunofluorescence 1140 Anti P-Anca Direct Immunofluorescence 1141 Anti C-Anca Direct Immunofluorescence 1142 Anti Ana Direct Immunofluorescence 1143 Anti Aquaporin 4 1144 C1q 1145 Flowcytometry 1146 Cd 16 Apc 1147 Hla B27 Kit ( Should Be Compatible With Bd Facscalibur ) 1148 Elisa ( Mago-4 ) 1149 Anti P-Anca Elisa 1150 Anti C-Anca Elisa 1151 Anti Cyclic Citrulinated Peptide ( Ccp ) Elisa 1152 Anti Smith Elisa 1153 Anti Peroxiredoxin Vi ( Prx Vi ) Elisa 1154 Anti Bmi I Elisa 1155 Anti Matrix Metalloproteinase 7 ( Mmp7 ) Elisa 1156 Anti Ny Eso I 1157 Anti Scl 70 1158 Anti Urnp 1159 Chemicals And Consumables 1160 Proteinase K 1161 Pronase 1162 Fish Reagents : 1163 Poly L Lysine 1164 20X Saline Sodium Citrate ( 20X Ssc ) Salt, Molecular Grade 1165 1 M Nascn ( 1M Sodium Thiocyanate ) Salt, Molecular Grade 1166 Igepal @ Ca 630 1167 Rubber Cement 1168 Dapi 1169 Sodium Chloride ( Nacl ) , 58.44G Mol-1 Molecular Grade 1170 Sodium Citrate ( Na3c6h5o7 ) 258.06G Mol-1 Molecular Grade 1171 Fluorescence Microscopic Immersion Oil 1172 Immunofluorescence Reagents : 1173 Trypsin Powder, Molecular Grade 1174 Additional Consumables / Disposables 1175 15Mm Double Swivel With Port & Extension 1176 72 Hours Closed Ventilation Suction Catheter Must Have Double - Lumen Siliconised Catheter Swivel Connector Un-Coupling Wedge, Lockable Thumb –Valve End Cap, Softer Sleeve Material, 72 Hour Recommended During Of Use. Size: 12F, 14F, 16F 1177 Adjustable Circle Breathing System ( 2 Litre Bag, 2 Metre Length And 1.5 Metre Limb ) 1178 Adjustable Circle Breathing System ( 2 Mts Length ) 1179 Adult Curved Flared Prong With Tube1.8M Length 1180 Adult Curved Nasal Prong With Tube1.8M Length 1181 Adult Respi-Check High Concentration Oxygen Mask With Oxygen Tube 1182 Anti-Microbial Circle Breathing System ( 1.6 Metre Length And 0.8 Metre Limb ) 1183 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 1.6 Metre Length, 0.8 Metre Limb ) 1184 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 2.4 Metre Length, 0.8 Metre Limb ) 1185 Apron Cloth ( Sterile ) 1186 Attest 1292 E Biological Indicator 1187 Attest Biological Indicator ( For Styeam ) 3M 1188 Attest Rapid Auto Reader Incubator ( For Steam ) ( Early Result For Biological Test ) 1189 Balanced Salt Solution ( Bss ) 1190 Bilbao-Dotter Tube With Guide Wire 1191 Bis Electrodes 1192 Bone File 1193 Bone Ronger 1194 Bp Blade With Handle ( No 15 & 17 ) 1195 Cardiac Troponin T Kit 1196 Center Hole Towel 1197 Coban Tm 4 1198 Cols Light Source For Transillumination 1199 Contra Angle Hand Piece 1200 Disposable Face Mask ( Cloth ) 1201 Disposable Head Positioning Device For The Prone Position – Made Of Latex- Free Foam With Mirror For Providing The Clinician A Clear View Of Face, Eye & Endotrachael Tube Plus Sloted Design For Positioning Of Endotracheal On Either Side Of The Patient Face 8000Hdp 1202 Disposable Kellys Pad 1203 Ecg Monitoring Electrode ( Solid Hydrogel ) 1204 Ecg Monitoring Electrode With Foam Backing 2223 1205 Ecg Monitoring Electrode With Foam Backing Large 1206 Elastometric Infusion Pump For Analgesia 5Ml / Hour 1207 Elastometric Infusion Pump For Analgesia 2Ml / Hour Model Sv2 1208 Elevators ( Straight And Periostal ) 1209 Emergency Cricothyrotomy Device Adult 4Mm Id Children 2Mm Id 1210 Eye Wear For Composite Fillings 1211 Face Guard 1212 Fibre Splint 1213 Fluid Warming Cassette ( Disposable ) Wf-250 1214 Fluid Warming Cassette ( Disposable ) Wf-100 1215 Gigly Saw 1216 Glass Bead Sterilizer 1217 Tungsen Carbide Burs For Air Rotor And Micro Motor Hand Pieces 1218 Green Pvc Tubing For Oxygen 6 Mm, Length In Metres 1219 Iodixannol 320 Mg Iodine / Ml-100 Ml. 1220 Iohexol 300 Mg-Iodine / Ml 100 Ml 1221 Iomeron 400 Mg / Ml – 50 Ml. 1222 Ioversol / Iopamide / Iopamidol – 50 Ml. 1223 Iso Green Standard Laryngoscope System ( Disposable Plastic Blades ) 7 Sizes Of Mac And Miller Blades 1224 Jess Fixtators Pediatric / Large 1225 Jobsons Probe 1226 Kinesiology Color Tap / Taping For Orthopaedic Used 1227 Killians Nasal Speculum 1228 K-Wires: 1.8Mm 1229 K-Wires: 4Mm 1230 K-Wires: 1.5 Mm 1231 K-Wires: 2.5 Mm 1232 K-Wires: 2Mm 1233 K-Wires: 3Mm 1234 Macintosh Style Blades 2, 4 1235 Magill’S Forceps Adult Child Infant 1236 Manual Plaster Cutting Saw 1237 Manual Plaster Spreader 1238 Manual Torniquet ( Cuff & Pump ) 1239 Mayo Stand Cover 1240 Miller Style Blades 0, 1241 Miller Style Blades 1 1242 Mortar And Pestle 1243 Mouth & Cheek Retractor 1244 Mouth Mirror 1245 Mri Compatible Laryngoscopes All Sizes 1246 Mri Film 14” X 17” 1247 Neopuff ( Neonatal Resuscitator ) 1248 North Nasal Preformed Cuffed Tubecuffed Must Have Ivory Pvc Profile Soft Seal Cuff, Implantation Tested Black Intubations Depth Marker, 15Mmconnector With 1S0 5356-1 Larger Cuff Resting Diameter Size: 6To 8Mm Id & Length 27Cm To 30.5 Tips To Nares 1249 Ovarian Shield ( Kiran ) 1250 Oxygen Supply Tubing For Heat & Moisture Exchanger Oxygen Supply Tubing For Heat & Moisture Exchanger With Connector To Attach Hme For Tracheostomy Tube Length 15Cm 1251 Oxygen Analyser 1252 Oxygen Blenders 1253 Para Film Roll ( Size 10Cmx125cm ) 3 “ Dia 1254 Parafilm, Roll 1255 Perineural Catheter For Continuous Plexus And Peripheral Nerve Blocks. Content: 118 G Lacoplex Needle With Centimeter Graduation 1 Perinueral Pebax Catheter ( 0.45 X 0.85Mm – 50Cm Long ) With Centimeter Distance Markings And Open Distal Tip 1 0.22 Antibacterial Filter 1 Additional Extension Tube, 50Cm Long, 1.5 X 2.5 Mm Dia, Priming Volume 1.10Ml 1 10Ml Syringe For The Aspiration Test 1 10 X 15 Cm Dermafilm Transparent Adhesive Dressing 1256 Periostal Elevators ( Small And Big ) 1257 Winged Infusion Set- Non Coring Needles With Injection Site To Access Ports, 20G X 1.00 ( Needle ) 1258 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-7Fr, 65Cm Length ( Ped ) 1259 Hickman-Broviac 4.2Fr ( Or Smaller ) Single Lumen Pediatric Cath W Stic Papais 1260 Hickman-Broviac 6.6Fr Single Lumen Pediatric Cath W Stic 90Cm 1261 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-9Fr, 90Cm Length ( Adult ) 1262 Plaster Cutter Electric 1263 Plaster Saw 1264 Plier Long Nose 1265 Pneumatic Compression Stocking 1266 Portable Autoclave Electrically Operated Made Of Aluminium Size:300Mm X 300Mm Capacity 24 Litres 1267 Portable Autoclave Electrically Operated Made Of Aluminium Size:350Mm X 300Mm-325Mm Depth: 1.5 Kw 1268 Pyridin 1269 Reusable Pressure Monitoring Cable With Integrity Check System By 100Mmhg Pressure And With Reusable Modular Clamp 1270 Reusable Pressure Transducer With Integrity Check System By 100Mmhg Pressure, With Microchip Technology, Reusable Cable, And With Reusable Clamp 1271 Ronguers ( Down Cutter ) 1272 Ronguers ( Up Cutter ) 1273 Rubber Macintosh 1274 Russian Forceps 1275 Light Weight Hernia Mesh, Pga Polypropylene 11 X 15 1276 Light Weight Hernia Mesh, Pga Polypropylene 6 X 11 1277 Seldinger Technique Catheter For Arterial Puncture Content: 1 Transparent And Xpo Cathter ( Pe ) / ( Ptfe ) 1 Intruducer Needle 1 Straight Wire 115.092 115.094 115.118 5118.702 5118.703 1278 Self Holding Retractors For Spine Surgery 1279 Single Use Resuscitation Mask For Cpcr ( Non-Return Valve, Integral Bacterial / Viral Filter ) 1280 Slide Mailer 1 Slide 1281 Slide Mailer 2 Slide 1282 Soap Dispenser 1283 Soda Lime ( Imported ) – Changes From White To Violet On Exhaustion 5Kg 1284 Sodium Hypochloride Solution 5Litre 1285 Spreader / Plugger 1286 Steinman Pins:4.5Mm 1287 Steinmann Pins 1288 Sterigage Chemical Indicator ( For Steam ) 3M 1289 Surgical Clipper 1290 Surgical Preparation Razor 1291 Thermal Videographic Printer ( Black & White ) ( Sony, Latest Up Series ) 1292 Tissue Paper For Ultrasound 1293 Ultra Violet Cabinet ( 800 / 500 X 2000 Mm ) 1294 Vacuum Assisted Dressing System 1295 Vascular Debeky Angle ( Medium ) 1296 Vascular Debeky Straight ( Medium ) 1297 Vaseline Gauze 1298 Ventilator 15 Mm Breathing Systems ( With Luer Lock, 1.6 Metre Length And Resealable Water Trap ) For Paediatrics 1299 Ventilator Breathing System With Resealable Water Traps ( Smooth Lumen ) 1300 Waste Management Wheeled Bins. ( 660Lit ; 300Lit; 1100 Lit ) 1301 Wire Cutter 1302 Y-Pieces For Breathing Circuit 1303 Absorbable Gelatin Sponge U.S.P ( Ab-Gel ) 10 X 10 1304 Alginate Impression Materials ( Dust Free ) 1305 Double Swivel With Port 15Mm 1306 Green Pvc Tubing 6Mm For Oxygen / Per Meter 1307 2 Mm Osteotomes 1308 3 Mm Osteotomes 1309 Asepto Pump 1310 Autoclavable Biohazard Plastic Bag 10Liter 1311 Autoclavable Biohazard Plastic Bag 20Liter 1312 Autoclavable Biohazard Plastic Bag 30Liter 1313 Bone Cement ( Plain ) 1314 Bone Cement ( Antibiotics ) 1315 Bougie ( Stylet ) 1316 Burretta 1317 Capd Catheter Tenckhoff With 2 Felt Cuffs Sa 1242 ( 420 Mm ) 1318 Cast Taper Mandrel 1319 Chiesel 1320 Cleaning Brush 1321 Cleaning Solution 1322 Cpr Manikin 1323 Stoma Flatmoldable Small 45Mm 1324 Stoma Flatmoldable Medium 45Mm 1325 Stoma Flatmoldable Regular 57Mm 1326 Stoma Flatmoldable Large 70Mm 1327 Moldable Convex 12 / 22Mm 1328 Moldable Convex 22 / 33Mm 1329 Moldable Convex 33 / 57Mm 1330 Ostomy Appliance Accessories Belt 1331 Coloured Ph Indicator Paper 1332 Dissecting Instrument Box 1333 Double Swivel With Port 15 Mm X 22Mm 1334 Drape Formers Trans Femoral 1335 Drape Formers Trans Tibial 1336 Espocan With Docking System 1337 Eto Chemical Indicator Tape -3M 1338 Eto Packing Sleeves Roll ( 3M ) 12 1339 Eto Packing Sleeves Roll ( 3M ) 4 1340 Eto Packing Sleeves Roll ( 3M ) 6 1341 Surgicel Fibrillar 1963 1342 G- Bone 1343 Gloves Wrapper 1344 Laparoscopic Aspiration Needle 1345 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 3.5Mm 1346 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 4.8Mm 1347 Hose Mount 15Mm Female Male Pair 1348 Hose Mount 22Mm Female Male Pair 1349 Hygrobaby / Hme Filter ( Infant ) 1350 Hygroboy / Hme Filter ( Paediatric ) 1351 Hygrostar / Hme Filter ( Adult ) 1352 Hygrobac S 1353 Intraocular Lense 6Mm Optics Foldable, Square Edge, Hydrophobic 1354 Intraocular Lense Rigid 5.25Mm Optics, Pmma, Square Edge 1355 Intraocular Lense Rigid 5.5Mm Optics 1356 Intraocular Lense Rigid 5.5Mm Optics Foldable 1357 Intraocular Lense Rigid 6Mm Optics 1358 Intraocular Lense Rigid 6Mm Optics Foldable 1359 Intraocular Lense Rigid 6Mm Optics, Pmma, Square Edge 1360 Rigid Anterior Chamber Intraocular Lens: Lens Power +16D ( 6.00Mm ) 1361 Rigid Anterior Chamber Intraocular Lens: Lens Power +19D ( 6.00Mm ) 1362 Rigid Anterior Chamber Intraocular Lens: Lens Power +18D ( 6.00Mm ) 1363 Rigid Anterior Chamber Intraocular Lens: Lens Power +20D ( 6.00Mm ) 1364 Rigid Anterior Chamber Intraocular Lens: Lens Power +21D ( 6.00Mm ) 1365 Rigid Anterior Chamber Intraocular Lens: Lens Power +22D ( 6.00Mm ) 1366 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1367 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.5D ( 5.50Mm ) 1368 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1369 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.0D ( 5.50Mm ) 1370 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.5D ( 5.50Mm ) 1371 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.0D ( 5.50Mm ) 1372 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.5D ( 5.50Mm ) 1373 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.0D ( 5.50Mm ) 1374 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.5D ( 5.50Mm ) 1375 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.0D ( 5.50Mm ) 1376 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.5D ( 5.50Mm ) 1377 ( A ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +10.0D 6.0Mm 1378 ( B ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +113.5D 6.0Mm 1379 ( C ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+14.0D 6.0Mm 1380 ( D ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.0D 6.0Mm 1381 ( E ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.5D 6.0Mm 1382 ( F ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.0D 6.0Mm 1383 ( G ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.5D 6.0Mm 1384 ( H ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.0D 6.0Mm 1385 ( I ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.5D 6.0Mm 1386 ( J ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.0D 6.0Mm 1387 ( K ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.5D 6.0Mm 1388 ( L ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19..0D 6.0Mm 1389 ( M ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19.5D 6.0Mm 1390 ( N ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.0D 6.0Mm 1391 ( O ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.5D 6.0Mm 1392 ( P ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.0D 6.0Mm 1393 ( Q ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.5D 6.0Mm 1394 ( R ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.0D 6.0Mm 1395 ( S ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.5D 6.0Mm 1396 ( T ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+23.0D 6.0Mm 1397 ( U ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +23.5D 6.0Mm 1398 ( V ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.0D 6.0Mm 1399 ( W ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.5D 6.0Mm 1400 ( X ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.0D 6.0Mm 1401 ( Y ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.5D 6.0Mm 1402 ( Z ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+26.0D 6.0Mm 1403 Mayo Trolly Cover ( Disposable ) 1404 Membrane Assembly 1405 Micro Centrifuge Tube 1.5Ml 1406 Micro Centrifuge Tube 15Ml 1407 Micro Centrifuge Tubes-.2Ml ( With Thin Wall For Pcr ) 1408 Micro Centrifuge Tubes-.5Ml ( With Thin Wall For Pcr ) 1409 Micro Centrifuge Tubes-2Ml 1410 Microscope Bulb- 6V 20W 1411 Mini & Micropates With Screw 1412 Nasal Tubing 70Mm 1413 Needle ( Cutting ) Big 1414 Needle ( Cutting ) Medium 1415 Needle ( Cutting ) Small 1416 Needle ( Round Body ) Big 1417 Needle ( Round Body ) Medium 1418 Needle ( Round Body ) Small 1419 Non Invasive Cardiac Output Monitoring Electrode 1420 Non Invasive Cardiac Pacing Electrode 1421 Ostomy Powder 25Gm 1422 Pneumatic Compression Stocking 1423 Pressure Monitoring Kit With Three Way Disposable Pressure ( For Cvp & Atrerial ) 1424 Rae Tub 7.5 1425 Self Adhesive Urine Sample Bag - Pediatric 1426 Spirit Swabs 1427 Sterile Swab Sticks 1428 Steri-Stripes 1429 Esmarch 4 1430 Esmarch 6 1431 Polyester Synthetic Cast Padding 1432 Suction Cannula For Mtp Size Purandre 1433 Ostomy Appliance Accessories Belt 1434 Stomadress Plus Single Pouch - Opaque 1435 Activelife One Pc Drainable Pouch 1436 Tubing Kit 1437 Urianalyser 1438 Urine Control A360 1439 Ventilating Airway Bougies 1440 Ventilator Tubing W / 1 ( Venti Breathing System With Reseable Water Trap ) 1441 Y-Pieces 1442 6Mm Green Pvc Tubing For Oxygen 1443 Alpha Mattress 1444 Analspeculum Size: 25 1445 Ao Universal Clamps 1446 Baby Cradle With Mattress And Net 1447 Blood Gas Quality Control ( 30X1.7Ml ) Level 1 ( Abg ) 1448 Blood Gas Quality Control ( 30X1.7Ml ) Level 2 ( Abg ) 1449 Blood Gas Quality Control ( 30X1.7Ml ) Level 3 ( Abg ) 1450 Bone Cutter 1451 Bone Cutter Big Size 1452 Centrifuge Tube 1453 Centrifuge Tubes, Polypropylene Seal With Capacity 3.5 - 10 Ml 1454 Clavicular Braces 1455 Cider Wood Oil 1456 Debakey’S Bull Dog Clamps, Curved 115Mm ( 4 ½” ) Long 1457 Debakey’S Bull Dog Clamps, Curved 70Mm ( 2 ¾” ) Long 1458 Debakey’S Bull Dog Clamps, Curved 80Mm ( 3 ?” ) Long 1459 Debakey’S Bull Dog Clamps, Straight 120Mm ( 4 ¾” ) 1460 Debakey’S Bull Dog Clamps, Straight 75Mm ( 3” ) 1461 Debakey’S Bull Dog Clamps, Straight 85Mm ( 3 ?” ) 1462 Divided Mattress 1463 Dropper Bottle 250Ml 1464 Dropper Bottle 500Ml 1465 Dropper P.P. 6 Long 1466 Npwt Dressing Kit 1467 Silicone Rubber Heel Cups 1468 Electrodes For Ift ( For Combination Therapy-Ultra Sound Therapy + Electrical Stimulator ) ( Make: Enraf Nonius Sonoplus 491 ) 1469 Episiotomy Scissor Size 15Cm 1470 Fixation Ring ( 904-898 ) 1471 Fixation Ring ( 904-898 ) For Transcutaneous Po2 / Pco2 ( Make: Radiometer, Model: Tcm 40 ) 1472 Fluid Warmer 1473 Fogging Machine 1474 G-Bone 1475 Gigly Saw 1476 Ginevri Capillary Tube ( H ) ( Microbillimeter ) 1477 Glover With Atraumatic Jaws, Curved Jaws, 85Mm ( 3 ?” ) , 45Mm Jaws 1478 Hand Drill 1479 Hand Wash Basin Stand ( Double ) . - Five Legs Base Mounted On 5Cms Dia Castors With One 35Cm S.S Basin.Pre Treated And Epoxy Powder Coated. 