Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later., Neigrihms, Shillong, Meghalaya-Meghalaya

TDR : 22947207

Tender Notice
Corrigendum Details
BOQ

Expired

Neigrihms, Shillong, Meghalaya , Meghalaya

Tender Brief : Corrigendum : Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later.

Document Fees
Refer document

EMD
₹ 30000.0 /-

Tender Value
₹ 30 Lakhs /-

Submission Date
04-12-2020

Competition Type
Indian

Bidding Type
Tender

Need a Business Loan? Apply Now !

Sr No	Corrigendum Date	Corrigendum	Type	New Submission Date
1	27-11-2020	Amendment	Fee	04-12-2020
2	10-11-2020	Date Extension November	Date	04-12-2020
3	03-03-2020	Extension2	Date	17-04-2020
4	13-02-2020	Date Extensionn2	Date	05-03-2020
5	20-01-2020	Extension	Date	21-02-2020

Description of Stores /Items: Open e-Tender for processing of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, etc for the Institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later.
	Sl.No.	Item Description	Item Code / Make	Quantity	Units
1	1.01	Albumin	Item1	1	per ml
2	1.02	Microalbumin	Item2	1	per ml
3	1.03	Gamma Glutamyl Tranferase	Item3	1	per ml
4	1.04	(??- GGT)	Item4	1	per ml
5	1.05	Amylase	Item5	1	per ml
6	1.06	Lipase	Item6	1	per ml
7	1.07	CK	Item7	1	per ml
8	1.08	CK-MB	Item8	1	per ml
9	1.09	LDH	Item9	1	per ml
10	1.1	Total Cholesterol	Item10	1	per ml
11	1.11	Triglyceride	Item11	1	per ml
12	1.12	HDL	Item12	1	per ml
13	1.13	LDL	Item13	1	per ml
14	1.14	Calcium	Item14	1	per ml
15	1.15	Copper	Item15	1	per ml
16	1.16	Phosphorus	Item16	1	per ml
17	1.17	Zinc	Item17	1	per ml
18	1.18	Parameter	Item18	1	per ml
19	1.19	Iron	Item19	1	per ml
20	1.2	TIBC	Item20	1	per ml
21	1.21	ADA	Item21	1	per ml
22	1.22	ADA Calibrator	Item22	1	per ml
23	1.23	G-6-PD	Item23	1	per ml
24	1.24	Glycosylated Hb	Item24	1	per ml
25	1.25	Glycosylated Hb Calibrator	Item25	1	per ml
26	1.26	CRP	Item26	1	per ml
27	1.27	CRP Calibrator	Item27	1	per ml
28	1.28	a-1 Acid Glycoprotein	Item28	1	per ml
29	1.29	Ammonia	Item29	1	per ml
30	1.3	Lactate	Item30	1	per ml
31	1.31	Glutathione Peroxidase	Item31	1	per ml
32	1.32	Superoxide dismutase	Item32	1	per ml
33	1.33	Total Antioxidant Status	Item33	1	per ml
34	1.34	Homocysteine	Item34	1	per ml
35	1.35	ASO	Item35	1	per ml
36	1.36	RF	Item36	1	per ml
37	1.37	Lipoprotein (a)	Item37	1	per ml
38	1.38	Lipoprotein (a) Calibrator	Item38	1	per ml
39	1.39	Transferrin	Item39	1	per ml
40	1.4	Cystatin C	Item40	1	per ml
41	1.41	Gentamycin	Item41	1	per ml
42	1.42	Barbiturates	Item42	1	per ml
43	1.43	Valproic Acid	Item43	1	per ml
44	1.44	Phenitoin	Item44	1	per ml
45	1.45	VMA	Item45	1	per ml
46	1.46	Galactosemia	Item46	1	per ml
47	1.47	Calcitonin	Item47	1	per ml
48	1.48	Calcitriol	Item48	1	per ml
49	1.49	Galactokinase	Item49	1	per ml
50	1.5	Galactose-1-phosphate uridyl transferase	Item50	1	per ml
51	1.51	Renin	Item51	1	per ml
52	1.52	ACTH	Item52	1	per ml
53	1.53	Interleukin 1	Item53	1	per ml
54	1.54	Interleukin 4	Item54	1	per ml
55	1.55	Interleukin10	Item55	1	per ml
56	1.56	Leukotrine A4	Item56	1	per ml
57	1.57	Leukotrine B4	Item57	1	per ml
58	1.58	Leukotrine C4	Item58	1	per ml
59	1.59	Leukotrine D4	Item59	1	per ml
60	1.6	Leukotrine E4	Item60	1	per ml
61	1.61	TNFa	Item61	1	per ml
62	1.62	Cephalosporin	Item62	1	per ml
63	1.63	Serum tryptase	Item63	1	per ml
64	1.64	Urine fluoride	Item64	1	per ml
65	1.65	Anti-dsDNA Antibody	Item65	1	per ml
66	1.66	Anti nuclear antibody	Item66	1	per ml
67	1.67	Anti-sm Antibody	Item67	1	per ml
68	1.68	Sodium carbonate	Item68	1	per gm
69	1.69	Potassium Dihydrogen Phosphate	Item69	1	per gm
70	1.7	Potassium Dihydrogen Phosphate KH2PO4 (HPLC grade)	Item70	1	per gm
71	1.71	Creatinine powder	Item71	1	per gm
72	1.72	Isopropyl alcohol, AR Grade	Item72	1	per ml
73	1.73	Acetone – AR grade AR grade	Item73	1	per ml
74	1.74	Ammonium chloride –AR grade,	Item74	1	per gm
75	1.75	Ammonium nitrate – AR grade,	Item75	1	per gm
76	1.76	Ammonium persulphate – AR grade,	Item76	1	per gm
77	1.77	Calcium chloride dihydrade – AR grade,	Item77	1	per gm
78	1.78	Dinitro phenyl hydrazine AR grade,	Item78	1	per gm
79	1.79	Magnesium chloride – AR grade,	Item79	1	per gm
80	1.8	Magnesium sulfate –AR grade,	Item80	1	per gm
81	1.81	Methanol – Acetone free – HPLC grade,	Item81	1	per ml
82	1.82	Methanol (HPLC grade)	Item82	1	per ml
83	1.83	Potassium dichromate – AR grade,	Item83	1	per gm
84	1.84	Silver nitrate – AR grade,	Item84	1	per gm
85	1.85	Sodium bicarbonate – AR grade,	Item85	1	per gm
86	1.86	Sodium acetate dehydrate –AR grade,	Item86	1	per gm
87	1.87	Ammonium acetate – AR grade,	Item87	1	per gm
88	1.88	Thio semi carbazide – AR grade,	Item88	1	per gm
89	1.89	Ethidium bromide soln 10ml– Biotechnology grade,	Item89	1	per ml
90	1.9	Guanidium iso thiocyanate – Biotechnology grade,	Item90	1	per gm
91	1.91	IPTG AR grade,	Item91	1	per gm
92	1.92	100 bp DNA ladder 1 ml X 5	Item92	1	per gm
93	1.93	Taq Polymerase with PCR buffer 3-5 U/µl, 1000 U per vial	Item93	1	per gm
94	1.94	dNTPs 100 millimolar each	Item94	1	per ml
95	1.95	EcoRI restriction enzyme 0.5 ml X 1	Item95	1	per ml
96	1.96	BamHI 0.5 ml X 1	Item96	1	per ml
97	1.97	HinDIII 0.5 ml X 1	Item97	1	per ml
98	1.98	DNA ligase 0.5 ml X 1	Item98	1	per ml
99	1.99	DNA extraction kit(column based) for 50 extraction	Item99	1	per ml
100	2	RNA extraction kit(column based) for 20 extraction	Item100	1	per ml
101	2.01	Plasmid extraction kit(column based) for 50 extraction	Item101	1	per ml
102	2.02	Oligo nucleotide primers (HPLC purification)	Item102	1	per ml
103	2.03	RNAlater	Item103	1	per ml
104	2.04	DEPC mol bio grade	Item104	1	per ml
105	2.05	Nuclese K	Item105	1	per ml
106	2.06	Milipore Prefiltrate Kit Cartridge	Item106	1	pc
107	2.07	Milipore Proguard 2 Pack Cat. No. PROG0002	Item107	1	pc
108	2.08	Milipore Q Guard 1 Cat. No. QGARD00R1	Item108	1	pc
109	2.09	Milipore Tank Vent Filter Cat. No. TANKMPK01	Item109	1	pc
110	2.1	Milipore Sanitization Tablet Cat. No. ZWCL01F50	Item110	1	pc
111	2.11	Millipore millicare Elix cat no JMBM01747	Item111	1	pc
112	2.12	Millipore Quantum Ex cat. No- QTUM000Ex	Item112	1	pc
113	2.13	MX cart 5 micron	Item113	1	pc
114	2.14	MX cart 1 micron	Item114	1	pc
115	2.15	RO cartridge	Item115	1	pc
116	2.16	Non sterile millipak 40	Item116	1	pc
117	2.17	Progard TS 2	Item117	1	pc
118	2.18	1 micron filter	Item118	1	pc
119	2.19	3 micron filter	Item119	1	pc
120	2.2	MX cartridge 5 µm	Item120	1	pc
121	2.21	20 '' carbon cartridge	Item121	1	pc
122	2.22	Sanitization tablets	Item122	1	pc
123	2.23	PM kit	Item123	1	pc
124	2.24	XL wash solution	Item124	1	per ml
125	2.25	200-1000 µl microtips	Item125	1	pc
126	2.26	100-200 µl microtips	Item126	1	pc
127	2.27	5-50 µl microtips	Item127	1	pc
128	2.28	1-5 ml microtips	Item128	1	pc
129	2.29	200-1000 µl micropipette	Item129	1	pc
130	2.3	100-200 µl micropipette	Item130	1	pc
131	2.31	5-50 µl micropipette	Item131	1	pc
132	2.32	2-20 µl micropipette	Item132	1	pc
133	2.33	Microcentrifuge tube 1.5ml	Item133	1	pc
134	2.34	Ammonium persulphate AR	Item134	1	per gm
135	2.35	Potassium iodate (KIO3)	Item135	1	per gm
136	2.36	Toluene AR	Item136	1	per ml
137	2.37	Arsenous acid(As2O3)	Item137	1	per ml
138	2.38	Arsenic trioxide	Item138	1	per ml
139	2.39	Ceric ammonium sulphate	Item139	1	per gm
140	2.4	20bp DNA ladder	Item140	1	pc
141	2.41	TRIS – base AR grade	Item141	1	per gm
142	2.42	Fok I & NlaIII restriction enzyme	Item142	1	pc
143	2.43	DNA loading buffer	Item143	1	pc
144	2.44	DNA sample loading dye	Item144	1	pc
145	2.45	Ethiduim bromide	Item145	1	pc
146	2.46	Primer (Both forward & reverse)	Item146	1	pc
147	2.47	10 X TBE	Item147	1	pc
148	2.48	Heparinised vial	Item148	1	pc
149	2.49	Disposable syringe	Item149	1	pc
150	2.5	Microwave oven	Item150	1	pc
151	2.51	Glucose kit	Item151	1	per kit
152	2.52	Bilirubin Kit	Item152	1	per kit
153	2.53	G6-PD kit	Item153	1	per kit
154	2.54	Vacutainer	Item154	1	pc
155	2.55	Disposable syringe	Item155	1	pc
156	2.56	Cystatin C kit	Item156	1	per kit
157	2.57	Bilirubin Kit	Item157	1	per kit
158	2.58	Creatinine kit	Item158	1	per kit
159	2.59	AST kit	Item159	1	per kit
160	2.6	ALT kit	Item160	1	per kit
161	2.61	ISE wash 2 solution	Item161	1	per ml
162	2.62	ISE cal-3 solution	Item162	1	per ml
163	2.63	ISE cal -4 solution	Item163	1	per ml
164	2.64	Microcentrifuge tube 2ml	Item164	1	pc
165	2.65	SP kit	Item165	1	per kit
166	2.66	Rep prep solution	Item166	1	per ml
167	2.67	Sample applicator	Item167	1	pc
168	2.68	Disposable sample cup	Item168	1	pc
169	2.69	AST	Item169	1	per test
170	2.7	ALT	Item170	1	per test
171	2.71	Creatinine	Item171	1	per test
172	2.72	Albumin	Item172	1	per test
173	2.73	Glucose	Item173	1	per test
174	2.74	GGT	Item174	1	per test
175	2.75	BUN	Item175	1	per test
176	2.76	HDL cholesterol	Item176	1	per test
177	2.77	LDL cholesterol	Item177	1	per test
178	2.78	Cholesterol	Item178	1	per test
179	2.79	UIBC	Item179	1	per test
180	2.8	RF RTG latex	Item180	1	per test
181	2.81	CRP	Item181	1	per test
182	2.82	Uric acid	Item182	1	per test
183	2.83	Triglyceride	Item183	1	per test
184	2.84	ALP	Item184	1	per test
185	2.85	Total bilirubin	Item185	1	per test
186	2.86	IgG	Item186	1	per test
187	2.87	Direct bilirubiun	Item187	1	per test
188	2.88	IgM	Item188	1	per test
189	2.89	Protein	Item189	1	per test
190	2.9	IgA	Item190	1	per test
191	2.91	Phosphorus	Item191	1	per test
192	2.92	C3	Item192	1	per test
193	2.93	Calcium	Item193	1	per test
194	2.94	CK-MB	Item194	1	per test
195	2.95	Lipase	Item195	1	per test
196	2.96	ASO	Item196	1	per test
197	2.97	Iron	Item197	1	per test
198	2.98	C4	Item198	1	per test
199	2.99	Amylase	Item199	1	per test
200	3	CK	Item200	1	per test
201	3.01	Acid phosphatase	Item201	1	per test
202	3.02	Transferrin	Item202	1	per test
203	3.03	LDH	Item203	1	per test
204	3.04	Magnessium	Item204	1	per test
205	3.05	HB-DH	Item205	1	per test
206	3.06	Haptoglobin	Item206	1	per test
207	3.07	Lactate	Item207	1	per test
208	3.08	Microalbumin	Item208	1	per test
209	3.09	Microalbumin calibrator	Item209	1	per test
210	3.1	Cholinesterase	Item210	1	per test
211	3.11	Urine CSF protein	Item211	1	per test
212	3.12	Wash solution	Item212	1	per ml
213	3.13	Cleaning solution	Item213	1	per ml
214	3.14	Cleaning solution weekly wash	Item214	1	per ml
215	3.15	CRP latex calibrator	Item215	1	per test
216	3.16	Urine calibrator	Item216	1	per test
217	3.17	System calibrator	Item217	1	per test
218	3.18	HDL calibrator	Item218	1	per test
219	3.19	LDL calibrator	Item219	1	per test
220	3.2	CRP calibrator	Item220	1	per test
221	3.21	RF calibrator	Item221	1	per test
222	3.22	CK-MB calibrator	Item222	1	per test
223	3.23	Xl-300/600 cuvette	Item223	1	pc
224	3.24	Beckman coulter AU 2700 cuvettes	Item224	1	pc
225	3.25	Xl-300/600 Lamp	Item225	1	pc
226	3.26	Beckman coulter AU 2700 lamp	Item226	1	pc
227	3.27	EQAS (Bio-Rad)	Item227	1	per test
228	3.28	ApoA1 & ApoB reagent & calibrator	Item228	1	per test
229	3.29	Bio-Rad lipid conrol	Item229	1	per test
230	3.3	Ethylene Glycol (Ethandiol	Item230	1	pc
231	3.31	Methylene Soluble (working Reagent	Item231	1	pc
232	3.32	Tissue Capsule Big	Item232	1	pc
233	3.33	Tissue Capsule Small	Item233	1	pc
234	3.34	Tissue Cassettes Big	Item234	1	pc
235	3.35	Tissue Cassettes Small	Item235	1	pc
236	3.36	Stock Phloxine B	Item236	1	pc
237	3.37	Progesterone Receptor	Item237	1	pc
238	3.38	ANA Kit for SLE (Indirect Immunoflurescence Method)	Item238	1	per test
239	3.39	Hb/Cayanaid Method standard	Item239	1	pc
240	3.4	Nalidixid 10ug	Item240	1	per disc
241	3.41	Netilmycin 10ug	Item241	1	per disc
242	3.42	Furozotidime 30ug	Item242	1	per disc
243	3.43	Antigen and antibody HCV ELISA test kits	Item243	1	per test
244	3.44	Cell counter reagents	Item244	1	pc
245	3.45	(Machine available is ABX pentra which is a closed system)	Item245	1	per gm
246	3.46	Reagent for APTT	Item246	1	per test
247	3.47	Calcium Chloride for APTT estimation	Item247	1	per test
248	3.48	Control plasma N	Item248	1	per test
249	3.49	Reaction tube	Item249	1	per test
250	3.5	CA CLEAN	Item250	1	per test
251	3.51	OWRENS Veronal buffer	Item251	1	per test
