Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later.

Tender Notice

22947207
Corrigendum : Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later.
Indian
Meghalaya
27-11-2020
04-12-2020
04-12-2020

Tender Details

Open E-Tender For Processing Of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, Etc For The Institute, For A Period Of Two Years, Extendable Upto 6 Months, Or Till The Finalization Of The Next Tender, Whichever Is Later. - 1 Albumin 2 Microalbumin 3 Gamma Glutamyl Tranferase 4 ( ??- Ggt ) 5 Amylase 6 Lipase 7 Ck 8 Ck-Mb 9 Ldh 10 Total Cholesterol 11 Triglyceride 12 Hdl 13 Ldl 14 Calcium 15 Copper 16 Phosphorus 17 Zinc 18 Parameter 19 Iron 20 Tibc 21 Ada 22 Ada Calibrator 23 G-6-Pd 24 Glycosylated Hb 25 Glycosylated Hb Calibrator 26 Crp 27 Crp Calibrator 28 A-1 Acid Glycoprotein 29 Ammonia 30 Lactate 31 Glutathione Peroxidase 32 Superoxide Dismutase 33 Total Antioxidant Status 34 Homocysteine 35 Aso 36 Rf 37 Lipoprotein ( A ) 38 Lipoprotein ( A ) Calibrator 39 Transferrin 40 Cystatin C 41 Gentamycin 42 Barbiturates 43 Valproic Acid 44 Phenitoin 45 Vma 46 Galactosemia 47 Calcitonin 48 Calcitriol 49 Galactokinase 50 Galactose-1-Phosphate Uridyl Transferase 51 Renin 52 Acth 53 Interleukin 1 54 Interleukin 4 55 Interleukin10 56 Leukotrine A4 57 Leukotrine B4 58 Leukotrine C4 59 Leukotrine D4 60 Leukotrine E4 61 Tnfa 62 Cephalosporin 63 Serum Tryptase 64 Urine Fluoride 65 Anti-Dsdna Antibody 66 Anti Nuclear Antibody 67 Anti-Sm Antibody 68 Sodium Carbonate 69 Potassium Dihydrogen Phosphate 70 Potassium Dihydrogen Phosphate Kh2po4 ( Hplc Grade ) 71 Creatinine Powder 72 Isopropyl Alcohol, Ar Grade 73 Acetone – Ar Grade Ar Grade 74 Ammonium Chloride –Ar Grade, 75 Ammonium Nitrate – Ar Grade, 76 Ammonium Persulphate – Ar Grade, 77 Calcium Chloride Dihydrade – Ar Grade, 78 Dinitro Phenyl Hydrazine Ar Grade, 79 Magnesium Chloride – Ar Grade, 80 Magnesium Sulfate –Ar Grade, 81 Methanol – Acetone Free – Hplc Grade, 82 Methanol ( Hplc Grade ) 83 Potassium Dichromate – Ar Grade, 84 Silver Nitrate – Ar Grade, 85 Sodium Bicarbonate – Ar Grade, 86 Sodium Acetate Dehydrate –Ar Grade, 87 Ammonium Acetate – Ar Grade, 88 Thio Semi Carbazide – Ar Grade, 89 Ethidium Bromide Soln 10Ml– Biotechnology Grade, 90 Guanidium Iso Thiocyanate – Biotechnology Grade, 91 Iptg Ar Grade, 92 100 Bp Dna Ladder 1 Ml X 5 93 Taq Polymerase With Pcr Buffer 3-5 U / Μl, 1000 U Per Vial 94 Dntps 100 Millimolar Each 95 Ecori Restriction Enzyme 0.5 Ml X 1 96 Bamhi 0.5 Ml X 1 97 Hindiii 0.5 Ml X 1 98 Dna Ligase 0.5 Ml X 1 99 Dna Extraction Kit ( Column Based ) For 50 Extraction 100 Rna Extraction Kit ( Column Based ) For 20 Extraction 101 Plasmid Extraction Kit ( Column Based ) For 50 Extraction 102 Oligo Nucleotide Primers ( Hplc Purification ) 103 Rnalater 104 Depc Mol Bio Grade 105 Nuclese K 106 Milipore Prefiltrate Kit Cartridge 107 Milipore Proguard 2 Pack Cat. No. Prog0002 108 Milipore Q Guard 1 Cat. No. Qgard00r1 109 Milipore Tank Vent Filter Cat. No. Tankmpk01 110 Milipore Sanitization Tablet Cat. No. Zwcl01f50 111 Millipore Millicare Elix Cat No Jmbm01747 112 Millipore Quantum Ex Cat. No- Qtum000ex 113 Mx Cart 5 Micron 114 Mx Cart 1 Micron 115 Ro Cartridge 116 Non Sterile Millipak 40 117 Progard Ts 2 118 1 Micron Filter 119 3 Micron Filter 120 Mx Cartridge 5 Μm 121 20 '''' Carbon Cartridge 122 Sanitization Tablets 123 Pm Kit 124 Xl Wash Solution 125 200-1000 Μl Microtips 126 100-200 Μl Microtips 127 5-50 Μl Microtips 128 1-5 Ml Microtips 129 200-1000 Μl Micropipette 130 100-200 Μl Micropipette 131 5-50 Μl Micropipette 132 2-20 Μl Micropipette 133 Microcentrifuge Tube 1.5Ml 134 Ammonium Persulphate Ar 135 Potassium Iodate ( Kio3 ) 136 Toluene Ar 137 Arsenous Acid ( As2o3 ) 138 Arsenic Trioxide 139 Ceric Ammonium Sulphate 140 20Bp Dna Ladder 141 Tris – Base Ar Grade 142 Fok I & Nlaiii Restriction Enzyme 143 Dna Loading Buffer 144 Dna Sample Loading Dye 145 Ethiduim Bromide 146 Primer ( Both Forward & Reverse ) 147 10 X Tbe 148 Heparinised Vial 149 Disposable Syringe 150 Microwave Oven 151 Glucose Kit 152 Bilirubin Kit 153 G6-Pd Kit 154 Vacutainer 155 Disposable Syringe 156 Cystatin C Kit 157 Bilirubin Kit 158 Creatinine Kit 159 Ast Kit 160 Alt Kit 161 Ise Wash 2 Solution 162 Ise Cal-3 Solution 163 Ise Cal -4 Solution 164 Microcentrifuge Tube 2Ml 165 Sp Kit 166 Rep Prep Solution 167 Sample Applicator 168 Disposable Sample Cup 169 Ast 170 Alt 171 Creatinine 172 Albumin 173 Glucose 174 Ggt 175 Bun 176 Hdl Cholesterol 177 Ldl Cholesterol 178 Cholesterol 179 Uibc 180 Rf Rtg Latex 181 Crp 182 Uric Acid 183 Triglyceride 184 Alp 185 Total Bilirubin 186 Igg 187 Direct Bilirubiun 188 Igm 189 Protein 190 Iga 191 Phosphorus 192 C3 193 Calcium 194 Ck-Mb 195 Lipase 196 Aso 197 Iron 198 C4 199 Amylase 200 Ck 201 Acid Phosphatase 202 Transferrin 203 Ldh 204 Magnessium 205 Hb-Dh 206 Haptoglobin 207 Lactate 208 Microalbumin 209 Microalbumin Calibrator 210 Cholinesterase 211 Urine Csf Protein 212 Wash Solution 213 Cleaning Solution 214 Cleaning Solution Weekly Wash 215 Crp Latex Calibrator 216 Urine Calibrator 217 System Calibrator 218 Hdl Calibrator 219 Ldl Calibrator 220 Crp Calibrator 221 Rf Calibrator 222 Ck-Mb Calibrator 223 Xl-300 / 600 Cuvette 224 Beckman Coulter Au 2700 Cuvettes 225 Xl-300 / 600 Lamp 226 Beckman Coulter Au 2700 Lamp 227 Eqas ( Bio-Rad ) 228 Apoa1 & Apob Reagent & Calibrator 229 Bio-Rad Lipid Conrol 230 Ethylene Glycol ( Ethandiol 231 Methylene Soluble ( Working Reagent 232 Tissue Capsule Big 233 Tissue Capsule Small 234 Tissue Cassettes Big 235 Tissue Cassettes Small 236 Stock Phloxine B 237 Progesterone Receptor 238 Ana Kit For Sle ( Indirect Immunoflurescence Method ) 239 Hb / Cayanaid Method Standard 240 Nalidixid 10Ug 241 Netilmycin 10Ug 242 Furozotidime 