1480 Hysterectomy Clamp ‘Faure’ 1481 I.V. Drip Stand 1482 Intra Uterine Cannula ‘Collins’ Plain 3 Size 1483 Intra Uterine Cannula ‘Hayes Provis’ With Rubber Cone 1484 Kidney Wash Machine ( Renatron Ii ) 1485 Knee Immobilizer Oc 2035 1486 Knee Immobilizer Oc 2035 1487 Knee Stabilizer-Dc 2069 1488 Leishmans Stain 1489 Lengenback Retractor 1490 Lengenback Retractor 1491 Lens Cleaning Paper 1492 Lymph Node 1493 Magnet For Ecg 1494 Malleable Stylets With Adjustable Stop, Different Size 1495 Measuring Tape 1496 Measuring Tape ( Clinical ) 1497 Microscope ( For Side Lab ) - Binocular Electric Light Microscope 1498 Molina Sheet 1499 Mosquito Net ( Single Use Patient Specific, Plastic ) 1500 Mouth Gag 1501 Myoma Screw ‘Doyen’ 1502 Na+ - Sensor Casing ( Abg ) 1503 Non Invasive Glucose Monitoring System ( Glucometer ) 1504 Ounce Glass Steel 1505 Oxygen Cylinder Stand / Trolley - B Type 1506 Pad Electrodes For Swd ( Dx 500 Roland ) 1507 Paper Roll ( Abg ) 1508 Patient Breathing Set Infant Reusable ( Galileo Gold ) 1509 Patient Cable For Ift / Mst ( Make / Model: Multidyne 965 ) 1510 Patient Shifting Trolleys With The Facility Of Oxygen Cylinder Carrier 1511 Pelvic Traction Kit With Pulley And Weight 1512 Pile Binder 1513 Plastic Dropping Bottle ( 120Ml ) 1514 Plastic Small Tube 1515 Raos Hand Suction Unit 100 Ml 1516 Ref. - Membrane Shell ( Abg ) 1517 Resucitation Kits Automatics 1518 Resuscitation Kit Emergency 1519 Resuscitation Kit For Neonates 1520 Rubber Sole - 4Mm 1521 Sample Detector 1522 Screw Driver 1523 Sealing Rings 1524 Set Tubing For Roller Pump ( Reagents ) ( Abg ) 1525 Shin Tube Cutting Jig 30Mm 1526 Shin Tube Cutting Jig 35Mm 1527 Short Needle Holder 1528 Side Support ( Meditrin ) 1529 Silicon Tubal Ring 1530 Solid Waste Containers Liners 1531 Solution Valve 1532 Spare Canvas Bag 1533 Spare Lamp For Opthalmoscope 1534 Spare Parts For: Easylyte, 911 , 912 & Others 1535 Spirit Lamp 1536 Stich Scissor 1537 Suture Anchor ( Orthopaedics ) 1538 Syringe Infusion Pump 1539 T- Handle For Orthopaedics 1540 Tailor Thread 1541 Tco2 Sensor 1542 Teleys Forcep 1543 Vortex Mixer 1544 Vulsellum Forceps 1 X 1 Teeth 25Cm 1545 Wire Cutter 1546 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure ) 1547 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Low Pressure ) 1548 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene. 1549 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure With Bacterial Resistance ) 1550 Manual Hub Cutter – With Biohazard Symbol And Which Can Cut The Plastic Hub And Not The Metal Needle With Temporary And Permanent Locking Mechanism On Complete Filling Of The Disposal Hub Cutter With Clear Demarcation Of Fill Line And Which Can Accomadate Upto 400-600 Needles. 1551 Cerebral Reservior ( Omaya Type ) 1552 Extranal Ventricular Drainage Syatem 1553 Lumbar Extranal Drainage System 1554 Poly Propylene Mesh ( Small ) For Duroplasty 1555 Poly Propylene Mesh ( Medium ) For Duroplasty 1556 Poly Propylene Mesh ( Large ) For Duroplasty 1557 G Bone Cement ( For Cranioplasty ) 1558 Kraniotomy Drape 1559 Iodine Drape Large 1560 Balanced Salt Solution With Na / K / Mg & Chloride Levels Similar To Plasma With Acetate & Gluconate / Malate As Buffer, Must Not Contain Calcium ( Eg.Plasmalyte A / Volulyte Etc ) 1561 Bactiseal Impregnated Shunt - Fda Approved, Fixed Pressure Vp Shunts ( Low, Medium, High ) That Are Antibiotic Impregnated And Can Reduce The Potential For Bacterial Colonization In The Lumen As Well As Its Outer Surface. 1562 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1563 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1564 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1565 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1566 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1567 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1568 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1569 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1570 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1571 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1572 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1573 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1574 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1575 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1576 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1577 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1578 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1579 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1580 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1581 Raneys Scalp Disposable Clips - Disposable Raneys Clips 1582 Cranioplasty Kit - Cranioplasty Kit, Sterile, Pack Of Two Packets Of Methyl Methacrylate And Two Vials Of Liquid. 1583 Universal Extremity Drape- Control Plus Fabric, Us Fda Certified 1584 Impervious Split Sheet- 60 X 70, 4 X 21 Split, Polyethylene Sheet, Us Fda Certified 1585 U-Bar-Pack- 1 Back Table Cover-Reinforced 44 X 88, 1 Mayo Stand Cover Reinforced 23 X 54, 1 Suture Bag, 1U Drape 71 X 124, 1 Bar Drape 71 X 124, 1 Bar Drape 41.5 X 82, Us Fda Certified 1586 Back Table Cover Zone Reinforced- 44 X 99, Us Fda Certified 1587 Impervious Stockinette-12 X 58, Uds Fda 1588 Fluid Shield Mask With Visor -Four Layer Mask, Water Resistant With Water Resistant, -Naosh, Osha Approved 1589 Hip Drape With Leg Pockets -Control Plus Fabric, Us Fda Approved 1590 Hip Drape Without Leg Pockets -Control Plus Fabric, Us Fda Approved 1591 Quattro Fx -Full Face Mask Vented 1592 Mirage Fx- Nasal Mask Vented 1593 Transmission Electron Microscope 1594 G011 / 2 Glut Em 25% Amps 1595 Self Closing Tweezer ( Biology ) T-403 1596 O001 Osmium Tetroxide 1597 Eukitt Mouning Media 1598 Taab Araldite 502 / 812 Kit ( E2o2 ) 1599 Dibutyl Phthalate 1600 E069 Embedding Mould Flat C 1601 Z10 Molecular Seive 3Nm For Drying Acetone 1602 Shaving Razor Blade 1603 300 Mesh Cu Grid With Thin Carbon Film ( Cu - 300Cn 1604 300M Mesh Cu Grid With Holey / Dbl Carbon Film ( Cu-300Hd 1605 G062 Grid Storage Box 1606 U007 Uranyl Acetate 1607 L018 Lead Citrate 1608 Truf 2208-100 1609 Octagon Magnetic Stirrer Bar ( 4151 ) 1610 Consumables 1611 Micro Tips ( 10Micro Litre ) 1612 Microcentrifuge Tube
Corrigendum
| Sr No | Corrigendum Date | Corrigendum | Type | New Submission Date |
|---|---|---|---|---|
| 1 | 20-Jan-2020 | Extension | Date | 21-Feb-2020 |
| 2 | 13-Feb-2020 | Date Extensionn2 | Date | 05-Mar-2020 |
| 3 | 03-Mar-2020 | Extension2 | Date | 17-Apr-2020 |
| 4 | 10-Nov-2020 | Date Extension November | Date | 04-Dec-2020 |
| 5 | 27-Nov-2020 | Amendment | Fee | 04-Dec-2020 |
BOQ
| Description of Stores /Items: Open e-Tender for processing of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, etc for the Institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. | |||||
|---|---|---|---|---|---|
| Sl.No. | Item Description | Item Code / Make | Quantity | Units | |
| 1 | 1.01 | Albumin | Item1 | 1 | per ml |
| 2 | 1.02 | Microalbumin | Item2 | 1 | per ml |
| 3 | 1.03 | Gamma Glutamyl Tranferase | Item3 | 1 | per ml |
| 4 | 1.04 | (??- GGT) | Item4 | 1 | per ml |
| 5 | 1.05 | Amylase | Item5 | 1 | per ml |
| 6 | 1.06 | Lipase | Item6 | 1 | per ml |
| 7 | 1.07 | CK | Item7 | 1 | per ml |
| 8 | 1.08 | CK-MB | Item8 | 1 | per ml |
| 9 | 1.09 | LDH | Item9 | 1 | per ml |
| 10 | 1.1 | Total Cholesterol | Item10 | 1 | per ml |
| 11 | 1.11 | Triglyceride | Item11 | 1 | per ml |
| 12 | 1.12 | HDL | Item12 | 1 | per ml |
| 13 | 1.13 | LDL | Item13 | 1 | per ml |
| 14 | 1.14 | Calcium | Item14 | 1 | per ml |
| 15 | 1.15 | Copper | Item15 | 1 | per ml |
| 16 | 1.16 | Phosphorus | Item16 | 1 | per ml |
| 17 | 1.17 | Zinc | Item17 | 1 | per ml |
| 18 | 1.18 | Parameter | Item18 | 1 | per ml |
| 19 | 1.19 | Iron | Item19 | 1 | per ml |
| 20 | 1.2 | TIBC | Item20 | 1 | per ml |
| 21 | 1.21 | ADA | Item21 | 1 | per ml |
| 22 | 1.22 | ADA Calibrator | Item22 | 1 | per ml |
| 23 | 1.23 | G-6-PD | Item23 | 1 | per ml |
| 24 | 1.24 | Glycosylated Hb | Item24 | 1 | per ml |
| 25 | 1.25 | Glycosylated Hb Calibrator | Item25 | 1 | per ml |
| 26 | 1.26 | CRP | Item26 | 1 | per ml |
| 27 | 1.27 | CRP Calibrator | Item27 | 1 | per ml |
| 28 | 1.28 | a-1 Acid Glycoprotein | Item28 | 1 | per ml |
| 29 | 1.29 | Ammonia | Item29 | 1 | per ml |
| 30 | 1.3 | Lactate | Item30 | 1 | per ml |
| 31 | 1.31 | Glutathione Peroxidase | Item31 | 1 | per ml |
| 32 | 1.32 | Superoxide dismutase | Item32 | 1 | per ml |
| 33 | 1.33 | Total Antioxidant Status | Item33 | 1 | per ml |
| 34 | 1.34 | Homocysteine | Item34 | 1 | per ml |
| 35 | 1.35 | ASO | Item35 | 1 | per ml |
| 36 | 1.36 | RF | Item36 | 1 | per ml |
| 37 | 1.37 | Lipoprotein (a) | Item37 | 1 | per ml |
| 38 | 1.38 | Lipoprotein (a) Calibrator | Item38 | 1 | per ml |
| 39 | 1.39 | Transferrin | Item39 | 1 | per ml |
| 40 | 1.4 | Cystatin C | Item40 | 1 | per ml |
| 41 | 1.41 | Gentamycin | Item41 | 1 | per ml |
| 42 | 1.42 | Barbiturates | Item42 | 1 | per ml |
| 43 | 1.43 | Valproic Acid | Item43 | 1 | per ml |
| 44 | 1.44 | Phenitoin | Item44 | 1 | per ml |
| 45 | 1.45 | VMA | Item45 | 1 | per ml |
| 46 | 1.46 | Galactosemia | Item46 | 1 | per ml |
| 47 | 1.47 | Calcitonin | Item47 | 1 | per ml |
| 48 | 1.48 | Calcitriol | Item48 | 1 | per ml |
| 49 | 1.49 | Galactokinase | Item49 | 1 | per ml |
| 50 | 1.5 | Galactose-1-phosphate uridyl transferase | Item50 | 1 | per ml |
| 51 | 1.51 | Renin | Item51 | 1 | per ml |
| 52 | 1.52 | ACTH | Item52 | 1 | per ml |
| 53 | 1.53 | Interleukin 1 | Item53 | 1 | per ml |
| 54 | 1.54 | Interleukin 4 | Item54 | 1 | per ml |
| 55 | 1.55 | Interleukin10 | Item55 | 1 | per ml |
| 56 | 1.56 | Leukotrine A4 | Item56 | 1 | per ml |
| 57 | 1.57 | Leukotrine B4 | Item57 | 1 | per ml |
| 58 | 1.58 | Leukotrine C4 | Item58 | 1 | per ml |
| 59 | 1.59 | Leukotrine D4 | Item59 | 1 | per ml |
| 60 | 1.6 | Leukotrine E4 | Item60 | 1 | per ml |
| 61 | 1.61 | TNFa | Item61 | 1 | per ml |
| 62 | 1.62 | Cephalosporin | Item62 | 1 | per ml |
| 63 | 1.63 | Serum tryptase | Item63 | 1 | per ml |
| 64 | 1.64 | Urine fluoride | Item64 | 1 | per ml |
| 65 | 1.65 | Anti-dsDNA Antibody | Item65 | 1 | per ml |
| 66 | 1.66 | Anti nuclear antibody | Item66 | 1 | per ml |
| 67 | 1.67 | Anti-sm Antibody | Item67 | 1 | per ml |
| 68 | 1.68 | Sodium carbonate | Item68 | 1 | per gm |
| 69 | 1.69 | Potassium Dihydrogen Phosphate | Item69 | 1 | per gm |
| 70 | 1.7 | Potassium Dihydrogen Phosphate KH2PO4 (HPLC grade) | Item70 | 1 | per gm |
| 71 | 1.71 | Creatinine powder | Item71 | 1 | per gm |
| 72 | 1.72 | Isopropyl alcohol, AR Grade | Item72 | 1 | per ml |
| 73 | 1.73 | Acetone – AR grade AR grade | Item73 | 1 | per ml |
| 74 | 1.74 | Ammonium chloride –AR grade, | Item74 | 1 | per gm |
| 75 | 1.75 | Ammonium nitrate – AR grade, | Item75 | 1 | per gm |
| 76 | 1.76 | Ammonium persulphate – AR grade, | Item76 | 1 | per gm |
| 77 | 1.77 | Calcium chloride dihydrade – AR grade, | Item77 | 1 | per gm |
| 78 | 1.78 | Dinitro phenyl hydrazine AR grade, | Item78 | 1 | per gm |
| 79 | 1.79 | Magnesium chloride – AR grade, | Item79 | 1 | per gm |
| 80 | 1.8 | Magnesium sulfate –AR grade, | Item80 | 1 | per gm |
| 81 | 1.81 | Methanol – Acetone free – HPLC grade, | Item81 | 1 | per ml |
| 82 | 1.82 | Methanol (HPLC grade) | Item82 | 1 | per ml |
| 83 | 1.83 | Potassium dichromate – AR grade, | Item83 | 1 | per gm |
| 84 | 1.84 | Silver nitrate – AR grade, | Item84 | 1 | per gm |
| 85 | 1.85 | Sodium bicarbonate – AR grade, | Item85 | 1 | per gm |
| 86 | 1.86 | Sodium acetate dehydrate –AR grade, | Item86 | 1 | per gm |
| 87 | 1.87 | Ammonium acetate – AR grade, | Item87 | 1 | per gm |
| 88 | 1.88 | Thio semi carbazide – AR grade, | Item88 | 1 | per gm |
| 89 | 1.89 | Ethidium bromide soln 10ml– Biotechnology grade, | Item89 | 1 | per ml |
| 90 | 1.9 | Guanidium iso thiocyanate – Biotechnology grade, | Item90 | 1 | per gm |
| 91 | 1.91 | IPTG AR grade, | Item91 | 1 | per gm |
| 92 | 1.92 | 100 bp DNA ladder 1 ml X 5 | Item92 | 1 | per gm |
| 93 | 1.93 | Taq Polymerase with PCR buffer 3-5 U/µl, 1000 U per vial | Item93 | 1 | per gm |
| 94 | 1.94 | dNTPs 100 millimolar each | Item94 | 1 | per ml |
| 95 | 1.95 | EcoRI restriction enzyme 0.5 ml X 1 | Item95 | 1 | per ml |
| 96 | 1.96 | BamHI 0.5 ml X 1 | Item96 | 1 | per ml |
| 97 | 1.97 | HinDIII 0.5 ml X 1 | Item97 | 1 | per ml |
| 98 | 1.98 | DNA ligase 0.5 ml X 1 | Item98 | 1 | per ml |
| 99 | 1.99 | DNA extraction kit(column based) for 50 extraction | Item99 | 1 | per ml |
| 100 | 2 | RNA extraction kit(column based) for 20 extraction | Item100 | 1 | per ml |
| 101 | 2.01 | Plasmid extraction kit(column based) for 50 extraction | Item101 | 1 | per ml |
| 102 | 2.02 | Oligo nucleotide primers (HPLC purification) | Item102 | 1 | per ml |
| 103 | 2.03 | RNAlater | Item103 | 1 | per ml |
| 104 | 2.04 | DEPC mol bio grade | Item104 | 1 | per ml |
| 105 | 2.05 | Nuclese K | Item105 | 1 | per ml |
| 106 | 2.06 | Milipore Prefiltrate Kit Cartridge | Item106 | 1 | pc |
| 107 | 2.07 | Milipore Proguard 2 Pack Cat. No. PROG0002 | Item107 | 1 | pc |
| 108 | 2.08 | Milipore Q Guard 1 Cat. No. QGARD00R1 | Item108 | 1 | pc |
| 109 | 2.09 | Milipore Tank Vent Filter Cat. No. TANKMPK01 | Item109 | 1 | pc |
| 110 | 2.1 | Milipore Sanitization Tablet Cat. No. ZWCL01F50 | Item110 | 1 | pc |
| 111 | 2.11 | Millipore millicare Elix cat no JMBM01747 | Item111 | 1 | pc |
| 112 | 2.12 | Millipore Quantum Ex cat. No- QTUM000Ex | Item112 | 1 | pc |
| 113 | 2.13 | MX cart 5 micron | Item113 | 1 | pc |
| 114 | 2.14 | MX cart 1 micron | Item114 | 1 | pc |
| 115 | 2.15 | RO cartridge | Item115 | 1 | pc |
| 116 | 2.16 | Non sterile millipak 40 | Item116 | 1 | pc |
| 117 | 2.17 | Progard TS 2 | Item117 | 1 | pc |
| 118 | 2.18 | 1 micron filter | Item118 | 1 | pc |
| 119 | 2.19 | 3 micron filter | Item119 | 1 | pc |
| 120 | 2.2 | MX cartridge 5 µm | Item120 | 1 | pc |
| 121 | 2.21 | 20 '' carbon cartridge | Item121 | 1 | pc |
| 122 | 2.22 | Sanitization tablets | Item122 | 1 | pc |
| 123 | 2.23 | PM kit | Item123 | 1 | pc |
| 124 | 2.24 | XL wash solution | Item124 | 1 | per ml |
| 125 | 2.25 | 200-1000 µl microtips | Item125 | 1 | pc |
| 126 | 2.26 | 100-200 µl microtips | Item126 | 1 | pc |
| 127 | 2.27 | 5-50 µl microtips | Item127 | 1 | pc |
| 128 | 2.28 | 1-5 ml microtips | Item128 | 1 | pc |
| 129 | 2.29 | 200-1000 µl micropipette | Item129 | 1 | pc |
| 130 | 2.3 | 100-200 µl micropipette | Item130 | 1 | pc |
| 131 | 2.31 | 5-50 µl micropipette | Item131 | 1 | pc |
| 132 | 2.32 | 2-20 µl micropipette | Item132 | 1 | pc |
| 133 | 2.33 | Microcentrifuge tube 1.5ml | Item133 | 1 | pc |
| 134 | 2.34 | Ammonium persulphate AR | Item134 | 1 | per gm |
| 135 | 2.35 | Potassium iodate (KIO3) | Item135 | 1 | per gm |
| 136 | 2.36 | Toluene AR | Item136 | 1 | per ml |
| 137 | 2.37 | Arsenous acid(As2O3) | Item137 | 1 | per ml |
| 138 | 2.38 | Arsenic trioxide | Item138 | 1 | per ml |
| 139 | 2.39 | Ceric ammonium sulphate | Item139 | 1 | per gm |
| 140 | 2.4 | 20bp DNA ladder | Item140 | 1 | pc |
| 141 | 2.41 | TRIS – base AR grade | Item141 | 1 | per gm |
| 142 | 2.42 | Fok I & NlaIII restriction enzyme | Item142 | 1 | pc |
| 143 | 2.43 | DNA loading buffer | Item143 | 1 | pc |
| 144 | 2.44 | DNA sample loading dye | Item144 | 1 | pc |
| 145 | 2.45 | Ethiduim bromide | Item145 | 1 | pc |
| 146 | 2.46 | Primer (Both forward & reverse) | Item146 | 1 | pc |
| 147 | 2.47 | 10 X TBE | Item147 | 1 | pc |
| 148 | 2.48 | Heparinised vial | Item148 | 1 | pc |
| 149 | 2.49 | Disposable syringe | Item149 | 1 | pc |
| 150 | 2.5 | Microwave oven | Item150 | 1 | pc |
| 151 | 2.51 | Glucose kit | Item151 | 1 | per kit |
| 152 | 2.52 | Bilirubin Kit | Item152 | 1 | per kit |
| 153 | 2.53 | G6-PD kit | Item153 | 1 | per kit |
| 154 | 2.54 | Vacutainer | Item154 | 1 | pc |
| 155 | 2.55 | Disposable syringe | Item155 | 1 | pc |
| 156 | 2.56 | Cystatin C kit | Item156 | 1 | per kit |
| 157 | 2.57 | Bilirubin Kit | Item157 | 1 | per kit |
| 158 | 2.58 | Creatinine kit | Item158 | 1 | per kit |
| 159 | 2.59 | AST kit | Item159 | 1 | per kit |
| 160 | 2.6 | ALT kit | Item160 | 1 | per kit |
| 161 | 2.61 | ISE wash 2 solution | Item161 | 1 | per ml |
| 162 | 2.62 | ISE cal-3 solution | Item162 | 1 | per ml |
| 163 | 2.63 | ISE cal -4 solution | Item163 | 1 | per ml |
| 164 | 2.64 | Microcentrifuge tube 2ml | Item164 | 1 | pc |
| 165 | 2.65 | SP kit | Item165 | 1 | per kit |
| 166 | 2.66 | Rep prep solution | Item166 | 1 | per ml |
| 167 | 2.67 | Sample applicator | Item167 | 1 | pc |
| 168 | 2.68 | Disposable sample cup | Item168 | 1 | pc |
| 169 | 2.69 | AST | Item169 | 1 | per test |
| 170 | 2.7 | ALT | Item170 | 1 | per test |
| 171 | 2.71 | Creatinine | Item171 | 1 | per test |
| 172 | 2.72 | Albumin | Item172 | 1 | per test |
| 173 | 2.73 | Glucose | Item173 | 1 | per test |
| 174 | 2.74 | GGT | Item174 | 1 | per test |
| 175 | 2.75 | BUN | Item175 | 1 | per test |
| 176 | 2.76 | HDL cholesterol | Item176 | 1 | per test |
| 177 | 2.77 | LDL cholesterol | Item177 | 1 | per test |
| 178 | 2.78 | Cholesterol | Item178 | 1 | per test |
| 179 | 2.79 | UIBC | Item179 | 1 | per test |
| 180 | 2.8 | RF RTG latex | Item180 | 1 | per test |
| 181 | 2.81 | CRP | Item181 | 1 | per test |
| 182 | 2.82 | Uric acid | Item182 | 1 | per test |
| 183 | 2.83 | Triglyceride | Item183 | 1 | per test |
| 184 | 2.84 | ALP | Item184 | 1 | per test |
| 185 | 2.85 | Total bilirubin | Item185 | 1 | per test |
| 186 | 2.86 | IgG | Item186 | 1 | per test |
| 187 | 2.87 | Direct bilirubiun | Item187 | 1 | per test |
| 188 | 2.88 | IgM | Item188 | 1 | per test |
| 189 | 2.89 | Protein | Item189 | 1 | per test |
| 190 | 2.9 | IgA | Item190 | 1 | per test |
| 191 | 2.91 | Phosphorus | Item191 | 1 | per test |
| 192 | 2.92 | C3 | Item192 | 1 | per test |
| 193 | 2.93 | Calcium | Item193 | 1 | per test |
| 194 | 2.94 | CK-MB | Item194 | 1 | per test |
| 195 | 2.95 | Lipase | Item195 | 1 | per test |
| 196 | 2.96 | ASO | Item196 | 1 | per test |
| 197 | 2.97 | Iron | Item197 | 1 | per test |
| 198 | 2.98 | C4 | Item198 | 1 | per test |
| 199 | 2.99 | Amylase | Item199 | 1 | per test |
| 200 | 3 | CK | Item200 | 1 | per test |
| 201 | 3.01 | Acid phosphatase | Item201 | 1 | per test |
| 202 | 3.02 | Transferrin | Item202 | 1 | per test |
| 203 | 3.03 | LDH | Item203 | 1 | per test |
| 204 | 3.04 | Magnessium | Item204 | 1 | per test |
| 205 | 3.05 | HB-DH | Item205 | 1 | per test |
| 206 | 3.06 | Haptoglobin | Item206 | 1 | per test |
| 207 | 3.07 | Lactate | Item207 | 1 | per test |