252	3.52	Standard Human Plasma	Item252	1	per test
253	3.53	Sodium Azide (NaN3)	Item253	1	per test
254	3.54	Bovine thrombin	Item254	1	per test
255	3.55	1000 NIH units/ mg of protein	Item255	1	per test
256	3.56	Anti DCE	Item256	1	per test
257	3.57	Sc(1)	Item257	1	per test
258	3.58	Sc(2)	Item258	1	per test
259	3.59	Sc(3)	Item259	1	per test
260	3.6	Yt(a)	Item260	1	per test
261	3.61	Yt(b)	Item261	1	per test
262	3.62	Do(a)	Item262	1	per test
263	3.63	Do(b)	Item263	1	per test
264	3.64	PYR Broth	Item264	1	per gm
265	3.65	PYR -Pyrolidonyl-ß naphthylamine	Item265	1	per test
266	3.66	Paradimethylaminobenzaldehyde	Item266	1	per ml
267	3.67	P-dimethylaminocinamaldehyde	Item267	1	pc
268	3.68	p-nitrophenylglycerol	Item268	1	pc
269	3.69	Potassium Telurite	Item269	1	pc
270	3.7	Potassium Cyanide (KCN)	Item270	1	per gm
271	3.71	Para dimethyl aminobenzaldehyde	Item271	1	per ml
272	3.72	Potassium hydroxide	Item272	1	per gm
273	3.73	Potassium Hydrogen Sulphate	Item273	1	per gm
274	3.74	Phenol Crystal (powder)	Item274	1	per gm
275	3.75	Phosphate Buffer Saline	Item275	1	per ml
276	3.76	Phenethyl alcohol	Item276	1	per ml
277	3.77	Phenol red indicator	Item277	1	per ml
278	3.78	Phenol red indicator	Item278	1	per gm
279	3.79	Phenol red	Item279	1	per gm
280	3.8	Phenylpyruvic acid Reagent	Item280	1	pc
281	3.81	Potassium dichromate LR	Item281	1	per gm
282	3.82	Potassium permanganate LR	Item282	1	per gm
283	3.83	Potassium permanganate AR	Item283	1	per gm
284	3.84	Potassium Phosphate monobasic	Item284	1	per gm
285	3.85	Potassium Nitrate	Item285	1	per gm
286	3.86	Phenol (Crystal)	Item286	1	per gm
287	3.87	Peptone	Item287	1	per gm
288	3.88	Raffinose AR	Item288	1	per gm
289	3.89	Rhammnose	Item289	1	per gm
290	3.9	Sodium/ Potassium Dichromate	Item290	1	pc
291	3.91	Sodium citrate	Item291	1	per ml
292	3.92	Sodium Pyruvate AR	Item292	1	per gm
293	3.93	Sodium Biocarbonate LR	Item293	1	per gm
294	3.94	Sodium acetate	Item294	1	per gm
295	3.95	Sodium Iodide	Item295	1	per gm
296	3.96	Sulphanilamine-AR	Item296	1	per gm
297	3.97	Sugar assimilation disc – Cellobiose	Item297	1	pc
298	3.98	Sugar assimilation disc – Dextrose	Item298	1	pc
299	3.99	Sugar assimilation disc – Dulcitol	Item299	1	pc
300	4	Sugar assimilation disc – Galactose	Item300	1	pc
301	4.01	Sugar assimilation disc – Inositol	Item301	1	pc
302	4.02	Sugar assimilation disc – Lactose	Item302	1	pc
303	4.03	Sugar assimilation disc – Maltose	Item303	1	pc
304	4.04	Sugar assimilation disc – Melibiose	Item304	1	pc
305	4.05	Sugar assimilation disc - Raffinose	Item305	1	pc
306	4.06	Sugar assimilation disc- Sucrose	Item306	1	pc
307	4.07	Sugar assimilation disc – Trehalose	Item307	1	pc
308	4.08	Sugar assimilation disc - Xylose	Item308	1	pc
309	4.09	Salicin AR	Item309	1	per gm
310	4.1	Tarric Acid	Item310	1	per gm
311	4.11	Trehalose Ar	Item311	1	per gm
312	4.12	Triypticase	Item312	1	per gm
313	4.13	Thiosulphate	Item313	1	per ml
314	4.14	Tri-Sodium Citrate	Item314	1	per gm
315	4.15	Voges proskaeur reagent	Item315	1	pc
316	4.16	Vibriostatic (0/129) Agent	Item316	1	per ml
317	4.17	Wright’s Stain	Item317	1	per gm
318	4.18	Xylose AR	Item318	1	per gm
319	4.19	Vibrio cholerae-01 3ml	Item319	1	per ml
320	4.2	Vibrio cholerae-0139 3ml	Item320	1	per ml
321	4.21	Vibrio cholerae-Ogawa 3ml	Item321	1	per ml
322	4.22	Vibrio cholerae-Inaba 3ml	Item322	1	per ml
323	4.23	Salmonella Polyvalent O 3ml	Item323	1	per ml
324	4.24	Salmonella Polyvalent H 3ml	Item324	1	per ml
325	4.25	Salmonella Polyvalent O2 3ml	Item325	1	per ml
326	4.26	Salmonella Polyvalent O4 3ml	Item326	1	per ml
327	4.27	Salmonella Polyvalent O9 3ml	Item327	1	per ml
328	4.28	Salmonella Polyvalent H Phase I a 3ml	Item328	1	per ml
329	4.29	Salmonella Polyvalent H Phase Ib 3ml	Item329	1	per ml
330	4.3	Salmonella Polyvalent H Phase Ic 3ml	Item330	1	per ml
331	4.31	Salmonella Polyvalent H Phase Ii 3ml	Item331	1	per ml
332	4.32	Shigella Polyvalent dysenteriae 3ml	Item332	1	per ml
333	4.33	Shigella Polyvalent flexnerii 3ml	Item333	1	per ml
334	4.34	Shigella Polyvalent sonnei 3ml	Item334	1	per ml
335	4.35	Shigella Polyvalent boydii 3ml	Item335	1	per ml
336	4.36	Cryptococcus antigen detection kit (latex Agglutination detection)	Item336	1	per test
337	4.37	Antigen detection kit for Meningitis (H influenza b, N meningitis A & C, S. pneumonia, GBS, E.coli)	Item337	1	per test
338	4.38	Amphotericin Powder	Item338	1	per gm
339	4.39	Benzal Pennicillin Powder	Item339	1	per gm
340	4.4	Cefoxitin 5gm/vial	Item340	1	vial
341	4.41	Clindamycin Powder	Item341	1	per gm
342	4.42	Ciprofloxacin 5gm/vial	Item342	1	vial
343	4.43	Erythromycin Powder	Item343	1	per gm
344	4.44	Gentamicin 5gm/vial	Item344	1	vial
345	4.45	Imipenem 5gm/vial	Item345	1	vial
346	4.46	Oxacillin 5gm/vial	Item346	1	vial
347	4.47	Vancomycin 5gm/vial	Item347	1	vial
348	4.48	Anidulafungin (0.015-128µg/ml)	Item348	1	per strip
349	4.49	Ceftriaxone (0.016-256 ug /ml.)	Item349	1	per strip
350	4.5	Ciprofloxacin (0.001-8ug / ml.)	Item350	1	per strip
351	4.51	Ceftazidime+ Clavulanate(0.004-128ug / ml.)	Item351	1	per strip
352	4.52	Clindamycin E-test (0.016-256 µg/ml)	Item352	1	per strip
353	4.53	Colistin (0.06-0.25µg/ml)	Item353	1	per strip
354	4.54	Caspofungin (0.015-128µg/ml	Item354	1	per strip
355	4.55	Doripenem(0.002-32 µg/ml)	Item355	1	per strip
356	4.56	Ertapenem (0.002-32 µg/ml)	Item356	1	per strip
357	4.57	Fluconazole (0.016-256 µg/ml)	Item357	1	per strip
358	4.58	Imipenem(0.004-128ug / ml.)	Item358	1	per strip
359	4.59	Levofloxacin (0.001-8ug / ml.)	Item359	1	per strip
360	4.6	Meropenem (4-256 µg/ml)	Item360	1	per strip
361	4.61	Meropenem/EDTA (1-64 µg/ml)	Item361	1	per strip
362	4.62	Moxifloxacin (0.001-8ug / ml.)	Item362	1	per strip
363	4.63	Candida albicans ATCC 14053	Item363	1	vial
364	4.64	Candida guilliermondii ATCC 6260	Item364	1	vial
365	4.65	Candida Psedotropicalis TCC 4135	Item365	1	vial
366	4.66	Corynebacterium diptheriae ATCC 13812 Vial	Item366	1	vial
367	4.67	Escherichia coli ATCC 25922 Vial	Item367	1	vial
368	4.68	Escherichia coli ATCC 35218 Vial	Item368	1	vial
369	4.69	Enterococcus faecalis ATCC 29212 Vial	Item369	1	vial
370	4.7	Haemophilus influenzae ATCC-49766 Vial	Item370	1	vial
371	4.71	Pseudomonas aeruginosa ATCC 27853 Vial	Item371	1	vial
372	4.72	Positive Control for T.B. (My.TB H37rv strain)	Item372	1	vial
373	4.73	Staphylococcus aureus ATCC 25923 Vial	Item373	1	vial
374	4.74	Streptococcus pneumoniae ATCC 49619 Vial	Item374	1	vial
375	4.75	Staphylococcus aureus ATCC 33591 Vial	Item375	1	vial
376	4.76	Salmonella enterica subspecies enterica serovar cholerasuis ATCC-10708 Vial	Item376	1	vial
377	4.77	Salmonella enterica subspecies enterica serovar paratyphi A ATCC-9150 Vial	Item377	1	vial
378	4.78	Salmonella enterica subspecies enterica serovar typhimurium ATCC-25241 Vial	Item378	1	vial
379	4.79	Shigella flexneri ATCC- 9199 Vial	Item379	1	vial
380	4.8	AST for GNB AST –N280	Item380	1	per test
381	4.81	Media for Pediatric Sample -259794,BACT/ALERT PF	Item381	1	per test
382	4.82	Media for Aerobic Sample – 259791, BACT/ALERT FA	Item382	1	per test
383	4.83	Solution for Inoculum Preparation – V1204, 3x500 ml	Item383	1	per test
384	4.84	Tubes for Inoculum Preparation - 69285(unsensitised tube)	Item384	1	per test
385	4.85	Identification of Fermentes and Non-ferments – 21341(GN TEST KIT VTK)	Item385	1	per test
386	4.86	DNA ladder / molecular weight marker size range : 100 to 1200 bp (50µg)	Item386	1	per test
387	4.87	DNA Extraction kit	Item387	1	per test
388	4.88	Deoxynucleotide triphosphate (dNTP) mixture	Item388	1	per test
389	4.89	Anaerogas pack (5 nos/pack)	Item389	1	pc
390	4.9	Autoclavable Biohazard plastic bag: size 10 ltr 10ltr	Item390	1	pc
391	4.91	Anaerobic Blood Culture bottle – Adult (50/ pack)	Item391	1	pc
392	4.92	Anaerobic Blood Culture bottle – Paediatric (50/ pack)	Item392	1	pc
393	4.93	Anaerobic System Rubber Ring	Item393	1	pc
394	4.94	Anaero Indicator Tablet RT (1x10/pkt)	Item394	1	pc
395	4.95	Autoclavable Plastic Vial Flat Bottom,screw capped 11.5 mm x53 mm.	Item395	1	pc
396	4.96	Craigie’s tube	Item396	1	pc
397	4.97	Durham's tube 25 x 6 mm	Item397	1	pc
398	4.98	Durham's tube 37x 6 mm	Item398	1	pc
399	4.99	Embading Cassette 1x1000/box	Item399	1	pc
400	5	Kline Concavity Slides 75x56x3 mm thick & 12 concavity code GW097	Item400	1	pc
401	5.01	Microtips (Autoclavable) with box (96’s/pack) 0.1ul - 20µl	Item401	1	pc
402	5.02	Microtips (Autoclavable) with box (96’s/pack) 2ul - 200µl	Item402	1	pc
403	5.03	Microtips (Autoclavable) with box (96’s/pack) 50ul - 1000µl	Item403	1	pc
404	5.04	Microtips (Autoclavable) 0.1ul - 20µl	Item404	1	pc
405	5.05	Microtips (Autoclavable) 2ul - 20ul	Item405	1	pc
406	5.06	Microtips (Autoclavable) 5ul-50ul	Item406	1	pc
407	5.07	Microtips (Autoclavable) 20ul-200ul	Item407	1	pc
408	5.08	Microtips (Autoclavable) 200ul-1000ul	Item408	1	pc
409	5.09	Microtips-1000 ul	Item409	1	pc
410	5.1	Microtips-5000 ul	Item410	1	pc
411	5.11	Microtitre plate with round bottom wells 96wells	Item411	1	pc
412	5.12	Microtitre plate with detachable wells 96wells	Item412	1	pc
413	5.13	Micro centrifuge Autoclavable Plastic Tubes with cap 2ml	Item413	1	pc
414	5.14	Micro centrifuge Autoclavable Plastic Tubes with cap 5ml	Item414	1	pc
415	5.15	Micro centrifuge Autoclavable Plastic Tubes with cap 10ml	Item415	1	pc
416	5.16	Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. Capacity 30ml	Item416	1	pc
417	5.17	Museum Jar, With Cover 160x110x60mm	Item417	1	pc
418	5.18	Museum Jar, With Cover 170x130x210 mm	Item418	1	pc
419	5.19	Screw capped tubes 20x150mm	Item419	1	pc
420	5.2	Serum vials sample storage box & stand for 3ml capacity	Item420	1	pc
421	5.21	Sample Container -Wide mouth bottle,125ml Autoclavable (Polypropylene) 125ml	Item421	1	pc
422	5.22	Storage vials (autoclavable) 2ml	Item422	1	pc
423	5.23	Teasing Needles for moulds	Item423	1	pc
424	5.24	Test Tube Stand - Test -tube size - 25mm diametre	Item424	1	pc
425	5.25	Test Tube Stand - test -tube size - 16mm diametre	Item425	1	pc
426	5.26	Test Tube Stand - Test-tube size - 10mm diametre	Item426	1	pc
427	5.27	Test tube basket, large	Item427	1	pc
428	5.28	Test tube basket, small	Item428	1	pc
429	5.29	Test tube rack to accommodate 3 ml. test tubes 5X15	Item429	1	pc
430	5.3	Test tube rack to accommodate 5 ml. test tubes 5X15	Item430	1	pc
431	5.31	Test tube racks:4 x 13	Item431	1	pc
432	5.32	Test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes)	Item432	1	pc
433	5.33	Test Tube Carrier (stainless steel)	Item433	1	pc
434	5.34	V.D.R.L. Slides (75mmx50mm 1.45mm)	Item434	1	pc
435	5.35	Wash bottle plastic with delivery Nozzle 200ml	Item435	1	pc
436	5.36	Wash bottle plastic with delivery Nozzle 60ml	Item436	1	pc
437	5.37	Bunsen burner	Item437	1	pc
438	5.38	Bacteriological loop holder with loop (ready to use)	Item438	1	pc
439	5.39	Biological indicator for steam	Item439	1	pc
440	5.4	Bowie DickTest Pack Steam	Item440	1	pc
441	5.41	Ice box 5 litres	Item441	1	pc
442	5.42	Labels for Micro centrifuge tubes white Size ½”	Item442	1	pc
443	5.43	Metaloops (Changeable Nichrome loop embedded in Brass rod with heat resistant handle with-	Item443	1	pc
444	5.44	a. 2 mm diameter Nichrome wire	Item444	1	pc
445	5.45	b. 3 mm diameter Nichrome wire	Item445	1	pc
446	5.46	c. 4 mm diameter Nichrome wire	Item446	1	pc
447	5.47	Metaloops (Fixed straight Nichrome loop embedded in SS rod with heat resistant handle with-	Item447	1	pc
448	5.48	Microtome Knife	Item448	1	pc
449	5.49	Mops	Item449	1	pc
450	5.5	Magnifying glass, big size with handle	Item450	1	pc
451	5.51	Mortar - Pestle	Item451	1	pc
452	5.52	Nichrome loop-4 mm	Item452	1	pc
453	5.53	Nichrome loop-2 mm	Item453	1	pc
454	5.54	Nichrome loop-1.3 mm	Item454	1	pc
455	5.55	Pipette stand( vertical & horizontal) 4/5 pipettes	Item455	1	pc
456	5.56	Staining rack. 20 slide capacity.	Item456	1	pc
457	5.57	Sprit Lamp glass/ metal	Item457	1	pc
458	5.58	Screwdrivers -multipurpose	Item458	1	pc
459	5.59	Silver aluminium foil	Item459	1	pc
460	5.6	Surgical Knife (Big)	Item460	1	pc