30Ug 243 Antigen And Antibody Hcv Elisa Test Kits 244 Cell Counter Reagents 245 ( Machine Available Is Abx Pentra Which Is A Closed System ) 246 Reagent For Aptt 247 Calcium Chloride For Aptt Estimation 248 Control Plasma N 249 Reaction Tube 250 Ca Clean 251 Owrens Veronal Buffer 252 Standard Human Plasma 253 Sodium Azide ( Nan3 ) 254 Bovine Thrombin 255 1000 Nih Units / Mg Of Protein 256 Anti Dce 257 Sc ( 1 ) 258 Sc ( 2 ) 259 Sc ( 3 ) 260 Yt ( A ) 261 Yt ( B ) 262 Do ( A ) 263 Do ( B ) 264 Pyr Broth 265 Pyr -Pyrolidonyl-ß Naphthylamine 266 Paradimethylaminobenzaldehyde 267 P-Dimethylaminocinamaldehyde 268 P-Nitrophenylglycerol 269 Potassium Telurite 270 Potassium Cyanide ( Kcn ) 271 Para Dimethyl Aminobenzaldehyde 272 Potassium Hydroxide 273 Potassium Hydrogen Sulphate 274 Phenol Crystal ( Powder ) 275 Phosphate Buffer Saline 276 Phenethyl Alcohol 277 Phenol Red Indicator 278 Phenol Red Indicator 279 Phenol Red 280 Phenylpyruvic Acid Reagent 281 Potassium Dichromate Lr 282 Potassium Permanganate Lr 283 Potassium Permanganate Ar 284 Potassium Phosphate Monobasic 285 Potassium Nitrate 286 Phenol ( Crystal ) 287 Peptone 288 Raffinose Ar 289 Rhammnose 290 Sodium / Potassium Dichromate 291 Sodium Citrate 292 Sodium Pyruvate Ar 293 Sodium Biocarbonate Lr 294 Sodium Acetate 295 Sodium Iodide 296 Sulphanilamine-Ar 297 Sugar Assimilation Disc – Cellobiose 298 Sugar Assimilation Disc – Dextrose 299 Sugar Assimilation Disc – Dulcitol 300 Sugar Assimilation Disc – Galactose 301 Sugar Assimilation Disc – Inositol 302 Sugar Assimilation Disc – Lactose 303 Sugar Assimilation Disc – Maltose 304 Sugar Assimilation Disc – Melibiose 305 Sugar Assimilation Disc - Raffinose 306 Sugar Assimilation Disc- Sucrose 307 Sugar Assimilation Disc – Trehalose 308 Sugar Assimilation Disc - Xylose 309 Salicin Ar 310 Tarric Acid 311 Trehalose Ar 312 Triypticase 313 Thiosulphate 314 Tri-Sodium Citrate 315 Voges Proskaeur Reagent 316 Vibriostatic ( 0 / 129 ) Agent 317 Wright’S Stain 318 Xylose Ar 319 Vibrio Cholerae-01 3Ml 320 Vibrio Cholerae-0139 3Ml 321 Vibrio Cholerae-Ogawa 3Ml 322 Vibrio Cholerae-Inaba 3Ml 323 Salmonella Polyvalent O 3Ml 324 Salmonella Polyvalent H 3Ml 325 Salmonella Polyvalent O2 3Ml 326 Salmonella Polyvalent O4 3Ml 327 Salmonella Polyvalent O9 3Ml 328 Salmonella Polyvalent H Phase I A 3Ml 329 Salmonella Polyvalent H Phase Ib 3Ml 330 Salmonella Polyvalent H Phase Ic 3Ml 331 Salmonella Polyvalent H Phase Ii 3Ml 332 Shigella Polyvalent Dysenteriae 3Ml 333 Shigella Polyvalent Flexnerii 3Ml 334 Shigella Polyvalent Sonnei 3Ml 335 Shigella Polyvalent Boydii 3Ml 336 Cryptococcus Antigen Detection Kit ( Latex Agglutination Detection ) 337 Antigen Detection Kit For Meningitis ( H Influenza B, N Meningitis A & C, S. Pneumonia, Gbs, E.Coli ) 338 Amphotericin Powder 339 Benzal Pennicillin Powder 340 Cefoxitin 5Gm / Vial 341 Clindamycin Powder 342 Ciprofloxacin 5Gm / Vial 343 Erythromycin Powder 344 Gentamicin 5Gm / Vial 345 Imipenem 5Gm / Vial 346 Oxacillin 5Gm / Vial 347 Vancomycin 5Gm / Vial 348 Anidulafungin ( 0.015-128Μg / Ml ) 349 Ceftriaxone ( 0.016-256 Ug / Ml. ) 350 Ciprofloxacin ( 0.001-8Ug / Ml. ) 351 Ceftazidime+ Clavulanate ( 0.004-128Ug / Ml. ) 352 Clindamycin E-Test ( 0.016-256 Μg / Ml ) 353 Colistin ( 0.06-0.25Μg / Ml ) 354 Caspofungin ( 0.015-128Μg / Ml 355 Doripenem ( 0.002-32 Μg / Ml ) 356 Ertapenem ( 0.002-32 Μg / Ml ) 357 Fluconazole ( 0.016-256 Μg / Ml ) 358 Imipenem ( 0.004-128Ug / Ml. ) 359 Levofloxacin ( 0.001-8Ug / Ml. ) 360 Meropenem ( 4-256 Μg / Ml ) 361 Meropenem / Edta ( 1-64 Μg / Ml ) 362 Moxifloxacin ( 0.001-8Ug / Ml. ) 363 Candida Albicans Atcc 14053 364 Candida Guilliermondii Atcc 6260 365 Candida Psedotropicalis Tcc 4135 366 Corynebacterium Diptheriae Atcc 13812 Vial 367 Escherichia Coli Atcc 25922 Vial 368 Escherichia Coli Atcc 35218 Vial 369 Enterococcus Faecalis Atcc 29212 Vial 370 Haemophilus Influenzae Atcc-49766 Vial 371 Pseudomonas Aeruginosa Atcc 27853 Vial 372 Positive Control For T.B. ( My.Tb H37rv Strain ) 373 Staphylococcus Aureus Atcc 25923 Vial 374 Streptococcus Pneumoniae Atcc 49619 Vial 375 Staphylococcus Aureus Atcc 33591 Vial 376 Salmonella Enterica Subspecies Enterica Serovar Cholerasuis Atcc-10708 Vial 377 Salmonella Enterica Subspecies Enterica Serovar Paratyphi A Atcc-9150 Vial 378 Salmonella Enterica Subspecies Enterica Serovar Typhimurium Atcc-25241 Vial 379 Shigella Flexneri Atcc- 9199 Vial 380 Ast For Gnb Ast –N280 381 Media For Pediatric Sample -259794, Bact / Alert Pf 382 Media For Aerobic Sample – 259791, Bact / Alert Fa 383 Solution For Inoculum Preparation – V1204, 3X500 Ml 384 Tubes For Inoculum Preparation - 69285 ( Unsensitised Tube ) 385 Identification Of Fermentes And Non-Ferments – 21341 ( Gn Test Kit Vtk ) 386 Dna Ladder / Molecular Weight Marker Size Range : 100 To 1200 Bp ( 50Μg ) 387 Dna Extraction Kit 388 Deoxynucleotide Triphosphate ( Dntp ) Mixture 389 Anaerogas Pack ( 5 Nos / Pack ) 390 Autoclavable Biohazard Plastic Bag: Size 10 Ltr 10Ltr 391 Anaerobic Blood Culture Bottle – Adult ( 50 / Pack ) 392 Anaerobic Blood Culture Bottle – Paediatric ( 50 / Pack ) 393 Anaerobic System Rubber Ring 394 Anaero Indicator Tablet Rt ( 1X10 / Pkt ) 395 Autoclavable Plastic Vial Flat Bottom, Screw Capped 11.5 Mm X53 Mm. 396 Craigie’S Tube 397 Durham''s Tube 25 X 6 Mm 398 Durham''s Tube 37X 6 Mm 399 Embading Cassette 1X1000 / Box 400 Kline Concavity Slides 75X56x3 Mm Thick & 12 Concavity Code Gw097 401 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 0.1Ul - 20Μl 402 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 2Ul - 200Μl 403 Microtips ( Autoclavable ) With Box ( 96’S / Pack ) 50Ul - 1000Μl 404 Microtips ( Autoclavable ) 0.1Ul - 20Μl 405 Microtips ( Autoclavable ) 2Ul - 20Ul 406 Microtips ( Autoclavable ) 5Ul-50Ul 407 Microtips ( Autoclavable ) 20Ul-200Ul 408 Microtips ( Autoclavable ) 200Ul-1000Ul 409 Microtips-1000 Ul 410 Microtips-5000 Ul 411 Microtitre Plate With Round Bottom Wells 96Wells 412 Microtitre Plate With Detachable Wells 96Wells 413 Micro Centrifuge Autoclavable Plastic Tubes With Cap 2Ml 414 Micro Centrifuge Autoclavable Plastic Tubes With Cap 5Ml 415 Micro Centrifuge Autoclavable Plastic Tubes With Cap 10Ml 416 Mac Cartney Bottles Flat Bottom With Aluminium Screw Cap & Rubber Liner. Capacity 30Ml 417 Museum Jar, With Cover 160X110x60mm 418 Museum Jar, With Cover 170X130x210 Mm 419 Screw Capped Tubes 20X150mm 420 Serum Vials Sample Storage Box & Stand For 3Ml Capacity 421 Sample Container -Wide Mouth Bottle, 125Ml Autoclavable ( Polypropylene ) 125Ml 422 Storage Vials ( Autoclavable ) 2Ml 423 Teasing Needles For Moulds 424 Test Tube Stand - Test -Tube Size - 25Mm Diametre 425 Test Tube Stand - Test -Tube Size - 16Mm Diametre 426 Test Tube Stand - Test-Tube Size - 10Mm Diametre 427 Test Tube Basket, Large 428 Test Tube Basket, Small 429 Test Tube Rack To Accommodate 3 Ml. Test Tubes 5X15 430 Test Tube Rack To Accommodate 5 Ml. Test Tubes 5X15 431 Test Tube Racks:4 X 13 432 Test Tube Cleaning Brush ( Polypropylene Filament Bunched Typed Brush For Cleaning 6”, 5” & 4” Tubes ) 433 Test Tube Carrier ( Stainless Steel ) 434 V.D.R.L. Slides ( 75Mmx50mm 1.45Mm ) 435 Wash Bottle Plastic With Delivery Nozzle 200Ml 436 Wash Bottle Plastic With Delivery Nozzle 60Ml 437 Bunsen Burner 438 Bacteriological Loop Holder With Loop ( Ready To Use ) 439 Biological Indicator For Steam 440 Bowie Dicktest Pack Steam 441 Ice Box 5 Litres 442 Labels For Micro Centrifuge Tubes White Size ½” 443 Metaloops ( Changeable Nichrome Loop Embedded In Brass Rod With Heat Resistant Handle With- 444 A. 2 Mm Diameter Nichrome Wire 445 B. 3 Mm Diameter Nichrome Wire 446 C. 4 Mm Diameter Nichrome Wire 447 Metaloops ( Fixed Straight Nichrome Loop Embedded In Ss Rod With Heat Resistant Handle With- 448 Microtome Knife 449 Mops 450 Magnifying Glass, Big Size With Handle 451 Mortar - Pestle 452 Nichrome Loop-4 Mm 453 Nichrome Loop-2 Mm 454 Nichrome Loop-1.3 Mm 455 Pipette Stand ( Vertical & Horizontal ) 4 / 5 Pipettes 456 Staining Rack. 20 Slide Capacity. 457 Sprit Lamp Glass / Metal 458 Screwdrivers -Multipurpose 459 Silver Aluminium Foil 460 Surgical Knife ( Big ) 461 Sterile Swab Sticks 462 Syringe Driven Filters Ptfe ( Hydrophilic ) Pore Size 0.22Μm 463 Thermometer 37Degree C 464 Twine 465 Universal Collection Vials ( Urine Pot ) 466 Universal Wash Reagents 500Ml 467 Anti-Cd 56 468 Anti-61 469 Anti-Cd 68 470 Anti-Cd 33 471 Anti-Ki 67 ( Mib ) 472 Anti Neurofilament Protein 473 Anti-Synaptophysin 474 Anti-Gfap 475 Anti-Cd 99 476 Anti-Cd 31 477 Anti-B Hcg 478 Poly-L.Lysine 479 Anti-Cd 20 ( B Cells ) 480 Anti-Cd 45 ( Lca ) 481 Anti-S 100 482 Anti- Desmin 483 Anti-C-Erb B-2 ( Her-L / Neu ) 484 Anti-Er 485 Anti-Pr 486 Anti-Cd 3 487 Anti-Cd 20 488 Anti-Cd 117 489 Anti-Cd 34 490 Anti-Cd 30 491 Anti-Cyclin D1 492 Anti-Cd 15 493 Anti-Cd 5 494 Fitc-Conjugated Rabbit 495 Anti-Human Iga ( Alpha Chain ) 496 Fitc-Conjugated Rabbit 497 Anti-Human Igg ( Gamma Chain ) 498 Fitc-Conjugated Rabbit 499 Anti-Human Kappa Light Chain 500 Fitc-Conjugated Rabbit 501 Anti-Human C3c Complement 502 Fitc-Conjugated Rabbit 503 Anti-Human Igm ( Mu Chain ) 504 Fitc-Conjugated Rabbit 505 Anti-Human Lambda ( Light Chain ) 506 Ana By Hep-2-Cell-Line Substrate ( Kit With Reagents ) 507 Electrodes For Μph System 361 508 Osmium Tetroxide 509 Chromium Trioxide 510 Zinc Chloride 511 Di-Sodium Hydrogen Phosphate Anhydrous 512 Di-Sodium Hydrogen Orthophosphate Dibasic 513 Sodium Dihydrogen Orthophosphate Monohydrate 514 Sodium Borate 515 Alpha Napthyl Butyrate 516 Anti-Cish Kits-Hpv16 / 18Dna 517 Er / P-R Control 518 Anti-Melanomal ( Hmb45 ) 519 Anti Myeloperoxidase 520 Anti -Nse 521 Anti-Plap 522 Anti-Bc12 Oncoprotein 523 Anti-Cytokeratin7 524 Anti-Cytokeratin20 525 Anti-Brca 1Protein 526 Anti-Iga 527 Anti-Igm 528 Anti-Igg 529 Anti-Compliment Cd3 530 Anti-Rb Gene Protein 531 Anti-P53 Protein 532 Anti-Wt1 Turmor 533 Anti-Vimentin ( V9 ) 534 Anti-Ema ( E29 ) 535 Anti-P169ink4 ) 536 Kappa 537 Lamda 538 Eosine Spirit Soluble 539 Pap Pen Immuno Histochemistry 540 Anti-Cd 1A 541 Anti-Sma 542 Anti-Myogenin 543 Fluorescent Bchiff Reagent 544 Carmine 545 Acriffarine 546 Cresyl Fast Blue 547 Luxol Fast Blue 548 Cresyl Violet 549 Epinephrine ( 3X0.5Ml ) 550 Aggrecetion Ristocetion A Sulfate ( 3X0.5Ml ) 551 A D P ( Adenosine-5L Diphosphate ( 3X0.5Ml ) 552 Arachidonic Acid Lyohillzed Sodium Arachidonate 553 Collagen Soluble Calfskin ( 3X0.5Ml ) 554 Vw Fator Assay Ristocetin Cofactor ( 3X0.5Ml ) 555 Test Tube ( Siliconized, Flate Bottom 7X25x55mm ) 556 Stri Bars Plastic Coaled Micro 557 Cryo Glue ( Tissue Embedding Medium ) For Cryostat Machine 558 Diposables Blades For Cryostat Machine 559 Silicon Tubal Ring 560 Laser Spectacles 561 Fluid Warmer 562 Filter For Suction Machine ( Atmos ) 563 Nibp Monitor With Integrated Cuff Arm 564 Serum Zinc 565 Copper 566 Ceruloplasmin 567 Ammonia 568 Ammonia 569 Alcohol 570 D- Dimer 571 Anti Ds Dna 572 Anti Sn Antibody 573 Vitamin D 574 Vitamin E 575 Ngal 576 Cystatin C 577 G6 Pd 578 Lactate 579 Apo A1 580 Homocysteine 581 Bnp 582 Urinary Vma 583 Blood Ketones 584 Lip A 585 Ana 586 Anti Phospholipid Antibody 587 Vitamin C 588 Ena 589 Vitamin K 590 Iodine 591 Apo B 592 Troponin T 593 Ck Mb1 594 Ck Mb 2 595 Tibc 596 Transferrin 597 Igg 598 Igm 599 Iga 600 Inhibin A 601 ß Trace Protein 602 ?Eta 2 Microgobulin 603 Alpha 1 Antitrypsin 604 A -1 Microglobulin 605 A-2 Macroglobulin 606 Screening Kit For Inborn Error Of Metabolism 607 Eqas For Clinical Chemistry, Immunoassay, Electrolyte, Hba1c. 