| 208 | 3.08 | Microalbumin | Item208 | 1 | per test |
| 209 | 3.09 | Microalbumin calibrator | Item209 | 1 | per test |
| 210 | 3.1 | Cholinesterase | Item210 | 1 | per test |
| 211 | 3.11 | Urine CSF protein | Item211 | 1 | per test |
| 212 | 3.12 | Wash solution | Item212 | 1 | per ml |
| 213 | 3.13 | Cleaning solution | Item213 | 1 | per ml |
| 214 | 3.14 | Cleaning solution weekly wash | Item214 | 1 | per ml |
| 215 | 3.15 | CRP latex calibrator | Item215 | 1 | per test |
| 216 | 3.16 | Urine calibrator | Item216 | 1 | per test |
| 217 | 3.17 | System calibrator | Item217 | 1 | per test |
| 218 | 3.18 | HDL calibrator | Item218 | 1 | per test |
| 219 | 3.19 | LDL calibrator | Item219 | 1 | per test |
| 220 | 3.2 | CRP calibrator | Item220 | 1 | per test |
| 221 | 3.21 | RF calibrator | Item221 | 1 | per test |
| 222 | 3.22 | CK-MB calibrator | Item222 | 1 | per test |
| 223 | 3.23 | Xl-300/600 cuvette | Item223 | 1 | pc |
| 224 | 3.24 | Beckman coulter AU 2700 cuvettes | Item224 | 1 | pc |
| 225 | 3.25 | Xl-300/600 Lamp | Item225 | 1 | pc |
| 226 | 3.26 | Beckman coulter AU 2700 lamp | Item226 | 1 | pc |
| 227 | 3.27 | EQAS (Bio-Rad) | Item227 | 1 | per test |
| 228 | 3.28 | ApoA1 & ApoB reagent & calibrator | Item228 | 1 | per test |
| 229 | 3.29 | Bio-Rad lipid conrol | Item229 | 1 | per test |
| 230 | 3.3 | Ethylene Glycol (Ethandiol | Item230 | 1 | pc |
| 231 | 3.31 | Methylene Soluble (working Reagent | Item231 | 1 | pc |
| 232 | 3.32 | Tissue Capsule Big | Item232 | 1 | pc |
| 233 | 3.33 | Tissue Capsule Small | Item233 | 1 | pc |
| 234 | 3.34 | Tissue Cassettes Big | Item234 | 1 | pc |
| 235 | 3.35 | Tissue Cassettes Small | Item235 | 1 | pc |
| 236 | 3.36 | Stock Phloxine B | Item236 | 1 | pc |
| 237 | 3.37 | Progesterone Receptor | Item237 | 1 | pc |
| 238 | 3.38 | ANA Kit for SLE (Indirect Immunoflurescence Method) | Item238 | 1 | per test |
| 239 | 3.39 | Hb/Cayanaid Method standard | Item239 | 1 | pc |
| 240 | 3.4 | Nalidixid 10ug | Item240 | 1 | per disc |
| 241 | 3.41 | Netilmycin 10ug | Item241 | 1 | per disc |
| 242 | 3.42 | Furozotidime 30ug | Item242 | 1 | per disc |
| 243 | 3.43 | Antigen and antibody HCV ELISA test kits | Item243 | 1 | per test |
| 244 | 3.44 | Cell counter reagents | Item244 | 1 | pc |
| 245 | 3.45 | (Machine available is ABX pentra which is a closed system) | Item245 | 1 | per gm |
| 246 | 3.46 | Reagent for APTT | Item246 | 1 | per test |
| 247 | 3.47 | Calcium Chloride for APTT estimation | Item247 | 1 | per test |
| 248 | 3.48 | Control plasma N | Item248 | 1 | per test |
| 249 | 3.49 | Reaction tube | Item249 | 1 | per test |
| 250 | 3.5 | CA CLEAN | Item250 | 1 | per test |
| 251 | 3.51 | OWRENS Veronal buffer | Item251 | 1 | per test |
| 252 | 3.52 | Standard Human Plasma | Item252 | 1 | per test |
| 253 | 3.53 | Sodium Azide (NaN3) | Item253 | 1 | per test |
| 254 | 3.54 | Bovine thrombin | Item254 | 1 | per test |
| 255 | 3.55 | 1000 NIH units/ mg of protein | Item255 | 1 | per test |
| 256 | 3.56 | Anti DCE | Item256 | 1 | per test |
| 257 | 3.57 | Sc(1) | Item257 | 1 | per test |
| 258 | 3.58 | Sc(2) | Item258 | 1 | per test |
| 259 | 3.59 | Sc(3) | Item259 | 1 | per test |
| 260 | 3.6 | Yt(a) | Item260 | 1 | per test |
| 261 | 3.61 | Yt(b) | Item261 | 1 | per test |
| 262 | 3.62 | Do(a) | Item262 | 1 | per test |
| 263 | 3.63 | Do(b) | Item263 | 1 | per test |
| 264 | 3.64 | PYR Broth | Item264 | 1 | per gm |
| 265 | 3.65 | PYR -Pyrolidonyl-ß naphthylamine | Item265 | 1 | per test |
| 266 | 3.66 | Paradimethylaminobenzaldehyde | Item266 | 1 | per ml |
| 267 | 3.67 | P-dimethylaminocinamaldehyde | Item267 | 1 | pc |
| 268 | 3.68 | p-nitrophenylglycerol | Item268 | 1 | pc |
| 269 | 3.69 | Potassium Telurite | Item269 | 1 | pc |
| 270 | 3.7 | Potassium Cyanide (KCN) | Item270 | 1 | per gm |
| 271 | 3.71 | Para dimethyl aminobenzaldehyde | Item271 | 1 | per ml |
| 272 | 3.72 | Potassium hydroxide | Item272 | 1 | per gm |
| 273 | 3.73 | Potassium Hydrogen Sulphate | Item273 | 1 | per gm |
| 274 | 3.74 | Phenol Crystal (powder) | Item274 | 1 | per gm |
| 275 | 3.75 | Phosphate Buffer Saline | Item275 | 1 | per ml |
| 276 | 3.76 | Phenethyl alcohol | Item276 | 1 | per ml |
| 277 | 3.77 | Phenol red indicator | Item277 | 1 | per ml |
| 278 | 3.78 | Phenol red indicator | Item278 | 1 | per gm |
| 279 | 3.79 | Phenol red | Item279 | 1 | per gm |
| 280 | 3.8 | Phenylpyruvic acid Reagent | Item280 | 1 | pc |
| 281 | 3.81 | Potassium dichromate LR | Item281 | 1 | per gm |
| 282 | 3.82 | Potassium permanganate LR | Item282 | 1 | per gm |
| 283 | 3.83 | Potassium permanganate AR | Item283 | 1 | per gm |
| 284 | 3.84 | Potassium Phosphate monobasic | Item284 | 1 | per gm |
| 285 | 3.85 | Potassium Nitrate | Item285 | 1 | per gm |
| 286 | 3.86 | Phenol (Crystal) | Item286 | 1 | per gm |
| 287 | 3.87 | Peptone | Item287 | 1 | per gm |
| 288 | 3.88 | Raffinose AR | Item288 | 1 | per gm |
| 289 | 3.89 | Rhammnose | Item289 | 1 | per gm |
| 290 | 3.9 | Sodium/ Potassium Dichromate | Item290 | 1 | pc |
| 291 | 3.91 | Sodium citrate | Item291 | 1 | per ml |
| 292 | 3.92 | Sodium Pyruvate AR | Item292 | 1 | per gm |
| 293 | 3.93 | Sodium Biocarbonate LR | Item293 | 1 | per gm |
| 294 | 3.94 | Sodium acetate | Item294 | 1 | per gm |
| 295 | 3.95 | Sodium Iodide | Item295 | 1 | per gm |
| 296 | 3.96 | Sulphanilamine-AR | Item296 | 1 | per gm |
| 297 | 3.97 | Sugar assimilation disc – Cellobiose | Item297 | 1 | pc |
| 298 | 3.98 | Sugar assimilation disc – Dextrose | Item298 | 1 | pc |
| 299 | 3.99 | Sugar assimilation disc – Dulcitol | Item299 | 1 | pc |
| 300 | 4 | Sugar assimilation disc – Galactose | Item300 | 1 | pc |
| 301 | 4.01 | Sugar assimilation disc – Inositol | Item301 | 1 | pc |
| 302 | 4.02 | Sugar assimilation disc – Lactose | Item302 | 1 | pc |
| 303 | 4.03 | Sugar assimilation disc – Maltose | Item303 | 1 | pc |
| 304 | 4.04 | Sugar assimilation disc – Melibiose | Item304 | 1 | pc |
| 305 | 4.05 | Sugar assimilation disc - Raffinose | Item305 | 1 | pc |
| 306 | 4.06 | Sugar assimilation disc- Sucrose | Item306 | 1 | pc |
| 307 | 4.07 | Sugar assimilation disc – Trehalose | Item307 | 1 | pc |
| 308 | 4.08 | Sugar assimilation disc - Xylose | Item308 | 1 | pc |
| 309 | 4.09 | Salicin AR | Item309 | 1 | per gm |
| 310 | 4.1 | Tarric Acid | Item310 | 1 | per gm |
| 311 | 4.11 | Trehalose Ar | Item311 | 1 | per gm |
| 312 | 4.12 | Triypticase | Item312 | 1 | per gm |
| 313 | 4.13 | Thiosulphate | Item313 | 1 | per ml |
| 314 | 4.14 | Tri-Sodium Citrate | Item314 | 1 | per gm |
| 315 | 4.15 | Voges proskaeur reagent | Item315 | 1 | pc |
| 316 | 4.16 | Vibriostatic (0/129) Agent | Item316 | 1 | per ml |
| 317 | 4.17 | Wright’s Stain | Item317 | 1 | per gm |
| 318 | 4.18 | Xylose AR | Item318 | 1 | per gm |
| 319 | 4.19 | Vibrio cholerae-01 3ml | Item319 | 1 | per ml |
| 320 | 4.2 | Vibrio cholerae-0139 3ml | Item320 | 1 | per ml |
| 321 | 4.21 | Vibrio cholerae-Ogawa 3ml | Item321 | 1 | per ml |
| 322 | 4.22 | Vibrio cholerae-Inaba 3ml | Item322 | 1 | per ml |
| 323 | 4.23 | Salmonella Polyvalent O 3ml | Item323 | 1 | per ml |
| 324 | 4.24 | Salmonella Polyvalent H 3ml | Item324 | 1 | per ml |
| 325 | 4.25 | Salmonella Polyvalent O2 3ml | Item325 | 1 | per ml |
| 326 | 4.26 | Salmonella Polyvalent O4 3ml | Item326 | 1 | per ml |
| 327 | 4.27 | Salmonella Polyvalent O9 3ml | Item327 | 1 | per ml |
| 328 | 4.28 | Salmonella Polyvalent H Phase I a 3ml | Item328 | 1 | per ml |
| 329 | 4.29 | Salmonella Polyvalent H Phase Ib 3ml | Item329 | 1 | per ml |
| 330 | 4.3 | Salmonella Polyvalent H Phase Ic 3ml | Item330 | 1 | per ml |
| 331 | 4.31 | Salmonella Polyvalent H Phase Ii 3ml | Item331 | 1 | per ml |
| 332 | 4.32 | Shigella Polyvalent dysenteriae 3ml | Item332 | 1 | per ml |
| 333 | 4.33 | Shigella Polyvalent flexnerii 3ml | Item333 | 1 | per ml |
| 334 | 4.34 | Shigella Polyvalent sonnei 3ml | Item334 | 1 | per ml |
| 335 | 4.35 | Shigella Polyvalent boydii 3ml | Item335 | 1 | per ml |
| 336 | 4.36 | Cryptococcus antigen detection kit (latex Agglutination detection) | Item336 | 1 | per test |
| 337 | 4.37 | Antigen detection kit for Meningitis (H influenza b, N meningitis A & C, S. pneumonia, GBS, E.coli) | Item337 | 1 | per test |
| 338 | 4.38 | Amphotericin Powder | Item338 | 1 | per gm |
| 339 | 4.39 | Benzal Pennicillin Powder | Item339 | 1 | per gm |
| 340 | 4.4 | Cefoxitin 5gm/vial | Item340 | 1 | vial |
| 341 | 4.41 | Clindamycin Powder | Item341 | 1 | per gm |
| 342 | 4.42 | Ciprofloxacin 5gm/vial | Item342 | 1 | vial |
| 343 | 4.43 | Erythromycin Powder | Item343 | 1 | per gm |
| 344 | 4.44 | Gentamicin 5gm/vial | Item344 | 1 | vial |
| 345 | 4.45 | Imipenem 5gm/vial | Item345 | 1 | vial |
| 346 | 4.46 | Oxacillin 5gm/vial | Item346 | 1 | vial |
| 347 | 4.47 | Vancomycin 5gm/vial | Item347 | 1 | vial |
| 348 | 4.48 | Anidulafungin (0.015-128µg/ml) | Item348 | 1 | per strip |
| 349 | 4.49 | Ceftriaxone (0.016-256 ug /ml.) | Item349 | 1 | per strip |
| 350 | 4.5 | Ciprofloxacin (0.001-8ug / ml.) | Item350 | 1 | per strip |
| 351 | 4.51 | Ceftazidime+ Clavulanate(0.004-128ug / ml.) | Item351 | 1 | per strip |
| 352 | 4.52 | Clindamycin E-test (0.016-256 µg/ml) | Item352 | 1 | per strip |
| 353 | 4.53 | Colistin (0.06-0.25µg/ml) | Item353 | 1 | per strip |
| 354 | 4.54 | Caspofungin (0.015-128µg/ml | Item354 | 1 | per strip |
| 355 | 4.55 | Doripenem(0.002-32 µg/ml) | Item355 | 1 | per strip |
| 356 | 4.56 | Ertapenem (0.002-32 µg/ml) | Item356 | 1 | per strip |
| 357 | 4.57 | Fluconazole (0.016-256 µg/ml) | Item357 | 1 | per strip |
| 358 | 4.58 | Imipenem(0.004-128ug / ml.) | Item358 | 1 | per strip |
| 359 | 4.59 | Levofloxacin (0.001-8ug / ml.) | Item359 | 1 | per strip |
| 360 | 4.6 | Meropenem (4-256 µg/ml) | Item360 | 1 | per strip |
| 361 | 4.61 | Meropenem/EDTA (1-64 µg/ml) | Item361 | 1 | per strip |
| 362 | 4.62 | Moxifloxacin (0.001-8ug / ml.) | Item362 | 1 | per strip |
| 363 | 4.63 | Candida albicans ATCC 14053 | Item363 | 1 | vial |
| 364 | 4.64 | Candida guilliermondii ATCC 6260 | Item364 | 1 | vial |
| 365 | 4.65 | Candida Psedotropicalis TCC 4135 | Item365 | 1 | vial |
| 366 | 4.66 | Corynebacterium diptheriae ATCC 13812 Vial | Item366 | 1 | vial |
| 367 | 4.67 | Escherichia coli ATCC 25922 Vial | Item367 | 1 | vial |
| 368 | 4.68 | Escherichia coli ATCC 35218 Vial | Item368 | 1 | vial |
| 369 | 4.69 | Enterococcus faecalis ATCC 29212 Vial | Item369 | 1 | vial |
| 370 | 4.7 | Haemophilus influenzae ATCC-49766 Vial | Item370 | 1 | vial |
| 371 | 4.71 | Pseudomonas aeruginosa ATCC 27853 Vial | Item371 | 1 | vial |
| 372 | 4.72 | Positive Control for T.B. (My.TB H37rv strain) | Item372 | 1 | vial |
| 373 | 4.73 | Staphylococcus aureus ATCC 25923 Vial | Item373 | 1 | vial |
| 374 | 4.74 | Streptococcus pneumoniae ATCC 49619 Vial | Item374 | 1 | vial |
| 375 | 4.75 | Staphylococcus aureus ATCC 33591 Vial | Item375 | 1 | vial |
| 376 | 4.76 | Salmonella enterica subspecies enterica serovar cholerasuis ATCC-10708 Vial | Item376 | 1 | vial |
| 377 | 4.77 | Salmonella enterica subspecies enterica serovar paratyphi A ATCC-9150 Vial | Item377 | 1 | vial |
| 378 | 4.78 | Salmonella enterica subspecies enterica serovar typhimurium ATCC-25241 Vial | Item378 | 1 | vial |
| 379 | 4.79 | Shigella flexneri ATCC- 9199 Vial | Item379 | 1 | vial |
| 380 | 4.8 | AST for GNB AST –N280 | Item380 | 1 | per test |
| 381 | 4.81 | Media for Pediatric Sample -259794,BACT/ALERT PF | Item381 | 1 | per test |
| 382 | 4.82 | Media for Aerobic Sample – 259791, BACT/ALERT FA | Item382 | 1 | per test |
| 383 | 4.83 | Solution for Inoculum Preparation – V1204, 3x500 ml | Item383 | 1 | per test |
| 384 | 4.84 | Tubes for Inoculum Preparation - 69285(unsensitised tube) | Item384 | 1 | per test |
| 385 | 4.85 | Identification of Fermentes and Non-ferments – 21341(GN TEST KIT VTK) | Item385 | 1 | per test |
| 386 | 4.86 | DNA ladder / molecular weight marker size range : 100 to 1200 bp (50µg) | Item386 | 1 | per test |
| 387 | 4.87 | DNA Extraction kit | Item387 | 1 | per test |
| 388 | 4.88 | Deoxynucleotide triphosphate (dNTP) mixture | Item388 | 1 | per test |
| 389 | 4.89 | Anaerogas pack (5 nos/pack) | Item389 | 1 | pc |
| 390 | 4.9 | Autoclavable Biohazard plastic bag: size 10 ltr 10ltr | Item390 | 1 | pc |
| 391 | 4.91 | Anaerobic Blood Culture bottle – Adult (50/ pack) | Item391 | 1 | pc |
| 392 | 4.92 | Anaerobic Blood Culture bottle – Paediatric (50/ pack) | Item392 | 1 | pc |
| 393 | 4.93 | Anaerobic System Rubber Ring | Item393 | 1 | pc |
| 394 | 4.94 | Anaero Indicator Tablet RT (1x10/pkt) | Item394 | 1 | pc |
| 395 | 4.95 | Autoclavable Plastic Vial Flat Bottom,screw capped 11.5 mm x53 mm. | Item395 | 1 | pc |
| 396 | 4.96 | Craigie’s tube | Item396 | 1 | pc |
| 397 | 4.97 | Durham's tube 25 x 6 mm | Item397 | 1 | pc |
| 398 | 4.98 | Durham's tube 37x 6 mm | Item398 | 1 | pc |
| 399 | 4.99 | Embading Cassette 1x1000/box | Item399 | 1 | pc |
| 400 | 5 | Kline Concavity Slides 75x56x3 mm thick & 12 concavity code GW097 | Item400 | 1 | pc |
| 401 | 5.01 | Microtips (Autoclavable) with box (96’s/pack) 0.1ul - 20µl | Item401 | 1 | pc |
| 402 | 5.02 | Microtips (Autoclavable) with box (96’s/pack) 2ul - 200µl | Item402 | 1 | pc |
| 403 | 5.03 | Microtips (Autoclavable) with box (96’s/pack) 50ul - 1000µl | Item403 | 1 | pc |
| 404 | 5.04 | Microtips (Autoclavable) 0.1ul - 20µl | Item404 | 1 | pc |
| 405 | 5.05 | Microtips (Autoclavable) 2ul - 20ul | Item405 | 1 | pc |
| 406 | 5.06 | Microtips (Autoclavable) 5ul-50ul | Item406 | 1 | pc |
| 407 | 5.07 | Microtips (Autoclavable) 20ul-200ul | Item407 | 1 | pc |
| 408 | 5.08 | Microtips (Autoclavable) 200ul-1000ul | Item408 | 1 | pc |
| 409 | 5.09 | Microtips-1000 ul | Item409 | 1 | pc |
| 410 | 5.1 | Microtips-5000 ul | Item410 | 1 | pc |
| 411 | 5.11 | Microtitre plate with round bottom wells 96wells | Item411 | 1 | pc |
| 412 | 5.12 | Microtitre plate with detachable wells 96wells | Item412 | 1 | pc |
| 413 | 5.13 | Micro centrifuge Autoclavable Plastic Tubes with cap 2ml | Item413 | 1 | pc |
| 414 | 5.14 | Micro centrifuge Autoclavable Plastic Tubes with cap 5ml | Item414 | 1 | pc |
| 415 | 5.15 | Micro centrifuge Autoclavable Plastic Tubes with cap 10ml | Item415 | 1 | pc |
| 416 | 5.16 | Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. Capacity 30ml | Item416 | 1 | pc |
| 417 | 5.17 | Museum Jar, With Cover 160x110x60mm | Item417 | 1 | pc |
| 418 | 5.18 | Museum Jar, With Cover 170x130x210 mm | Item418 | 1 | pc |
| 419 | 5.19 | Screw capped tubes 20x150mm | Item419 | 1 | pc |
| 420 | 5.2 | Serum vials sample storage box & stand for 3ml capacity | Item420 | 1 | pc |
| 421 | 5.21 | Sample Container -Wide mouth bottle,125ml Autoclavable (Polypropylene) 125ml | Item421 | 1 | pc |
| 422 | 5.22 | Storage vials (autoclavable) 2ml | Item422 | 1 | pc |
| 423 | 5.23 | Teasing Needles for moulds | Item423 | 1 | pc |
| 424 | 5.24 | Test Tube Stand - Test -tube size - 25mm diametre | Item424 | 1 | pc |
| 425 | 5.25 | Test Tube Stand - test -tube size - 16mm diametre | Item425 | 1 | pc |
| 426 | 5.26 | Test Tube Stand - Test-tube size - 10mm diametre | Item426 | 1 | pc |
| 427 | 5.27 | Test tube basket, large | Item427 | 1 | pc |
| 428 | 5.28 | Test tube basket, small | Item428 | 1 | pc |
| 429 | 5.29 | Test tube rack to accommodate 3 ml. test tubes 5X15 | Item429 | 1 | pc |
| 430 | 5.3 | Test tube rack to accommodate 5 ml. test tubes 5X15 | Item430 | 1 | pc |
| 431 | 5.31 | Test tube racks:4 x 13 | Item431 | 1 | pc |
| 432 | 5.32 | Test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes) | Item432 | 1 | pc |
| 433 | 5.33 | Test Tube Carrier (stainless steel) | Item433 | 1 | pc |
| 434 | 5.34 | V.D.R.L. Slides (75mmx50mm 1.45mm) | Item434 | 1 | pc |
| 435 | 5.35 | Wash bottle plastic with delivery Nozzle 200ml | Item435 | 1 | pc |
| 436 | 5.36 | Wash bottle plastic with delivery Nozzle 60ml | Item436 | 1 | pc |
| 437 | 5.37 | Bunsen burner | Item437 | 1 | pc |
| 438 | 5.38 | Bacteriological loop holder with loop (ready to use) | Item438 | 1 | pc |
| 439 | 5.39 | Biological indicator for steam | Item439 | 1 | pc |
| 440 | 5.4 | Bowie DickTest Pack Steam | Item440 | 1 | pc |
| 441 | 5.41 | Ice box 5 litres | Item441 | 1 | pc |
| 442 | 5.42 | Labels for Micro centrifuge tubes white Size ½” | Item442 | 1 | pc |
| 443 | 5.43 | Metaloops (Changeable Nichrome loop embedded in Brass rod with heat resistant handle with- | Item443 | 1 | pc |
| 444 | 5.44 | a. 2 mm diameter Nichrome wire | Item444 | 1 | pc |
| 445 | 5.45 | b. 3 mm diameter Nichrome wire | Item445 | 1 | pc |
| 446 | 5.46 | c. 4 mm diameter Nichrome wire | Item446 | 1 | pc |
| 447 | 5.47 | Metaloops (Fixed straight Nichrome loop embedded in SS rod with heat resistant handle with- | Item447 | 1 | pc |
| 448 | 5.48 | Microtome Knife | Item448 | 1 | pc |
| 449 | 5.49 | Mops | Item449 | 1 | pc |
| 450 | 5.5 | Magnifying glass, big size with handle | Item450 | 1 | pc |
| 451 | 5.51 | Mortar - Pestle | Item451 | 1 | pc |
| 452 | 5.52 | Nichrome loop-4 mm | Item452 | 1 | pc |
| 453 | 5.53 | Nichrome loop-2 mm | Item453 | 1 | pc |
| 454 | 5.54 | Nichrome loop-1.3 mm | Item454 | 1 | pc |
| 455 | 5.55 | Pipette stand( vertical & horizontal) 4/5 pipettes | Item455 | 1 | pc |
| 456 | 5.56 | Staining rack. 20 slide capacity. | Item456 | 1 | pc |
| 457 | 5.57 | Sprit Lamp glass/ metal | Item457 | 1 | pc |
| 458 | 5.58 | Screwdrivers -multipurpose | Item458 | 1 | pc |