461	5.61	Sterile swab sticks	Item461	1	pc
462	5.62	Syringe driven filters PTFE (hydrophilic) pore size 0.22µm	Item462	1	pc
463	5.63	Thermometer 37degree C	Item463	1	pc
464	5.64	Twine	Item464	1	pc
465	5.65	Universal collection vials (Urine pot)	Item465	1	pc
466	5.66	Universal Wash Reagents 500ml	Item466	1	pc
467	5.67	Anti-CD 56	Item467	1	per ml
468	5.68	Anti-61	Item468	1	per ml
469	5.69	Anti-CD 68	Item469	1	per ml
470	5.7	Anti-CD 33	Item470	1	per ml
471	5.71	Anti-Ki 67 (Mib)	Item471	1	per ml
472	5.72	Anti Neurofilament Protein	Item472	1	per ml
473	5.73	Anti-Synaptophysin	Item473	1	per ml
474	5.74	Anti-GFAP	Item474	1	per ml
475	5.75	Anti-CD 99	Item475	1	per ml
476	5.76	Anti-CD 31	Item476	1	per ml
477	5.77	Anti-B HCG	Item477	1	per ml
478	5.78	Poly-L.Lysine	Item478	1	per ml
479	5.79	Anti-CD 20 (B cells)	Item479	1	per ml
480	5.8	Anti-CD 45 (LCA)	Item480	1	per ml
481	5.81	Anti-S 100	Item481	1	per ml
482	5.82	Anti- Desmin	Item482	1	per ml
483	5.83	Anti-C-erb B-2 (Her-L/Neu)	Item483	1	per ml
484	5.84	Anti-ER	Item484	1	per ml
485	5.85	Anti-PR	Item485	1	per ml
486	5.86	Anti-CD 3	Item486	1	per ml
487	5.87	Anti-CD 20	Item487	1	per ml
488	5.88	Anti-CD 117	Item488	1	per ml
489	5.89	Anti-CD 34	Item489	1	per ml
490	5.9	Anti-CD 30	Item490	1	per ml
491	5.91	Anti-Cyclin D1	Item491	1	per ml
492	5.92	Anti-CD 15	Item492	1	per ml
493	5.93	Anti-CD 5	Item493	1	per ml
494	5.94	FITC-Conjugated Rabbit	Item494	1	per ml
495	5.95	Anti-Human IgA (alpha chain)	Item495	1	per ml
496	5.96	FITC-Conjugated Rabbit	Item496	1	per ml
497	5.97	Anti-Human IgG (Gamma chain)	Item497	1	per ml
498	5.98	FITC-Conjugated Rabbit	Item498	1	per ml
499	5.99	Anti-Human Kappa Light chain	Item499	1	per ml
500	6	FITC-Conjugated Rabbit	Item500	1	per ml
501	6.01	Anti-Human C3c Complement	Item501	1	per ml
502	6.02	FITC-Conjugated Rabbit	Item502	1	per ml
503	6.03	Anti-Human IgM (Mu chain)	Item503	1	per ml
504	6.04	FITC-Conjugated Rabbit	Item504	1	per ml
505	6.05	Anti-Human Lambda (Light chain)	Item505	1	per ml
506	6.06	ANA by Hep-2-cell-line substrate(kit with reagents)	Item506	1	pc
507	6.07	Electrodes for µpH System 361	Item507	1	pc
508	6.08	Osmium Tetroxide	Item508	1	pc
509	6.09	Chromium trioxide	Item509	1	pc
510	6.1	Zinc Chloride	Item510	1	pc
511	6.11	Di-Sodium hydrogen phosphate anhydrous	Item511	1	per gm
512	6.12	Di-Sodium hydrogen Orthophosphate Dibasic	Item512	1	per gm
513	6.13	Sodium dihydrogen orthophosphate monohydrate	Item513	1	per gm
514	6.14	Sodium borate	Item514	1	per gm
515	6.15	Alpha napthyl butyrate	Item515	1	per gm
516	6.16	Anti-CISH kits-HPV16/18DNA	Item516	1	per ml
517	6.17	ER/P-R control	Item517	1	per ml
518	6.18	Anti-Melanomal(HMB45)	Item518	1	per ml
519	6.19	Anti Myeloperoxidase	Item519	1	per ml
520	6.2	Anti -NSE	Item520	1	per ml
521	6.21	Anti-PLAP	Item521	1	per ml
522	6.22	Anti-bc12 oncoprotein	Item522	1	per ml
523	6.23	Anti-Cytokeratin7	Item523	1	per ml
524	6.24	Anti-Cytokeratin20	Item524	1	per ml
525	6.25	Anti-BRCA 1Protein	Item525	1	per ml
526	6.26	Anti-IgA	Item526	1	per ml
527	6.27	Anti-IgM	Item527	1	per ml
528	6.28	Anti-IgG	Item528	1	per ml
529	6.29	Anti-compliment CD3	Item529	1	per ml
530	6.3	Anti-Rb gene protein	Item530	1	per ml
531	6.31	Anti-P53 protein	Item531	1	per ml
532	6.32	Anti-WT1 turmor	Item532	1	per ml
533	6.33	Anti-Vimentin (V9)	Item533	1	per ml
534	6.34	Anti-EMA(E29)	Item534	1	per ml
535	6.35	Anti-p169INK4)	Item535	1	per ml
536	6.36	Kappa	Item536	1	per ml
537	6.37	Lamda	Item537	1	per ml
538	6.38	Eosine spirit soluble	Item538	1	per ml
539	6.39	PAP Pen Immuno histochemistry	Item539	1	per ml
540	6.4	Anti-CD 1a	Item540	1	per ml
541	6.41	Anti-SMA	Item541	1	per ml
542	6.42	Anti-Myogenin	Item542	1	per ml
543	6.43	Fluorescent bchiff reagent	Item543	1	per ml
544	6.44	Carmine	Item544	1	per ml
545	6.45	Acriffarine	Item545	1	per ml
546	6.46	Cresyl fast blue	Item546	1	per ml
547	6.47	Luxol fast blue	Item547	1	per ml
548	6.48	Cresyl violet	Item548	1	per ml
549	6.49	Epinephrine (3x0.5ml)	Item549	1	pc
550	6.5	Aggrecetion ristocetion A Sulfate (3x0.5ml)	Item550	1	pc
551	6.51	A D P(Adenosine-5l Diphosphate(3x0.5ml)	Item551	1	pc
552	6.52	Arachidonic acid lyohillzed sodium Arachidonate	Item552	1	pc
553	6.53	Collagen Soluble Calfskin(3x0.5ml)	Item553	1	pc
554	6.54	Vw Fator Assay ristocetin cofactor (3x0.5ml)	Item554	1	pc
555	6.55	Test tube( siliconized,flate bottom 7x25x55mm)	Item555	1	pc
556	6.56	Stri Bars plastic coaled MICRO	Item556	1	pc
557	6.57	Cryo Glue (Tissue Embedding Medium)for Cryostat Machine	Item557	1	pc
558	6.58	Diposables blades for Cryostat Machine	Item558	1	pc
559	6.59	Silicon Tubal Ring	Item559	1	pc
560	6.6	Laser Spectacles	Item560	1	pc
561	6.61	Fluid Warmer	Item561	1	pc
562	6.62	Filter for Suction Machine( Atmos)	Item562	1	pc
563	6.63	NIBP Monitor with integrated cuff arm	Item563	1	pc
564	6.64	Serum Zinc	Item564	1	per ml
565	6.65	Copper	Item565	1	per ml
566	6.66	Ceruloplasmin	Item566	1	per ml
567	6.67	Ammonia	Item567	1	per ml
568	6.68	Ammonia	Item568	1	per ml
569	6.69	Alcohol	Item569	1	per ml
570	6.7	D- Dimer	Item570	1	per ml
571	6.71	Anti ds DNA	Item571	1	per ml
572	6.72	Anti sn Antibody	Item572	1	per ml
573	6.73	Vitamin D	Item573	1	per ml
574	6.74	Vitamin E	Item574	1	per ml
575	6.75	NGAL	Item575	1	per ml
576	6.76	Cystatin C	Item576	1	per ml
577	6.77	G6 PD	Item577	1	per ml
578	6.78	Lactate	Item578	1	per ml
579	6.79	Apo A1	Item579	1	per ml
580	6.8	Homocysteine	Item580	1	per ml
581	6.81	BNP	Item581	1	per ml
582	6.82	Urinary VMA	Item582	1	per ml
583	6.83	Blood ketones	Item583	1	per ml
584	6.84	Lip a	Item584	1	per ml
585	6.85	ANA	Item585	1	per ml
586	6.86	Anti phospholipid antibody	Item586	1	per ml
587	6.87	Vitamin C	Item587	1	per ml
588	6.88	ENA	Item588	1	per ml
589	6.89	Vitamin K	Item589	1	per ml
590	6.9	Iodine	Item590	1	per ml
591	6.91	APO B	Item591	1	per ml
592	6.92	Troponin T	Item592	1	per ml
593	6.93	CK MB1	Item593	1	per ml
594	6.94	CK MB 2	Item594	1	per ml
595	6.95	TIBC	Item595	1	per ml
596	6.96	Transferrin	Item596	1	per ml
597	6.97	IgG	Item597	1	per ml
598	6.98	IgM	Item598	1	per ml
599	6.99	IgA	Item599	1	per ml
600	7	Inhibin A	Item600	1	per ml
601	7.01	ß trace protein	Item601	1	per ml
602	7.02	?eta 2 microgobulin	Item602	1	per ml
603	7.03	Alpha 1 Antitrypsin	Item603	1	per ml
604	7.04	a -1 Microglobulin	Item604	1	per ml
605	7.05	a-2 Macroglobulin	Item605	1	per ml
606	7.06	Screening kit for inborn error of metabolism	Item606	1	per ml
607	7.07	EQAS for clinical chemistry,Immunoassay, electrolyte, HbA1C.	Item607	1	per ml
608	7.08	TPO (Thyroperoxidase) antibody	Item608	1	per ml
609	7.09	Control for M-band electrophoresis	Item609	1	per ml
610	7.1	TNF-a	Item610	1	per ml
611	7.11	IL-2	Item611	1	per ml
612	7.12	Procalcitonin	Item612	1	per ml
613	7.13	5'ACAGCGTCATGGCAGAGCAGGTGGC3’	Item613	1	per ml
614	7.14	5'AAAAGCTCTTCCCGCAGGATCCCGC3’	Item614	1	per ml
615	7.15	5'GTGGCTGTTCCGGGATGGCCTTCTG3’	Item615	1	per ml
616	7.16	5'CTTGAAGAAGGGCTCACTCTGTTTG3’	Item616	1	per ml
617	7.17	5'CAGTACGATGATGCAGC3’	Item617	1	per ml
618	7.18	5'CAGGTAGAAGAGGCGGT3’	Item618	1	per ml
619	7.19	amikacin ,neomycin &	Item619	1	per ml
620	7.2	tobramycin standard (HPLC grade)	Item620	1	per ml
621	7.21	EDTA gel (15%)	Item621	1	Per gm
622	7.22	Acrylic - Heat cure-clear	Item622	1	Pc
623	7.23	Acrylic - Heat cure-pink	Item623	1	Pc
624	7.24	Acrylic - Self cure-clear	Item624	1	Pc
625	7.25	Acrylic - Self cure-pink	Item625	1	Pc
626	7.26	Agate Spatula	Item626	1	Pc
627	7.27	Alginate impression material ( Dustless)	Item627	1	Pc
628	7.28	Articulation paper	Item628	1	Pc
629	7.29	Bur - Airotor-Diamond	Item629	1	Pc
630	7.3	Bur - Airotor-TC- straight fissure	Item630	1	Pc
631	7.31	Calcium Hydroxide paste for root canal	Item631	1	Pc
632	7.32	Dappen dish	Item632	1	Pc
633	7.33	Dental Floss – waxed, 25 m	Item633	1	Pc
634	7.34	Dental Stone	Item634	1	Pc
635	7.35	Dentin bonding agent	Item635	1	Pc
636	7.36	Die stone	Item636	1	Pc
637	7.37	Disposable Suction Tips with copper wire	Item637	1	Pc
638	7.38	Emery Sheet - 100, 150 and 400 Grade	Item638	1	Pc
639	7.39	Endodontic Gutta Percha Points(15-80)	Item639	1	Pc
640	7.4	Etchant gel ( 37 % Phosphoric Acid)	Item640	1	Pc
641	7.41	Fiber Composite splint	Item641	1	Pc
642	7.42	Flexible Composite polishing discs	Item642	1	Pc
643	7.43	Formocresol	Item643	1	Pc
644	7.44	GIC- High strength pacakable for posteriors	Item644	1	Pc
645	7.45	Glass Ionomer Cement Type I	Item645	1	Pc
646	7.46	Glass Ionomer Cement Type II	Item646	1	Pc
647	7.47	Gluma Dentin Desensitizer	Item647	1	Pc
648	7.48	Gutta Percha Sticks	Item648	1	Pc
649	7.49	Halogen bulbs- 12V, 55 W	Item649	1	Pc
650	7.5	Hydroxyapatite Bone graft Material	Item650	1	Pc
651	7.51	K File - all sizes	Item651	1	Pc
652	7.52	Light cure composite - Flowable - All shades	Item652	1	Pc
653	7.53	Light cure composite - nano-hybrid – all shades	Item653	1	Pc
654	7.54	Modelling wax sheet no.2	Item654	1	Pc
655	7.55	Non Eugenol Impression Paste - standard pack	Item655	1	Pc
656	7.56	Pinnacle tracing sticks ( minimum three years shelf life)	Item656	1	Pc
657	7.57	Polishing brush for dental lathe	Item657	1	Pc
658	7.58	Polymer Reinforced Zinc oxide Eugenol cement	Item658	1	Pc
659	7.59	Pumice powder for polishing dentures	Item659	1	Pc
660	7.6	Silver reinforced Glass Ionomer	Item660	1	Pc
661	7.61	Supernal Base Plate	Item661	1	Pc
662	7.62	Tissue conditioner ( Soft reliner)	Item662	1	Pc
663	7.63	Ultrasonic scaler tip	Item663	1	Pc
664	7.64	Vacuum formed sheets - Soft and hard - 2 and 3mm	Item664	1	Pc
665	7.65	Vulcanite Trimmer ( TC)	Item665	1	Pc
666	7.66	Zinc oxide Eugenol impression paste	Item666	1	Pc
667	7.67	Self Cure Acrylic Tooth Colour Temporary Crown Materials (Powder & Liquid)	Item667	1	Pc
668	7.68	Cold - Cure Acrylic Powder With Liquid (White Colour)	Item668	1	Pc
669	7.69	Pits and Fissure Sealant	Item669	1	Pc
670	7.7	Zinc oxide Eugenol impression paste	Item670	1	Pc
671	7.71	IRM (Intermediate Restorative Materials)	Item671	1	Pc
672	7.72	GIC Fuji Tupe IX	Item672	1	Pc
673	7.73	GIC Type -II Restoative Materials	Item673	1	Pc
674	7.74	Light Cure Composite Nano- Filling Materials	Item674	1	Pc
675	7.75	Alginate impression material ( Dustless)	Item675	1	Pc
676	7.76	Dental Stone	Item676	1	Pc
677	7.77	Wedges	Item677	1	Pc
678	7.78	Miracle Mix Materials	Item678	1	Pc
679	7.79	Hand Piece Lubricant	Item679	1	Pc
680	7.8	Dycal	Item680	1	Pc
681	7.81	Suction Tips	Item681	1	Pc
682	7.82	Acrylic Teeth Set	Item682	1	Pc
683	7.83	Polishing Paste	Item683	1	Pc
684	7.84	Polishing Rubber Cups and Bristle	Item684	1	Pc
685	7.85	Disposable Glass	Item685	1	Pc
686	7.86	Abrasive Strips for Polishing Proximal Areas of Teeth	Item686	1	Pc
687	7.87	Cellophene Matrix Strips for LC Restoration	Item687	1	Pc
688	7.88	Applicator Tips for LC	Item688	1	Pc
689	7.89	Desensitizing Varnish	Item689	1	Pc
690	7.9	Burs For Tooth Reduction Set	Item690	1	Pc
691	7.91	Dental stone cutting Burs (Small Size)	Item691	1	Pc
692	7.92	H-Files for Both Anterior and Posterior	Item692	1	Pc
693	7.93	K- File for Both Anterior and Posterior	Item693	1	Pc
694	7.94	Broaches	Item694	1	Pc
695	7.95	Reamers for Both Anterior and Posterior	Item695	1	Pc
696	7.96	Gutta Percha	Item696	1	Pc
697	7.97	Absorbant Paper Point	Item697	1	Pc
698	7.98	Titanium Post (All Sizes)	Item698	1	Pc
699	7.99	Protapper Gutta Parcha All Size	Item699	1	Pc
700	8	Alveogel	Item700	1	Pc
701	8.01	RC CAL (Intra Canal Dressing Paste)	Item701	1	Pc
702	8.02	Fiber Optics Air Rotor Hand Pieces with Coupling Unit	Item702	1	Pc
703	8.03	GP Cutter	Item703	1	Pc
704	8.04	Tungsten Carbide Burs For Air Rotor and Micro Motor HandPieces	Item704	1	Pc
705	8.05	Sectional Matrixs	Item705	1	Pc
706	8.06	Metal Crown	Item706	1	Pc
707	8.07	Zinc oxide powder and eugenol (Big Size)	Item707	1	Pc
708	8.08	Zinc oxide eugenol (Powder )	Item708	1	Pc
709	8.09	Zinc oxide eugenol (Liquid)	Item709	1	Pc
710	8.1	Zinc oxide eugenol (ready mix)	Item710	1	Pc
711	8.11	ZnO Impression paste	Item711	1	Pc
712	8.12	Dycal Cement	Item712	1	Pc
713	8.13	Stone burs (all sizes and shape)	Item713	1	Pc