608 Tpo ( Thyroperoxidase ) Antibody 609 Control For M-Band Electrophoresis 610 Tnf-A 611 Il-2 612 Procalcitonin 613 5''Acagcgtcatggcagagcaggtggc3’ 614 5''Aaaagctcttcccgcaggatcccgc3’ 615 5''Gtggctgttccgggatggccttctg3’ 616 5''Cttgaagaagggctcactctgtttg3’ 617 5''Cagtacgatgatgcagc3’ 618 5''Caggtagaagaggcggt3’ 619 Amikacin , Neomycin & 620 Tobramycin Standard ( Hplc Grade ) 621 Edta Gel ( 15% ) 622 Acrylic - Heat Cure-Clear 623 Acrylic - Heat Cure-Pink 624 Acrylic - Self Cure-Clear 625 Acrylic - Self Cure-Pink 626 Agate Spatula 627 Alginate Impression Material ( Dustless ) 628 Articulation Paper 629 Bur - Airotor-Diamond 630 Bur - Airotor-Tc- Straight Fissure 631 Calcium Hydroxide Paste For Root Canal 632 Dappen Dish 633 Dental Floss – Waxed, 25 M 634 Dental Stone 635 Dentin Bonding Agent 636 Die Stone 637 Disposable Suction Tips With Copper Wire 638 Emery Sheet - 100, 150 And 400 Grade 639 Endodontic Gutta Percha Points ( 15-80 ) 640 Etchant Gel ( 37 % Phosphoric Acid ) 641 Fiber Composite Splint 642 Flexible Composite Polishing Discs 643 Formocresol 644 Gic- High Strength Pacakable For Posteriors 645 Glass Ionomer Cement Type I 646 Glass Ionomer Cement Type Ii 647 Gluma Dentin Desensitizer 648 Gutta Percha Sticks 649 Halogen Bulbs- 12V, 55 W 650 Hydroxyapatite Bone Graft Material 651 K File - All Sizes 652 Light Cure Composite - Flowable - All Shades 653 Light Cure Composite - Nano-Hybrid – All Shades 654 Modelling Wax Sheet No.2 655 Non Eugenol Impression Paste - Standard Pack 656 Pinnacle Tracing Sticks ( Minimum Three Years Shelf Life ) 657 Polishing Brush For Dental Lathe 658 Polymer Reinforced Zinc Oxide Eugenol Cement 659 Pumice Powder For Polishing Dentures 660 Silver Reinforced Glass Ionomer 661 Supernal Base Plate 662 Tissue Conditioner ( Soft Reliner ) 663 Ultrasonic Scaler Tip 664 Vacuum Formed Sheets - Soft And Hard - 2 And 3Mm 665 Vulcanite Trimmer ( Tc ) 666 Zinc Oxide Eugenol Impression Paste 667 Self Cure Acrylic Tooth Colour Temporary Crown Materials ( Powder & Liquid ) 668 Cold - Cure Acrylic Powder With Liquid ( White Colour ) 669 Pits And Fissure Sealant 670 Zinc Oxide Eugenol Impression Paste 671 Irm ( Intermediate Restorative Materials ) 672 Gic Fuji Tupe Ix 673 Gic Type -Ii Restoative Materials 674 Light Cure Composite Nano- Filling Materials 675 Alginate Impression Material ( Dustless ) 676 Dental Stone 677 Wedges 678 Miracle Mix Materials 679 Hand Piece Lubricant 680 Dycal 681 Suction Tips 682 Acrylic Teeth Set 683 Polishing Paste 684 Polishing Rubber Cups And Bristle 685 Disposable Glass 686 Abrasive Strips For Polishing Proximal Areas Of Teeth 687 Cellophene Matrix Strips For Lc Restoration 688 Applicator Tips For Lc 689 Desensitizing Varnish 690 Burs For Tooth Reduction Set 691 Dental Stone Cutting Burs ( Small Size ) 692 H-Files For Both Anterior And Posterior 693 K- File For Both Anterior And Posterior 694 Broaches 695 Reamers For Both Anterior And Posterior 696 Gutta Percha 697 Absorbant Paper Point 698 Titanium Post ( All Sizes ) 699 Protapper Gutta Parcha All Size 700 Alveogel 701 Rc Cal ( Intra Canal Dressing Paste ) 702 Fiber Optics Air Rotor Hand Pieces With Coupling Unit 703 Gp Cutter 704 Tungsten Carbide Burs For Air Rotor And Micro Motor Handpieces 705 Sectional Matrixs 706 Metal Crown 707 Zinc Oxide Powder And Eugenol ( Big Size ) 708 Zinc Oxide Eugenol ( Powder ) 709 Zinc Oxide Eugenol ( Liquid ) 710 Zinc Oxide Eugenol ( Ready Mix ) 711 Zno Impression Paste 712 Dycal Cement 713 Stone Burs ( All Sizes And Shape ) 714 Stone Burs For Polishing ( Fine ) 715 Composit Polishing Disc 716 Composite Cement 717 Composite Filling Kit 718 Composite Finishing And Polishing 719 Composite Polishing Disc 720 Composite Polishing Kit 721 Composite Polishing Paste 722 Endo Wash 5% 450Ml 723 Bristle Brush & Cup 724 Eugenol 15Ml 725 Eugenol 110Ml 726 Dpi Selfcure 727 Ketac Molar 728 Nt Premium 729 One Coat Bond 730 Gic Lc ( Mini ) Gc 731 Pivo Crown & Bridge Kit 732 Protaper Hand Kit 21 / 25Mm 733 Mouth Mith Handle ( Gdc ) 734 Explorer ( Gdc ) 735 Surgical Scissor ( Brp ) 736 Dpi Alloy 737 Tri Hawk 738 Glyde 3Mlx1 739 Gp F4-F5 ( Dentsply ) 740 Gp ( 15 / 35 / 40 ) Dentsply 741 Dtech Etchn 742 H File 15 / 20 / 25 743 Matrix Band No1 744 Diamond Bur 745 Shofu Crown & Bridge Kit 746 Vitrebond 747 Ah 26 748 Ketac Silver 749 Api Needle Holder 750 Nsk Push Button Airotor Handpiece 751 Apex Locator Pixi Dentsply 752 Lightcure Michine Coltene 753 Sealer Machine With Pouch 754 Scaller Tips Satellec 755 Ultrasonic Cleaner 756 Smart Burs 757 Anti Fog Mouth Mirror 758 Flouride Solution With Applicator 759 Luting Cement 760 Silicon Base Impression Materials 761 Base Putty Impression Materials 762 Light Body Impression Materials 763 Re Cap 764 Dvi Self 765 Propopar Band Kit 21 / 25Ml 766 Ghofu Crown & Bridge Kit 767 Alt 26 768 Apl Needle Holder 769 Giyote 3Ml 770 Ia File 15 / 20 / 25 771 Otech 772 Flowable Composite Shade 773 Plastic Filling Instruments 774 Cement Spatula 775 Cement Condenser 776 Ball Burnisher ( Api ) 777 Extraction Forcept For Pedo ( Set Of 16 ) 778 Tweezer 779 Diamond Round Bur 780 Diamond Straight Fissure Bur 781 Diamond Cone Shape Bur 782 Contra Angle Hand Piece 783 Paper Point ( 15-40 & 45-80 ) 784 Flamed Shaped Diamond Bur ( All Sizes ) 785 Spoon Excavator 786 Cold Mold Seal 787 Pain Off 788 Shade Guide 789 Coe- Pack 790 Apexit Plus 791 Fibre Post ( Yellow, Red , Blue ) 792 Gingival Retraction Cord 793 Spreader / Plugger ( All Sizes ) 794 Disposable Napkin 795 Crown Cutting Kit 796 Elevators ( Straight And Periostal ) 797 Extraction Forcept For Pedo Adult ( Set Of 14 ) 798 G-Coat Plus 799 Protemp With Tips And Gun 800 Gic Type Ix 801 Durable Flouride Releasing Coating 802 Light Curing Nano Ionomer