| 459 | 5.59 | Silver aluminium foil | Item459 | 1 | pc |
| 460 | 5.6 | Surgical Knife (Big) | Item460 | 1 | pc |
| 461 | 5.61 | Sterile swab sticks | Item461 | 1 | pc |
| 462 | 5.62 | Syringe driven filters PTFE (hydrophilic) pore size 0.22µm | Item462 | 1 | pc |
| 463 | 5.63 | Thermometer 37degree C | Item463 | 1 | pc |
| 464 | 5.64 | Twine | Item464 | 1 | pc |
| 465 | 5.65 | Universal collection vials (Urine pot) | Item465 | 1 | pc |
| 466 | 5.66 | Universal Wash Reagents 500ml | Item466 | 1 | pc |
| 467 | 5.67 | Anti-CD 56 | Item467 | 1 | per ml |
| 468 | 5.68 | Anti-61 | Item468 | 1 | per ml |
| 469 | 5.69 | Anti-CD 68 | Item469 | 1 | per ml |
| 470 | 5.7 | Anti-CD 33 | Item470 | 1 | per ml |
| 471 | 5.71 | Anti-Ki 67 (Mib) | Item471 | 1 | per ml |
| 472 | 5.72 | Anti Neurofilament Protein | Item472 | 1 | per ml |
| 473 | 5.73 | Anti-Synaptophysin | Item473 | 1 | per ml |
| 474 | 5.74 | Anti-GFAP | Item474 | 1 | per ml |
| 475 | 5.75 | Anti-CD 99 | Item475 | 1 | per ml |
| 476 | 5.76 | Anti-CD 31 | Item476 | 1 | per ml |
| 477 | 5.77 | Anti-B HCG | Item477 | 1 | per ml |
| 478 | 5.78 | Poly-L.Lysine | Item478 | 1 | per ml |
| 479 | 5.79 | Anti-CD 20 (B cells) | Item479 | 1 | per ml |
| 480 | 5.8 | Anti-CD 45 (LCA) | Item480 | 1 | per ml |
| 481 | 5.81 | Anti-S 100 | Item481 | 1 | per ml |
| 482 | 5.82 | Anti- Desmin | Item482 | 1 | per ml |
| 483 | 5.83 | Anti-C-erb B-2 (Her-L/Neu) | Item483 | 1 | per ml |
| 484 | 5.84 | Anti-ER | Item484 | 1 | per ml |
| 485 | 5.85 | Anti-PR | Item485 | 1 | per ml |
| 486 | 5.86 | Anti-CD 3 | Item486 | 1 | per ml |
| 487 | 5.87 | Anti-CD 20 | Item487 | 1 | per ml |
| 488 | 5.88 | Anti-CD 117 | Item488 | 1 | per ml |
| 489 | 5.89 | Anti-CD 34 | Item489 | 1 | per ml |
| 490 | 5.9 | Anti-CD 30 | Item490 | 1 | per ml |
| 491 | 5.91 | Anti-Cyclin D1 | Item491 | 1 | per ml |
| 492 | 5.92 | Anti-CD 15 | Item492 | 1 | per ml |
| 493 | 5.93 | Anti-CD 5 | Item493 | 1 | per ml |
| 494 | 5.94 | FITC-Conjugated Rabbit | Item494 | 1 | per ml |
| 495 | 5.95 | Anti-Human IgA (alpha chain) | Item495 | 1 | per ml |
| 496 | 5.96 | FITC-Conjugated Rabbit | Item496 | 1 | per ml |
| 497 | 5.97 | Anti-Human IgG (Gamma chain) | Item497 | 1 | per ml |
| 498 | 5.98 | FITC-Conjugated Rabbit | Item498 | 1 | per ml |
| 499 | 5.99 | Anti-Human Kappa Light chain | Item499 | 1 | per ml |
| 500 | 6 | FITC-Conjugated Rabbit | Item500 | 1 | per ml |
| 501 | 6.01 | Anti-Human C3c Complement | Item501 | 1 | per ml |
| 502 | 6.02 | FITC-Conjugated Rabbit | Item502 | 1 | per ml |
| 503 | 6.03 | Anti-Human IgM (Mu chain) | Item503 | 1 | per ml |
| 504 | 6.04 | FITC-Conjugated Rabbit | Item504 | 1 | per ml |
| 505 | 6.05 | Anti-Human Lambda (Light chain) | Item505 | 1 | per ml |
| 506 | 6.06 | ANA by Hep-2-cell-line substrate(kit with reagents) | Item506 | 1 | pc |
| 507 | 6.07 | Electrodes for µpH System 361 | Item507 | 1 | pc |
| 508 | 6.08 | Osmium Tetroxide | Item508 | 1 | pc |
| 509 | 6.09 | Chromium trioxide | Item509 | 1 | pc |
| 510 | 6.1 | Zinc Chloride | Item510 | 1 | pc |
| 511 | 6.11 | Di-Sodium hydrogen phosphate anhydrous | Item511 | 1 | per gm |
| 512 | 6.12 | Di-Sodium hydrogen Orthophosphate Dibasic | Item512 | 1 | per gm |
| 513 | 6.13 | Sodium dihydrogen orthophosphate monohydrate | Item513 | 1 | per gm |
| 514 | 6.14 | Sodium borate | Item514 | 1 | per gm |
| 515 | 6.15 | Alpha napthyl butyrate | Item515 | 1 | per gm |
| 516 | 6.16 | Anti-CISH kits-HPV16/18DNA | Item516 | 1 | per ml |
| 517 | 6.17 | ER/P-R control | Item517 | 1 | per ml |
| 518 | 6.18 | Anti-Melanomal(HMB45) | Item518 | 1 | per ml |
| 519 | 6.19 | Anti Myeloperoxidase | Item519 | 1 | per ml |
| 520 | 6.2 | Anti -NSE | Item520 | 1 | per ml |
| 521 | 6.21 | Anti-PLAP | Item521 | 1 | per ml |
| 522 | 6.22 | Anti-bc12 oncoprotein | Item522 | 1 | per ml |
| 523 | 6.23 | Anti-Cytokeratin7 | Item523 | 1 | per ml |
| 524 | 6.24 | Anti-Cytokeratin20 | Item524 | 1 | per ml |
| 525 | 6.25 | Anti-BRCA 1Protein | Item525 | 1 | per ml |
| 526 | 6.26 | Anti-IgA | Item526 | 1 | per ml |
| 527 | 6.27 | Anti-IgM | Item527 | 1 | per ml |
| 528 | 6.28 | Anti-IgG | Item528 | 1 | per ml |
| 529 | 6.29 | Anti-compliment CD3 | Item529 | 1 | per ml |
| 530 | 6.3 | Anti-Rb gene protein | Item530 | 1 | per ml |
| 531 | 6.31 | Anti-P53 protein | Item531 | 1 | per ml |
| 532 | 6.32 | Anti-WT1 turmor | Item532 | 1 | per ml |
| 533 | 6.33 | Anti-Vimentin (V9) | Item533 | 1 | per ml |
| 534 | 6.34 | Anti-EMA(E29) | Item534 | 1 | per ml |
| 535 | 6.35 | Anti-p169INK4) | Item535 | 1 | per ml |
| 536 | 6.36 | Kappa | Item536 | 1 | per ml |
| 537 | 6.37 | Lamda | Item537 | 1 | per ml |
| 538 | 6.38 | Eosine spirit soluble | Item538 | 1 | per ml |
| 539 | 6.39 | PAP Pen Immuno histochemistry | Item539 | 1 | per ml |
| 540 | 6.4 | Anti-CD 1a | Item540 | 1 | per ml |
| 541 | 6.41 | Anti-SMA | Item541 | 1 | per ml |
| 542 | 6.42 | Anti-Myogenin | Item542 | 1 | per ml |
| 543 | 6.43 | Fluorescent bchiff reagent | Item543 | 1 | per ml |
| 544 | 6.44 | Carmine | Item544 | 1 | per ml |
| 545 | 6.45 | Acriffarine | Item545 | 1 | per ml |
| 546 | 6.46 | Cresyl fast blue | Item546 | 1 | per ml |
| 547 | 6.47 | Luxol fast blue | Item547 | 1 | per ml |
| 548 | 6.48 | Cresyl violet | Item548 | 1 | per ml |
| 549 | 6.49 | Epinephrine (3x0.5ml) | Item549 | 1 | pc |
| 550 | 6.5 | Aggrecetion ristocetion A Sulfate (3x0.5ml) | Item550 | 1 | pc |
| 551 | 6.51 | A D P(Adenosine-5l Diphosphate(3x0.5ml) | Item551 | 1 | pc |
| 552 | 6.52 | Arachidonic acid lyohillzed sodium Arachidonate | Item552 | 1 | pc |
| 553 | 6.53 | Collagen Soluble Calfskin(3x0.5ml) | Item553 | 1 | pc |
| 554 | 6.54 | Vw Fator Assay ristocetin cofactor (3x0.5ml) | Item554 | 1 | pc |
| 555 | 6.55 | Test tube( siliconized,flate bottom 7x25x55mm) | Item555 | 1 | pc |
| 556 | 6.56 | Stri Bars plastic coaled MICRO | Item556 | 1 | pc |
| 557 | 6.57 | Cryo Glue (Tissue Embedding Medium)for Cryostat Machine | Item557 | 1 | pc |
| 558 | 6.58 | Diposables blades for Cryostat Machine | Item558 | 1 | pc |
| 559 | 6.59 | Silicon Tubal Ring | Item559 | 1 | pc |
| 560 | 6.6 | Laser Spectacles | Item560 | 1 | pc |
| 561 | 6.61 | Fluid Warmer | Item561 | 1 | pc |
| 562 | 6.62 | Filter for Suction Machine( Atmos) | Item562 | 1 | pc |
| 563 | 6.63 | NIBP Monitor with integrated cuff arm | Item563 | 1 | pc |
| 564 | 6.64 | Serum Zinc | Item564 | 1 | per ml |
| 565 | 6.65 | Copper | Item565 | 1 | per ml |
| 566 | 6.66 | Ceruloplasmin | Item566 | 1 | per ml |
| 567 | 6.67 | Ammonia | Item567 | 1 | per ml |
| 568 | 6.68 | Ammonia | Item568 | 1 | per ml |
| 569 | 6.69 | Alcohol | Item569 | 1 | per ml |
| 570 | 6.7 | D- Dimer | Item570 | 1 | per ml |
| 571 | 6.71 | Anti ds DNA | Item571 | 1 | per ml |
| 572 | 6.72 | Anti sn Antibody | Item572 | 1 | per ml |
| 573 | 6.73 | Vitamin D | Item573 | 1 | per ml |
| 574 | 6.74 | Vitamin E | Item574 | 1 | per ml |
| 575 | 6.75 | NGAL | Item575 | 1 | per ml |
| 576 | 6.76 | Cystatin C | Item576 | 1 | per ml |
| 577 | 6.77 | G6 PD | Item577 | 1 | per ml |
| 578 | 6.78 | Lactate | Item578 | 1 | per ml |
| 579 | 6.79 | Apo A1 | Item579 | 1 | per ml |
| 580 | 6.8 | Homocysteine | Item580 | 1 | per ml |
| 581 | 6.81 | BNP | Item581 | 1 | per ml |
| 582 | 6.82 | Urinary VMA | Item582 | 1 | per ml |
| 583 | 6.83 | Blood ketones | Item583 | 1 | per ml |
| 584 | 6.84 | Lip a | Item584 | 1 | per ml |
| 585 | 6.85 | ANA | Item585 | 1 | per ml |
| 586 | 6.86 | Anti phospholipid antibody | Item586 | 1 | per ml |
| 587 | 6.87 | Vitamin C | Item587 | 1 | per ml |
| 588 | 6.88 | ENA | Item588 | 1 | per ml |
| 589 | 6.89 | Vitamin K | Item589 | 1 | per ml |
| 590 | 6.9 | Iodine | Item590 | 1 | per ml |
| 591 | 6.91 | APO B | Item591 | 1 | per ml |
| 592 | 6.92 | Troponin T | Item592 | 1 | per ml |
| 593 | 6.93 | CK MB1 | Item593 | 1 | per ml |
| 594 | 6.94 | CK MB 2 | Item594 | 1 | per ml |
| 595 | 6.95 | TIBC | Item595 | 1 | per ml |
| 596 | 6.96 | Transferrin | Item596 | 1 | per ml |
| 597 | 6.97 | IgG | Item597 | 1 | per ml |
| 598 | 6.98 | IgM | Item598 | 1 | per ml |
| 599 | 6.99 | IgA | Item599 | 1 | per ml |
| 600 | 7 | Inhibin A | Item600 | 1 | per ml |
| 601 | 7.01 | ß trace protein | Item601 | 1 | per ml |
| 602 | 7.02 | ?eta 2 microgobulin | Item602 | 1 | per ml |
| 603 | 7.03 | Alpha 1 Antitrypsin | Item603 | 1 | per ml |
| 604 | 7.04 | a -1 Microglobulin | Item604 | 1 | per ml |
| 605 | 7.05 | a-2 Macroglobulin | Item605 | 1 | per ml |
| 606 | 7.06 | Screening kit for inborn error of metabolism | Item606 | 1 | per ml |
| 607 | 7.07 | EQAS for clinical chemistry,Immunoassay, electrolyte, HbA1C. | Item607 | 1 | per ml |
| 608 | 7.08 | TPO (Thyroperoxidase) antibody | Item608 | 1 | per ml |
| 609 | 7.09 | Control for M-band electrophoresis | Item609 | 1 | per ml |
| 610 | 7.1 | TNF-a | Item610 | 1 | per ml |
| 611 | 7.11 | IL-2 | Item611 | 1 | per ml |
| 612 | 7.12 | Procalcitonin | Item612 | 1 | per ml |
| 613 | 7.13 | 5'ACAGCGTCATGGCAGAGCAGGTGGC3’ | Item613 | 1 | per ml |
| 614 | 7.14 | 5'AAAAGCTCTTCCCGCAGGATCCCGC3’ | Item614 | 1 | per ml |
| 615 | 7.15 | 5'GTGGCTGTTCCGGGATGGCCTTCTG3’ | Item615 | 1 | per ml |
| 616 | 7.16 | 5'CTTGAAGAAGGGCTCACTCTGTTTG3’ | Item616 | 1 | per ml |
| 617 | 7.17 | 5'CAGTACGATGATGCAGC3’ | Item617 | 1 | per ml |
| 618 | 7.18 | 5'CAGGTAGAAGAGGCGGT3’ | Item618 | 1 | per ml |
| 619 | 7.19 | amikacin ,neomycin & | Item619 | 1 | per ml |
| 620 | 7.2 | tobramycin standard (HPLC grade) | Item620 | 1 | per ml |
| 621 | 7.21 | EDTA gel (15%) | Item621 | 1 | Per gm |
| 622 | 7.22 | Acrylic - Heat cure-clear | Item622 | 1 | Pc |
| 623 | 7.23 | Acrylic - Heat cure-pink | Item623 | 1 | Pc |
| 624 | 7.24 | Acrylic - Self cure-clear | Item624 | 1 | Pc |
| 625 | 7.25 | Acrylic - Self cure-pink | Item625 | 1 | Pc |
| 626 | 7.26 | Agate Spatula | Item626 | 1 | Pc |
| 627 | 7.27 | Alginate impression material ( Dustless) | Item627 | 1 | Pc |
| 628 | 7.28 | Articulation paper | Item628 | 1 | Pc |
| 629 | 7.29 | Bur - Airotor-Diamond | Item629 | 1 | Pc |
| 630 | 7.3 | Bur - Airotor-TC- straight fissure | Item630 | 1 | Pc |
| 631 | 7.31 | Calcium Hydroxide paste for root canal | Item631 | 1 | Pc |
| 632 | 7.32 | Dappen dish | Item632 | 1 | Pc |
| 633 | 7.33 | Dental Floss – waxed, 25 m | Item633 | 1 | Pc |
| 634 | 7.34 | Dental Stone | Item634 | 1 | Pc |
| 635 | 7.35 | Dentin bonding agent | Item635 | 1 | Pc |
| 636 | 7.36 | Die stone | Item636 | 1 | Pc |
| 637 | 7.37 | Disposable Suction Tips with copper wire | Item637 | 1 | Pc |
| 638 | 7.38 | Emery Sheet - 100, 150 and 400 Grade | Item638 | 1 | Pc |
| 639 | 7.39 | Endodontic Gutta Percha Points(15-80) | Item639 | 1 | Pc |
| 640 | 7.4 | Etchant gel ( 37 % Phosphoric Acid) | Item640 | 1 | Pc |
| 641 | 7.41 | Fiber Composite splint | Item641 | 1 | Pc |
| 642 | 7.42 | Flexible Composite polishing discs | Item642 | 1 | Pc |
| 643 | 7.43 | Formocresol | Item643 | 1 | Pc |
| 644 | 7.44 | GIC- High strength pacakable for posteriors | Item644 | 1 | Pc |
| 645 | 7.45 | Glass Ionomer Cement Type I | Item645 | 1 | Pc |
| 646 | 7.46 | Glass Ionomer Cement Type II | Item646 | 1 | Pc |
| 647 | 7.47 | Gluma Dentin Desensitizer | Item647 | 1 | Pc |
| 648 | 7.48 | Gutta Percha Sticks | Item648 | 1 | Pc |
| 649 | 7.49 | Halogen bulbs- 12V, 55 W | Item649 | 1 | Pc |
| 650 | 7.5 | Hydroxyapatite Bone graft Material | Item650 | 1 | Pc |
| 651 | 7.51 | K File - all sizes | Item651 | 1 | Pc |
| 652 | 7.52 | Light cure composite - Flowable - All shades | Item652 | 1 | Pc |
| 653 | 7.53 | Light cure composite - nano-hybrid – all shades | Item653 | 1 | Pc |
| 654 | 7.54 | Modelling wax sheet no.2 | Item654 | 1 | Pc |
| 655 | 7.55 | Non Eugenol Impression Paste - standard pack | Item655 | 1 | Pc |
| 656 | 7.56 | Pinnacle tracing sticks ( minimum three years shelf life) | Item656 | 1 | Pc |
| 657 | 7.57 | Polishing brush for dental lathe | Item657 | 1 | Pc |
| 658 | 7.58 | Polymer Reinforced Zinc oxide Eugenol cement | Item658 | 1 | Pc |
| 659 | 7.59 | Pumice powder for polishing dentures | Item659 | 1 | Pc |
| 660 | 7.6 | Silver reinforced Glass Ionomer | Item660 | 1 | Pc |
| 661 | 7.61 | Supernal Base Plate | Item661 | 1 | Pc |
| 662 | 7.62 | Tissue conditioner ( Soft reliner) | Item662 | 1 | Pc |
| 663 | 7.63 | Ultrasonic scaler tip | Item663 | 1 | Pc |
| 664 | 7.64 | Vacuum formed sheets - Soft and hard - 2 and 3mm | Item664 | 1 | Pc |
| 665 | 7.65 | Vulcanite Trimmer ( TC) | Item665 | 1 | Pc |
| 666 | 7.66 | Zinc oxide Eugenol impression paste | Item666 | 1 | Pc |
| 667 | 7.67 | Self Cure Acrylic Tooth Colour Temporary Crown Materials (Powder & Liquid) | Item667 | 1 | Pc |
| 668 | 7.68 | Cold - Cure Acrylic Powder With Liquid (White Colour) | Item668 | 1 | Pc |
| 669 | 7.69 | Pits and Fissure Sealant | Item669 | 1 | Pc |
| 670 | 7.7 | Zinc oxide Eugenol impression paste | Item670 | 1 | Pc |
| 671 | 7.71 | IRM (Intermediate Restorative Materials) | Item671 | 1 | Pc |
| 672 | 7.72 | GIC Fuji Tupe IX | Item672 | 1 | Pc |
| 673 | 7.73 | GIC Type -II Restoative Materials | Item673 | 1 | Pc |
| 674 | 7.74 | Light Cure Composite Nano- Filling Materials | Item674 | 1 | Pc |
| 675 | 7.75 | Alginate impression material ( Dustless) | Item675 | 1 | Pc |
| 676 | 7.76 | Dental Stone | Item676 | 1 | Pc |
| 677 | 7.77 | Wedges | Item677 | 1 | Pc |
| 678 | 7.78 | Miracle Mix Materials | Item678 | 1 | Pc |
| 679 | 7.79 | Hand Piece Lubricant | Item679 | 1 | Pc |
| 680 | 7.8 | Dycal | Item680 | 1 | Pc |
| 681 | 7.81 | Suction Tips | Item681 | 1 | Pc |
| 682 | 7.82 | Acrylic Teeth Set | Item682 | 1 | Pc |
| 683 | 7.83 | Polishing Paste | Item683 | 1 | Pc |
| 684 | 7.84 | Polishing Rubber Cups and Bristle | Item684 | 1 | Pc |
| 685 | 7.85 | Disposable Glass | Item685 | 1 | Pc |
| 686 | 7.86 | Abrasive Strips for Polishing Proximal Areas of Teeth | Item686 | 1 | Pc |
| 687 | 7.87 | Cellophene Matrix Strips for LC Restoration | Item687 | 1 | Pc |
| 688 | 7.88 | Applicator Tips for LC | Item688 | 1 | Pc |
| 689 | 7.89 | Desensitizing Varnish | Item689 | 1 | Pc |
| 690 | 7.9 | Burs For Tooth Reduction Set | Item690 | 1 | Pc |
| 691 | 7.91 | Dental stone cutting Burs (Small Size) | Item691 | 1 | Pc |
| 692 | 7.92 | H-Files for Both Anterior and Posterior | Item692 | 1 | Pc |
| 693 | 7.93 | K- File for Both Anterior and Posterior | Item693 | 1 | Pc |
| 694 | 7.94 | Broaches | Item694 | 1 | Pc |
| 695 | 7.95 | Reamers for Both Anterior and Posterior | Item695 | 1 | Pc |
| 696 | 7.96 | Gutta Percha | Item696 | 1 | Pc |
| 697 | 7.97 | Absorbant Paper Point | Item697 | 1 | Pc |
| 698 | 7.98 | Titanium Post (All Sizes) | Item698 | 1 | Pc |
| 699 | 7.99 | Protapper Gutta Parcha All Size | Item699 | 1 | Pc |
| 700 | 8 | Alveogel | Item700 | 1 | Pc |
| 701 | 8.01 | RC CAL (Intra Canal Dressing Paste) | Item701 | 1 | Pc |
| 702 | 8.02 | Fiber Optics Air Rotor Hand Pieces with Coupling Unit | Item702 | 1 | Pc |
| 703 | 8.03 | GP Cutter | Item703 | 1 | Pc |
| 704 | 8.04 | Tungsten Carbide Burs For Air Rotor and Micro Motor HandPieces | Item704 | 1 | Pc |
| 705 | 8.05 | Sectional Matrixs | Item705 | 1 | Pc |
| 706 | 8.06 | Metal Crown | Item706 | 1 | Pc |
| 707 | 8.07 | Zinc oxide powder and eugenol (Big Size) | Item707 | 1 | Pc |
| 708 | 8.08 | Zinc oxide eugenol (Powder ) | Item708 | 1 | Pc |
| 709 | 8.09 | Zinc oxide eugenol (Liquid) | Item709 | 1 | Pc |
| 710 | 8.1 | Zinc oxide eugenol (ready mix) | Item710 | 1 | Pc |
| 711 | 8.11 | ZnO Impression paste | Item711 | 1 | Pc |
| 712 | 8.12 | Dycal Cement | Item712 | 1 | Pc |
| 713 | 8.13 | Stone burs (all sizes and shape) | Item713 | 1 | Pc |
| 714 | 8.14 | Stone burs for polishing (fine) | Item714 | 1 | Pc |
| 715 | 8.15 | Composit polishing disc | Item715 | 1 | Pc |
| 716 | 8.16 | Composite Cement | Item716 | 1 | Pc |
| 717 | 8.17 | Composite filling kit | Item717 | 1 | Pc |
| 718 | 8.18 | Composite finishing and polishing | Item718 | 1 | Pc |
| 719 | 8.19 | Composite polishing disc | Item719 | 1 | Pc |
| 720 | 8.2 | Composite polishing kit | Item720 | 1 | Pc |
| 721 | 8.21 | Composite polishing paste | Item721 | 1 | Pc |
| 722 | 8.22 | Endo Wash 5% 450ml | Item722 | 1 | Pc |
| 723 | 8.23 | Bristle Brush & Cup | Item723 | 1 | Pc |
| 724 | 8.24 | Eugenol 15ml | Item724 | 1 | Pc |
| 725 | 8.25 | Eugenol 110ml | Item725 | 1 | Pc |
| 726 | 8.26 | DPI Selfcure | Item726 | 1 | Pc |
| 727 | 8.27 | Ketac Molar | Item727 | 1 | Pc |
| 728 | 8.28 | NT Premium | Item728 | 1 | Pc |
| 729 | 8.29 | One Coat Bond | Item729 | 1 | Pc |
| 730 | 8.3 | GIC LC (Mini) GC | Item730 | 1 | Pc |
| 731 | 8.31 | PIVO Crown & Bridge Kit | Item731 | 1 | Pc |
| 732 | 8.32 | Protaper Hand Kit 21/25mm | Item732 | 1 | Pc |
| 733 | 8.33 | Mouth Mith Handle (GDC) | Item733 | 1 | Pc |
| 734 | 8.34 | Explorer (GDC) | Item734 | 1 | Pc |
| 735 | 8.35 | Surgical scissor (BRP) | Item735 | 1 | Pc |
| 736 | 8.36 | DPI Alloy | Item736 | 1 | Pc |
| 737 | 8.37 | Tri Hawk | Item737 | 1 | Pc |
| 738 | 8.38 | Glyde 3mlx1 | Item738 | 1 | Pc |
| 739 | 8.39 | GP F4-F5 (Dentsply) | Item739 | 1 | Pc |
| 740 | 8.4 | GP (15/35/40 ) Dentsply | Item740 | 1 | Pc |
| 741 | 8.41 | Dtech Etchn | Item741 | 1 | Pc |
| 742 | 8.42 | H File 15/20/25 | Item742 | 1 | Pc |
| 743 | 8.43 | Matrix Band No1 | Item743 | 1 | Pc |
| 744 | 8.44 | Diamond Bur | Item744 | 1 | Pc |
| 745 | 8.45 | Shofu Crown & Bridge Kit | Item745 | 1 | Pc |
| 746 | 8.46 | Vitrebond | Item746 | 1 | Pc |
| 747 | 8.47 | AH 26 | Item747 | 1 | Pc |
| 748 | 8.48 | Ketac Silver | Item748 | 1 | Pc |
| 749 | 8.49 | API Needle Holder | Item749 | 1 | Pc |