714	8.14	Stone burs for polishing (fine)	Item714	1	Pc
715	8.15	Composit polishing disc	Item715	1	Pc
716	8.16	Composite Cement	Item716	1	Pc
717	8.17	Composite filling kit	Item717	1	Pc
718	8.18	Composite finishing and polishing	Item718	1	Pc
719	8.19	Composite polishing disc	Item719	1	Pc
720	8.2	Composite polishing kit	Item720	1	Pc
721	8.21	Composite polishing paste	Item721	1	Pc
722	8.22	Endo Wash 5% 450ml	Item722	1	Pc
723	8.23	Bristle Brush & Cup	Item723	1	Pc
724	8.24	Eugenol 15ml	Item724	1	Pc
725	8.25	Eugenol 110ml	Item725	1	Pc
726	8.26	DPI Selfcure	Item726	1	Pc
727	8.27	Ketac Molar	Item727	1	Pc
728	8.28	NT Premium	Item728	1	Pc
729	8.29	One Coat Bond	Item729	1	Pc
730	8.3	GIC LC (Mini) GC	Item730	1	Pc
731	8.31	PIVO Crown & Bridge Kit	Item731	1	Pc
732	8.32	Protaper Hand Kit 21/25mm	Item732	1	Pc
733	8.33	Mouth Mith Handle (GDC)	Item733	1	Pc
734	8.34	Explorer (GDC)	Item734	1	Pc
735	8.35	Surgical scissor (BRP)	Item735	1	Pc
736	8.36	DPI Alloy	Item736	1	Pc
737	8.37	Tri Hawk	Item737	1	Pc
738	8.38	Glyde 3mlx1	Item738	1	Pc
739	8.39	GP F4-F5 (Dentsply)	Item739	1	Pc
740	8.4	GP (15/35/40 ) Dentsply	Item740	1	Pc
741	8.41	Dtech Etchn	Item741	1	Pc
742	8.42	H File 15/20/25	Item742	1	Pc
743	8.43	Matrix Band No1	Item743	1	Pc
744	8.44	Diamond Bur	Item744	1	Pc
745	8.45	Shofu Crown & Bridge Kit	Item745	1	Pc
746	8.46	Vitrebond	Item746	1	Pc
747	8.47	AH 26	Item747	1	Pc
748	8.48	Ketac Silver	Item748	1	Pc
749	8.49	API Needle Holder	Item749	1	Pc
750	8.5	NSK Push Button Airotor Handpiece	Item750	1	Pc
751	8.51	Apex Locator Pixi Dentsply	Item751	1	Pc
752	8.52	Lightcure Michine Coltene	Item752	1	Pc
753	8.53	Sealer Machine with Pouch	Item753	1	Pc
754	8.54	Scaller Tips Satellec	Item754	1	Pc
755	8.55	Ultrasonic Cleaner	Item755	1	Pc
756	8.56	Smart Burs	Item756	1	Pc
757	8.57	Anti Fog Mouth Mirror	Item757	1	Pc
758	8.58	Flouride Solution with Applicator	Item758	1	Pc
759	8.59	Luting Cement	Item759	1	Pc
760	8.6	Silicon Base Impression Materials	Item760	1	Pc
761	8.61	Base Putty Impression Materials	Item761	1	Pc
762	8.62	Light Body Impression Materials	Item762	1	Pc
763	8.63	Re Cap	Item763	1	Pc
764	8.64	DVI Self	Item764	1	Pc
765	8.65	Propopar Band Kit 21/25ml	Item765	1	Pc
766	8.66	GHOFU Crown & Bridge Kit	Item766	1	Pc
767	8.67	ALT 26	Item767	1	Pc
768	8.68	APL Needle Holder	Item768	1	Pc
769	8.69	Giyote 3ml	Item769	1	Pc
770	8.7	IA File 15/20/25	Item770	1	Pc
771	8.71	Otech	Item771	1	Pc
772	8.72	Flowable Composite Shade	Item772	1	Pc
773	8.73	Plastic Filling Instruments	Item773	1	Pc
774	8.74	Cement Spatula	Item774	1	Pc
775	8.75	Cement Condenser	Item775	1	Pc
776	8.76	Ball Burnisher (API)	Item776	1	Pc
777	8.77	Extraction Forcept for Pedo (set of 16)	Item777	1	Pc
778	8.78	Tweezer	Item778	1	Pc
779	8.79	Diamond Round Bur	Item779	1	Pc
780	8.8	Diamond Straight Fissure Bur	Item780	1	Pc
781	8.81	Diamond Cone Shape Bur	Item781	1	Pc
782	8.82	Contra Angle Hand Piece	Item782	1	Pc
783	8.83	Paper point (15-40 & 45-80)	Item783	1	Pc
784	8.84	Flamed Shaped Diamond Bur (All Sizes)	Item784	1	Pc
785	8.85	Spoon Excavator	Item785	1	Pc
786	8.86	Cold Mold Seal	Item786	1	Pc
787	8.87	Pain Off	Item787	1	Pc
788	8.88	Shade Guide	Item788	1	Pc
789	8.89	Coe- Pack	Item789	1	Pc
790	8.9	Apexit Plus	Item790	1	Pc
791	8.91	Fibre Post (yellow, red , blue)	Item791	1	Pc
792	8.92	Gingival Retraction Cord	Item792	1	Pc
793	8.93	Spreader /Plugger (all sizes)	Item793	1	Pc
794	8.94	Disposable Napkin	Item794	1	Pc
795	8.95	Crown Cutting Kit	Item795	1	Pc
796	8.96	Elevators (straight and periostal)	Item796	1	Pc
797	8.97	Extraction Forcept for pedo adult (set of 14)	Item797	1	Pc
798	8.98	G-coat Plus	Item798	1	Pc
799	8.99	Protemp with tips and gun	Item799	1	Pc
800	9	GIC Type IX	Item800	1	Pc
801	9.01	Durable Flouride Releasing Coating	Item801	1	Pc
802	9.02	Light Curing nano ionomer restorative	Item802	1	Pc
803	9.03	Remin pro (protective dental cream)	Item803	1	Pc
804	9.04	Chair Bulbs (ocero Infinity)	Item804	1	Pc
805	9.05	Cold cure (pink) powder	Item805	1	Pc
806	9.06	Cold cure (White) powder	Item806	1	Pc
807	9.07	Cold Cure Liquid	Item807	1	Pc
808	9.08	Green Sticks	Item808	1	Pc
809	9.09	Mercury	Item809	1	Pc
810	9.1	Disposable Patient Apron	Item810	1	Pc
811	9.11	Bobe Cutter	Item811	1	Pc
812	9.12	Bobe ronger	Item812	1	Pc
813	9.13	Bone file	Item813	1	Pc
814	9.14	Mought Prod Chain	Item814	1	Pc
815	9.15	Macet/Hammer	Item815	1	Pc
816	9.16	Amalgam Condenser	Item816	1	Pc
817	9.17	Amalgam carrier	Item817	1	Pc
818	9.18	Amalgam Curver	Item818	1	Pc
819	9.19	Wax Knife	Item819	1	Pc
820	9.2	Wire Cutter	Item820	1	Pc
821	9.21	Plier	Item821	1	Pc
822	9.22	Rubber dam Kit	Item822	1	Pc
823	9.23	Crown remover	Item823	1	Pc
824	9.24	Micromotor drill bits	Item824	1	Pc
825	9.25	Compo Roller	Item825	1	Pc
826	9.26	GP Holder	Item826	1	Pc
827	9.27	Surgical Micromotor	Item827	1	Pc
828	9.28	Periodontal Probe	Item828	1	Pc
829	9.29	Acrylic Mixing Jar	Item829	1	Pc
830	9.3	Air Polisher	Item830	1	Pc
831	9.31	S.S. Inter maxillary fixation Screws 2.0mm - 12-14mm	Item831	1	Pc
832	9.32	S.S. Inter maxillary fixation Screws 2.5mm - 12-14 mm	Item832	1	Pc
833	9.33	Titanium cranial microplates (0.5mm plate thickness)10-18hole straight	Item833	1	Pc
834	9.34	Titanium mandible miniplates (1mm plate thickness) 4 hole with bar/gap	Item834	1	Pc
835	9.35	Titanium mandible miniplates (1mm plate thickness) 10-12hole straight	Item835	1	Pc
836	9.36	Titanium midfacial miniplates (0.5-0.6mm plate thickness) L plate 90 degree long 4 hole with bar/gap Right side	Item836	1	Pc
837	9.37	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 90 degree Long 4 hole with bar/gap left side.	Item837	1	Pc
838	9.38	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree short 4 hole with bar/gap Right side	Item838	1	Pc
839	9.39	Titanum Mid Facial Miniplates (0.5-0.6mm plates thickness) L plate 100-110 degree short 4 hole with bar/ gap Left side	Item839	1	Pc
840	9.4	Titannium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree long 4 hole with bar/gap Right side	Item840	1	Pc
841	9.41	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree Long 4 hole With bar/gap Left side	Item841	1	Pc
842	9.42	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 4 hole With bar/gap	Item842	1	Pc
843	9.43	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 6 hole with bar/gap .	Item843	1	Pc
844	9.44	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 10 hole	Item844	1	Pc
845	9.45	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) T Plates 5 holes	Item845	1	Pc
846	9.46	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Y plate 4 holes	Item846	1	Pc
847	9.47	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Double Y plate 4 holes	Item847	1	Pc
848	9.48	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) X plate 5 holes	Item848	1	Pc
849	9.49	Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Straight plate 10-12 holes	Item849	1	Pc
850	9.5	Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 12-16 holes	Item850	1	Pc
851	9.51	Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 20-25 holes	Item851	1	Pc
852	9.52	Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 12-16 holes	Item852	1	Pc
853	9.53	Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 20-25 holes	Item853	1	Pc
854	9.54	Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 12-16 holes	Item854	1	Pc
855	9.55	Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 20-25 holes	Item855	1	Pc
856	9.56	Titanium double angled Reconstruction plates (2-2.4mm plate thickness) 20-25 holes	Item856	1	Pc
857	9.57	Titanium Cranial ( outer diameter 1.0-1.2 mm) non self drilling screw- 4-6 mm length	Item857	1	Pc
858	9.58	Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -6mm length	Item858	1	Pc
859	9.59	Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -8 mm length	Item859	1	Pc
860	9.6	Titanium midfacial (outer diameter 1.8/1.9mm) non self- drilling emergency screw -6 mm length	Item860	1	Pc
861	9.61	Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -6mm length	Item861	1	Pc
862	9.62	Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -8mm length	Item862	1	Pc
863	9.63	Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -6mm length	Item863	1	Pc
864	9.64	Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -8 mm length	Item864	1	Pc
865	9.65	Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling screw -10mm length	Item865	1	Pc
866	9.66	Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling Maxi screw -12mm length	Item866	1	Pc
867	9.67	Titanium Reconstruction (2.4mm) non self- drilling Maxi Emergency screw -8-20mm length	Item867	1	Pc
868	9.68	Titanium Lag Screws non self drilling ( outer diameter 2.4/2.5 mm)- 15-20mm length	Item868	1	Pc
869	9.69	Drill bit with 6mm stop for Titanium cranial (1.0/1.2mm,1.0 mm pilot hole diameter) non self- drilling screw	Item869	1	Pc
870	9.7	Drill bit with 6mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw	Item870	1	Pc
871	9.71	Drill bit with 8mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw	Item871	1	Pc
872	9.72	Drill bit with 6mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw	Item872	1	Pc
873	9.73	Drill bit with 8mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw	Item873	1	Pc
874	9.74	Drill bit with 10-12mm stop for Titanium (2.4mm reconstruction, pilot hole diameter 2mm) non self-drilling screw	Item874	1	Pc
875	9.75	Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 4x4 cms	Item875	1	Pc
876	9.76	Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 6x6 cms	Item876	1	Pc
877	9.77	Titanium Mesh for mandible (0.5-0.6mm thickness) approx. dimension 10x8 cms	Item877	1	Pc
878	9.78	Titanium orbital reconstruction mesh plates- Small	Item878	1	Pc
879	9.79	Titanium orbital reconstruction mesh plates- Medium	Item879	1	Pc
880	9.8	Titanium orbital reconstruction mesh plates- Large ( with medial and lateral wall extensions)	Item880	1	Pc
881	9.81	Porous Polyethylene Orbital sheets ( 0.8-1.5 mm thickness; 5x5 cms approx)	Item881	1	Pc
882	9.82	26 guage Stainless Steel wire spool	Item882	1	Pc
883	9.83	32 guage Stainless Steel wire spool	Item883	1	Pc
884	9.84	Raney Clips Stainless Steel	Item884	1	Pc
885	9.85	022 slot MBT Brackets with weldable convertible UTLD first molar Buccal tubes and NC II molar tubes	Item885	1	Pc
886	9.86	Crimpable hooks	Item886	1	Pc
887	9.87	016 Multistranded SS wire	Item887	1	Pc
888	9.88	Preformed Archwire - 014 NiTi U/ L	Item888	1	Pc
889	9.89	Preformed Archwire - 016 NiTi U/ L	Item889	1	Pc
890	9.9	Preformed Archwire - 016 x 022 SS – U/L	Item890	1	Pc
891	9.91	Preformed Archwire - 017 x 025 SS– U /L	Item891	1	Pc
892	9.92	Preformed Archwire - 019 x 025 SS – U / L	Item892	1	Pc
893	9.93	Orthodontic stone	Item893	1	Pc
894	9.94	Dunaform – soft and hard sheets- 2mm, 3mm	Item894	1	Pc
895	9.95	Dental Surgery	Item895	1	Pc
896	9.96	Mouth Mirror with Handle	Item896	1	Pc
897	9.97	Mouth mirror	Item897	1	Pc
898	9.98	Dental probe	Item898	1	Pc
899	9.99	Periodontal probe	Item899	1	Pc
900	10	Dental Explorer ( Curved and pigtail)	Item900	1	Pc
901	10.01	Glass Bead Sterilizer	Item901	1	Pc
902	10.02	Airotor handpiece - Mini-head (2 years warranty)	Item902	1	Pc
903	10.03	Medesy/Hu Friedy Maxillary Anterior Extraction forceps	Item903	1	Pc
904	10.04	Medesy/Hu Friedy Maxillary Reed's Extraction forceps	Item904	1	Pc
905	10.05	Medesy/Hu Friedy Maxillary Premolar Extraction forceps	Item905	1	Pc
906	10.06	Medesy/Hu Friedy Maxillary Molar Extraction forceps Right/Left	Item906	1	Pc
907	10.07	Medesy/Hu Friedy Maxillary Bayonet Extraction forceps	Item907	1	Pc
908	10.08	Medesy/Hu Friedy MaxillaryThird molar Extraction forceps	Item908	1	Pc
909	10.09	Medesy/Hu Friedy Mandibular Anterior Extraction forceps	Item909	1	Pc
910	10.1	Medesy/Hu Friedy Mandibular premolar Extraction forceps	Item910	1	Pc
911	10.11	Medesy/Hu Friedy Mandibular molar Extraction forceps	Item911	1	Pc
912	10.12	Medesy/Hu Friedy Warwick James Elevator-Straight	Item912	1	Pc
913	10.13	Medesy/Hu FriedyWarwick James Elevator-Right/Left	Item913	1	Pc