Restorative 803 Remin Pro ( Protective Dental Cream ) 804 Chair Bulbs ( Ocero Infinity ) 805 Cold Cure ( Pink ) Powder 806 Cold Cure ( White ) Powder 807 Cold Cure Liquid 808 Green Sticks 809 Mercury 810 Disposable Patient Apron 811 Bobe Cutter 812 Bobe Ronger 813 Bone File 814 Mought Prod Chain 815 Macet / Hammer 816 Amalgam Condenser 817 Amalgam Carrier 818 Amalgam Curver 819 Wax Knife 820 Wire Cutter 821 Plier 822 Rubber Dam Kit 823 Crown Remover 824 Micromotor Drill Bits 825 Compo Roller 826 Gp Holder 827 Surgical Micromotor 828 Periodontal Probe 829 Acrylic Mixing Jar 830 Air Polisher 831 S.S. Inter Maxillary Fixation Screws 2.0Mm - 12-14Mm 832 S.S. Inter Maxillary Fixation Screws 2.5Mm - 12-14 Mm 833 Titanium Cranial Microplates ( 0.5Mm Plate Thickness ) 10-18Hole Straight 834 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 4 Hole With Bar / Gap 835 Titanium Mandible Miniplates ( 1Mm Plate Thickness ) 10-12Hole Straight 836 Titanium Midfacial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Right Side 837 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 90 Degree Long 4 Hole With Bar / Gap Left Side. 838 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Right Side 839 Titanum Mid Facial Miniplates ( 0.5-0.6Mm Plates Thickness ) L Plate 100-110 Degree Short 4 Hole With Bar / Gap Left Side 840 Titannium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Right Side 841 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) L Plate 100-110 Degree Long 4 Hole With Bar / Gap Left Side 842 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 4 Hole With Bar / Gap 843 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 6 Hole With Bar / Gap . 844 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Orbital Plate 10 Hole 845 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) T Plates 5 Holes 846 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Y Plate 4 Holes 847 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Double Y Plate 4 Holes 848 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) X Plate 5 Holes 849 Titanium Mid Facial Miniplates ( 0.5-0.6Mm Plate Thickness ) Straight Plate 10-12 Holes 850 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 12-16 Holes 851 Titanium Right Angle Reconstruction Plates ( 2-2.4 Mm Plate Thickness ) 20-25 Holes 852 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 853 Titanium Left Angle Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 854 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 12-16 Holes 855 Titanium Straight Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 856 Titanium Double Angled Reconstruction Plates ( 2-2.4Mm Plate Thickness ) 20-25 Holes 857 Titanium Cranial ( Outer Diameter 1.0-1.2 Mm ) Non Self Drilling Screw- 4-6 Mm Length 858 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -6Mm Length 859 Titanium Midfacial ( Outer Diameter 1.5 / 1.6Mm ) Non Self- Drilling Screw -8 Mm Length 860 Titanium Midfacial ( Outer Diameter 1.8 / 1.9Mm ) Non Self- Drilling Emergency Screw -6 Mm Length 861 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -6Mm Length 862 Titanium Mandible ( Outer Diameter 1.9 / 2Mm ) Non Self- Drilling Screw -8Mm Length 863 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -6Mm Length 864 Titanium Mandible ( Outer Diameter 2.2 / 2.3Mm ) Non Self- Drilling Emergency Screw -8 Mm Length 865 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Screw -10Mm Length 866 Titanium Reconstruction ( Outer Diameter 2.3 / 2.4Mm ) Non Self- Drilling Maxi Screw -12Mm Length 867 Titanium Reconstruction ( 2.4Mm ) Non Self- Drilling Maxi Emergency Screw -8-20Mm Length 868 Titanium Lag Screws Non Self Drilling ( Outer Diameter 2.4 / 2.5 Mm ) - 15-20Mm Length 869 Drill Bit With 6Mm Stop For Titanium Cranial ( 1.0 / 1.2Mm, 1.0 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 870 Drill Bit With 6Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 871 Drill Bit With 8Mm Stop For Titanium Midfacial ( 1.5 / 1.6Mm, 1.3 Mm Pilot Hole Diameter ) Non Self- Drilling Screw 872 Drill Bit With 6Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 873 Drill Bit With 8Mm Stop For Titanium Mandible ( 2Mm, 1.6 Mm Pilot Hole Diameter ) Non Self-Drilling Screw 874 Drill Bit With 10-12Mm Stop For Titanium ( 2.4Mm Reconstruction, Pilot Hole Diameter 2Mm ) Non Self-Drilling Screw 875 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 4X4 Cms 876 Titanium Mesh For Midface ( 0.5-0.6Mm Thickness ) Approx. Dimension 6X6 Cms 877 Titanium Mesh For Mandible ( 0.5-0.6Mm Thickness ) Approx. Dimension 10X8 Cms 878 Titanium Orbital Reconstruction Mesh Plates- Small 879 Titanium Orbital Reconstruction Mesh Plates- Medium 880 Titanium Orbital Reconstruction Mesh Plates- Large ( With Medial And Lateral Wall Extensions ) 881 Porous Polyethylene Orbital Sheets ( 0.8-1.5 Mm Thickness; 5X5 Cms Approx ) 882 26 Guage Stainless Steel Wire Spool 883 32 Guage Stainless Steel Wire Spool 884 Raney Clips Stainless Steel 885 022 Slot Mbt Brackets With Weldable Convertible Utld First Molar Buccal Tubes And Nc Ii Molar Tubes 886 Crimpable Hooks 887 016 Multistranded Ss Wire 888 Preformed Archwire - 014 Niti U / L 889 Preformed Archwire - 016 Niti U / L 890 Preformed Archwire - 016 X 022 Ss – U / L 891 Preformed Archwire - 017 X 025 Ss– U / L 892 Preformed Archwire - 019 X 025 Ss – U / L 893 Orthodontic Stone 894 Dunaform – Soft And Hard Sheets- 2Mm, 3Mm 895 Dental Surgery 896 Mouth Mirror With Handle 897 Mouth Mirror 898 Dental Probe 899 Periodontal Probe 900 Dental Explorer ( Curved And Pigtail ) 901 Glass Bead Sterilizer 902 Airotor Handpiece - Mini-Head ( 2 Years Warranty ) 903 Medesy / Hu Friedy Maxillary Anterior Extraction Forceps 904 Medesy / Hu Friedy Maxillary Reed''s