| 750 | 8.5 | NSK Push Button Airotor Handpiece | Item750 | 1 | Pc |
| 751 | 8.51 | Apex Locator Pixi Dentsply | Item751 | 1 | Pc |
| 752 | 8.52 | Lightcure Michine Coltene | Item752 | 1 | Pc |
| 753 | 8.53 | Sealer Machine with Pouch | Item753 | 1 | Pc |
| 754 | 8.54 | Scaller Tips Satellec | Item754 | 1 | Pc |
| 755 | 8.55 | Ultrasonic Cleaner | Item755 | 1 | Pc |
| 756 | 8.56 | Smart Burs | Item756 | 1 | Pc |
| 757 | 8.57 | Anti Fog Mouth Mirror | Item757 | 1 | Pc |
| 758 | 8.58 | Flouride Solution with Applicator | Item758 | 1 | Pc |
| 759 | 8.59 | Luting Cement | Item759 | 1 | Pc |
| 760 | 8.6 | Silicon Base Impression Materials | Item760 | 1 | Pc |
| 761 | 8.61 | Base Putty Impression Materials | Item761 | 1 | Pc |
| 762 | 8.62 | Light Body Impression Materials | Item762 | 1 | Pc |
| 763 | 8.63 | Re Cap | Item763 | 1 | Pc |
| 764 | 8.64 | DVI Self | Item764 | 1 | Pc |
| 765 | 8.65 | Propopar Band Kit 21/25ml | Item765 | 1 | Pc |
| 766 | 8.66 | GHOFU Crown & Bridge Kit | Item766 | 1 | Pc |
| 767 | 8.67 | ALT 26 | Item767 | 1 | Pc |
| 768 | 8.68 | APL Needle Holder | Item768 | 1 | Pc |
| 769 | 8.69 | Giyote 3ml | Item769 | 1 | Pc |
| 770 | 8.7 | IA File 15/20/25 | Item770 | 1 | Pc |
| 771 | 8.71 | Otech | Item771 | 1 | Pc |
| 772 | 8.72 | Flowable Composite Shade | Item772 | 1 | Pc |
| 773 | 8.73 | Plastic Filling Instruments | Item773 | 1 | Pc |
| 774 | 8.74 | Cement Spatula | Item774 | 1 | Pc |
| 775 | 8.75 | Cement Condenser | Item775 | 1 | Pc |
| 776 | 8.76 | Ball Burnisher (API) | Item776 | 1 | Pc |
| 777 | 8.77 | Extraction Forcept for Pedo (set of 16) | Item777 | 1 | Pc |
| 778 | 8.78 | Tweezer | Item778 | 1 | Pc |
| 779 | 8.79 | Diamond Round Bur | Item779 | 1 | Pc |
| 780 | 8.8 | Diamond Straight Fissure Bur | Item780 | 1 | Pc |
| 781 | 8.81 | Diamond Cone Shape Bur | Item781 | 1 | Pc |
| 782 | 8.82 | Contra Angle Hand Piece | Item782 | 1 | Pc |
| 783 | 8.83 | Paper point (15-40 & 45-80) | Item783 | 1 | Pc |
| 784 | 8.84 | Flamed Shaped Diamond Bur (All Sizes) | Item784 | 1 | Pc |
| 785 | 8.85 | Spoon Excavator | Item785 | 1 | Pc |
| 786 | 8.86 | Cold Mold Seal | Item786 | 1 | Pc |
| 787 | 8.87 | Pain Off | Item787 | 1 | Pc |
| 788 | 8.88 | Shade Guide | Item788 | 1 | Pc |
| 789 | 8.89 | Coe- Pack | Item789 | 1 | Pc |
| 790 | 8.9 | Apexit Plus | Item790 | 1 | Pc |
| 791 | 8.91 | Fibre Post (yellow, red , blue) | Item791 | 1 | Pc |
| 792 | 8.92 | Gingival Retraction Cord | Item792 | 1 | Pc |
| 793 | 8.93 | Spreader /Plugger (all sizes) | Item793 | 1 | Pc |
| 794 | 8.94 | Disposable Napkin | Item794 | 1 | Pc |
| 795 | 8.95 | Crown Cutting Kit | Item795 | 1 | Pc |
| 796 | 8.96 | Elevators (straight and periostal) | Item796 | 1 | Pc |
| 797 | 8.97 | Extraction Forcept for pedo adult (set of 14) | Item797 | 1 | Pc |
| 798 | 8.98 | G-coat Plus | Item798 | 1 | Pc |
| 799 | 8.99 | Protemp with tips and gun | Item799 | 1 | Pc |
| 800 | 9 | GIC Type IX | Item800 | 1 | Pc |
| 801 | 9.01 | Durable Flouride Releasing Coating | Item801 | 1 | Pc |
| 802 | 9.02 | Light Curing nano ionomer restorative | Item802 | 1 | Pc |
| 803 | 9.03 | Remin pro (protective dental cream) | Item803 | 1 | Pc |
| 804 | 9.04 | Chair Bulbs (ocero Infinity) | Item804 | 1 | Pc |
| 805 | 9.05 | Cold cure (pink) powder | Item805 | 1 | Pc |
| 806 | 9.06 | Cold cure (White) powder | Item806 | 1 | Pc |
| 807 | 9.07 | Cold Cure Liquid | Item807 | 1 | Pc |
| 808 | 9.08 | Green Sticks | Item808 | 1 | Pc |
| 809 | 9.09 | Mercury | Item809 | 1 | Pc |
| 810 | 9.1 | Disposable Patient Apron | Item810 | 1 | Pc |
| 811 | 9.11 | Bobe Cutter | Item811 | 1 | Pc |
| 812 | 9.12 | Bobe ronger | Item812 | 1 | Pc |
| 813 | 9.13 | Bone file | Item813 | 1 | Pc |
| 814 | 9.14 | Mought Prod Chain | Item814 | 1 | Pc |
| 815 | 9.15 | Macet/Hammer | Item815 | 1 | Pc |
| 816 | 9.16 | Amalgam Condenser | Item816 | 1 | Pc |
| 817 | 9.17 | Amalgam carrier | Item817 | 1 | Pc |
| 818 | 9.18 | Amalgam Curver | Item818 | 1 | Pc |
| 819 | 9.19 | Wax Knife | Item819 | 1 | Pc |
| 820 | 9.2 | Wire Cutter | Item820 | 1 | Pc |
| 821 | 9.21 | Plier | Item821 | 1 | Pc |
| 822 | 9.22 | Rubber dam Kit | Item822 | 1 | Pc |
| 823 | 9.23 | Crown remover | Item823 | 1 | Pc |
| 824 | 9.24 | Micromotor drill bits | Item824 | 1 | Pc |
| 825 | 9.25 | Compo Roller | Item825 | 1 | Pc |
| 826 | 9.26 | GP Holder | Item826 | 1 | Pc |
| 827 | 9.27 | Surgical Micromotor | Item827 | 1 | Pc |
| 828 | 9.28 | Periodontal Probe | Item828 | 1 | Pc |
| 829 | 9.29 | Acrylic Mixing Jar | Item829 | 1 | Pc |
| 830 | 9.3 | Air Polisher | Item830 | 1 | Pc |
| 831 | 9.31 | S.S. Inter maxillary fixation Screws 2.0mm - 12-14mm | Item831 | 1 | Pc |
| 832 | 9.32 | S.S. Inter maxillary fixation Screws 2.5mm - 12-14 mm | Item832 | 1 | Pc |
| 833 | 9.33 | Titanium cranial microplates (0.5mm plate thickness)10-18hole straight | Item833 | 1 | Pc |
| 834 | 9.34 | Titanium mandible miniplates (1mm plate thickness) 4 hole with bar/gap | Item834 | 1 | Pc |
| 835 | 9.35 | Titanium mandible miniplates (1mm plate thickness) 10-12hole straight | Item835 | 1 | Pc |
| 836 | 9.36 | Titanium midfacial miniplates (0.5-0.6mm plate thickness) L plate 90 degree long 4 hole with bar/gap Right side | Item836 | 1 | Pc |
| 837 | 9.37 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 90 degree Long 4 hole with bar/gap left side. | Item837 | 1 | Pc |
| 838 | 9.38 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree short 4 hole with bar/gap Right side | Item838 | 1 | Pc |
| 839 | 9.39 | Titanum Mid Facial Miniplates (0.5-0.6mm plates thickness) L plate 100-110 degree short 4 hole with bar/ gap Left side | Item839 | 1 | Pc |
| 840 | 9.4 | Titannium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree long 4 hole with bar/gap Right side | Item840 | 1 | Pc |
| 841 | 9.41 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree Long 4 hole With bar/gap Left side | Item841 | 1 | Pc |
| 842 | 9.42 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 4 hole With bar/gap | Item842 | 1 | Pc |
| 843 | 9.43 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 6 hole with bar/gap . | Item843 | 1 | Pc |
| 844 | 9.44 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 10 hole | Item844 | 1 | Pc |
| 845 | 9.45 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) T Plates 5 holes | Item845 | 1 | Pc |
| 846 | 9.46 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Y plate 4 holes | Item846 | 1 | Pc |
| 847 | 9.47 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Double Y plate 4 holes | Item847 | 1 | Pc |
| 848 | 9.48 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) X plate 5 holes | Item848 | 1 | Pc |
| 849 | 9.49 | Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Straight plate 10-12 holes | Item849 | 1 | Pc |
| 850 | 9.5 | Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 12-16 holes | Item850 | 1 | Pc |
| 851 | 9.51 | Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 20-25 holes | Item851 | 1 | Pc |
| 852 | 9.52 | Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 12-16 holes | Item852 | 1 | Pc |
| 853 | 9.53 | Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 20-25 holes | Item853 | 1 | Pc |
| 854 | 9.54 | Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 12-16 holes | Item854 | 1 | Pc |
| 855 | 9.55 | Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 20-25 holes | Item855 | 1 | Pc |
| 856 | 9.56 | Titanium double angled Reconstruction plates (2-2.4mm plate thickness) 20-25 holes | Item856 | 1 | Pc |
| 857 | 9.57 | Titanium Cranial ( outer diameter 1.0-1.2 mm) non self drilling screw- 4-6 mm length | Item857 | 1 | Pc |
| 858 | 9.58 | Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -6mm length | Item858 | 1 | Pc |
| 859 | 9.59 | Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -8 mm length | Item859 | 1 | Pc |
| 860 | 9.6 | Titanium midfacial (outer diameter 1.8/1.9mm) non self- drilling emergency screw -6 mm length | Item860 | 1 | Pc |
| 861 | 9.61 | Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -6mm length | Item861 | 1 | Pc |
| 862 | 9.62 | Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -8mm length | Item862 | 1 | Pc |
| 863 | 9.63 | Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -6mm length | Item863 | 1 | Pc |
| 864 | 9.64 | Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -8 mm length | Item864 | 1 | Pc |
| 865 | 9.65 | Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling screw -10mm length | Item865 | 1 | Pc |
| 866 | 9.66 | Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling Maxi screw -12mm length | Item866 | 1 | Pc |
| 867 | 9.67 | Titanium Reconstruction (2.4mm) non self- drilling Maxi Emergency screw -8-20mm length | Item867 | 1 | Pc |
| 868 | 9.68 | Titanium Lag Screws non self drilling ( outer diameter 2.4/2.5 mm)- 15-20mm length | Item868 | 1 | Pc |
| 869 | 9.69 | Drill bit with 6mm stop for Titanium cranial (1.0/1.2mm,1.0 mm pilot hole diameter) non self- drilling screw | Item869 | 1 | Pc |
| 870 | 9.7 | Drill bit with 6mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw | Item870 | 1 | Pc |
| 871 | 9.71 | Drill bit with 8mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw | Item871 | 1 | Pc |
| 872 | 9.72 | Drill bit with 6mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw | Item872 | 1 | Pc |
| 873 | 9.73 | Drill bit with 8mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw | Item873 | 1 | Pc |
| 874 | 9.74 | Drill bit with 10-12mm stop for Titanium (2.4mm reconstruction, pilot hole diameter 2mm) non self-drilling screw | Item874 | 1 | Pc |
| 875 | 9.75 | Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 4x4 cms | Item875 | 1 | Pc |
| 876 | 9.76 | Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 6x6 cms | Item876 | 1 | Pc |
| 877 | 9.77 | Titanium Mesh for mandible (0.5-0.6mm thickness) approx. dimension 10x8 cms | Item877 | 1 | Pc |
| 878 | 9.78 | Titanium orbital reconstruction mesh plates- Small | Item878 | 1 | Pc |
| 879 | 9.79 | Titanium orbital reconstruction mesh plates- Medium | Item879 | 1 | Pc |
| 880 | 9.8 | Titanium orbital reconstruction mesh plates- Large ( with medial and lateral wall extensions) | Item880 | 1 | Pc |
| 881 | 9.81 | Porous Polyethylene Orbital sheets ( 0.8-1.5 mm thickness; 5x5 cms approx) | Item881 | 1 | Pc |
| 882 | 9.82 | 26 guage Stainless Steel wire spool | Item882 | 1 | Pc |
| 883 | 9.83 | 32 guage Stainless Steel wire spool | Item883 | 1 | Pc |
| 884 | 9.84 | Raney Clips Stainless Steel | Item884 | 1 | Pc |
| 885 | 9.85 | 022 slot MBT Brackets with weldable convertible UTLD first molar Buccal tubes and NC II molar tubes | Item885 | 1 | Pc |
| 886 | 9.86 | Crimpable hooks | Item886 | 1 | Pc |
| 887 | 9.87 | 016 Multistranded SS wire | Item887 | 1 | Pc |
| 888 | 9.88 | Preformed Archwire - 014 NiTi U/ L | Item888 | 1 | Pc |
| 889 | 9.89 | Preformed Archwire - 016 NiTi U/ L | Item889 | 1 | Pc |
| 890 | 9.9 | Preformed Archwire - 016 x 022 SS – U/L | Item890 | 1 | Pc |
| 891 | 9.91 | Preformed Archwire - 017 x 025 SS– U /L | Item891 | 1 | Pc |
| 892 | 9.92 | Preformed Archwire - 019 x 025 SS – U / L | Item892 | 1 | Pc |
| 893 | 9.93 | Orthodontic stone | Item893 | 1 | Pc |
| 894 | 9.94 | Dunaform – soft and hard sheets- 2mm, 3mm | Item894 | 1 | Pc |
| 895 | 9.95 | Dental Surgery | Item895 | 1 | Pc |
| 896 | 9.96 | Mouth Mirror with Handle | Item896 | 1 | Pc |
| 897 | 9.97 | Mouth mirror | Item897 | 1 | Pc |
| 898 | 9.98 | Dental probe | Item898 | 1 | Pc |
| 899 | 9.99 | Periodontal probe | Item899 | 1 | Pc |
| 900 | 10 | Dental Explorer ( Curved and pigtail) | Item900 | 1 | Pc |
| 901 | 10.01 | Glass Bead Sterilizer | Item901 | 1 | Pc |
| 902 | 10.02 | Airotor handpiece - Mini-head (2 years warranty) | Item902 | 1 | Pc |
| 903 | 10.03 | Medesy/Hu Friedy Maxillary Anterior Extraction forceps | Item903 | 1 | Pc |
| 904 | 10.04 | Medesy/Hu Friedy Maxillary Reed's Extraction forceps | Item904 | 1 | Pc |
| 905 | 10.05 | Medesy/Hu Friedy Maxillary Premolar Extraction forceps | Item905 | 1 | Pc |
| 906 | 10.06 | Medesy/Hu Friedy Maxillary Molar Extraction forceps Right/Left | Item906 | 1 | Pc |
| 907 | 10.07 | Medesy/Hu Friedy Maxillary Bayonet Extraction forceps | Item907 | 1 | Pc |
| 908 | 10.08 | Medesy/Hu Friedy MaxillaryThird molar Extraction forceps | Item908 | 1 | Pc |
| 909 | 10.09 | Medesy/Hu Friedy Mandibular Anterior Extraction forceps | Item909 | 1 | Pc |
| 910 | 10.1 | Medesy/Hu Friedy Mandibular premolar Extraction forceps | Item910 | 1 | Pc |
| 911 | 10.11 | Medesy/Hu Friedy Mandibular molar Extraction forceps | Item911 | 1 | Pc |
| 912 | 10.12 | Medesy/Hu Friedy Warwick James Elevator-Straight | Item912 | 1 | Pc |
| 913 | 10.13 | Medesy/Hu FriedyWarwick James Elevator-Right/Left | Item913 | 1 | Pc |
| 914 | 10.14 | Medesy/Hu FriedyCryer's Elevator-Small size- Right/Left | Item914 | 1 | Pc |
| 915 | 10.15 | Medesy/Hu FriedyCryer's Elevator-Medium size- Right/Left | Item915 | 1 | Pc |
| 916 | 10.16 | Medesy/Hu FriedyCryer's Elevator- Large Size-Right/left | Item916 | 1 | Pc |
| 917 | 10.17 | Double angled Currette- Medium size | Item917 | 1 | Pc |
| 918 | 10.18 | Double angled Currette- Large size | Item918 | 1 | Pc |
| 919 | 10.19 | Molt's Perisoteal Elevator | Item919 | 1 | Pc |
| 920 | 10.2 | Freer Periosteal Elevator | Item920 | 1 | Pc |
| 921 | 10.21 | Walsham's nasal Forceps- Pair | Item921 | 1 | Pc |
| 922 | 10.22 | Asche Septal Forceps | Item922 | 1 | Pc |
| 923 | 10.23 | Hayton's Williams maxillary forceps | Item923 | 1 | Pc |
| 924 | 10.24 | Rowe's zygomatic elevator | Item924 | 1 | Pc |
| 925 | 10.25 | Sigmoid Notch retractor (Left/Right) | Item925 | 1 | Pc |
| 926 | 10.26 | Ramal Retractor | Item926 | 1 | Pc |
| 927 | 10.27 | wire cutter | Item927 | 1 | Pc |
| 928 | 10.28 | wire twister | Item928 | 1 | Pc |
| 929 | 10.29 | Coronoid retractor | Item929 | 1 | Pc |
| 930 | 10.3 | Mastoid self retaining retractor | Item930 | 1 | Pc |
| 931 | 10.31 | Mandibular Lower Border retractor | Item931 | 1 | Pc |
| 932 | 10.32 | Condylar retractor | Item932 | 1 | Pc |
| 933 | 10.33 | Dingmann retractor ( Adult) | Item933 | 1 | Pc |
| 934 | 10.34 | Vestibular retractor | Item934 | 1 | Pc |
| 935 | 10.35 | Swallow Tail retractor | Item935 | 1 | Pc |
| 936 | 10.36 | Curved Pterygoid osteotome 8mm | Item936 | 1 | Pc |
| 937 | 10.37 | Curved Pterygoid osteotome 10mm | Item937 | 1 | Pc |
| 938 | 10.38 | Epker Osteotome 4mm/6mm/8mm Curved | Item938 | 1 | Pc |
| 939 | 10.39 | Epker Osteotome 4mm/6mm/8mm Straight with marking | Item939 | 1 | Pc |
| 940 | 10.4 | Orthodontic model boxes | Item940 | 1 | Pc |
| 941 | 10.41 | Tongue Guard - Medium | Item941 | 1 | Pc |
| 942 | 10.42 | Dontrix gauge | Item942 | 1 | Pc |
| 943 | 10.43 | Extraoral Force gauge | Item943 | 1 | Pc |
| 944 | 10.44 | Orthodontic Typodont set ( With wax ridges and teeth set ) | Item944 | 1 | Pc |
| 945 | 10.45 | Plaster Vibrator (Worktop area of at least 20 X 10 cm, adjustable setting, 2 years warranty) | Item945 | 1 | Pc |
| 946 | 10.46 | Haematoxylin & Eosin Stain | Item946 | 1 | Pc |
| 947 | 10.47 | Eosin & Negrosin stain | Item947 | 1 | Pc |
| 948 | 10.48 | V.G. Tube | Item948 | 1 | Pc |
| 949 | 10.49 | Manipulation Pipette | Item949 | 1 | Pc |
| 950 | 10.5 | Metallic TVS Needle Guided Bracket | Item950 | 1 | Pc |
| 951 | 10.51 | Syringe Non Rubber 1ml | Item951 | 1 | Pc |
| 952 | 10.52 | Granulocyte colony stimulating factor | Item952 | 1 | Pc |
| 953 | 10.53 | Pipelle Aspirator/Vabra Aspirator | Item953 | 1 | Pc |
| 954 | 10.54 | Progesterone gel | Item954 | 1 | Pc |
| 955 | 10.55 | Injectable Progesterone | Item955 | 1 | Pc |
| 956 | 10.56 | Latex Condom without spermicide | Item956 | 1 | Pc |
| 957 | 10.57 | Osafe Incubator and Laminar Floor Cleaning Lotion | Item957 | 1 | Pc |
| 958 | 10.58 | Fersafe Antiseptic Lotion | Item958 | 1 | Pc |
| 959 | 10.59 | Liquid Nitrogen for Cryocan | Item959 | 1 | Pc |
| 960 | 10.6 | Immunobeads Reagents( Rabbit Anti Human IgG | Item960 | 1 | Pc |
| 961 | 10.61 | Immunobeads Reagents( Rabbit Anti Human IgA | Item961 | 1 | Pc |
| 962 | 10.62 | Immunobeads Reagents( Rabbit Anti Human IgM | Item962 | 1 | Pc |
| 963 | 10.63 | Conical Dispo Beaker 3.0ml | Item963 | 1 | Pc |
| 964 | 10.64 | PRP Lens | Item964 | 1 | Each |
| 965 | 10.65 | FAC's Tube (12 x 75mm, 5ml Round Bottom Test Tube, snap, sterile Cat: 352054 | Item965 | 1 | Each |
| 966 | 10.66 | Kymograph Paper (100 sheets) | Item966 | 1 | Each |
| 967 | 10.67 | Perimetric Chart Paper (100 sheets) | Item967 | 1 | Each |
| 968 | 10.68 | Haemocytometer Box | Item968 | 1 | Each |
| 969 | 10.69 | Haemoglobinometer sets | Item969 | 1 | Each |
| 970 | 10.7 | Dewar Tank 11 litre | Item970 | 1 | Each |
| 971 | 10.71 | CRYO PRO - 500ml (Liquid Nitrogen Cryosurgical Equipment | Item971 | 1 | Each |
| 972 | 10.72 | Bulb for Telepack Lamp | Item972 | 1 | Each |
| 973 | 10.73 | Radiofrequency Electrode Round Loop Big | Item973 | 1 | Each |
| 974 | 10.74 | Radiofrequency Electrode Round Loop Small | Item974 | 1 | Each |
| 975 | 10.75 | Bacterial Filter Machine sl No:101122008 | Item975 | 1 | Each |
| 976 | 10.76 | Indirect Ophthalmoscope | Item976 | 1 | Each |
| 977 | 10.77 | 20448-000Hgh Pressure Hose(Erbe Cryo Unit)) | Item977 | 1 | Each |
| 978 | 10.78 | Bone hand Drill Moore - 8448.28 | Item978 | 1 | Each |
| 979 | 10.79 | Hand Drill Jacobs Chuck | Item979 | 1 | Each |
| 980 | 10.8 | Demartel Condf/Wire Sawsflex 350mm | Item980 | 1 | Each |
| 981 | 10.81 | Twist Drill Set of 3mm, 3.5mm 4mm, 4.5mm | Item981 | 1 | Each |