914	10.14	Medesy/Hu FriedyCryer's Elevator-Small size- Right/Left	Item914	1	Pc
915	10.15	Medesy/Hu FriedyCryer's Elevator-Medium size- Right/Left	Item915	1	Pc
916	10.16	Medesy/Hu FriedyCryer's Elevator- Large Size-Right/left	Item916	1	Pc
917	10.17	Double angled Currette- Medium size	Item917	1	Pc
918	10.18	Double angled Currette- Large size	Item918	1	Pc
919	10.19	Molt's Perisoteal Elevator	Item919	1	Pc
920	10.2	Freer Periosteal Elevator	Item920	1	Pc
921	10.21	Walsham's nasal Forceps- Pair	Item921	1	Pc
922	10.22	Asche Septal Forceps	Item922	1	Pc
923	10.23	Hayton's Williams maxillary forceps	Item923	1	Pc
924	10.24	Rowe's zygomatic elevator	Item924	1	Pc
925	10.25	Sigmoid Notch retractor (Left/Right)	Item925	1	Pc
926	10.26	Ramal Retractor	Item926	1	Pc
927	10.27	wire cutter	Item927	1	Pc
928	10.28	wire twister	Item928	1	Pc
929	10.29	Coronoid retractor	Item929	1	Pc
930	10.3	Mastoid self retaining retractor	Item930	1	Pc
931	10.31	Mandibular Lower Border retractor	Item931	1	Pc
932	10.32	Condylar retractor	Item932	1	Pc
933	10.33	Dingmann retractor ( Adult)	Item933	1	Pc
934	10.34	Vestibular retractor	Item934	1	Pc
935	10.35	Swallow Tail retractor	Item935	1	Pc
936	10.36	Curved Pterygoid osteotome 8mm	Item936	1	Pc
937	10.37	Curved Pterygoid osteotome 10mm	Item937	1	Pc
938	10.38	Epker Osteotome 4mm/6mm/8mm Curved	Item938	1	Pc
939	10.39	Epker Osteotome 4mm/6mm/8mm Straight with marking	Item939	1	Pc
940	10.4	Orthodontic model boxes	Item940	1	Pc
941	10.41	Tongue Guard - Medium	Item941	1	Pc
942	10.42	Dontrix gauge	Item942	1	Pc
943	10.43	Extraoral Force gauge	Item943	1	Pc
944	10.44	Orthodontic Typodont set ( With wax ridges and teeth set )	Item944	1	Pc
945	10.45	Plaster Vibrator (Worktop area of at least 20 X 10 cm, adjustable setting, 2 years warranty)	Item945	1	Pc
946	10.46	Haematoxylin & Eosin Stain	Item946	1	Pc
947	10.47	Eosin & Negrosin stain	Item947	1	Pc
948	10.48	V.G. Tube	Item948	1	Pc
949	10.49	Manipulation Pipette	Item949	1	Pc
950	10.5	Metallic TVS Needle Guided Bracket	Item950	1	Pc
951	10.51	Syringe Non Rubber 1ml	Item951	1	Pc
952	10.52	Granulocyte colony stimulating factor	Item952	1	Pc
953	10.53	Pipelle Aspirator/Vabra Aspirator	Item953	1	Pc
954	10.54	Progesterone gel	Item954	1	Pc
955	10.55	Injectable Progesterone	Item955	1	Pc
956	10.56	Latex Condom without spermicide	Item956	1	Pc
957	10.57	Osafe Incubator and Laminar Floor Cleaning Lotion	Item957	1	Pc
958	10.58	Fersafe Antiseptic Lotion	Item958	1	Pc
959	10.59	Liquid Nitrogen for Cryocan	Item959	1	Pc
960	10.6	Immunobeads Reagents( Rabbit Anti Human IgG	Item960	1	Pc
961	10.61	Immunobeads Reagents( Rabbit Anti Human IgA	Item961	1	Pc
962	10.62	Immunobeads Reagents( Rabbit Anti Human IgM	Item962	1	Pc
963	10.63	Conical Dispo Beaker 3.0ml	Item963	1	Pc
964	10.64	PRP Lens	Item964	1	Each
965	10.65	FAC's Tube (12 x 75mm, 5ml Round Bottom Test Tube, snap, sterile Cat: 352054	Item965	1	Each
966	10.66	Kymograph Paper (100 sheets)	Item966	1	Each
967	10.67	Perimetric Chart Paper (100 sheets)	Item967	1	Each
968	10.68	Haemocytometer Box	Item968	1	Each
969	10.69	Haemoglobinometer sets	Item969	1	Each
970	10.7	Dewar Tank 11 litre	Item970	1	Each
971	10.71	CRYO PRO - 500ml (Liquid Nitrogen Cryosurgical Equipment	Item971	1	Each
972	10.72	Bulb for Telepack Lamp	Item972	1	Each
973	10.73	Radiofrequency Electrode Round Loop Big	Item973	1	Each
974	10.74	Radiofrequency Electrode Round Loop Small	Item974	1	Each
975	10.75	Bacterial Filter Machine sl No:101122008	Item975	1	Each
976	10.76	Indirect Ophthalmoscope	Item976	1	Each
977	10.77	20448-000Hgh Pressure Hose(Erbe Cryo Unit))	Item977	1	Each
978	10.78	Bone hand Drill Moore - 8448.28	Item978	1	Each
979	10.79	Hand Drill Jacobs Chuck	Item979	1	Each
980	10.8	Demartel Condf/Wire Sawsflex 350mm	Item980	1	Each
981	10.81	Twist Drill Set of 3mm, 3.5mm 4mm, 4.5mm	Item981	1	Each
982	10.82	Crocodile Forceps (Ear Microsurgery)	Item982	1	Each
983	10.83	Ear Microsuction Tips	Item983	1	Each
984	10.84	Adaptors for Ear Microsuction Tips	Item984	1	Each
985	10.85	Cup Ear Forceps	Item985	1	Each
986	10.86	Perforators for Stopedectomy 0.4mm	Item986	1	Each
987	10.87	Perforators for Stopedectomy 0.5mm	Item987	1	Each
988	10.88	Rigid Pharyngoscope (pediatric) 20cm	Item988	1	Each
989	10.89	Tonsil Holding Forceps	Item989	1	Each
990	10.9	Straight Pick (Tympanyplasty)	Item990	1	Each
991	10.91	Back Biting Forceps for Endoscope Nasal Surgery	Item991	1	Each
992	10.92	Fiberoptic Otoscope with Pneumatic Pump	Item992	1	Each
993	10.93	Bismith lodopyrrophosphate (BIPP) Paste/Powder	Item993	1	Each
994	10.94	Mercurochrome Lotion	Item994	1	Each
995	10.95	Haed Light fot ENT	Item995	1	Each
996	10.96	Endoscopic Biopsy Forceps with Needle	Item996	1	Each
997	10.97	CPR Manikin	Item997	1	Each
998	10.98	Intubation Manikin	Item998	1	Each
999	10.99	Easy Pump	Item999	1	Each
1000	11	MRI Contrast Media - Gadoterate Meglumine Injection 5mmmol /ml. 10 ml vial	Item1000	1	vial
1001	11.01	MRI Contrast Media - Gadobenate Dimeglumine Injection 10ml vial	Item1001	1	vial
1002	11.02	MRI Contrast Media - Gadopentetate Dimeglumine Injection 0.5mmol/ml. 10 ml vial	Item1002	1	vial
1003	11.03	MRI Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5ml	Item1003	1	vial
1004	11.04	Non -Ionic Contrast Media - Iopromide Injection: USP 370mg - 50 ml vial	Item1004	1	vial
1005	11.05	Non -Ionic Contrast Media - Iopromide Injection: USP 370mg -100ml vial	Item1005	1	vial
1006	11.06	Non -Ionic Contrast Media - Iopromide Injection: USP 300mg -100ml vial	Item1006	1	vial
1007	11.07	Non -Ionic Contrast Media -Iobitridol 350mg -100ml vial	Item1007	1	vial
1008	11.08	Non -Ionic Contrast Media -Iomeprol Injection 300mg -50ml vial	Item1008	1	vial
1009	11.09	Non -Ionic Contrast Media -Iomeprol Injection 300mg -100ml vial	Item1009	1	vial
1010	11.1	Non -Ionic Contrast Media -Iomeprol Injection 350mg -50ml vial	Item1010	1	vial
1011	11.11	Non -Ionic Contrast Media -Iomeprol Injection 350mg -100ml vial	Item1011	1	vial
1012	11.12	Non -Ionic Contrast Media -Iomeprol Injection 400mg -50ml vial	Item1012	1	vial
1013	11.13	Non -Ionic Contrast Media -Iomeprol Injection 400mg -100ml vial	Item1013	1	vial
1014	11.14	Non -Ionic Contrast Media -Iopamidol Injection 370mg -50ml vial	Item1014	1	vial
1015	11.15	Non -Ionic Contrast Media -Iopamidol Injection 370mg -100ml vial	Item1015	1	vial
1016	11.16	Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20ml vial	Item1016	1	vial
1017	11.17	Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50ml vial	Item1017	1	vial
1018	11.18	Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100ml vial	Item1018	1	vial
1019	11.19	COUPLAND ALL NOS	Item1019	1	vial
1020	11.2	ELEVATORS (CRYER) 1 PAIRS	Item1020	1	vial
1021	11.21	CASTROVEJO SCISSOR	Item1021	1	vial
1022	11.22	SAMLL MICRO SCISSOR	Item1022	1	vial
1023	11.23	LIGHT CURE COMPOSITE A2	Item1023	1	vial
1024	11.24	LIGHT CURE COMPOSITE A3	Item1024	1	vial
1025	11.25	LIGHT CURE COMPOSITE A3.5	Item1025	1	vial
1026	11.26	H-FILES FOR SIZE (15-40) 21MM	Item1026	1	vial
1027	11.27	TOOTH POLISHING BRUSH	Item1027	1	vial
1028	11.28	GLIDE	Item1028	1	vial
1029	11.29	GRACY CURRETTE	Item1029	1	vial
1030	11.3	Polyester braided suture * 2 75cm HGS-21, Blue 37mm 1/2 circle Taper Point : size-2	Item1030	1	pc
1031	11.31	Polyester braided suture * 2 75cm HOS-10, Blue 26mm 1/2 circle Reserve Cutting : size-2	Item1031	1	pc
1032	11.32	Polyester braided suture * 1 75cm HOS 12, Blue 40mm 1/2 Circle Reserve Cutting size -1	Item1032	1	pc
1033	11.33	Polyester braided suture * 5 75cm HOS-14, Blue 57mm 1/2 Circle Reverse Cutting size-5	Item1033	1	pc
1034	11.34	Polyester braided suture * 25x75cm KV-37, Blue 40mm 1/2 Circle Tapercutting size-2	Item1034	1	pc
1035	11.35	Poleyster braided suture * 54x75cm KV-40, Blue 45mm 1/2 Circle Tapercutting size-5	Item1035	1	pc
1036	11.36	Monofilament Knotless Polyglyconate wound closure device, 0 45cm GS-21, Green 37mm 1/2 Circle Taper Point, box of 12 foils size-0	Item1036	1	pc
1037	11.37	Monofilament Knotless Polyglyconate wound closure device, 2-0 30cm cm V-20, Green 26mm 1/2 Circle Taper Point, box of 12 foils size-2-0	Item1037	1	pc
1038	11.38	Monofilament Knotless Glycomer 631 wound closure device, 3-0 45cm P-14, UNDYED 24mm 3/8 Circle Resverse Cutting, box of 12 foils size- 3-0	Item1038	1	pc
1039	11.39	Polybutester monofilament suture with polytribolate coating size-*6-0 60cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0	Item1039	1	pc
1040	11.4	Polybutester monofilament suture with polytribolate coating size-*6-0 75cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0	Item1040	1	pc
1041	11.41	Polybutester monifilament suture with polytribolate coating Size-*5-0, 75cm 2XCV-11X36, Blue 12mm 3/8 Circle Taper Point	Item1041	1	pc
1042	11.42	Polybutester monofilament suture with polytribolate coating Size-*4-0 90cm 2XCV-23X36, Blue 17mm 1/2Circle Taper Point size: 4-0	Item1042	1	pc
1043	11.43	Polybutester monofilament suture with polytribulate coating Size-*5-0 90cm2XCV, Blue 17mm 1/2 Circle Taper Point size: 5-0	Item1043	1	pc
1044	11.44	Polybutester moniofilament suture with polytribulate coating Size-*5-0, 75cm 2XKV-11X36, Blue 13mm 3/8 Circle Tapercutting size: 5-0	Item1044	1	pc
1045	11.45	Polybutester monofilament suture with polytribolate coating Size-* 7-0, 60cm 2XMV-175-8, Blue 8mm 3/8 Circle Taper Point size: 7-0	Item1045	1	pc
1046	11.46	Polybutester monofilament suture with polytribolate coating Size-*2-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point	Item1046	1	pc
1047	11.47	Polybutester monofilament suture with polytribolate coating Size-*3-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point	Item1047	1	pc
1048	11.48	Monofilament Knotless Glycomer 631 wound closure device, 2-0 23cm , VIOLET 27mm 1/2 Circle Taper Point, box of 12 foils size- 2-0	Item1048	1	pc
1049	11.49	Vaccutrend Needle/Syringe 21\" x 15\"	Item1049	1	Each
1050	11.5	Vaccutrend Needle/Syringe 22\" x 15\"	Item1050	1	Each
1051	11.51	Vaccutrent Needle /Syringe	Item1051	1	Each
1052	11.52	Immunohistochemistry:	Item1052	1	Each
1053	11.53	Anti Pax-5 FFPE	Item1053	1	per ml
1054	11.54	Anti EBV FFPE	Item1054	1	per ml
1055	11.55	Anti Pan CMV FFPE	Item1055	1	per ml
1056	11.56	Anti CD 68 FFPE	Item1056	1	per ml
1057	11.57	Anti WTI FFPE	Item1057	1	per ml
1058	11.58	Anti PLAP FFPE	Item1058	1	per ml
1059	11.59	Anti C3 FFPE	Item1059	1	per ml
1060	11.6	Anti SMA FFPE	Item1060	1	per ml
1061	11.61	Anti AR FFPE	Item1061	1	per ml
1062	11.62	Anti BC16 FFPE	Item1062	1	per ml
1063	11.63	Anti Myogenin FFPE	Item1063	1	per ml
1064	11.64	Anti IDH-1 FFPE	Item1064	1	per ml
1065	11.65	Anti ATRX FFPE	Item1065	1	per ml
1066	11.66	Anti P63 FFPE	Item1066	1	per ml
1067	11.67	Anti Neurofilament FFPE	Item1067	1	per ml
1068	11.68	Anti CD 19 FFPE	Item1068	1	per ml
1069	11.69	Anti MSA FFPE	Item1069	1	per ml
1070	11.7	Anti Adipophylin FFPE	Item1070	1	per ml
1071	11.71	Anti ALK D5F3 FFPE	Item1071	1	per ml
1072	11.72	Anti Arginase-1 FFPE	Item1072	1	per ml
1073	11.73	Anti B Catenin	Item1073	1	per ml
1074	11.74	Bcl 10 FFPE	Item1074	1	per ml
1075	11.75	Anti BER-EP4 FFPE	Item1075	1	per ml
1076	11.76	Anti Clauclin 4 FFPE	Item1076	1	per ml
1077	11.77	Anti D2 - 40 Podolanin FFPE	Item1077	1	per ml
1078	11.78	Anti DOG 1 FFPE	Item1078	1	per ml
1079	11.79	Anti SALL 4 FFPE	Item1079	1	per ml
1080	11.8	Anti ERG FFPE	Item1080	1	per ml
1081	11.81	Anti HBMEIgG4	Item1081	1	per ml
1082	11.82	Anti Inhilein FFPE	Item1082	1	per ml
1083	11.83	Anti INSM 1 FFPE	Item1083	1	per ml
1084	11.84	Anti Mammaglobin FFPE	Item1084	1	per ml
1085	11.85	MART 1 FFPE	Item1085	1	per ml
1086	11.86	Anti Melan A FFPE	Item1086	1	per ml
1087	11.87	Anti MDM2 FFPE	Item1087	1	per ml
1088	11.88	Anti Napsin A FFPE	Item1088	1	per ml
1089	11.89	Anti P40 FFPE	Item1089	1	per ml
1090	11.9	Anti PAX-8 FFPE	Item1090	1	per ml
1091	11.91	Anti STAT-6 FFPE	Item1091	1	per ml
1092	11.92	Anti TLE-1 FFPE	Item1092	1	per ml
1093	11.93	Anti Uroplalcin-2 FFPE	Item1093	1	per ml