Extraction Forceps 905 Medesy / Hu Friedy Maxillary Premolar Extraction Forceps 906 Medesy / Hu Friedy Maxillary Molar Extraction Forceps Right / Left 907 Medesy / Hu Friedy Maxillary Bayonet Extraction Forceps 908 Medesy / Hu Friedy Maxillarythird Molar Extraction Forceps 909 Medesy / Hu Friedy Mandibular Anterior Extraction Forceps 910 Medesy / Hu Friedy Mandibular Premolar Extraction Forceps 911 Medesy / Hu Friedy Mandibular Molar Extraction Forceps 912 Medesy / Hu Friedy Warwick James Elevator-Straight 913 Medesy / Hu Friedywarwick James Elevator-Right / Left 914 Medesy / Hu Friedycryer''s Elevator-Small Size- Right / Left 915 Medesy / Hu Friedycryer''s Elevator-Medium Size- Right / Left 916 Medesy / Hu Friedycryer''s Elevator- Large Size-Right / Left 917 Double Angled Currette- Medium Size 918 Double Angled Currette- Large Size 919 Molt''s Perisoteal Elevator 920 Freer Periosteal Elevator 921 Walsham''s Nasal Forceps- Pair 922 Asche Septal Forceps 923 Hayton''s Williams Maxillary Forceps 924 Rowe''s Zygomatic Elevator 925 Sigmoid Notch Retractor ( Left / Right ) 926 Ramal Retractor 927 Wire Cutter 928 Wire Twister 929 Coronoid Retractor 930 Mastoid Self Retaining Retractor 931 Mandibular Lower Border Retractor 932 Condylar Retractor 933 Dingmann Retractor ( Adult ) 934 Vestibular Retractor 935 Swallow Tail Retractor 936 Curved Pterygoid Osteotome 8Mm 937 Curved Pterygoid Osteotome 10Mm 938 Epker Osteotome 4Mm / 6Mm / 8Mm Curved 939 Epker Osteotome 4Mm / 6Mm / 8Mm Straight With Marking 940 Orthodontic Model Boxes 941 Tongue Guard - Medium 942 Dontrix Gauge 943 Extraoral Force Gauge 944 Orthodontic Typodont Set ( With Wax Ridges And Teeth Set ) 945 Plaster Vibrator ( Worktop Area Of At Least 20 X 10 Cm, Adjustable Setting, 2 Years Warranty ) 946 Haematoxylin & Eosin Stain 947 Eosin & Negrosin Stain 948 V.G. Tube 949 Manipulation Pipette 950 Metallic Tvs Needle Guided Bracket 951 Syringe Non Rubber 1Ml 952 Granulocyte Colony Stimulating Factor 953 Pipelle Aspirator / Vabra Aspirator 954 Progesterone Gel 955 Injectable Progesterone 956 Latex Condom Without Spermicide 957 Osafe Incubator And Laminar Floor Cleaning Lotion 958 Fersafe Antiseptic Lotion 959 Liquid Nitrogen For Cryocan 960 Immunobeads Reagents ( Rabbit Anti Human Igg 961 Immunobeads Reagents ( Rabbit Anti Human Iga 962 Immunobeads Reagents ( Rabbit Anti Human Igm 963 Conical Dispo Beaker 3.0Ml 964 Prp Lens 965 Fac''s Tube ( 12 X 75Mm, 5Ml Round Bottom Test Tube, Snap, Sterile Cat: 352054 966 Kymograph Paper ( 100 Sheets ) 967 Perimetric Chart Paper ( 100 Sheets ) 968 Haemocytometer Box 969 Haemoglobinometer Sets 970 Dewar Tank 11 Litre 971 Cryo Pro - 500Ml ( Liquid Nitrogen Cryosurgical Equipment 972 Bulb For Telepack Lamp 973 Radiofrequency Electrode Round Loop Big 974 Radiofrequency Electrode Round Loop Small 975 Bacterial Filter Machine Sl No:101122008 976 Indirect Ophthalmoscope 977 20448-000Hgh Pressure Hose ( Erbe Cryo Unit ) ) 978 Bone Hand Drill Moore - 8448.28 979 Hand Drill Jacobs Chuck 980 Demartel Condf / Wire Sawsflex 350Mm 981 Twist Drill Set Of 3Mm, 3.5Mm 4Mm, 4.5Mm 982 Crocodile Forceps ( Ear Microsurgery ) 983 Ear Microsuction Tips 984 Adaptors For Ear Microsuction Tips 985 Cup Ear Forceps 986 Perforators For Stopedectomy 0.4Mm 987 Perforators For Stopedectomy 0.5Mm 988 Rigid Pharyngoscope ( Pediatric ) 20Cm 989 Tonsil Holding Forceps 990 Straight Pick ( Tympanyplasty ) 991 Back Biting Forceps For Endoscope Nasal Surgery 992 Fiberoptic Otoscope With Pneumatic Pump 993 Bismith Lodopyrrophosphate ( Bipp ) Paste / Powder 994 Mercurochrome Lotion 995 Haed Light Fot Ent 996 Endoscopic Biopsy Forceps With Needle 997 Cpr Manikin 998 Intubation Manikin 999 Easy Pump 1000 Mri Contrast Media - Gadoterate Meglumine Injection 5Mmmol / Ml. 10 Ml Vial 1001 Mri Contrast Media - Gadobenate Dimeglumine Injection 10Ml Vial 1002 Mri Contrast Media - Gadopentetate Dimeglumine Injection 0.5Mmol / Ml. 10 Ml Vial 1003 Mri Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5Ml 1004 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg - 50 Ml Vial 1005 Non -Ionic Contrast Media - Iopromide Injection: Usp 370Mg -100Ml Vial 1006 Non -Ionic Contrast Media - Iopromide Injection: Usp 300Mg -100Ml Vial 1007 Non -Ionic Contrast Media -Iobitridol 350Mg -100Ml Vial 1008 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -50Ml Vial 1009 Non -Ionic Contrast Media -Iomeprol Injection 300Mg -100Ml Vial 1010 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -50Ml Vial 1011 Non -Ionic Contrast Media -Iomeprol Injection 350Mg -100Ml Vial 1012 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -50Ml Vial 1013 Non -Ionic Contrast Media -Iomeprol Injection 400Mg -100Ml Vial 1014 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -50Ml Vial 1015 Non -Ionic Contrast Media -Iopamidol Injection 370Mg -100Ml Vial 1016 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20Ml Vial 1017 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50Ml Vial 1018 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100Ml Vial 1019 Coupland All Nos 1020 Elevators ( Cryer ) 1 Pairs 1021 Castrovejo Scissor 1022 Samll Micro Scissor 1023 Light Cure Composite A2 1024 Light Cure Composite A3 1025 Light Cure Composite A3.5 1026 H-Files For Size ( 15-40 ) 21Mm 1027 Tooth Polishing Brush 1028 Glide 1029 Gracy Currette 1030 Polyester Braided Suture * 2 75Cm Hgs-21, Blue 37Mm 1 / 2 Circle Taper Point : Size-2 1031 Polyester Braided Suture * 2 75Cm Hos-10, Blue 26Mm 1 / 2 Circle Reserve Cutting : Size-2 1032 Polyester Braided Suture * 1 75Cm Hos 12, Blue 40Mm 1 / 2 Circle Reserve Cutting Size -1 1033 Polyester Braided Suture * 5 75Cm Hos-14, Blue 57Mm 1 / 2 Circle Reverse Cutting Size-5 1034 Polyester Braided Suture * 25X75cm