| 982 | 10.82 | Crocodile Forceps (Ear Microsurgery) | Item982 | 1 | Each |
| 983 | 10.83 | Ear Microsuction Tips | Item983 | 1 | Each |
| 984 | 10.84 | Adaptors for Ear Microsuction Tips | Item984 | 1 | Each |
| 985 | 10.85 | Cup Ear Forceps | Item985 | 1 | Each |
| 986 | 10.86 | Perforators for Stopedectomy 0.4mm | Item986 | 1 | Each |
| 987 | 10.87 | Perforators for Stopedectomy 0.5mm | Item987 | 1 | Each |
| 988 | 10.88 | Rigid Pharyngoscope (pediatric) 20cm | Item988 | 1 | Each |
| 989 | 10.89 | Tonsil Holding Forceps | Item989 | 1 | Each |
| 990 | 10.9 | Straight Pick (Tympanyplasty) | Item990 | 1 | Each |
| 991 | 10.91 | Back Biting Forceps for Endoscope Nasal Surgery | Item991 | 1 | Each |
| 992 | 10.92 | Fiberoptic Otoscope with Pneumatic Pump | Item992 | 1 | Each |
| 993 | 10.93 | Bismith lodopyrrophosphate (BIPP) Paste/Powder | Item993 | 1 | Each |
| 994 | 10.94 | Mercurochrome Lotion | Item994 | 1 | Each |
| 995 | 10.95 | Haed Light fot ENT | Item995 | 1 | Each |
| 996 | 10.96 | Endoscopic Biopsy Forceps with Needle | Item996 | 1 | Each |
| 997 | 10.97 | CPR Manikin | Item997 | 1 | Each |
| 998 | 10.98 | Intubation Manikin | Item998 | 1 | Each |
| 999 | 10.99 | Easy Pump | Item999 | 1 | Each |
| 1000 | 11 | MRI Contrast Media - Gadoterate Meglumine Injection 5mmmol /ml. 10 ml vial | Item1000 | 1 | vial |
| 1001 | 11.01 | MRI Contrast Media - Gadobenate Dimeglumine Injection 10ml vial | Item1001 | 1 | vial |
| 1002 | 11.02 | MRI Contrast Media - Gadopentetate Dimeglumine Injection 0.5mmol/ml. 10 ml vial | Item1002 | 1 | vial |
| 1003 | 11.03 | MRI Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5ml | Item1003 | 1 | vial |
| 1004 | 11.04 | Non -Ionic Contrast Media - Iopromide Injection: USP 370mg - 50 ml vial | Item1004 | 1 | vial |
| 1005 | 11.05 | Non -Ionic Contrast Media - Iopromide Injection: USP 370mg -100ml vial | Item1005 | 1 | vial |
| 1006 | 11.06 | Non -Ionic Contrast Media - Iopromide Injection: USP 300mg -100ml vial | Item1006 | 1 | vial |
| 1007 | 11.07 | Non -Ionic Contrast Media -Iobitridol 350mg -100ml vial | Item1007 | 1 | vial |
| 1008 | 11.08 | Non -Ionic Contrast Media -Iomeprol Injection 300mg -50ml vial | Item1008 | 1 | vial |
| 1009 | 11.09 | Non -Ionic Contrast Media -Iomeprol Injection 300mg -100ml vial | Item1009 | 1 | vial |
| 1010 | 11.1 | Non -Ionic Contrast Media -Iomeprol Injection 350mg -50ml vial | Item1010 | 1 | vial |
| 1011 | 11.11 | Non -Ionic Contrast Media -Iomeprol Injection 350mg -100ml vial | Item1011 | 1 | vial |
| 1012 | 11.12 | Non -Ionic Contrast Media -Iomeprol Injection 400mg -50ml vial | Item1012 | 1 | vial |
| 1013 | 11.13 | Non -Ionic Contrast Media -Iomeprol Injection 400mg -100ml vial | Item1013 | 1 | vial |
| 1014 | 11.14 | Non -Ionic Contrast Media -Iopamidol Injection 370mg -50ml vial | Item1014 | 1 | vial |
| 1015 | 11.15 | Non -Ionic Contrast Media -Iopamidol Injection 370mg -100ml vial | Item1015 | 1 | vial |
| 1016 | 11.16 | Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20ml vial | Item1016 | 1 | vial |
| 1017 | 11.17 | Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50ml vial | Item1017 | 1 | vial |
| 1018 | 11.18 | Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100ml vial | Item1018 | 1 | vial |
| 1019 | 11.19 | COUPLAND ALL NOS | Item1019 | 1 | vial |
| 1020 | 11.2 | ELEVATORS (CRYER) 1 PAIRS | Item1020 | 1 | vial |
| 1021 | 11.21 | CASTROVEJO SCISSOR | Item1021 | 1 | vial |
| 1022 | 11.22 | SAMLL MICRO SCISSOR | Item1022 | 1 | vial |
| 1023 | 11.23 | LIGHT CURE COMPOSITE A2 | Item1023 | 1 | vial |
| 1024 | 11.24 | LIGHT CURE COMPOSITE A3 | Item1024 | 1 | vial |
| 1025 | 11.25 | LIGHT CURE COMPOSITE A3.5 | Item1025 | 1 | vial |
| 1026 | 11.26 | H-FILES FOR SIZE (15-40) 21MM | Item1026 | 1 | vial |
| 1027 | 11.27 | TOOTH POLISHING BRUSH | Item1027 | 1 | vial |
| 1028 | 11.28 | GLIDE | Item1028 | 1 | vial |
| 1029 | 11.29 | GRACY CURRETTE | Item1029 | 1 | vial |
| 1030 | 11.3 | Polyester braided suture * 2 75cm HGS-21, Blue 37mm 1/2 circle Taper Point : size-2 | Item1030 | 1 | pc |
| 1031 | 11.31 | Polyester braided suture * 2 75cm HOS-10, Blue 26mm 1/2 circle Reserve Cutting : size-2 | Item1031 | 1 | pc |
| 1032 | 11.32 | Polyester braided suture * 1 75cm HOS 12, Blue 40mm 1/2 Circle Reserve Cutting size -1 | Item1032 | 1 | pc |
| 1033 | 11.33 | Polyester braided suture * 5 75cm HOS-14, Blue 57mm 1/2 Circle Reverse Cutting size-5 | Item1033 | 1 | pc |
| 1034 | 11.34 | Polyester braided suture * 25x75cm KV-37, Blue 40mm 1/2 Circle Tapercutting size-2 | Item1034 | 1 | pc |
| 1035 | 11.35 | Poleyster braided suture * 54x75cm KV-40, Blue 45mm 1/2 Circle Tapercutting size-5 | Item1035 | 1 | pc |
| 1036 | 11.36 | Monofilament Knotless Polyglyconate wound closure device, 0 45cm GS-21, Green 37mm 1/2 Circle Taper Point, box of 12 foils size-0 | Item1036 | 1 | pc |
| 1037 | 11.37 | Monofilament Knotless Polyglyconate wound closure device, 2-0 30cm cm V-20, Green 26mm 1/2 Circle Taper Point, box of 12 foils size-2-0 | Item1037 | 1 | pc |
| 1038 | 11.38 | Monofilament Knotless Glycomer 631 wound closure device, 3-0 45cm P-14, UNDYED 24mm 3/8 Circle Resverse Cutting, box of 12 foils size- 3-0 | Item1038 | 1 | pc |
| 1039 | 11.39 | Polybutester monofilament suture with polytribolate coating size-*6-0 60cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0 | Item1039 | 1 | pc |
| 1040 | 11.4 | Polybutester monofilament suture with polytribolate coating size-*6-0 75cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0 | Item1040 | 1 | pc |
| 1041 | 11.41 | Polybutester monifilament suture with polytribolate coating Size-*5-0, 75cm 2XCV-11X36, Blue 12mm 3/8 Circle Taper Point | Item1041 | 1 | pc |
| 1042 | 11.42 | Polybutester monofilament suture with polytribolate coating Size-*4-0 90cm 2XCV-23X36, Blue 17mm 1/2Circle Taper Point size: 4-0 | Item1042 | 1 | pc |
| 1043 | 11.43 | Polybutester monofilament suture with polytribulate coating Size-*5-0 90cm2XCV, Blue 17mm 1/2 Circle Taper Point size: 5-0 | Item1043 | 1 | pc |
| 1044 | 11.44 | Polybutester moniofilament suture with polytribulate coating Size-*5-0, 75cm 2XKV-11X36, Blue 13mm 3/8 Circle Tapercutting size: 5-0 | Item1044 | 1 | pc |
| 1045 | 11.45 | Polybutester monofilament suture with polytribolate coating Size-* 7-0, 60cm 2XMV-175-8, Blue 8mm 3/8 Circle Taper Point size: 7-0 | Item1045 | 1 | pc |
| 1046 | 11.46 | Polybutester monofilament suture with polytribolate coating Size-*2-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point | Item1046 | 1 | pc |
| 1047 | 11.47 | Polybutester monofilament suture with polytribolate coating Size-*3-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point | Item1047 | 1 | pc |
| 1048 | 11.48 | Monofilament Knotless Glycomer 631 wound closure device, 2-0 23cm , VIOLET 27mm 1/2 Circle Taper Point, box of 12 foils size- 2-0 | Item1048 | 1 | pc |
| 1049 | 11.49 | Vaccutrend Needle/Syringe 21\" x 15\" | Item1049 | 1 | Each |
| 1050 | 11.5 | Vaccutrend Needle/Syringe 22\" x 15\" | Item1050 | 1 | Each |
| 1051 | 11.51 | Vaccutrent Needle /Syringe | Item1051 | 1 | Each |
| 1052 | 11.52 | Immunohistochemistry: | Item1052 | 1 | Each |
| 1053 | 11.53 | Anti Pax-5 FFPE | Item1053 | 1 | per ml |
| 1054 | 11.54 | Anti EBV FFPE | Item1054 | 1 | per ml |
| 1055 | 11.55 | Anti Pan CMV FFPE | Item1055 | 1 | per ml |
| 1056 | 11.56 | Anti CD 68 FFPE | Item1056 | 1 | per ml |
| 1057 | 11.57 | Anti WTI FFPE | Item1057 | 1 | per ml |
| 1058 | 11.58 | Anti PLAP FFPE | Item1058 | 1 | per ml |
| 1059 | 11.59 | Anti C3 FFPE | Item1059 | 1 | per ml |
| 1060 | 11.6 | Anti SMA FFPE | Item1060 | 1 | per ml |
| 1061 | 11.61 | Anti AR FFPE | Item1061 | 1 | per ml |
| 1062 | 11.62 | Anti BC16 FFPE | Item1062 | 1 | per ml |
| 1063 | 11.63 | Anti Myogenin FFPE | Item1063 | 1 | per ml |
| 1064 | 11.64 | Anti IDH-1 FFPE | Item1064 | 1 | per ml |
| 1065 | 11.65 | Anti ATRX FFPE | Item1065 | 1 | per ml |
| 1066 | 11.66 | Anti P63 FFPE | Item1066 | 1 | per ml |
| 1067 | 11.67 | Anti Neurofilament FFPE | Item1067 | 1 | per ml |
| 1068 | 11.68 | Anti CD 19 FFPE | Item1068 | 1 | per ml |
| 1069 | 11.69 | Anti MSA FFPE | Item1069 | 1 | per ml |
| 1070 | 11.7 | Anti Adipophylin FFPE | Item1070 | 1 | per ml |
| 1071 | 11.71 | Anti ALK D5F3 FFPE | Item1071 | 1 | per ml |
| 1072 | 11.72 | Anti Arginase-1 FFPE | Item1072 | 1 | per ml |
| 1073 | 11.73 | Anti B Catenin | Item1073 | 1 | per ml |
| 1074 | 11.74 | Bcl 10 FFPE | Item1074 | 1 | per ml |
| 1075 | 11.75 | Anti BER-EP4 FFPE | Item1075 | 1 | per ml |
| 1076 | 11.76 | Anti Clauclin 4 FFPE | Item1076 | 1 | per ml |
| 1077 | 11.77 | Anti D2 - 40 Podolanin FFPE | Item1077 | 1 | per ml |
| 1078 | 11.78 | Anti DOG 1 FFPE | Item1078 | 1 | per ml |
| 1079 | 11.79 | Anti SALL 4 FFPE | Item1079 | 1 | per ml |
| 1080 | 11.8 | Anti ERG FFPE | Item1080 | 1 | per ml |
| 1081 | 11.81 | Anti HBMEIgG4 | Item1081 | 1 | per ml |
| 1082 | 11.82 | Anti Inhilein FFPE | Item1082 | 1 | per ml |
| 1083 | 11.83 | Anti INSM 1 FFPE | Item1083 | 1 | per ml |
| 1084 | 11.84 | Anti Mammaglobin FFPE | Item1084 | 1 | per ml |
| 1085 | 11.85 | MART 1 FFPE | Item1085 | 1 | per ml |
| 1086 | 11.86 | Anti Melan A FFPE | Item1086 | 1 | per ml |
| 1087 | 11.87 | Anti MDM2 FFPE | Item1087 | 1 | per ml |
| 1088 | 11.88 | Anti Napsin A FFPE | Item1088 | 1 | per ml |
| 1089 | 11.89 | Anti P40 FFPE | Item1089 | 1 | per ml |
| 1090 | 11.9 | Anti PAX-8 FFPE | Item1090 | 1 | per ml |
| 1091 | 11.91 | Anti STAT-6 FFPE | Item1091 | 1 | per ml |
| 1092 | 11.92 | Anti TLE-1 FFPE | Item1092 | 1 | per ml |
| 1093 | 11.93 | Anti Uroplalcin-2 FFPE | Item1093 | 1 | per ml |
| 1094 | 11.94 | Anti Glycophorin FFPE | Item1094 | 1 | per ml |
| 1095 | 11.95 | Anti GCET-1 FFPE | Item1095 | 1 | per ml |
| 1096 | 11.96 | Anti CD 38/138 FFPE | Item1096 | 1 | per ml |
| 1097 | 11.97 | Anti Calcitonin FFPE | Item1097 | 1 | per ml |
| 1098 | 11.98 | Anti Caldermon FFPE | Item1098 | 1 | per ml |
| 1099 | 11.99 | Anti B Caldermon FFPE | Item1099 | 1 | per ml |
| 1100 | 12 | Anti CD 56 FFPE | Item1100 | 1 | per ml |
| 1101 | 12.01 | Anti NSM FFPE | Item1101 | 1 | per ml |
| 1102 | 12.02 | Anti CD 99 MIC-2 , 013 FFPE | Item1102 | 1 | per ml |
| 1103 | 12.03 | Anti CD 138 FFPE | Item1103 | 1 | per ml |
| 1104 | 12.04 | Anti CDH 17 Cadherin 17 FFPE | Item1104 | 1 | per ml |
| 1105 | 12.05 | Anti HeparII FFPE | Item1105 | 1 | per ml |
| 1106 | 12.06 | Anti Glypican-3 FFPE | Item1106 | 1 | per ml |
| 1107 | 12.07 | Anti STAB 2 FFPE | Item1107 | 1 | per ml |
| 1108 | 12.08 | Anti HRP Polymer Kit | Item1108 | 1 | per ml |
| 1109 | 12.09 | FITC Lambda light chain Immunofluorescence | Item1109 | 1 | per ml |
| 1110 | 12.1 | FITC IgM Immunofluorescence | Item1110 | 1 | per ml |
| 1111 | 12.11 | FITC IgA Immunofluorescence | Item1111 | 1 | per ml |
| 1112 | 12.12 | FITC IgG Immunofluorescence | Item1112 | 1 | per ml |
| 1113 | 12.13 | FITC C3 Immunofluorescence | Item1113 | 1 | per ml |
| 1114 | 12.14 | MLH1, MSH2, MSH6, PMS2 (Together) | Item1114 | 1 | per ml |
| 1115 | 12.15 | PDL1 Clone SP142 | Item1115 | 1 | per ml |
| 1116 | 12.16 | EGFR Clone 31G7 | Item1116 | 1 | per ml |
| 1117 | 12.17 | CDX2 | Item1117 | 1 | per ml |
| 1118 | 12.18 | GATA 3 | Item1118 | 1 | per ml |
| 1119 | 12.19 | CK 18 | Item1119 | 1 | per ml |
| 1120 | 12.2 | Mesothelin | Item1120 | 1 | per ml |
| 1121 | 12.21 | Glut 1 | Item1121 | 1 | per ml |
| 1122 | 12.22 | GCDFP | Item1122 | 1 | per ml |
| 1123 | 12.23 | MYB | Item1123 | 1 | per ml |
| 1124 | 12.24 | PLAG 1 | Item1124 | 1 | per ml |
| 1125 | 12.25 | HMGA 2 | Item1125 | 1 | per ml |
| 1126 | 12.26 | EBER in-situ Hybridization | Item1126 | 1 | Kit |
| 1127 | 12.27 | PCR | Item1127 | 1 | Each |
| 1128 | 12.28 | EGFR RT PCR Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue | Item1128 | 1 | Kit |
| 1129 | 12.29 | MSI detection Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue | Item1129 | 1 | Kit |
| 1130 | 12.3 | BCR-Abl1-PCR Kit compatible With Qiagen | Item1130 | 1 | Kit |
| 1131 | 12.31 | FISH | Item1131 | 1 | Each |
| 1132 | 12.32 | ALK mutation break apart probe in lung adenocarcinoma | Item1132 | 1 | Kit |
| 1133 | 12.33 | MYB-NFIB dual colour fusion probe | Item1133 | 1 | Kit |
| 1134 | 12.34 | MYB dual colour break apart probe | Item1134 | 1 | Kit |
| 1135 | 12.35 | MAML2 dual colour break apart probe | Item1135 | 1 | Kit |
| 1136 | 12.36 | ETV6 dual colour break apart rearrangement probe | Item1136 | 1 | Kit |
| 1137 | 12.37 | PLAG 1 rearrangement probe | Item1137 | 1 | Kit |
| 1138 | 12.38 | HMGA 2 rearrangement probe | Item1138 | 1 | Kit |
| 1139 | 12.39 | Immunofluorescence | Item1139 | 1 | Each |
| 1140 | 12.4 | Anti p-ANCA direct Immunofluorescence | Item1140 | 1 | Kit |
| 1141 | 12.41 | Anti c-ANCA direct Immunofluorescence | Item1141 | 1 | Kit |
| 1142 | 12.42 | Anti ANA direct Immunofluorescence | Item1142 | 1 | Kit |
| 1143 | 12.43 | Anti Aquaporin 4 | Item1143 | 1 | Kit |
| 1144 | 12.44 | C1q | Item1144 | 1 | Kit |
| 1145 | 12.45 | Flowcytometry | Item1145 | 1 | Each |
| 1146 | 12.46 | CD 16 APC | Item1146 | 1 | Kit |
| 1147 | 12.47 | HLA B27 Kit (should be compatible with BD Facscalibur) | Item1147 | 1 | Kit |
| 1148 | 12.48 | Elisa (MAGO-4) | Item1148 | 1 | Each |
| 1149 | 12.49 | Anti P-ANCA Elisa | Item1149 | 1 | Sets |
| 1150 | 12.5 | Anti c-ANCA Elisa | Item1150 | 1 | Sets |
| 1151 | 12.51 | Anti Cyclic Citrulinated peptide (CCP) Elisa | Item1151 | 1 | Sets |
| 1152 | 12.52 | Anti Smith Elisa | Item1152 | 1 | Sets |
| 1153 | 12.53 | Anti Peroxiredoxin VI (Prx VI) Elisa | Item1153 | 1 | Sets |
| 1154 | 12.54 | Anti Bmi I Elisa | Item1154 | 1 | Sets |
| 1155 | 12.55 | Anti Matrix Metalloproteinase 7 (MMP7) Elisa | Item1155 | 1 | Sets |
| 1156 | 12.56 | Anti NY ESO I | Item1156 | 1 | Sets |
| 1157 | 12.57 | Anti Scl 70 | Item1157 | 1 | Sets |
| 1158 | 12.58 | Anti URNP | Item1158 | 1 | Sets |
| 1159 | 12.59 | Chemicals and Consumables | Item1159 | 1 | Each |
| 1160 | 12.6 | Proteinase K | Item1160 | 1 | Sets |
| 1161 | 12.61 | Pronase | Item1161 | 1 | Sets |
| 1162 | 12.62 | FISH Reagents : | Item1162 | 1 | Each |
| 1163 | 12.63 | Poly L Lysine | Item1163 | 1 | ml |
| 1164 | 12.64 | 20X Saline Sodium Citrate (20X SSC) Salt, Molecular Grade | Item1164 | 1 | gm |
| 1165 | 12.65 | 1 M NaSCN ( 1M Sodium Thiocyanate) Salt, Molecular Grade | Item1165 | 1 | gm |
| 1166 | 12.66 | IGEPAL @ CA 630 | Item1166 | 1 | gm |
| 1167 | 12.67 | Rubber Cement | Item1167 | 1 | tube |
| 1168 | 12.68 | DAPI | Item1168 | 1 | ml |
| 1169 | 12.69 | Sodium Chloride (NaCL), 58.44g mol-1 Molecular Grade | Item1169 | 1 | gm |
| 1170 | 12.7 | Sodium Citrate (Na3C6H5O7) 258.06g mol-1 Molecular Grade | Item1170 | 1 | gm |
| 1171 | 12.71 | Fluorescence microscopic immersion oil | Item1171 | 1 | ml |
| 1172 | 12.72 | Immunofluorescence Reagents : | Item1172 | 1 | Each |
| 1173 | 12.73 | Trypsin Powder,Molecular Grade | Item1173 | 1 | gm |
| 1174 | 12.74 | Additional Consumables / Disposables | Item1174 | 1 | Each |
| 1175 | 12.75 | 15mm double swivel with port & extension | Item1175 | 1 | Each |
| 1176 | 12.76 | 72 hours CLOSED VENTILATION SUCTION CATHETER Must have double - lumen siliconised catheter Swivel connector un-coupling wedge, Lockable thumb –Valve end Cap, Softer Sleeve material, 72 hour recommended during of use. Size: 12F, 14F, 16F | Item1176 | 1 | Each |
| 1177 | 12.77 | Adjustable circle breathing system (2 Litre bag, 2 metre length and 1.5 metre limb) | Item1177 | 1 | Each |
| 1178 | 12.78 | Adjustable circle breathing system (2 mts length) | Item1178 | 1 | Each |
| 1179 | 12.79 | Adult curved flared prong with tube1.8m length | Item1179 | 1 | Each |
| 1180 | 12.8 | Adult curved nasal prong with tube1.8m length | Item1180 | 1 | Each |
| 1181 | 12.81 | Adult Respi-Check high concentration oxygen mask with oxygen tube | Item1181 | 1 | Each |
| 1182 | 12.82 | Anti-microbial circle breathing system (1.6 metre length and 0.8 metre limb) | Item1182 | 1 | Each |
| 1183 | 12.83 | Anti-microbial circle breathing system (2 litre bag, 1.6 metre Length, 0.8 metre limb) | Item1183 | 1 | Each |
| 1184 | 12.84 | Anti-microbial circle breathing system (2 litre bag, 2.4 metre Length, 0.8 metre limb) | Item1184 | 1 | Each |
| 1185 | 12.85 | Apron Cloth (Sterile) | Item1185 | 1 | Each |
| 1186 | 12.86 | Attest 1292 E Biological Indicator | Item1186 | 1 | Each |
| 1187 | 12.87 | Attest Biological Indicator (for styeam) 3M | Item1187 | 1 | Each |
| 1188 | 12.88 | Attest Rapid Auto Reader Incubator (For Steam) (Early result for biological test) | Item1188 | 1 | Each |
| 1189 | 12.89 | Balanced Salt Solution (BSS) | Item1189 | 1 | Each |
| 1190 | 12.9 | Bilbao-Dotter tube with guide wire | Item1190 | 1 | Each |
| 1191 | 12.91 | BIS Electrodes | Item1191 | 1 | Each |
| 1192 | 12.92 | Bone file | Item1192 | 1 | Each |
| 1193 | 12.93 | Bone ronger | Item1193 | 1 | Each |
| 1194 | 12.94 | BP blade with handle (no 15 & 17) | Item1194 | 1 | Each |
| 1195 | 12.95 | Cardiac Troponin T kit | Item1195 | 1 | Each |
| 1196 | 12.96 | Center hole towel | Item1196 | 1 | Each |
| 1197 | 12.97 | COBAN Tm 4\" | Item1197 | 1 | Each |
| 1198 | 12.98 | Cols light source for transillumination | Item1198 | 1 | Each |
| 1199 | 12.99 | Contra angle hand piece | Item1199 | 1 | Each |
| 1200 | 13 | Disposable Face Mask (Cloth) | Item1200 | 1 | Each |
| 1201 | 13.01 | Disposable Head Positioning Device for the Prone Position – Made of latex- free foam with mirror for providing the clinician a clear view of face, eye & endotrachael tube plus sloted design for positioning of Endotracheal on either side of the patient face 8000HDP | Item1201 | 1 | Each |