1094	11.94	Anti Glycophorin FFPE	Item1094	1	per ml
1095	11.95	Anti GCET-1 FFPE	Item1095	1	per ml
1096	11.96	Anti CD 38/138 FFPE	Item1096	1	per ml
1097	11.97	Anti Calcitonin FFPE	Item1097	1	per ml
1098	11.98	Anti Caldermon FFPE	Item1098	1	per ml
1099	11.99	Anti B Caldermon FFPE	Item1099	1	per ml
1100	12	Anti CD 56 FFPE	Item1100	1	per ml
1101	12.01	Anti NSM FFPE	Item1101	1	per ml
1102	12.02	Anti CD 99 MIC-2 , 013 FFPE	Item1102	1	per ml
1103	12.03	Anti CD 138 FFPE	Item1103	1	per ml
1104	12.04	Anti CDH 17 Cadherin 17 FFPE	Item1104	1	per ml
1105	12.05	Anti HeparII FFPE	Item1105	1	per ml
1106	12.06	Anti Glypican-3 FFPE	Item1106	1	per ml
1107	12.07	Anti STAB 2 FFPE	Item1107	1	per ml
1108	12.08	Anti HRP Polymer Kit	Item1108	1	per ml
1109	12.09	FITC Lambda light chain Immunofluorescence	Item1109	1	per ml
1110	12.1	FITC IgM Immunofluorescence	Item1110	1	per ml
1111	12.11	FITC IgA Immunofluorescence	Item1111	1	per ml
1112	12.12	FITC IgG Immunofluorescence	Item1112	1	per ml
1113	12.13	FITC C3 Immunofluorescence	Item1113	1	per ml
1114	12.14	MLH1, MSH2, MSH6, PMS2 (Together)	Item1114	1	per ml
1115	12.15	PDL1 Clone SP142	Item1115	1	per ml
1116	12.16	EGFR Clone 31G7	Item1116	1	per ml
1117	12.17	CDX2	Item1117	1	per ml
1118	12.18	GATA 3	Item1118	1	per ml
1119	12.19	CK 18	Item1119	1	per ml
1120	12.2	Mesothelin	Item1120	1	per ml
1121	12.21	Glut 1	Item1121	1	per ml
1122	12.22	GCDFP	Item1122	1	per ml
1123	12.23	MYB	Item1123	1	per ml
1124	12.24	PLAG 1	Item1124	1	per ml
1125	12.25	HMGA 2	Item1125	1	per ml
1126	12.26	EBER in-situ Hybridization	Item1126	1	Kit
1127	12.27	PCR	Item1127	1	Each
1128	12.28	EGFR RT PCR Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue	Item1128	1	Kit
1129	12.29	MSI detection Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue	Item1129	1	Kit
1130	12.3	BCR-Abl1-PCR Kit compatible With Qiagen	Item1130	1	Kit
1131	12.31	FISH	Item1131	1	Each
1132	12.32	ALK mutation break apart probe in lung adenocarcinoma	Item1132	1	Kit
1133	12.33	MYB-NFIB dual colour fusion probe	Item1133	1	Kit
1134	12.34	MYB dual colour break apart probe	Item1134	1	Kit
1135	12.35	MAML2 dual colour break apart probe	Item1135	1	Kit
1136	12.36	ETV6 dual colour break apart rearrangement probe	Item1136	1	Kit
1137	12.37	PLAG 1 rearrangement probe	Item1137	1	Kit
1138	12.38	HMGA 2 rearrangement probe	Item1138	1	Kit
1139	12.39	Immunofluorescence	Item1139	1	Each
1140	12.4	Anti p-ANCA direct Immunofluorescence	Item1140	1	Kit
1141	12.41	Anti c-ANCA direct Immunofluorescence	Item1141	1	Kit
1142	12.42	Anti ANA direct Immunofluorescence	Item1142	1	Kit
1143	12.43	Anti Aquaporin 4	Item1143	1	Kit
1144	12.44	C1q	Item1144	1	Kit
1145	12.45	Flowcytometry	Item1145	1	Each
1146	12.46	CD 16 APC	Item1146	1	Kit
1147	12.47	HLA B27 Kit (should be compatible with BD Facscalibur)	Item1147	1	Kit
1148	12.48	Elisa (MAGO-4)	Item1148	1	Each
1149	12.49	Anti P-ANCA Elisa	Item1149	1	Sets
1150	12.5	Anti c-ANCA Elisa	Item1150	1	Sets
1151	12.51	Anti Cyclic Citrulinated peptide (CCP) Elisa	Item1151	1	Sets
1152	12.52	Anti Smith Elisa	Item1152	1	Sets
1153	12.53	Anti Peroxiredoxin VI (Prx VI) Elisa	Item1153	1	Sets
1154	12.54	Anti Bmi I Elisa	Item1154	1	Sets
1155	12.55	Anti Matrix Metalloproteinase 7 (MMP7) Elisa	Item1155	1	Sets
1156	12.56	Anti NY ESO I	Item1156	1	Sets
1157	12.57	Anti Scl 70	Item1157	1	Sets
1158	12.58	Anti URNP	Item1158	1	Sets
1159	12.59	Chemicals and Consumables	Item1159	1	Each
1160	12.6	Proteinase K	Item1160	1	Sets
1161	12.61	Pronase	Item1161	1	Sets
1162	12.62	FISH Reagents :	Item1162	1	Each
1163	12.63	Poly L Lysine	Item1163	1	ml
1164	12.64	20X Saline Sodium Citrate (20X SSC) Salt, Molecular Grade	Item1164	1	gm
1165	12.65	1 M NaSCN ( 1M Sodium Thiocyanate) Salt, Molecular Grade	Item1165	1	gm
1166	12.66	IGEPAL @ CA 630	Item1166	1	gm
1167	12.67	Rubber Cement	Item1167	1	tube
1168	12.68	DAPI	Item1168	1	ml
1169	12.69	Sodium Chloride (NaCL), 58.44g mol-1 Molecular Grade	Item1169	1	gm
1170	12.7	Sodium Citrate (Na3C6H5O7) 258.06g mol-1 Molecular Grade	Item1170	1	gm
1171	12.71	Fluorescence microscopic immersion oil	Item1171	1	ml
1172	12.72	Immunofluorescence Reagents :	Item1172	1	Each
1173	12.73	Trypsin Powder,Molecular Grade	Item1173	1	gm
1174	12.74	Additional Consumables / Disposables	Item1174	1	Each
1175	12.75	15mm double swivel with port & extension	Item1175	1	Each
1176	12.76	72 hours CLOSED VENTILATION SUCTION CATHETER Must have double - lumen siliconised catheter Swivel connector un-coupling wedge, Lockable thumb –Valve end Cap, Softer Sleeve material, 72 hour recommended during of use. Size: 12F, 14F, 16F	Item1176	1	Each
1177	12.77	Adjustable circle breathing system (2 Litre bag, 2 metre length and 1.5 metre limb)	Item1177	1	Each
1178	12.78	Adjustable circle breathing system (2 mts length)	Item1178	1	Each
1179	12.79	Adult curved flared prong with tube1.8m length	Item1179	1	Each
1180	12.8	Adult curved nasal prong with tube1.8m length	Item1180	1	Each
1181	12.81	Adult Respi-Check high concentration oxygen mask with oxygen tube	Item1181	1	Each
1182	12.82	Anti-microbial circle breathing system (1.6 metre length and 0.8 metre limb)	Item1182	1	Each
1183	12.83	Anti-microbial circle breathing system (2 litre bag, 1.6 metre Length, 0.8 metre limb)	Item1183	1	Each
1184	12.84	Anti-microbial circle breathing system (2 litre bag, 2.4 metre Length, 0.8 metre limb)	Item1184	1	Each
1185	12.85	Apron Cloth (Sterile)	Item1185	1	Each
1186	12.86	Attest 1292 E Biological Indicator	Item1186	1	Each
1187	12.87	Attest Biological Indicator (for styeam) 3M	Item1187	1	Each
1188	12.88	Attest Rapid Auto Reader Incubator (For Steam) (Early result for biological test)	Item1188	1	Each
1189	12.89	Balanced Salt Solution (BSS)	Item1189	1	Each
1190	12.9	Bilbao-Dotter tube with guide wire	Item1190	1	Each
1191	12.91	BIS Electrodes	Item1191	1	Each
1192	12.92	Bone file	Item1192	1	Each
1193	12.93	Bone ronger	Item1193	1	Each
1194	12.94	BP blade with handle (no 15 & 17)	Item1194	1	Each
1195	12.95	Cardiac Troponin T kit	Item1195	1	Each
1196	12.96	Center hole towel	Item1196	1	Each
1197	12.97	COBAN Tm 4\"	Item1197	1	Each
1198	12.98	Cols light source for transillumination	Item1198	1	Each
1199	12.99	Contra angle hand piece	Item1199	1	Each
1200	13	Disposable Face Mask (Cloth)	Item1200	1	Each
1201	13.01	Disposable Head Positioning Device for the Prone Position – Made of latex- free foam with mirror for providing the clinician a clear view of face, eye & endotrachael tube plus sloted design for positioning of Endotracheal on either side of the patient face 8000HDP	Item1201	1	Each
1202	13.02	Disposable Kelly's Pad	Item1202	1	Each
1203	13.03	ECG monitoring Electrode (Solid Hydrogel)	Item1203	1	Each
1204	13.04	ECG monitoring Electrode with foam backing 2223	Item1204	1	Each
1205	13.05	ECG monitoring Electrode with foam backing Large	Item1205	1	Each
1206	13.06	Elastometric Infusion Pump for Analgesia 5ml/hour	Item1206	1	Each
1207	13.07	Elastometric Infusion Pump for Analgesia 2ml/hour Model SV2	Item1207	1	Each
1208	13.08	Elevators (Straight and Periostal)	Item1208	1	Each
1209	13.09	Emergency Cricothyrotomy Device Adult 4mm ID Children 2mm ID	Item1209	1	Each
1210	13.1	Eye wear for composite fillings	Item1210	1	Each
1211	13.11	Face guard	Item1211	1	Each
1212	13.12	Fibre splint	Item1212	1	Each
1213	13.13	Fluid Warming Cassette (Disposable) WF-250	Item1213	1	Each
1214	13.14	Fluid Warming Cassette (Disposable) WF-100	Item1214	1	Each
1215	13.15	Gigly Saw	Item1215	1	Each
1216	13.16	Glass bead sterilizer	Item1216	1	Each
1217	13.17	Tungsen Carbide Burs for Air Rotor and Micro Motor Hand Pieces	Item1217	1	Each
1218	13.18	Green PVC tubing for oxygen 6 mm, Length in metres	Item1218	1	Each
1219	13.19	Iodixannol 320 mg Iodine/ml-100 ml.	Item1219	1	Each
1220	13.2	Iohexol 300 mg-Iodine/ml 100 ml	Item1220	1	Each
1221	13.21	Iomeron 400 mg/ml – 50 ml.	Item1221	1	Each
1222	13.22	Ioversol/Iopamide/Iopamidol – 50 ml.	Item1222	1	Each
1223	13.23	ISO Green Standard Laryngoscope System (Disposable plastic blades) 7 sizes of MAC and Miller blades	Item1223	1	Each
1224	13.24	JESS fixtators pediatric/large	Item1224	1	Each
1225	13.25	Jobson's Probe	Item1225	1	Each
1226	13.26	Kinesiology Color Tap/Taping for Orthopaedic used	Item1226	1	Each
1227	13.27	Killian's Nasal Speculum	Item1227	1	Each
1228	13.28	K-Wires: 1.8mm	Item1228	1	Each
1229	13.29	K-Wires: 4mm	Item1229	1	Each
1230	13.3	K-Wires: 1.5 mm	Item1230	1	Each
1231	13.31	K-Wires: 2.5 mm	Item1231	1	Each
1232	13.32	K-Wires: 2mm	Item1232	1	Each
1233	13.33	K-Wires: 3mm	Item1233	1	Each
1234	13.34	Macintosh Style blades 2, 4	Item1234	1	Each
1235	13.35	Magill’s forceps Adult child infant	Item1235	1	Each
1236	13.36	Manual Plaster cutting saw	Item1236	1	Each
1237	13.37	Manual Plaster spreader	Item1237	1	Each
1238	13.38	Manual Torniquet (cuff & Pump)	Item1238	1	Each
1239	13.39	Mayo stand cover	Item1239	1	Each
1240	13.4	Miller style blades 0,	Item1240	1	Each
1241	13.41	Miller style blades 1	Item1241	1	Each
1242	13.42	Mortar and Pestle	Item1242	1	Each
1243	13.43	Mouth & Cheek retractor	Item1243	1	Each
1244	13.44	Mouth mirror	Item1244	1	Each
1245	13.45	MRI compatible Laryngoscopes All sizes	Item1245	1	Each
1246	13.46	MRI Film 14” x 17”	Item1246	1	Each
1247	13.47	Neopuff (Neonatal Resuscitator)	Item1247	1	Each
1248	13.48	North Nasal Preformed Cuffed TubeCuffed Must have IVORY PVC Profile Soft Seal Cuff, implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 6To 8mm ID & length 27cm to 30.5 tips to nares	Item1248	1	Each
1249	13.49	OVARIAN SHIELD (Kiran)	Item1249	1	Each
1250	13.5	Oxygen Supply Tubing for Heat & Moisture Exchanger Oxygen Supply Tubing for Heat & Moisture Exchanger with Connector to attach HME for Tracheostomy Tube Length 15cm	Item1250	1	Each
1251	13.51	Oxygen Analyser	Item1251	1	Each
1252	13.52	Oxygen Blenders	Item1252	1	Each
1253	13.53	Para film roll (size 10cmx125cm) 3 “ dia	Item1253	1	Each
1254	13.54	Parafilm, roll	Item1254	1	Each
1255	13.55	Perineural catheter for continuous plexus and peripheral nerve blocks. Content: 118 G lacoplex needle with centimeter graduation 1 perinueral Pebax catheter (0.45 x 0.85mm – 50cm long) with centimeter distance markings and open distal tip 1 0.22 antibacterial filter 1 additional extension tube, 50cm long, 1.5 x 2.5 mm dia, priming volume 1.10ml 1 10ml syringe for the aspiration test 1 10 x 15 cm Dermafilm transparent adhesive dressing	Item1255	1	Each
1256	13.56	Periostal elevators (small and big)	Item1256	1	Each
1257	13.57	Winged infusion set- Non coring needles with injection site to access ports,20G X 1.00(needle)	Item1257	1	Each
1258	13.58	Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-7fr,65cm length(Ped)	Item1258	1	Each
1259	13.59	Hickman-Broviac 4.2Fr(or smaller) single lumen pediatric cath w STIC PAPAIS	Item1259	1	Each
1260	13.6	Hickman-Broviac 6.6Fr single lumen pediatric cath w STIC 90cm	Item1260	1	Each
1261	13.61	Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-9fr,90cm length(Adult)	Item1261	1	Each
1262	13.62	Plaster Cutter Electric	Item1262	1	Each
1263	13.63	Plaster saw	Item1263	1	Each
1264	13.64	Plier long nose	Item1264	1	Each
1265	13.65	Pneumatic Compression Stocking	Item1265	1	Each
1266	13.66	Portable Autoclave Electrically Operated Made of Aluminium size:300mm x 300mm capacity 24 litres	Item1266	1	Each
1267	13.67	Portable Autoclave Electrically Operated Made of Aluminium size:350mm x 300mm-325mm Depth: 1.5 Kw	Item1267	1	Each
1268	13.68	Pyridin	Item1268	1	Each
1269	13.69	Reusable Pressure Monitoring cable With integrity check system by 100mmhg pressure and with reusable modular clamp	Item1269	1	Each
1270	13.7	Reusable Pressure Transducer With integrity check system by 100mmhg pressure, with microchip technology, Reusable cable, and with reusable clamp	Item1270	1	Each
1271	13.71	Ronguers(down cutter)	Item1271	1	Each
1272	13.72	Ronguers(up cutter)	Item1272	1	Each
1273	13.73	Rubber Macintosh	Item1273	1	Each
1274	13.74	Russian Forceps	Item1274	1	Each