Kv-37, Blue 40Mm 1 / 2 Circle Tapercutting Size-2 1035 Poleyster Braided Suture * 54X75cm Kv-40, Blue 45Mm 1 / 2 Circle Tapercutting Size-5 1036 Monofilament Knotless Polyglyconate Wound Closure Device, 0 45Cm Gs-21, Green 37Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-0 1037 Monofilament Knotless Polyglyconate Wound Closure Device, 2-0 30Cm Cm V-20, Green 26Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size-2-0 1038 Monofilament Knotless Glycomer 631 Wound Closure Device, 3-0 45Cm P-14, Undyed 24Mm 3 / 8 Circle Resverse Cutting, Box Of 12 Foils Size- 3-0 1039 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 60Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1040 Polybutester Monofilament Suture With Polytribolate Coating Size-*6-0 75Cm 2Xcv-1X36, Blue 9Mm 3 / 8 Circle Taper Point Size:6--0 1041 Polybutester Monifilament Suture With Polytribolate Coating Size-*5-0, 75Cm 2Xcv-11X36, Blue 12Mm 3 / 8 Circle Taper Point 1042 Polybutester Monofilament Suture With Polytribolate Coating Size-*4-0 90Cm 2Xcv-23X36, Blue 17Mm 1 / 2Circle Taper Point Size: 4-0 1043 Polybutester Monofilament Suture With Polytribulate Coating Size-*5-0 90Cm2xcv, Blue 17Mm 1 / 2 Circle Taper Point Size: 5-0 1044 Polybutester Moniofilament Suture With Polytribulate Coating Size-*5-0, 75Cm 2Xkv-11X36, Blue 13Mm 3 / 8 Circle Tapercutting Size: 5-0 1045 Polybutester Monofilament Suture With Polytribolate Coating Size-* 7-0, 60Cm 2Xmv-175-8, Blue 8Mm 3 / 8 Circle Taper Point Size: 7-0 1046 Polybutester Monofilament Suture With Polytribolate Coating Size-*2-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1047 Polybutester Monofilament Suture With Polytribolate Coating Size-*3-0, 90Cm 2Xv-20X36, Blue 26Mm 1 / 2 Circle Taper Point 1048 Monofilament Knotless Glycomer 631 Wound Closure Device, 2-0 23Cm , Violet 27Mm 1 / 2 Circle Taper Point, Box Of 12 Foils Size- 2-0 1049 Vaccutrend Needle / Syringe 21" X 15" 1050 Vaccutrend Needle / Syringe 22" X 15" 1051 Vaccutrent Needle / Syringe 1052 Immunohistochemistry: 1053 Anti Pax-5 Ffpe 1054 Anti Ebv Ffpe 1055 Anti Pan Cmv Ffpe 1056 Anti Cd 68 Ffpe 1057 Anti Wti Ffpe 1058 Anti Plap Ffpe 1059 Anti C3 Ffpe 1060 Anti Sma Ffpe 1061 Anti Ar Ffpe 1062 Anti Bc16 Ffpe 1063 Anti Myogenin Ffpe 1064 Anti Idh-1 Ffpe 1065 Anti Atrx Ffpe 1066 Anti P63 Ffpe 1067 Anti Neurofilament Ffpe 1068 Anti Cd 19 Ffpe 1069 Anti Msa Ffpe 1070 Anti Adipophylin Ffpe 1071 Anti Alk D5f3 Ffpe 1072 Anti Arginase-1 Ffpe 1073 Anti B Catenin 1074 Bcl 10 Ffpe 1075 Anti Ber-Ep4 Ffpe 1076 Anti Clauclin 4 Ffpe 1077 Anti D2 - 40 Podolanin Ffpe 1078 Anti Dog 1 Ffpe 1079 Anti Sall 4 Ffpe 1080 Anti Erg Ffpe 1081 Anti Hbmeigg4 1082 Anti Inhilein Ffpe 1083 Anti Insm 1 Ffpe 1084 Anti Mammaglobin Ffpe 1085 Mart 1 Ffpe 1086 Anti Melan A Ffpe 1087 Anti Mdm2 Ffpe 1088 Anti Napsin A Ffpe 1089 Anti P40 Ffpe 1090 Anti Pax-8 Ffpe 1091 Anti Stat-6 Ffpe 1092 Anti Tle-1 Ffpe 1093 Anti Uroplalcin-2 Ffpe 1094 Anti Glycophorin Ffpe 1095 Anti Gcet-1 Ffpe 1096 Anti Cd 38 / 138 Ffpe 1097 Anti Calcitonin Ffpe 1098 Anti Caldermon Ffpe 1099 Anti B Caldermon Ffpe 1100 Anti Cd 56 Ffpe 1101 Anti Nsm Ffpe 1102 Anti Cd 99 Mic-2 , 013 Ffpe 1103 Anti Cd 138 Ffpe 1104 Anti Cdh 17 Cadherin 17 Ffpe 1105 Anti Heparii Ffpe 1106 Anti Glypican-3 Ffpe 1107 Anti Stab 2 Ffpe 1108 Anti Hrp Polymer Kit 1109 Fitc Lambda Light Chain Immunofluorescence 1110 Fitc Igm Immunofluorescence 1111 Fitc Iga Immunofluorescence 1112 Fitc Igg Immunofluorescence 1113 Fitc C3 Immunofluorescence 1114 Mlh1, Msh2, Msh6, Pms2 ( Together ) 1115 Pdl1 Clone Sp142 1116 Egfr Clone 31G7 1117 Cdx2 1118 Gata 3 1119 Ck 18 1120 Mesothelin 1121 Glut 1 1122 Gcdfp 1123 Myb 1124 Plag 1 1125 Hmga 2 1126 Eber In-Situ Hybridization 1127 Pcr 1128 Egfr Rt Pcr Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1129 Msi Detection Kit Compatible With Qiagen For Formalin Fixed Paraffin Embedded Ffpe Tissue 1130 Bcr-Abl1-Pcr Kit Compatible With Qiagen 1131 Fish 1132 Alk Mutation Break Apart Probe In Lung Adenocarcinoma 1133 Myb-Nfib Dual Colour Fusion Probe 1134 Myb Dual Colour Break Apart Probe 1135 Maml2 Dual Colour Break Apart Probe 1136 Etv6 Dual Colour Break Apart Rearrangement Probe 1137 Plag 1 Rearrangement Probe 1138 Hmga 2 Rearrangement Probe 1139 Immunofluorescence 1140 Anti P-Anca Direct Immunofluorescence 1141 Anti C-Anca Direct Immunofluorescence 1142 Anti Ana Direct Immunofluorescence 1143 Anti Aquaporin 4 1144 C1q 1145 Flowcytometry 1146 Cd 16 Apc 1147 Hla B27 Kit ( Should Be Compatible With Bd Facscalibur ) 1148 Elisa ( Mago-4 ) 1149 Anti P-Anca Elisa 1150 Anti C-Anca Elisa 1151 Anti Cyclic Citrulinated Peptide ( Ccp ) Elisa 1152 Anti Smith Elisa 1153 Anti Peroxiredoxin Vi ( Prx Vi ) Elisa 1154 Anti Bmi I Elisa 1155 Anti Matrix Metalloproteinase 7 ( Mmp7 ) Elisa 1156 Anti Ny Eso I 1157 Anti Scl 70 1158 Anti Urnp 1159 Chemicals And Consumables 1160 Proteinase K 1161 Pronase 1162 Fish Reagents : 1163 Poly L Lysine 1164 20X Saline Sodium Citrate ( 20X Ssc ) Salt, Molecular Grade 1165 1 M Nascn ( 1M Sodium Thiocyanate ) Salt, Molecular Grade 1166 Igepal @ Ca 630 1167 Rubber Cement 1168 Dapi 1169 Sodium Chloride ( Nacl ) , 58.44G Mol-1 Molecular Grade 1170 Sodium Citrate ( Na3c6h5o7 ) 258.06G Mol-1 Molecular Grade 1171 Fluorescence Microscopic Immersion Oil 1172 Immunofluorescence Reagents : 1173 Trypsin Powder, Molecular Grade 1174 Additional Consumables / Disposables 1175 15Mm Double Swivel With Port & Extension 1176 72 Hours Closed Ventilation Suction Catheter Must Have Double - Lumen Siliconised Catheter Swivel Connector Un-Coupling Wedge, Lockable Thumb –Valve End Cap, Softer Sleeve Material, 72 Hour Recommended During Of Use. Size: 12F, 14F, 16F 1177 Adjustable Circle Breathing System ( 2 Litre Bag, 2 Metre Length And 1.5 