| 1202 | 13.02 | Disposable Kelly's Pad | Item1202 | 1 | Each |
| 1203 | 13.03 | ECG monitoring Electrode (Solid Hydrogel) | Item1203 | 1 | Each |
| 1204 | 13.04 | ECG monitoring Electrode with foam backing 2223 | Item1204 | 1 | Each |
| 1205 | 13.05 | ECG monitoring Electrode with foam backing Large | Item1205 | 1 | Each |
| 1206 | 13.06 | Elastometric Infusion Pump for Analgesia 5ml/hour | Item1206 | 1 | Each |
| 1207 | 13.07 | Elastometric Infusion Pump for Analgesia 2ml/hour Model SV2 | Item1207 | 1 | Each |
| 1208 | 13.08 | Elevators (Straight and Periostal) | Item1208 | 1 | Each |
| 1209 | 13.09 | Emergency Cricothyrotomy Device Adult 4mm ID Children 2mm ID | Item1209 | 1 | Each |
| 1210 | 13.1 | Eye wear for composite fillings | Item1210 | 1 | Each |
| 1211 | 13.11 | Face guard | Item1211 | 1 | Each |
| 1212 | 13.12 | Fibre splint | Item1212 | 1 | Each |
| 1213 | 13.13 | Fluid Warming Cassette (Disposable) WF-250 | Item1213 | 1 | Each |
| 1214 | 13.14 | Fluid Warming Cassette (Disposable) WF-100 | Item1214 | 1 | Each |
| 1215 | 13.15 | Gigly Saw | Item1215 | 1 | Each |
| 1216 | 13.16 | Glass bead sterilizer | Item1216 | 1 | Each |
| 1217 | 13.17 | Tungsen Carbide Burs for Air Rotor and Micro Motor Hand Pieces | Item1217 | 1 | Each |
| 1218 | 13.18 | Green PVC tubing for oxygen 6 mm, Length in metres | Item1218 | 1 | Each |
| 1219 | 13.19 | Iodixannol 320 mg Iodine/ml-100 ml. | Item1219 | 1 | Each |
| 1220 | 13.2 | Iohexol 300 mg-Iodine/ml 100 ml | Item1220 | 1 | Each |
| 1221 | 13.21 | Iomeron 400 mg/ml – 50 ml. | Item1221 | 1 | Each |
| 1222 | 13.22 | Ioversol/Iopamide/Iopamidol – 50 ml. | Item1222 | 1 | Each |
| 1223 | 13.23 | ISO Green Standard Laryngoscope System (Disposable plastic blades) 7 sizes of MAC and Miller blades | Item1223 | 1 | Each |
| 1224 | 13.24 | JESS fixtators pediatric/large | Item1224 | 1 | Each |
| 1225 | 13.25 | Jobson's Probe | Item1225 | 1 | Each |
| 1226 | 13.26 | Kinesiology Color Tap/Taping for Orthopaedic used | Item1226 | 1 | Each |
| 1227 | 13.27 | Killian's Nasal Speculum | Item1227 | 1 | Each |
| 1228 | 13.28 | K-Wires: 1.8mm | Item1228 | 1 | Each |
| 1229 | 13.29 | K-Wires: 4mm | Item1229 | 1 | Each |
| 1230 | 13.3 | K-Wires: 1.5 mm | Item1230 | 1 | Each |
| 1231 | 13.31 | K-Wires: 2.5 mm | Item1231 | 1 | Each |
| 1232 | 13.32 | K-Wires: 2mm | Item1232 | 1 | Each |
| 1233 | 13.33 | K-Wires: 3mm | Item1233 | 1 | Each |
| 1234 | 13.34 | Macintosh Style blades 2, 4 | Item1234 | 1 | Each |
| 1235 | 13.35 | Magill’s forceps Adult child infant | Item1235 | 1 | Each |
| 1236 | 13.36 | Manual Plaster cutting saw | Item1236 | 1 | Each |
| 1237 | 13.37 | Manual Plaster spreader | Item1237 | 1 | Each |
| 1238 | 13.38 | Manual Torniquet (cuff & Pump) | Item1238 | 1 | Each |
| 1239 | 13.39 | Mayo stand cover | Item1239 | 1 | Each |
| 1240 | 13.4 | Miller style blades 0, | Item1240 | 1 | Each |
| 1241 | 13.41 | Miller style blades 1 | Item1241 | 1 | Each |
| 1242 | 13.42 | Mortar and Pestle | Item1242 | 1 | Each |
| 1243 | 13.43 | Mouth & Cheek retractor | Item1243 | 1 | Each |
| 1244 | 13.44 | Mouth mirror | Item1244 | 1 | Each |
| 1245 | 13.45 | MRI compatible Laryngoscopes All sizes | Item1245 | 1 | Each |
| 1246 | 13.46 | MRI Film 14” x 17” | Item1246 | 1 | Each |
| 1247 | 13.47 | Neopuff (Neonatal Resuscitator) | Item1247 | 1 | Each |
| 1248 | 13.48 | North Nasal Preformed Cuffed TubeCuffed Must have IVORY PVC Profile Soft Seal Cuff, implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 6To 8mm ID & length 27cm to 30.5 tips to nares | Item1248 | 1 | Each |
| 1249 | 13.49 | OVARIAN SHIELD (Kiran) | Item1249 | 1 | Each |
| 1250 | 13.5 | Oxygen Supply Tubing for Heat & Moisture Exchanger Oxygen Supply Tubing for Heat & Moisture Exchanger with Connector to attach HME for Tracheostomy Tube Length 15cm | Item1250 | 1 | Each |
| 1251 | 13.51 | Oxygen Analyser | Item1251 | 1 | Each |
| 1252 | 13.52 | Oxygen Blenders | Item1252 | 1 | Each |
| 1253 | 13.53 | Para film roll (size 10cmx125cm) 3 “ dia | Item1253 | 1 | Each |
| 1254 | 13.54 | Parafilm, roll | Item1254 | 1 | Each |
| 1255 | 13.55 | Perineural catheter for continuous plexus and peripheral nerve blocks. Content: 118 G lacoplex needle with centimeter graduation 1 perinueral Pebax catheter (0.45 x 0.85mm – 50cm long) with centimeter distance markings and open distal tip 1 0.22 antibacterial filter 1 additional extension tube, 50cm long, 1.5 x 2.5 mm dia, priming volume 1.10ml 1 10ml syringe for the aspiration test 1 10 x 15 cm Dermafilm transparent adhesive dressing | Item1255 | 1 | Each |
| 1256 | 13.56 | Periostal elevators (small and big) | Item1256 | 1 | Each |
| 1257 | 13.57 | Winged infusion set- Non coring needles with injection site to access ports,20G X 1.00(needle) | Item1257 | 1 | Each |
| 1258 | 13.58 | Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-7fr,65cm length(Ped) | Item1258 | 1 | Each |
| 1259 | 13.59 | Hickman-Broviac 4.2Fr(or smaller) single lumen pediatric cath w STIC PAPAIS | Item1259 | 1 | Each |
| 1260 | 13.6 | Hickman-Broviac 6.6Fr single lumen pediatric cath w STIC 90cm | Item1260 | 1 | Each |
| 1261 | 13.61 | Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-9fr,90cm length(Adult) | Item1261 | 1 | Each |
| 1262 | 13.62 | Plaster Cutter Electric | Item1262 | 1 | Each |
| 1263 | 13.63 | Plaster saw | Item1263 | 1 | Each |
| 1264 | 13.64 | Plier long nose | Item1264 | 1 | Each |
| 1265 | 13.65 | Pneumatic Compression Stocking | Item1265 | 1 | Each |
| 1266 | 13.66 | Portable Autoclave Electrically Operated Made of Aluminium size:300mm x 300mm capacity 24 litres | Item1266 | 1 | Each |
| 1267 | 13.67 | Portable Autoclave Electrically Operated Made of Aluminium size:350mm x 300mm-325mm Depth: 1.5 Kw | Item1267 | 1 | Each |
| 1268 | 13.68 | Pyridin | Item1268 | 1 | Each |
| 1269 | 13.69 | Reusable Pressure Monitoring cable With integrity check system by 100mmhg pressure and with reusable modular clamp | Item1269 | 1 | Each |
| 1270 | 13.7 | Reusable Pressure Transducer With integrity check system by 100mmhg pressure, with microchip technology, Reusable cable, and with reusable clamp | Item1270 | 1 | Each |
| 1271 | 13.71 | Ronguers(down cutter) | Item1271 | 1 | Each |
| 1272 | 13.72 | Ronguers(up cutter) | Item1272 | 1 | Each |
| 1273 | 13.73 | Rubber Macintosh | Item1273 | 1 | Each |
| 1274 | 13.74 | Russian Forceps | Item1274 | 1 | Each |
| 1275 | 13.75 | Light Weight Hernia Mesh,PGA Polypropylene 11 x 15 | Item1275 | 1 | Each |
| 1276 | 13.76 | Light Weight Hernia Mesh,PGA Polypropylene 6 x 11 | Item1276 | 1 | Each |
| 1277 | 13.77 | Seldinger technique catheter for arterial puncture Content: 1 Transparent and XPO cathter (PE) /(PTFE) 1 Intruducer needle 1 straight wire 115.092 115.094 115.118 5118.702 5118.703 | Item1277 | 1 | Each |
| 1278 | 13.78 | Self Holding retractors for Spine surgery | Item1278 | 1 | Each |
| 1279 | 13.79 | Single Use Resuscitation Mask for CPCR (Non-return valve, Integral Bacterial/Viral filter) | Item1279 | 1 | Each |
| 1280 | 13.8 | Slide Mailer 1 slide | Item1280 | 1 | Each |
| 1281 | 13.81 | Slide Mailer 2 slide | Item1281 | 1 | Each |
| 1282 | 13.82 | Soap Dispenser | Item1282 | 1 | Each |
| 1283 | 13.83 | Soda Lime (Imported) – changes from White to Violet on exhaustion 5kg | Item1283 | 1 | Each |
| 1284 | 13.84 | Sodium hypochloride solution 5Litre | Item1284 | 1 | Each |
| 1285 | 13.85 | Spreader /Plugger | Item1285 | 1 | Each |
| 1286 | 13.86 | Steinman pins:4.5mm | Item1286 | 1 | Each |
| 1287 | 13.87 | Steinmann Pins | Item1287 | 1 | Each |
| 1288 | 13.88 | Sterigage Chemical Indicator (for Steam) 3M | Item1288 | 1 | Each |
| 1289 | 13.89 | Surgical Clipper | Item1289 | 1 | Each |
| 1290 | 13.9 | Surgical Preparation Razor | Item1290 | 1 | Each |
| 1291 | 13.91 | Thermal Videographic Printer (Black & White) (Sony, Latest UP series) | Item1291 | 1 | Each |
| 1292 | 13.92 | Tissue paper for Ultrasound | Item1292 | 1 | Each |
| 1293 | 13.93 | Ultra violet cabinet (800/500 x 2000 mm) | Item1293 | 1 | Each |
| 1294 | 13.94 | Vacuum assisted dressing system | Item1294 | 1 | Each |
| 1295 | 13.95 | Vascular Debeky Angle (Medium) | Item1295 | 1 | Each |
| 1296 | 13.96 | Vascular Debeky Straight (Medium) | Item1296 | 1 | Each |
| 1297 | 13.97 | Vaseline gauze | Item1297 | 1 | Each |
| 1298 | 13.98 | Ventilator 15 mm breathing systems (with luer lock, 1.6 metre length and resealable water trap) for Paediatrics | Item1298 | 1 | Each |
| 1299 | 13.99 | Ventilator Breathing System with resealable water traps (smooth lumen) | Item1299 | 1 | Each |
| 1300 | 14 | Waste Management Wheeled Bins. (660Lit ; 300lit; 1100 lit) | Item1300 | 1 | Each |
| 1301 | 14.01 | Wire cutter | Item1301 | 1 | Each |
| 1302 | 14.02 | Y-pieces for Breathing Circuit | Item1302 | 1 | Each |
| 1303 | 14.03 | Absorbable Gelatin Sponge U.S.P (Ab-Gel) 10 X 10 | Item1303 | 1 | Each |
| 1304 | 14.04 | Alginate impression materials(Dust free) | Item1304 | 1 | Each |
| 1305 | 14.05 | Double swivel with port 15mm | Item1305 | 1 | Each |
| 1306 | 14.06 | Green PVC tubing 6mm for oxygen / per meter | Item1306 | 1 | Each |
| 1307 | 14.07 | 2 mm Osteotomes | Item1307 | 1 | Each |
| 1308 | 14.08 | 3 mm Osteotomes | Item1308 | 1 | Each |
| 1309 | 14.09 | Asepto Pump | Item1309 | 1 | Each |
| 1310 | 14.1 | Autoclavable biohazard plastic bag 10liter | Item1310 | 1 | Each |
| 1311 | 14.11 | Autoclavable biohazard plastic bag 20liter | Item1311 | 1 | Each |
| 1312 | 14.12 | Autoclavable biohazard plastic bag 30liter | Item1312 | 1 | Each |
| 1313 | 14.13 | Bone Cement(Plain) | Item1313 | 1 | Each |
| 1314 | 14.14 | Bone Cement(Antibiotics) | Item1314 | 1 | Each |
| 1315 | 14.15 | Bougie(stylet) | Item1315 | 1 | Each |
| 1316 | 14.16 | Burretta | Item1316 | 1 | Each |
| 1317 | 14.17 | CAPD Catheter Tenckhoff with 2 felt cuffs SA 1242 (420 mm) | Item1317 | 1 | Each |
| 1318 | 14.18 | Cast Taper Mandrel | Item1318 | 1 | Each |
| 1319 | 14.19 | Chiesel | Item1319 | 1 | Each |
| 1320 | 14.2 | Cleaning Brush | Item1320 | 1 | Each |
| 1321 | 14.21 | Cleaning solution | Item1321 | 1 | Each |
| 1322 | 14.22 | CPR manikin | Item1322 | 1 | Each |
| 1323 | 14.23 | Stoma Flatmoldable Small 45MM | Item1323 | 1 | Each |
| 1324 | 14.24 | Stoma Flatmoldable Medium 45MM | Item1324 | 1 | Each |
| 1325 | 14.25 | Stoma Flatmoldable Regular 57MM | Item1325 | 1 | Each |
| 1326 | 14.26 | Stoma Flatmoldable Large 70MM | Item1326 | 1 | Each |
| 1327 | 14.27 | Moldable convex 12/22MM | Item1327 | 1 | Each |
| 1328 | 14.28 | Moldable convex 22/33MM | Item1328 | 1 | Each |
| 1329 | 14.29 | Moldable convex 33/57MM | Item1329 | 1 | Each |
| 1330 | 14.3 | Ostomy Appliance Accessories Belt | Item1330 | 1 | Each |
| 1331 | 14.31 | Coloured Ph indicator Paper | Item1331 | 1 | Each |
| 1332 | 14.32 | Dissecting Instrument Box | Item1332 | 1 | Each |
| 1333 | 14.33 | Double swivel with port 15 mm x 22mm | Item1333 | 1 | Each |
| 1334 | 14.34 | Drape Formers Trans femoral | Item1334 | 1 | Each |
| 1335 | 14.35 | Drape Formers Trans tibial | Item1335 | 1 | Each |
| 1336 | 14.36 | Espocan with Docking System | Item1336 | 1 | Each |
| 1337 | 14.37 | ETO chemical Indicator tape -3M | Item1337 | 1 | Each |
| 1338 | 14.38 | ETO packing sleeves roll (3M) 12' | Item1338 | 1 | Each |
| 1339 | 14.39 | ETO packing sleeves roll (3M) 4' | Item1339 | 1 | Each |
| 1340 | 14.4 | ETO packing sleeves roll (3M) 6' | Item1340 | 1 | Each |
| 1341 | 14.41 | Surgicel Fibrillar 1963 | Item1341 | 1 | Each |
| 1342 | 14.42 | G- Bone | Item1342 | 1 | Each |
| 1343 | 14.43 | Gloves wrapper | Item1343 | 1 | Each |
| 1344 | 14.44 | Laparoscopic Aspiration needle | Item1344 | 1 | Each |
| 1345 | 14.45 | Hemorrhoids and Prolapsed Stapler with Detachable Anvil 3.5mm | Item1345 | 1 | Each |
| 1346 | 14.46 | Hemorrhoids and Prolapsed Stapler with Detachable Anvil 4.8mm | Item1346 | 1 | Each |
| 1347 | 14.47 | Hose Mount 15mm female male pair | Item1347 | 1 | Each |
| 1348 | 14.48 | Hose Mount 22mm female male pair | Item1348 | 1 | Each |
| 1349 | 14.49 | Hygrobaby/HME Filter (Infant) | Item1349 | 1 | Each |
| 1350 | 14.5 | Hygroboy/HME Filter (Paediatric) | Item1350 | 1 | Each |
| 1351 | 14.51 | Hygrostar/HME Filter (Adult) | Item1351 | 1 | Each |
| 1352 | 14.52 | hygrobac S | Item1352 | 1 | Each |
| 1353 | 14.53 | Intraocular lense 6mm optics foldable, square edge, Hydrophobic | Item1353 | 1 | Each |
| 1354 | 14.54 | Intraocular lense rigid 5.25mm optics,PMMA, square edge | Item1354 | 1 | Each |
| 1355 | 14.55 | Intraocular lense rigid 5.5mm optics | Item1355 | 1 | Each |
| 1356 | 14.56 | Intraocular lense rigid 5.5mm optics foldable | Item1356 | 1 | Each |
| 1357 | 14.57 | Intraocular lense rigid 6mm optics | Item1357 | 1 | Each |
| 1358 | 14.58 | Intraocular lense rigid 6mm optics foldable | Item1358 | 1 | Each |
| 1359 | 14.59 | Intraocular lense rigid 6mm optics, PMMA, square edge | Item1359 | 1 | Each |
| 1360 | 14.6 | Rigid Anterior Chamber Intraocular Lens: Lens Power +16D(6.00mm) | Item1360 | 1 | Each |
| 1361 | 14.61 | Rigid Anterior Chamber Intraocular Lens: Lens Power +19D(6.00mm) | Item1361 | 1 | Each |
| 1362 | 14.62 | Rigid Anterior Chamber Intraocular Lens: Lens Power +18D(6.00mm) | Item1362 | 1 | Each |
| 1363 | 14.63 | Rigid Anterior Chamber Intraocular Lens: Lens Power +20D(6.00mm) | Item1363 | 1 | Each |
| 1364 | 14.64 | Rigid Anterior Chamber Intraocular Lens: Lens Power +21D(6.00mm) | Item1364 | 1 | Each |
| 1365 | 14.65 | Rigid Anterior Chamber Intraocular Lens: Lens Power +22D(6.00mm) | Item1365 | 1 | Each |
| 1366 | 14.66 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) | Item1366 | 1 | Each |
| 1367 | 14.67 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.5D(5.50mm) | Item1367 | 1 | Each |
| 1368 | 14.68 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) | Item1368 | 1 | Each |
| 1369 | 14.69 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.0D(5.50mm) | Item1369 | 1 | Each |
| 1370 | 14.7 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.5D(5.50mm) | Item1370 | 1 | Each |
| 1371 | 14.71 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.0D(5.50mm) | Item1371 | 1 | Each |
| 1372 | 14.72 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.5D(5.50mm) | Item1372 | 1 | Each |
| 1373 | 14.73 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.0D(5.50mm) | Item1373 | 1 | Each |
| 1374 | 14.74 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.5D(5.50mm) | Item1374 | 1 | Each |
| 1375 | 14.75 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.0D(5.50mm) | Item1375 | 1 | Each |
| 1376 | 14.76 | Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.5D(5.50mm) | Item1376 | 1 | Each |
| 1377 | 14.77 | (a) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +10.0D 6.0mm | Item1377 | 1 | Each |
| 1378 | 14.78 | (b) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +113.5D 6.0mm | Item1378 | 1 | Each |
| 1379 | 14.79 | (c) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+14.0D 6.0mm | Item1379 | 1 | Each |
| 1380 | 14.8 | (d) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.0D 6.0mm | Item1380 | 1 | Each |
| 1381 | 14.81 | (e) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.5D 6.0mm | Item1381 | 1 | Each |
| 1382 | 14.82 | (f) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.0D 6.0mm | Item1382 | 1 | Each |
| 1383 | 14.83 | (g) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.5D 6.0mm | Item1383 | 1 | Each |
| 1384 | 14.84 | (h) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.0D 6.0mm | Item1384 | 1 | Each |
| 1385 | 14.85 | (i) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.5D 6.0mm | Item1385 | 1 | Each |
| 1386 | 14.86 | (j) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.0D 6.0mm | Item1386 | 1 | Each |
| 1387 | 14.87 | (k) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.5D 6.0mm | Item1387 | 1 | Each |
| 1388 | 14.88 | (l) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19..0D 6.0mm | Item1388 | 1 | Each |
| 1389 | 14.89 | (m) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19.5D 6.0mm | Item1389 | 1 | Each |
| 1390 | 14.9 | (n) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.0D 6.0mm | Item1390 | 1 | Each |
| 1391 | 14.91 | (o) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.5D 6.0mm | Item1391 | 1 | Each |
| 1392 | 14.92 | (p) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.0D 6.0mm | Item1392 | 1 | Each |
| 1393 | 14.93 | (q) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.5D 6.0mm | Item1393 | 1 | Each |
| 1394 | 14.94 | (r) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.0D 6.0mm | Item1394 | 1 | Each |
| 1395 | 14.95 | (s) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.5D 6.0mm | Item1395 | 1 | Each |
| 1396 | 14.96 | (t) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+23.0D 6.0mm | Item1396 | 1 | Each |
| 1397 | 14.97 | (u)Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +23.5D 6.0mm | Item1397 | 1 | Each |
| 1398 | 14.98 | (v) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.0D 6.0mm | Item1398 | 1 | Each |
| 1399 | 14.99 | (w) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.5D 6.0mm | Item1399 | 1 | Each |
| 1400 | 15 | (x) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.0D 6.0mm | Item1400 | 1 | Each |
| 1401 | 15.01 | (y) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.5D 6.0mm | Item1401 | 1 | Each |