1275	13.75	Light Weight Hernia Mesh,PGA Polypropylene 11 x 15	Item1275	1	Each
1276	13.76	Light Weight Hernia Mesh,PGA Polypropylene 6 x 11	Item1276	1	Each
1277	13.77	Seldinger technique catheter for arterial puncture Content: 1 Transparent and XPO cathter (PE) /(PTFE) 1 Intruducer needle 1 straight wire 115.092 115.094 115.118 5118.702 5118.703	Item1277	1	Each
1278	13.78	Self Holding retractors for Spine surgery	Item1278	1	Each
1279	13.79	Single Use Resuscitation Mask for CPCR (Non-return valve, Integral Bacterial/Viral filter)	Item1279	1	Each
1280	13.8	Slide Mailer 1 slide	Item1280	1	Each
1281	13.81	Slide Mailer 2 slide	Item1281	1	Each
1282	13.82	Soap Dispenser	Item1282	1	Each
1283	13.83	Soda Lime (Imported) – changes from White to Violet on exhaustion 5kg	Item1283	1	Each
1284	13.84	Sodium hypochloride solution 5Litre	Item1284	1	Each
1285	13.85	Spreader /Plugger	Item1285	1	Each
1286	13.86	Steinman pins:4.5mm	Item1286	1	Each
1287	13.87	Steinmann Pins	Item1287	1	Each
1288	13.88	Sterigage Chemical Indicator (for Steam) 3M	Item1288	1	Each
1289	13.89	Surgical Clipper	Item1289	1	Each
1290	13.9	Surgical Preparation Razor	Item1290	1	Each
1291	13.91	Thermal Videographic Printer (Black & White) (Sony, Latest UP series)	Item1291	1	Each
1292	13.92	Tissue paper for Ultrasound	Item1292	1	Each
1293	13.93	Ultra violet cabinet (800/500 x 2000 mm)	Item1293	1	Each
1294	13.94	Vacuum assisted dressing system	Item1294	1	Each
1295	13.95	Vascular Debeky Angle (Medium)	Item1295	1	Each
1296	13.96	Vascular Debeky Straight (Medium)	Item1296	1	Each
1297	13.97	Vaseline gauze	Item1297	1	Each
1298	13.98	Ventilator 15 mm breathing systems (with luer lock, 1.6 metre length and resealable water trap) for Paediatrics	Item1298	1	Each
1299	13.99	Ventilator Breathing System with resealable water traps (smooth lumen)	Item1299	1	Each
1300	14	Waste Management Wheeled Bins. (660Lit ; 300lit; 1100 lit)	Item1300	1	Each
1301	14.01	Wire cutter	Item1301	1	Each
1302	14.02	Y-pieces for Breathing Circuit	Item1302	1	Each
1303	14.03	Absorbable Gelatin Sponge U.S.P (Ab-Gel) 10 X 10	Item1303	1	Each
1304	14.04	Alginate impression materials(Dust free)	Item1304	1	Each
1305	14.05	Double swivel with port 15mm	Item1305	1	Each
1306	14.06	Green PVC tubing 6mm for oxygen / per meter	Item1306	1	Each
1307	14.07	2 mm Osteotomes	Item1307	1	Each
1308	14.08	3 mm Osteotomes	Item1308	1	Each
1309	14.09	Asepto Pump	Item1309	1	Each
1310	14.1	Autoclavable biohazard plastic bag 10liter	Item1310	1	Each
1311	14.11	Autoclavable biohazard plastic bag 20liter	Item1311	1	Each
1312	14.12	Autoclavable biohazard plastic bag 30liter	Item1312	1	Each
1313	14.13	Bone Cement(Plain)	Item1313	1	Each
1314	14.14	Bone Cement(Antibiotics)	Item1314	1	Each
1315	14.15	Bougie(stylet)	Item1315	1	Each
1316	14.16	Burretta	Item1316	1	Each
1317	14.17	CAPD Catheter Tenckhoff with 2 felt cuffs SA 1242 (420 mm)	Item1317	1	Each
1318	14.18	Cast Taper Mandrel	Item1318	1	Each
1319	14.19	Chiesel	Item1319	1	Each
1320	14.2	Cleaning Brush	Item1320	1	Each
1321	14.21	Cleaning solution	Item1321	1	Each
1322	14.22	CPR manikin	Item1322	1	Each
1323	14.23	Stoma Flatmoldable Small 45MM	Item1323	1	Each
1324	14.24	Stoma Flatmoldable Medium 45MM	Item1324	1	Each
1325	14.25	Stoma Flatmoldable Regular 57MM	Item1325	1	Each
1326	14.26	Stoma Flatmoldable Large 70MM	Item1326	1	Each
1327	14.27	Moldable convex 12/22MM	Item1327	1	Each
1328	14.28	Moldable convex 22/33MM	Item1328	1	Each
1329	14.29	Moldable convex 33/57MM	Item1329	1	Each
1330	14.3	Ostomy Appliance Accessories Belt	Item1330	1	Each
1331	14.31	Coloured Ph indicator Paper	Item1331	1	Each
1332	14.32	Dissecting Instrument Box	Item1332	1	Each
1333	14.33	Double swivel with port 15 mm x 22mm	Item1333	1	Each
1334	14.34	Drape Formers Trans femoral	Item1334	1	Each
1335	14.35	Drape Formers Trans tibial	Item1335	1	Each
1336	14.36	Espocan with Docking System	Item1336	1	Each
1337	14.37	ETO chemical Indicator tape -3M	Item1337	1	Each
1338	14.38	ETO packing sleeves roll (3M) 12'	Item1338	1	Each
1339	14.39	ETO packing sleeves roll (3M) 4'	Item1339	1	Each
1340	14.4	ETO packing sleeves roll (3M) 6'	Item1340	1	Each
1341	14.41	Surgicel Fibrillar 1963	Item1341	1	Each
1342	14.42	G- Bone	Item1342	1	Each
1343	14.43	Gloves wrapper	Item1343	1	Each
1344	14.44	Laparoscopic Aspiration needle	Item1344	1	Each
1345	14.45	Hemorrhoids and Prolapsed Stapler with Detachable Anvil 3.5mm	Item1345	1	Each
1346	14.46	Hemorrhoids and Prolapsed Stapler with Detachable Anvil 4.8mm	Item1346	1	Each
1347	14.47	Hose Mount 15mm female male pair	Item1347	1	Each
1348	14.48	Hose Mount 22mm female male pair	Item1348	1	Each
1349	14.49	Hygrobaby/HME Filter (Infant)	Item1349	1	Each
1350	14.5	Hygroboy/HME Filter (Paediatric)	Item1350	1	Each
1351	14.51	Hygrostar/HME Filter (Adult)	Item1351	1	Each
1352	14.52	hygrobac S	Item1352	1	Each
1353	14.53	Intraocular lense 6mm optics foldable, square edge, Hydrophobic	Item1353	1	Each
1354	14.54	Intraocular lense rigid 5.25mm optics,PMMA, square edge	Item1354	1	Each
1355	14.55	Intraocular lense rigid 5.5mm optics	Item1355	1	Each
1356	14.56	Intraocular lense rigid 5.5mm optics foldable	Item1356	1	Each
1357	14.57	Intraocular lense rigid 6mm optics	Item1357	1	Each
1358	14.58	Intraocular lense rigid 6mm optics foldable	Item1358	1	Each
1359	14.59	Intraocular lense rigid 6mm optics, PMMA, square edge	Item1359	1	Each
1360	14.6	Rigid Anterior Chamber Intraocular Lens: Lens Power +16D(6.00mm)	Item1360	1	Each
1361	14.61	Rigid Anterior Chamber Intraocular Lens: Lens Power +19D(6.00mm)	Item1361	1	Each
1362	14.62	Rigid Anterior Chamber Intraocular Lens: Lens Power +18D(6.00mm)	Item1362	1	Each
1363	14.63	Rigid Anterior Chamber Intraocular Lens: Lens Power +20D(6.00mm)	Item1363	1	Each
1364	14.64	Rigid Anterior Chamber Intraocular Lens: Lens Power +21D(6.00mm)	Item1364	1	Each
1365	14.65	Rigid Anterior Chamber Intraocular Lens: Lens Power +22D(6.00mm)	Item1365	1	Each
1366	14.66	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm)	Item1366	1	Each
1367	14.67	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.5D(5.50mm)	Item1367	1	Each
1368	14.68	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm)	Item1368	1	Each
1369	14.69	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.0D(5.50mm)	Item1369	1	Each
1370	14.7	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.5D(5.50mm)	Item1370	1	Each
1371	14.71	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.0D(5.50mm)	Item1371	1	Each
1372	14.72	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.5D(5.50mm)	Item1372	1	Each
1373	14.73	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.0D(5.50mm)	Item1373	1	Each
1374	14.74	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.5D(5.50mm)	Item1374	1	Each
1375	14.75	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.0D(5.50mm)	Item1375	1	Each
1376	14.76	Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.5D(5.50mm)	Item1376	1	Each
1377	14.77	(a) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +10.0D 6.0mm	Item1377	1	Each
1378	14.78	(b) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +113.5D 6.0mm	Item1378	1	Each
1379	14.79	(c) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+14.0D 6.0mm	Item1379	1	Each
1380	14.8	(d) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.0D 6.0mm	Item1380	1	Each
1381	14.81	(e) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.5D 6.0mm	Item1381	1	Each
1382	14.82	(f) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.0D 6.0mm	Item1382	1	Each
1383	14.83	(g) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.5D 6.0mm	Item1383	1	Each
1384	14.84	(h) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.0D 6.0mm	Item1384	1	Each
1385	14.85	(i) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.5D 6.0mm	Item1385	1	Each
1386	14.86	(j) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.0D 6.0mm	Item1386	1	Each
1387	14.87	(k) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.5D 6.0mm	Item1387	1	Each
1388	14.88	(l) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19..0D 6.0mm	Item1388	1	Each
1389	14.89	(m) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19.5D 6.0mm	Item1389	1	Each
1390	14.9	(n) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.0D 6.0mm	Item1390	1	Each
1391	14.91	(o) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.5D 6.0mm	Item1391	1	Each
1392	14.92	(p) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.0D 6.0mm	Item1392	1	Each
1393	14.93	(q) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.5D 6.0mm	Item1393	1	Each
1394	14.94	(r) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.0D 6.0mm	Item1394	1	Each
1395	14.95	(s) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.5D 6.0mm	Item1395	1	Each
1396	14.96	(t) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+23.0D 6.0mm	Item1396	1	Each
1397	14.97	(u)Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +23.5D 6.0mm	Item1397	1	Each
1398	14.98	(v) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.0D 6.0mm	Item1398	1	Each
1399	14.99	(w) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.5D 6.0mm	Item1399	1	Each
1400	15	(x) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.0D 6.0mm	Item1400	1	Each
1401	15.01	(y) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.5D 6.0mm	Item1401	1	Each
1402	15.02	(z) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+26.0D 6.0mm	Item1402	1	Each
1403	15.03	Mayo trolly cover (disposable)	Item1403	1	Each
1404	15.04	Membrane Assembly	Item1404	1	Each
1405	15.05	Micro Centrifuge Tube 1.5ml	Item1405	1	Each
1406	15.06	Micro Centrifuge Tube 15ml	Item1406	1	Each
1407	15.07	micro centrifuge tubes-.2ml (with thin wall for PCR)	Item1407	1	Each
1408	15.08	micro centrifuge tubes-.5ml (with thin wall for PCR)	Item1408	1	Each
1409	15.09	micro centrifuge tubes-2ml	Item1409	1	Each
1410	15.1	Microscope Bulb- 6V 20W	Item1410	1	Each
1411	15.11	Mini & micropates with screw	Item1411	1	Each
1412	15.12	Nasal Tubing 70mm	Item1412	1	Each
1413	15.13	Needle (cutting) big	Item1413	1	Each
1414	15.14	Needle (cutting) medium	Item1414	1	Each
1415	15.15	Needle (cutting) small	Item1415	1	Each
1416	15.16	Needle (round body) big	Item1416	1	Each
1417	15.17	Needle (round body) medium	Item1417	1	Each
1418	15.18	Needle (round body) small	Item1418	1	Each
1419	15.19	Non invasive cardiac output monitoring electrode	Item1419	1	Each
1420	15.2	Non invasive cardiac pacing electrode	Item1420	1	Each
1421	15.21	Ostomy powder 25gm	Item1421	1	Each
1422	15.22	Pneumatic Compression Stocking	Item1422	1	Each
1423	15.23	Pressure monitoring kit with three way disposable pressure( For CVP & Atrerial)	Item1423	1	Each
1424	15.24	RAE tub 7.5	Item1424	1	Each
1425	15.25	Self adhesive urine sample bag - Pediatric	Item1425	1	Each
1426	15.26	Spirit swabs	Item1426	1	Each
1427	15.27	Sterile swab sticks	Item1427	1	Each
1428	15.28	Steri-Stripes	Item1428	1	Each
1429	15.29	Esmarch 4\"	Item1429	1	Each
1430	15.3	Esmarch 6\"	Item1430	1	Each
1431	15.31	Polyester Synthetic Cast padding	Item1431	1	Each
1432	15.32	Suction cannula for MTP size purandre	Item1432	1	Each
1433	15.33	Ostomy Appliance Accessories Belt	Item1433	1	Each
1434	15.34	Stomadress Plus Single Pouch - Opaque	Item1434	1	Each
1435	15.35	ActiveLife One Pc Drainable Pouch	Item1435	1	Each
1436	15.36	Tubing Kit	Item1436	1	Each
1437	15.37	urianalyser	Item1437	1	Each
1438	15.38	Urine Control A360	Item1438	1	Each
1439	15.39	Ventilating Airway Bougies	Item1439	1	Each
1440	15.4	Ventilator Tubing W/1 (venti breathing system with reseable water trap)	Item1440	1	Each
1441	15.41	Y-pieces	Item1441	1	Each
1442	15.42	6mm Green PVC tubing for oxygen	Item1442	1	Each
1443	15.43	Alpha mattress	Item1443	1	Each
1444	15.44	Analspeculum Size: 25	Item1444	1	Each
1445	15.45	AO universal clamps	Item1445	1	Each
1446	15.46	Baby Cradle with mattress and Net	Item1446	1	Each
1447	15.47	Blood Gas Quality Control (30x1.7ml) Level 1 (ABG)	Item1447	1	Each
1448	15.48	Blood Gas Quality Control (30x1.7ml) Level 2 (ABG)	Item1448	1	Each