| 1402 | 15.02 | (z) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+26.0D 6.0mm | Item1402 | 1 | Each |
| 1403 | 15.03 | Mayo trolly cover (disposable) | Item1403 | 1 | Each |
| 1404 | 15.04 | Membrane Assembly | Item1404 | 1 | Each |
| 1405 | 15.05 | Micro Centrifuge Tube 1.5ml | Item1405 | 1 | Each |
| 1406 | 15.06 | Micro Centrifuge Tube 15ml | Item1406 | 1 | Each |
| 1407 | 15.07 | micro centrifuge tubes-.2ml (with thin wall for PCR) | Item1407 | 1 | Each |
| 1408 | 15.08 | micro centrifuge tubes-.5ml (with thin wall for PCR) | Item1408 | 1 | Each |
| 1409 | 15.09 | micro centrifuge tubes-2ml | Item1409 | 1 | Each |
| 1410 | 15.1 | Microscope Bulb- 6V 20W | Item1410 | 1 | Each |
| 1411 | 15.11 | Mini & micropates with screw | Item1411 | 1 | Each |
| 1412 | 15.12 | Nasal Tubing 70mm | Item1412 | 1 | Each |
| 1413 | 15.13 | Needle (cutting) big | Item1413 | 1 | Each |
| 1414 | 15.14 | Needle (cutting) medium | Item1414 | 1 | Each |
| 1415 | 15.15 | Needle (cutting) small | Item1415 | 1 | Each |
| 1416 | 15.16 | Needle (round body) big | Item1416 | 1 | Each |
| 1417 | 15.17 | Needle (round body) medium | Item1417 | 1 | Each |
| 1418 | 15.18 | Needle (round body) small | Item1418 | 1 | Each |
| 1419 | 15.19 | Non invasive cardiac output monitoring electrode | Item1419 | 1 | Each |
| 1420 | 15.2 | Non invasive cardiac pacing electrode | Item1420 | 1 | Each |
| 1421 | 15.21 | Ostomy powder 25gm | Item1421 | 1 | Each |
| 1422 | 15.22 | Pneumatic Compression Stocking | Item1422 | 1 | Each |
| 1423 | 15.23 | Pressure monitoring kit with three way disposable pressure( For CVP & Atrerial) | Item1423 | 1 | Each |
| 1424 | 15.24 | RAE tub 7.5 | Item1424 | 1 | Each |
| 1425 | 15.25 | Self adhesive urine sample bag - Pediatric | Item1425 | 1 | Each |
| 1426 | 15.26 | Spirit swabs | Item1426 | 1 | Each |
| 1427 | 15.27 | Sterile swab sticks | Item1427 | 1 | Each |
| 1428 | 15.28 | Steri-Stripes | Item1428 | 1 | Each |
| 1429 | 15.29 | Esmarch 4\" | Item1429 | 1 | Each |
| 1430 | 15.3 | Esmarch 6\" | Item1430 | 1 | Each |
| 1431 | 15.31 | Polyester Synthetic Cast padding | Item1431 | 1 | Each |
| 1432 | 15.32 | Suction cannula for MTP size purandre | Item1432 | 1 | Each |
| 1433 | 15.33 | Ostomy Appliance Accessories Belt | Item1433 | 1 | Each |
| 1434 | 15.34 | Stomadress Plus Single Pouch - Opaque | Item1434 | 1 | Each |
| 1435 | 15.35 | ActiveLife One Pc Drainable Pouch | Item1435 | 1 | Each |
| 1436 | 15.36 | Tubing Kit | Item1436 | 1 | Each |
| 1437 | 15.37 | urianalyser | Item1437 | 1 | Each |
| 1438 | 15.38 | Urine Control A360 | Item1438 | 1 | Each |
| 1439 | 15.39 | Ventilating Airway Bougies | Item1439 | 1 | Each |
| 1440 | 15.4 | Ventilator Tubing W/1 (venti breathing system with reseable water trap) | Item1440 | 1 | Each |
| 1441 | 15.41 | Y-pieces | Item1441 | 1 | Each |
| 1442 | 15.42 | 6mm Green PVC tubing for oxygen | Item1442 | 1 | Each |
| 1443 | 15.43 | Alpha mattress | Item1443 | 1 | Each |
| 1444 | 15.44 | Analspeculum Size: 25 | Item1444 | 1 | Each |
| 1445 | 15.45 | AO universal clamps | Item1445 | 1 | Each |
| 1446 | 15.46 | Baby Cradle with mattress and Net | Item1446 | 1 | Each |
| 1447 | 15.47 | Blood Gas Quality Control (30x1.7ml) Level 1 (ABG) | Item1447 | 1 | Each |
| 1448 | 15.48 | Blood Gas Quality Control (30x1.7ml) Level 2 (ABG) | Item1448 | 1 | Each |
| 1449 | 15.49 | Blood Gas Quality Control (30x1.7ml) Level 3 (ABG) | Item1449 | 1 | Each |
| 1450 | 15.5 | Bone Cutter | Item1450 | 1 | Each |
| 1451 | 15.51 | Bone cutter Big size | Item1451 | 1 | Each |
| 1452 | 15.52 | Centrifuge Tube | Item1452 | 1 | Each |
| 1453 | 15.53 | Centrifuge tubes, polypropylene seal with capacity 3.5 - 10 ml | Item1453 | 1 | Each |
| 1454 | 15.54 | Clavicular Braces | Item1454 | 1 | Each |
| 1455 | 15.55 | Cider wood oil | Item1455 | 1 | Each |
| 1456 | 15.56 | DeBakey’s Bull Dog Clamps, Curved 115mm (4 ½”) long | Item1456 | 1 | Each |
| 1457 | 15.57 | DeBakey’s Bull Dog Clamps, Curved 70mm (2 ¾”) long | Item1457 | 1 | Each |
| 1458 | 15.58 | DeBakey’s Bull Dog Clamps, Curved 80mm (3 ?”) long | Item1458 | 1 | Each |
| 1459 | 15.59 | DeBakey’s Bull Dog Clamps, Straight 120mm (4 ¾”) | Item1459 | 1 | Each |
| 1460 | 15.6 | DeBakey’s Bull Dog Clamps, Straight 75mm (3”) | Item1460 | 1 | Each |
| 1461 | 15.61 | DeBakey’s Bull Dog Clamps, Straight 85mm (3 ?”) | Item1461 | 1 | Each |
| 1462 | 15.62 | Divided Mattress | Item1462 | 1 | Each |
| 1463 | 15.63 | Dropper bottle 250ml | Item1463 | 1 | Each |
| 1464 | 15.64 | Dropper bottle 500ml | Item1464 | 1 | Each |
| 1465 | 15.65 | Dropper p.p. 6 long | Item1465 | 1 | Each |
| 1466 | 15.66 | NPWT dressing kit | Item1466 | 1 | Each |
| 1467 | 15.67 | Silicone Rubber heel cups | Item1467 | 1 | Each |
| 1468 | 15.68 | Electrodes for IFT (For Combination therapy-Ultra sound therapy + Electrical Stimulator) (Make: Enraf nonius Sonoplus 491) | Item1468 | 1 | Each |
| 1469 | 15.69 | Episiotomy scissor size 15cm | Item1469 | 1 | Each |
| 1470 | 15.7 | Fixation Ring (904-898) | Item1470 | 1 | Each |
| 1471 | 15.71 | Fixation Ring (904-898) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40) | Item1471 | 1 | Each |
| 1472 | 15.72 | Fluid warmer | Item1472 | 1 | Each |
| 1473 | 15.73 | Fogging Machine | Item1473 | 1 | Each |
| 1474 | 15.74 | G-Bone | Item1474 | 1 | Each |
| 1475 | 15.75 | Gigly Saw | Item1475 | 1 | Each |
| 1476 | 15.76 | Ginevri Capillary tube (H) (Microbillimeter) | Item1476 | 1 | Each |
| 1477 | 15.77 | Glover with Atraumatic jaws, Curved jaws, 85mm (3 ?”), 45mm jaws | Item1477 | 1 | Each |
| 1478 | 15.78 | Hand Drill | Item1478 | 1 | Each |
| 1479 | 15.79 | Hand wash basin stand (double). - Five legs base mounted on 5cms dia castors with one 35cm s.s basin.Pre treated and epoxy powder coated. | Item1479 | 1 | Each |
| 1480 | 15.8 | Hysterectomy clamp ‘FAURE’ | Item1480 | 1 | Each |
| 1481 | 15.81 | I.V. drip stand | Item1481 | 1 | Each |
| 1482 | 15.82 | Intra uterine cannula ‘COLLINS’ plain 3 size | Item1482 | 1 | Each |
| 1483 | 15.83 | Intra uterine cannula ‘HAYES PROVIS’ with rubber cone | Item1483 | 1 | Each |
| 1484 | 15.84 | Kidney Wash Machine (Renatron II) | Item1484 | 1 | Each |
| 1485 | 15.85 | Knee Immobilizer OC 2035 | Item1485 | 1 | Each |
| 1486 | 15.86 | Knee Immobilizer OC 2035 | Item1486 | 1 | Each |
| 1487 | 15.87 | Knee Stabilizer-DC 2069 | Item1487 | 1 | Each |
| 1488 | 15.88 | Leishmans stain | Item1488 | 1 | Each |
| 1489 | 15.89 | Lengenback retractor | Item1489 | 1 | Each |
| 1490 | 15.9 | Lengenback retractor | Item1490 | 1 | Each |
| 1491 | 15.91 | Lens cleaning paper | Item1491 | 1 | Each |
| 1492 | 15.92 | Lymph node | Item1492 | 1 | Each |
| 1493 | 15.93 | Magnet for ECG | Item1493 | 1 | Each |
| 1494 | 15.94 | Malleable stylets with adjustable stop, different size | Item1494 | 1 | Each |
| 1495 | 15.95 | MEASURING TAPE | Item1495 | 1 | Each |
| 1496 | 15.96 | Measuring Tape (Clinical) | Item1496 | 1 | Each |
| 1497 | 15.97 | Microscope ( for side lab) - Binocular electric light microscope | Item1497 | 1 | Each |
| 1498 | 15.98 | Molina Sheet | Item1498 | 1 | Each |
| 1499 | 15.99 | Mosquito Net (Single use patient specific, plastic) | Item1499 | 1 | Each |
| 1500 | 16 | Mouth gag | Item1500 | 1 | Each |
| 1501 | 16.01 | Myoma screw ‘DOYEN’ | Item1501 | 1 | Each |
| 1502 | 16.02 | Na+ - sensor casing (ABG) | Item1502 | 1 | Each |
| 1503 | 16.03 | Non Invasive Glucose monitoring system (Glucometer) | Item1503 | 1 | Each |
| 1504 | 16.04 | Ounce glass steel | Item1504 | 1 | Each |
| 1505 | 16.05 | Oxygen cylinder stand /trolley - B Type | Item1505 | 1 | Each |
| 1506 | 16.06 | Pad Electrodes for SWD (DX 500 roland) | Item1506 | 1 | Each |
| 1507 | 16.07 | Paper Roll (ABG) | Item1507 | 1 | Each |
| 1508 | 16.08 | Patient Breathing Set Infant Reusable (Galileo Gold) | Item1508 | 1 | Each |
| 1509 | 16.09 | Patient cable for IFT/MST (Make/Model: Multidyne 965) | Item1509 | 1 | Each |
| 1510 | 16.1 | Patient shifting trolleys with the facility of Oxygen Cylinder carrier | Item1510 | 1 | Each |
| 1511 | 16.11 | Pelvic traction kit with pulley and weight | Item1511 | 1 | Each |
| 1512 | 16.12 | Pile Binder | Item1512 | 1 | Each |
| 1513 | 16.13 | Plastic dropping bottle (120ml) | Item1513 | 1 | Each |
| 1514 | 16.14 | Plastic small tube | Item1514 | 1 | Each |
| 1515 | 16.15 | RAOS hand suction unit 100 ml | Item1515 | 1 | Each |
| 1516 | 16.16 | Ref. - membrane shell (ABG) | Item1516 | 1 | Each |
| 1517 | 16.17 | Resucitation kits Automatics | Item1517 | 1 | Each |
| 1518 | 16.18 | Resuscitation kit Emergency | Item1518 | 1 | Each |
| 1519 | 16.19 | Resuscitation kit for neonates | Item1519 | 1 | Each |
| 1520 | 16.2 | Rubber Sole - 4mm | Item1520 | 1 | Each |
| 1521 | 16.21 | Sample detector | Item1521 | 1 | Each |
| 1522 | 16.22 | Screw driver | Item1522 | 1 | Each |
| 1523 | 16.23 | Sealing rings | Item1523 | 1 | Each |
| 1524 | 16.24 | Set tubing for roller pump (reagents) (ABG) | Item1524 | 1 | Each |
| 1525 | 16.25 | Shin tube cutting jig 30mm | Item1525 | 1 | Each |
| 1526 | 16.26 | Shin tube cutting jig 35mm | Item1526 | 1 | Each |
| 1527 | 16.27 | Short needle Holder | Item1527 | 1 | Each |
| 1528 | 16.28 | Side Support (Meditrin) | Item1528 | 1 | Each |
| 1529 | 16.29 | Silicon Tubal Ring | Item1529 | 1 | Each |
| 1530 | 16.3 | Solid waste containers liners | Item1530 | 1 | Each |
| 1531 | 16.31 | Solution Valve | Item1531 | 1 | Each |
| 1532 | 16.32 | Spare canvas bag | Item1532 | 1 | Each |
| 1533 | 16.33 | Spare lamp for Opthalmoscope | Item1533 | 1 | Each |
| 1534 | 16.34 | Spare parts for: Easylyte,911 , 912 & others | Item1534 | 1 | Each |
| 1535 | 16.35 | Spirit lamp | Item1535 | 1 | Each |
| 1536 | 16.36 | Stich scissor | Item1536 | 1 | Each |
| 1537 | 16.37 | Suture anchor (orthopaedics) | Item1537 | 1 | Each |
| 1538 | 16.38 | Syringe Infusion pump | Item1538 | 1 | Each |
| 1539 | 16.39 | T- handle for Orthopaedics | Item1539 | 1 | Each |
| 1540 | 16.4 | Tailor Thread | Item1540 | 1 | Each |
| 1541 | 16.41 | TCO2 sensor | Item1541 | 1 | Each |
| 1542 | 16.42 | Teley's Forcep | Item1542 | 1 | Each |
| 1543 | 16.43 | Vortex mixer | Item1543 | 1 | Each |
| 1544 | 16.44 | Vulsellum forceps 1 x 1 teeth 25cm | Item1544 | 1 | Each |
| 1545 | 16.45 | Wire Cutter | Item1545 | 1 | Each |
| 1546 | 16.46 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure) | Item1546 | 1 | Each |
| 1547 | 16.47 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Low Pressure) | Item1547 | 1 | Each |
| 1548 | 16.48 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene. | Item1548 | 1 | Each |
| 1549 | 16.49 | Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure with bacterial resistance) | Item1549 | 1 | Each |
| 1550 | 16.5 | Manual Hub Cutter – with biohazard symbol and which can cut the plastic hub and NOT the metal needle with temporary and permanent locking mechanism on complete filling of the disposal hub cutter with clear demarcation of fill line and which can accomadate upto 400-600 needles. | Item1550 | 1 | Each |
| 1551 | 16.51 | Cerebral Reservior (Omaya Type) | Item1551 | 1 | Each |
| 1552 | 16.52 | Extranal Ventricular Drainage Syatem | Item1552 | 1 | Each |
| 1553 | 16.53 | Lumbar Extranal Drainage System | Item1553 | 1 | Each |
| 1554 | 16.54 | Poly Propylene mesh (small) for Duroplasty | Item1554 | 1 | Each |
| 1555 | 16.55 | Poly Propylene Mesh (Medium) for Duroplasty | Item1555 | 1 | Each |
| 1556 | 16.56 | Poly Propylene Mesh (Large) for Duroplasty | Item1556 | 1 | Each |
| 1557 | 16.57 | G Bone Cement (for Cranioplasty) | Item1557 | 1 | Each |
| 1558 | 16.58 | Kraniotomy Drape | Item1558 | 1 | Each |
| 1559 | 16.59 | Iodine Drape Large | Item1559 | 1 | Each |
| 1560 | 16.6 | Balanced Salt Solution with Na/K/Mg & chloride levels similar to plasma with acetate & gluconate/malate as buffer, must not contain calcium ( eg.Plasmalyte A /Volulyte etc) | Item1560 | 1 | Each |
| 1561 | 16.61 | Bactiseal Impregnated Shunt - FDA Approved, fixed pressure VP Shunts (low,medium, high) that are antibiotic impregnated and can reduce the potential for bacterial colonization in the lumen as well as its outer surface. | Item1561 | 1 | Each |
| 1562 | 16.62 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1562 | 1 | Each |
| 1563 | 16.63 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1563 | 1 | Each |
| 1564 | 16.64 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1564 | 1 | Each |
| 1565 | 16.65 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1565 | 1 | Each |
| 1566 | 16.66 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1566 | 1 | Each |
| 1567 | 16.67 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1567 | 1 | Each |
| 1568 | 16.68 | Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. | Item1568 | 1 | Each |
| 1569 | 16.69 | Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. | Item1569 | 1 | Each |
| 1570 | 16.7 | Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. | Item1570 | 1 | Each |
| 1571 | 16.71 | Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. | Item1571 | 1 | Each |
| 1572 | 16.72 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1572 | 1 | Each |
| 1573 | 16.73 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1573 | 1 | Each |
| 1574 | 16.74 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1574 | 1 | Each |
| 1575 | 16.75 | Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . | Item1575 | 1 | Each |
| 1576 | 16.76 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1576 | 1 | Each |
| 1577 | 16.77 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1577 | 1 | Each |
| 1578 | 16.78 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1578 | 1 | Each |
| 1579 | 16.79 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1579 | 1 | Each |
| 1580 | 16.8 | Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. | Item1580 | 1 | Each |
| 1581 | 16.81 | Raneys scalp disposable clips - Disposable Raney's Clips | Item1581 | 1 | Each |
| 1582 | 16.82 | Cranioplasty kit - Cranioplasty kit, sterile, pack of two packets of Methyl methacrylate and two vials of liquid. | Item1582 | 1 | Each |
| 1583 | 16.83 | Universal Extremity Drape- Control plus fabric,US FDA certified | Item1583 | 1 | Each |
| 1584 | 16.84 | Impervious Split Sheet- 60\" x 70\", 4\" x 21\" split, Polyethylene Sheet, US FDA certified | Item1584 | 1 | Each |
| 1585 | 16.85 | U-Bar-Pack- 1 back table cover-Reinforced 44\" x 88\",1 mayo stand cover reinforced 23\" x 54\",1 suture bag, 1U drape 71\" x 124\", 1 Bar Drape 71\" x 124\", 1 Bar Drape 41.5\" x 82\",US FDA certified | Item1585 | 1 | Each |
| 1586 | 16.86 | Back Table Cover Zone Reinforced- 44\" x 99\", US FDA certified | Item1586 | 1 | Each |
| 1587 | 16.87 | Impervious Stockinette-12\" x 58\", UDS FDA | Item1587 | 1 | Each |
| 1588 | 16.88 | Fluid shield Mask with Visor -Four Layer Mask, water resistant with water resistant,-NAOSH, OSHA approved | Item1588 | 1 | Each |
| 1589 | 16.89 | HIP Drape with LEG Pockets -control plus fabric, US FDA approved | Item1589 | 1 | Each |
| 1590 | 16.9 | HIP Drape without LEG Pockets -Control plus fabric, US FDA approved | Item1590 | 1 | Each |
| 1591 | 16.91 | Quattro FX -Full Face Mask Vented | Item1591 | 1 | Each |
| 1592 | 16.92 | Mirage FX- Nasal Mask Vented | Item1592 | 1 | Each |
| 1593 | 16.93 | Transmission Electron Microscope | Item1593 | 1 | Each |
| 1594 | 16.94 | G011/2 Glut Em 25% AMPS | Item1594 | 1 | 10x2ml |
| 1595 | 16.95 | Self Closing Tweezer (biology) T-403 | Item1595 | 1 | Each |
| 1596 | 16.96 | O001 Osmium Tetroxide | Item1596 | 1 | 1vial/1gm |
| 1597 | 16.97 | EUKITT Mouning Media | Item1597 | 1 | 1bottle/100ml |
| 1598 | 16.98 | TAAB Araldite 502/812 Kit (E2O2) | Item1598 | 1 | Kit |
| 1599 | 16.99 | Dibutyl Phthalate | Item1599 | 1 | Bottle |
| 1600 | 17 | E069 Embedding Mould Flat C | Item1600 | 1 | 1 Piece |
| 1601 | 17.01 | Z10 Molecular Seive 3NM for Drying Acetone | Item1601 | 1 | 1bottle/Jar |
| 1602 | 17.02 | Shaving Razor Blade | Item1602 | 1 | 1Packet |
| 1603 | 17.03 | 300 mesh Cu Grid with thin carbon film (Cu - 300CN | Item1603 | 1 | 25grids/pkg |
| 1604 | 17.04 | 300M mesh Cu Grid with holey/dbl Carbon film (Cu-300HD | Item1604 | 1 | 25grids/Pkg |
| 1605 | 17.05 | G062 Grid Storage Box | Item1605 | 1 | 1x10pcs |
| 1606 | 17.06 | U007 Uranyl Acetate | Item1606 | 1 | 1 bottle |
| 1607 | 17.07 | L018 Lead Citrate | Item1607 | 1 | 1 bottle |
| 1608 | 17.08 | TRUF 2208-100 | Item1608 | 1 | 1 Packet |
| 1609 | 17.09 | Octagon Magnetic Stirrer Bar (4151) | Item1609 | 1 | 1packet (8x22mm) |
| 1610 | 17.1 | Consumables | Item1610 | 1 | Each |
| 1611 | 17.11 | Micro tips(10micro litre) | Item1611 | 1 | 1x1000pcs |
| 1612 | 17.12 | Microcentrifuge Tube | Item1612 | 1 | 1.5/2.0ml capacity |
AI Tender Summary
Tender Timeline
Tender Published
Tender notice published.
CompletedCorrigendum-1 Issued
Clarifications on tender conditions and amendments issued.
CompletedCorrigendum-2 Issued
Clarifications on tender conditions and amendments issued.
CompletedCorrigendum-3 Issued
Clarifications on tender conditions and amendments issued.
CompletedCorrigendum-4 Issued
Clarifications on tender conditions and amendments issued.
CompletedCorrigendum-5 Issued
Clarifications on tender conditions and amendments issued.
CompletedBid Submission Deadline
Online submission via eProcurement portal.
CompletedBid Opening Date
Technical bids will be opened and evaluated.
Completed