1449	15.49	Blood Gas Quality Control (30x1.7ml) Level 3 (ABG)	Item1449	1	Each
1450	15.5	Bone Cutter	Item1450	1	Each
1451	15.51	Bone cutter Big size	Item1451	1	Each
1452	15.52	Centrifuge Tube	Item1452	1	Each
1453	15.53	Centrifuge tubes, polypropylene seal with capacity 3.5 - 10 ml	Item1453	1	Each
1454	15.54	Clavicular Braces	Item1454	1	Each
1455	15.55	Cider wood oil	Item1455	1	Each
1456	15.56	DeBakey’s Bull Dog Clamps, Curved 115mm (4 ½”) long	Item1456	1	Each
1457	15.57	DeBakey’s Bull Dog Clamps, Curved 70mm (2 ¾”) long	Item1457	1	Each
1458	15.58	DeBakey’s Bull Dog Clamps, Curved 80mm (3 ?”) long	Item1458	1	Each
1459	15.59	DeBakey’s Bull Dog Clamps, Straight 120mm (4 ¾”)	Item1459	1	Each
1460	15.6	DeBakey’s Bull Dog Clamps, Straight 75mm (3”)	Item1460	1	Each
1461	15.61	DeBakey’s Bull Dog Clamps, Straight 85mm (3 ?”)	Item1461	1	Each
1462	15.62	Divided Mattress	Item1462	1	Each
1463	15.63	Dropper bottle 250ml	Item1463	1	Each
1464	15.64	Dropper bottle 500ml	Item1464	1	Each
1465	15.65	Dropper p.p. 6 long	Item1465	1	Each
1466	15.66	NPWT dressing kit	Item1466	1	Each
1467	15.67	Silicone Rubber heel cups	Item1467	1	Each
1468	15.68	Electrodes for IFT (For Combination therapy-Ultra sound therapy + Electrical Stimulator) (Make: Enraf nonius Sonoplus 491)	Item1468	1	Each
1469	15.69	Episiotomy scissor size 15cm	Item1469	1	Each
1470	15.7	Fixation Ring (904-898)	Item1470	1	Each
1471	15.71	Fixation Ring (904-898) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40)	Item1471	1	Each
1472	15.72	Fluid warmer	Item1472	1	Each
1473	15.73	Fogging Machine	Item1473	1	Each
1474	15.74	G-Bone	Item1474	1	Each
1475	15.75	Gigly Saw	Item1475	1	Each
1476	15.76	Ginevri Capillary tube (H) (Microbillimeter)	Item1476	1	Each
1477	15.77	Glover with Atraumatic jaws, Curved jaws, 85mm (3 ?”), 45mm jaws	Item1477	1	Each
1478	15.78	Hand Drill	Item1478	1	Each
1479	15.79	Hand wash basin stand (double). - Five legs base mounted on 5cms dia castors with one 35cm s.s basin.Pre treated and epoxy powder coated.	Item1479	1	Each
1480	15.8	Hysterectomy clamp ‘FAURE’	Item1480	1	Each
1481	15.81	I.V. drip stand	Item1481	1	Each
1482	15.82	Intra uterine cannula ‘COLLINS’ plain 3 size	Item1482	1	Each
1483	15.83	Intra uterine cannula ‘HAYES PROVIS’ with rubber cone	Item1483	1	Each
1484	15.84	Kidney Wash Machine (Renatron II)	Item1484	1	Each
1485	15.85	Knee Immobilizer OC 2035	Item1485	1	Each
1486	15.86	Knee Immobilizer OC 2035	Item1486	1	Each
1487	15.87	Knee Stabilizer-DC 2069	Item1487	1	Each
1488	15.88	Leishmans stain	Item1488	1	Each
1489	15.89	Lengenback retractor	Item1489	1	Each
1490	15.9	Lengenback retractor	Item1490	1	Each
1491	15.91	Lens cleaning paper	Item1491	1	Each
1492	15.92	Lymph node	Item1492	1	Each
1493	15.93	Magnet for ECG	Item1493	1	Each
1494	15.94	Malleable stylets with adjustable stop, different size	Item1494	1	Each
1495	15.95	MEASURING TAPE	Item1495	1	Each
1496	15.96	Measuring Tape (Clinical)	Item1496	1	Each
1497	15.97	Microscope ( for side lab) - Binocular electric light microscope	Item1497	1	Each
1498	15.98	Molina Sheet	Item1498	1	Each
1499	15.99	Mosquito Net (Single use patient specific, plastic)	Item1499	1	Each
1500	16	Mouth gag	Item1500	1	Each
1501	16.01	Myoma screw ‘DOYEN’	Item1501	1	Each
1502	16.02	Na+ - sensor casing (ABG)	Item1502	1	Each
1503	16.03	Non Invasive Glucose monitoring system (Glucometer)	Item1503	1	Each
1504	16.04	Ounce glass steel	Item1504	1	Each
1505	16.05	Oxygen cylinder stand /trolley - B Type	Item1505	1	Each
1506	16.06	Pad Electrodes for SWD (DX 500 roland)	Item1506	1	Each
1507	16.07	Paper Roll (ABG)	Item1507	1	Each
1508	16.08	Patient Breathing Set Infant Reusable (Galileo Gold)	Item1508	1	Each
1509	16.09	Patient cable for IFT/MST (Make/Model: Multidyne 965)	Item1509	1	Each
1510	16.1	Patient shifting trolleys with the facility of Oxygen Cylinder carrier	Item1510	1	Each
1511	16.11	Pelvic traction kit with pulley and weight	Item1511	1	Each
1512	16.12	Pile Binder	Item1512	1	Each
1513	16.13	Plastic dropping bottle (120ml)	Item1513	1	Each
1514	16.14	Plastic small tube	Item1514	1	Each
1515	16.15	RAOS hand suction unit 100 ml	Item1515	1	Each
1516	16.16	Ref. - membrane shell (ABG)	Item1516	1	Each
1517	16.17	Resucitation kits Automatics	Item1517	1	Each
1518	16.18	Resuscitation kit Emergency	Item1518	1	Each
1519	16.19	Resuscitation kit for neonates	Item1519	1	Each
1520	16.2	Rubber Sole - 4mm	Item1520	1	Each
1521	16.21	Sample detector	Item1521	1	Each
1522	16.22	Screw driver	Item1522	1	Each
1523	16.23	Sealing rings	Item1523	1	Each
1524	16.24	Set tubing for roller pump (reagents) (ABG)	Item1524	1	Each
1525	16.25	Shin tube cutting jig 30mm	Item1525	1	Each
1526	16.26	Shin tube cutting jig 35mm	Item1526	1	Each
1527	16.27	Short needle Holder	Item1527	1	Each
1528	16.28	Side Support (Meditrin)	Item1528	1	Each
1529	16.29	Silicon Tubal Ring	Item1529	1	Each
1530	16.3	Solid waste containers liners	Item1530	1	Each
1531	16.31	Solution Valve	Item1531	1	Each
1532	16.32	Spare canvas bag	Item1532	1	Each
1533	16.33	Spare lamp for Opthalmoscope	Item1533	1	Each
1534	16.34	Spare parts for: Easylyte,911 , 912 & others	Item1534	1	Each
1535	16.35	Spirit lamp	Item1535	1	Each
1536	16.36	Stich scissor	Item1536	1	Each
1537	16.37	Suture anchor (orthopaedics)	Item1537	1	Each
1538	16.38	Syringe Infusion pump	Item1538	1	Each
1539	16.39	T- handle for Orthopaedics	Item1539	1	Each
1540	16.4	Tailor Thread	Item1540	1	Each
1541	16.41	TCO2 sensor	Item1541	1	Each
1542	16.42	Teley's Forcep	Item1542	1	Each
1543	16.43	Vortex mixer	Item1543	1	Each
1544	16.44	Vulsellum forceps 1 x 1 teeth 25cm	Item1544	1	Each
1545	16.45	Wire Cutter	Item1545	1	Each
1546	16.46	Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure)	Item1546	1	Each
1547	16.47	Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Low Pressure)	Item1547	1	Each
1548	16.48	Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene.	Item1548	1	Each
1549	16.49	Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure with bacterial resistance)	Item1549	1	Each
1550	16.5	Manual Hub Cutter – with biohazard symbol and which can cut the plastic hub and NOT the metal needle with temporary and permanent locking mechanism on complete filling of the disposal hub cutter with clear demarcation of fill line and which can accomadate upto 400-600 needles.	Item1550	1	Each
1551	16.51	Cerebral Reservior (Omaya Type)	Item1551	1	Each
1552	16.52	Extranal Ventricular Drainage Syatem	Item1552	1	Each
1553	16.53	Lumbar Extranal Drainage System	Item1553	1	Each
1554	16.54	Poly Propylene mesh (small) for Duroplasty	Item1554	1	Each
1555	16.55	Poly Propylene Mesh (Medium) for Duroplasty	Item1555	1	Each
1556	16.56	Poly Propylene Mesh (Large) for Duroplasty	Item1556	1	Each
1557	16.57	G Bone Cement (for Cranioplasty)	Item1557	1	Each
1558	16.58	Kraniotomy Drape	Item1558	1	Each
1559	16.59	Iodine Drape Large	Item1559	1	Each
1560	16.6	Balanced Salt Solution with Na/K/Mg & chloride levels similar to plasma with acetate & gluconate/malate as buffer, must not contain calcium ( eg.Plasmalyte A /Volulyte etc)	Item1560	1	Each
1561	16.61	Bactiseal Impregnated Shunt - FDA Approved, fixed pressure VP Shunts (low,medium, high) that are antibiotic impregnated and can reduce the potential for bacterial colonization in the lumen as well as its outer surface.	Item1561	1	Each
1562	16.62	Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.	Item1562	1	Each
1563	16.63	Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.	Item1563	1	Each
1564	16.64	Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.	Item1564	1	Each
1565	16.65	Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.	Item1565	1	Each
1566	16.66	Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.	Item1566	1	Each
1567	16.67	Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.	Item1567	1	Each
1568	16.68	Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size.	Item1568	1	Each
1569	16.69	Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology.	Item1569	1	Each
1570	16.7	Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology.	Item1570	1	Each
1571	16.71	Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology.	Item1571	1	Each
1572	16.72	Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .	Item1572	1	Each
1573	16.73	Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .	Item1573	1	Each
1574	16.74	Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .	Item1574	1	Each
1575	16.75	Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes .	Item1575	1	Each
1576	16.76	Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.	Item1576	1	Each
1577	16.77	Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.	Item1577	1	Each
1578	16.78	Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.	Item1578	1	Each
1579	16.79	Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.	Item1579	1	Each
1580	16.8	Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second.	Item1580	1	Each
1581	16.81	Raneys scalp disposable clips - Disposable Raney's Clips	Item1581	1	Each
1582	16.82	Cranioplasty kit - Cranioplasty kit, sterile, pack of two packets of Methyl methacrylate and two vials of liquid.	Item1582	1	Each
1583	16.83	Universal Extremity Drape- Control plus fabric,US FDA certified	Item1583	1	Each
1584	16.84	Impervious Split Sheet- 60\" x 70\", 4\" x 21\" split, Polyethylene Sheet, US FDA certified	Item1584	1	Each
1585	16.85	U-Bar-Pack- 1 back table cover-Reinforced 44\" x 88\",1 mayo stand cover reinforced 23\" x 54\",1 suture bag, 1U drape 71\" x 124\", 1 Bar Drape 71\" x 124\", 1 Bar Drape 41.5\" x 82\",US FDA certified	Item1585	1	Each
1586	16.86	Back Table Cover Zone Reinforced- 44\" x 99\", US FDA certified	Item1586	1	Each
1587	16.87	Impervious Stockinette-12\" x 58\", UDS FDA	Item1587	1	Each
1588	16.88	Fluid shield Mask with Visor -Four Layer Mask, water resistant with water resistant,-NAOSH, OSHA approved	Item1588	1	Each
1589	16.89	HIP Drape with LEG Pockets -control plus fabric, US FDA approved	Item1589	1	Each
1590	16.9	HIP Drape without LEG Pockets -Control plus fabric, US FDA approved	Item1590	1	Each
1591	16.91	Quattro FX -Full Face Mask Vented	Item1591	1	Each
1592	16.92	Mirage FX- Nasal Mask Vented	Item1592	1	Each
1593	16.93	Transmission Electron Microscope	Item1593	1	Each
1594	16.94	G011/2 Glut Em 25% AMPS	Item1594	1	10x2ml
1595	16.95	Self Closing Tweezer (biology) T-403	Item1595	1	Each
1596	16.96	O001 Osmium Tetroxide	Item1596	1	1vial/1gm
1597	16.97	EUKITT Mouning Media	Item1597	1	1bottle/100ml
1598	16.98	TAAB Araldite 502/812 Kit (E2O2)	Item1598	1	Kit
1599	16.99	Dibutyl Phthalate	Item1599	1	Bottle
1600	17	E069 Embedding Mould Flat C	Item1600	1	1 Piece
1601	17.01	Z10 Molecular Seive 3NM for Drying Acetone	Item1601	1	1bottle/Jar
1602	17.02	Shaving Razor Blade	Item1602	1	1Packet
1603	17.03	300 mesh Cu Grid with thin carbon film (Cu - 300CN	Item1603	1	25grids/pkg
1604	17.04	300M mesh Cu Grid with holey/dbl Carbon film (Cu-300HD	Item1604	1	25grids/Pkg
1605	17.05	G062 Grid Storage Box	Item1605	1	1x10pcs
1606	17.06	U007 Uranyl Acetate	Item1606	1	1 bottle
1607	17.07	L018 Lead Citrate	Item1607	1	1 bottle
1608	17.08	TRUF 2208-100	Item1608	1	1 Packet
1609	17.09	Octagon Magnetic Stirrer Bar (4151)	Item1609	1	1packet (8x22mm)
1610	17.1	Consumables	Item1610	1	Each
1611	17.11	Micro tips(10micro litre)	Item1611	1	1x1000pcs
1612	17.12	Microcentrifuge Tube	Item1612	1	1.5/2.0ml capacity

Also Visit

Tenders

Meghalaya Tenders

Chemical Oil and Gas Tenders

Chemical Industry Tenders

Chemical Supply Tenders

Disclaimer

We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.

Top

Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later., Neigrihms, Shillong, Meghalaya-Meghalaya

Disclaimer

About Us

Services

Browse Tenders

For Sales Inquiry

Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later., Neigrihms, Shillong, Meghalaya-Meghalaya

Disclaimer

OTP Verification

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us