Metre Limb ) 1178 Adjustable Circle Breathing System ( 2 Mts Length ) 1179 Adult Curved Flared Prong With Tube1.8M Length 1180 Adult Curved Nasal Prong With Tube1.8M Length 1181 Adult Respi-Check High Concentration Oxygen Mask With Oxygen Tube 1182 Anti-Microbial Circle Breathing System ( 1.6 Metre Length And 0.8 Metre Limb ) 1183 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 1.6 Metre Length, 0.8 Metre Limb ) 1184 Anti-Microbial Circle Breathing System ( 2 Litre Bag, 2.4 Metre Length, 0.8 Metre Limb ) 1185 Apron Cloth ( Sterile ) 1186 Attest 1292 E Biological Indicator 1187 Attest Biological Indicator ( For Styeam ) 3M 1188 Attest Rapid Auto Reader Incubator ( For Steam ) ( Early Result For Biological Test ) 1189 Balanced Salt Solution ( Bss ) 1190 Bilbao-Dotter Tube With Guide Wire 1191 Bis Electrodes 1192 Bone File 1193 Bone Ronger 1194 Bp Blade With Handle ( No 15 & 17 ) 1195 Cardiac Troponin T Kit 1196 Center Hole Towel 1197 Coban Tm 4" 1198 Cols Light Source For Transillumination 1199 Contra Angle Hand Piece 1200 Disposable Face Mask ( Cloth ) 1201 Disposable Head Positioning Device For The Prone Position – Made Of Latex- Free Foam With Mirror For Providing The Clinician A Clear View Of Face, Eye & Endotrachael Tube Plus Sloted Design For Positioning Of Endotracheal On Either Side Of The Patient Face 8000Hdp 1202 Disposable Kelly''s Pad 1203 Ecg Monitoring Electrode ( Solid Hydrogel ) 1204 Ecg Monitoring Electrode With Foam Backing 2223 1205 Ecg Monitoring Electrode With Foam Backing Large 1206 Elastometric Infusion Pump For Analgesia 5Ml / Hour 1207 Elastometric Infusion Pump For Analgesia 2Ml / Hour Model Sv2 1208 Elevators ( Straight And Periostal ) 1209 Emergency Cricothyrotomy Device Adult 4Mm Id Children 2Mm Id 1210 Eye Wear For Composite Fillings 1211 Face Guard 1212 Fibre Splint 1213 Fluid Warming Cassette ( Disposable ) Wf-250 1214 Fluid Warming Cassette ( Disposable ) Wf-100 1215 Gigly Saw 1216 Glass Bead Sterilizer 1217 Tungsen Carbide Burs For Air Rotor And Micro Motor Hand Pieces 1218 Green Pvc Tubing For Oxygen 6 Mm, Length In Metres 1219 Iodixannol 320 Mg Iodine / Ml-100 Ml. 1220 Iohexol 300 Mg-Iodine / Ml 100 Ml 1221 Iomeron 400 Mg / Ml – 50 Ml. 1222 Ioversol / Iopamide / Iopamidol – 50 Ml. 1223 Iso Green Standard Laryngoscope System ( Disposable Plastic Blades ) 7 Sizes Of Mac And Miller Blades 1224 Jess Fixtators Pediatric / Large 1225 Jobson''s Probe 1226 Kinesiology Color Tap / Taping For Orthopaedic Used 1227 Killian''s Nasal Speculum 1228 K-Wires: 1.8Mm 1229 K-Wires: 4Mm 1230 K-Wires: 1.5 Mm 1231 K-Wires: 2.5 Mm 1232 K-Wires: 2Mm 1233 K-Wires: 3Mm 1234 Macintosh Style Blades 2, 4 1235 Magill’S Forceps Adult Child Infant 1236 Manual Plaster Cutting Saw 1237 Manual Plaster Spreader 1238 Manual Torniquet ( Cuff & Pump ) 1239 Mayo Stand Cover 1240 Miller Style Blades 0, 1241 Miller Style Blades 1 1242 Mortar And Pestle 1243 Mouth & Cheek Retractor 1244 Mouth Mirror 1245 Mri Compatible Laryngoscopes All Sizes 1246 Mri Film 14” X 17” 1247 Neopuff ( Neonatal Resuscitator ) 1248 North Nasal Preformed Cuffed Tubecuffed Must Have Ivory Pvc Profile Soft Seal Cuff, Implantation Tested Black Intubations Depth Marker, 15Mmconnector With 1S0 5356-1 Larger Cuff Resting Diameter Size: 6To 8Mm Id & Length 27Cm To 30.5 Tips To Nares 1249 Ovarian Shield ( Kiran ) 1250 Oxygen Supply Tubing For Heat & Moisture Exchanger Oxygen Supply Tubing For Heat & Moisture Exchanger With Connector To Attach Hme For Tracheostomy Tube Length 15Cm 1251 Oxygen Analyser 1252 Oxygen Blenders 1253 Para Film Roll ( Size 10Cmx125cm ) 3 “ Dia 1254 Parafilm, Roll 1255 Perineural Catheter For Continuous Plexus And Peripheral Nerve Blocks. Content: 118 G Lacoplex Needle With Centimeter Graduation 1 Perinueral Pebax Catheter ( 0.45 X 0.85Mm – 50Cm Long ) With Centimeter Distance Markings And Open Distal Tip 1 0.22 Antibacterial Filter 1 Additional Extension Tube, 50Cm Long, 1.5 X 2.5 Mm Dia, Priming Volume 1.10Ml 1 10Ml Syringe For The Aspiration Test 1 10 X 15 Cm Dermafilm Transparent Adhesive Dressing 1256 Periostal Elevators ( Small And Big ) 1257 Winged Infusion Set- Non Coring Needles With Injection Site To Access Ports, 20G X 1.00 ( Needle ) 1258 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-7Fr, 65Cm Length ( Ped ) 1259 Hickman-Broviac 4.2Fr ( Or Smaller ) Single Lumen Pediatric Cath W Stic Papais 1260 Hickman-Broviac 6.6Fr Single Lumen Pediatric Cath W Stic 90Cm 1261 Hickman-Double Lumen Tunneled Silicon Catheter With Sure Cuff Tissue In Growth Cuff, Size-9Fr, 90Cm Length ( Adult ) 1262 Plaster Cutter Electric 1263 Plaster Saw 1264 Plier Long Nose 1265 Pneumatic Compression Stocking 1266 Portable Autoclave Electrically Operated Made Of Aluminium Size:300Mm X 300Mm Capacity 24 Litres 1267 Portable Autoclave Electrically Operated Made Of Aluminium Size:350Mm X 300Mm-325Mm Depth: 1.5 Kw 1268 Pyridin 1269 Reusable Pressure Monitoring Cable With Integrity Check System By 100Mmhg Pressure And With Reusable Modular Clamp 1270 Reusable Pressure Transducer With Integrity Check System By 100Mmhg Pressure, With Microchip Technology, Reusable Cable, And With Reusable Clamp 1271 Ronguers ( Down Cutter ) 1272 Ronguers ( Up Cutter ) 1273 Rubber Macintosh 1274 Russian Forceps 1275 Light Weight Hernia Mesh, Pga Polypropylene 11 X 15 1276 Light Weight Hernia Mesh, Pga Polypropylene 6 X 11 1277 Seldinger Technique Catheter For Arterial Puncture Content: 1 Transparent And Xpo Cathter ( Pe ) / ( Ptfe ) 1 Intruducer Needle 1 Straight Wire 115.092 115.094 115.118 5118.702 5118.703 1278 Self Holding Retractors For Spine Surgery 1279 Single Use Resuscitation Mask For Cpcr ( Non-Return Valve, Integral Bacterial / Viral Filter ) 1280 Slide Mailer 1 Slide 1281 Slide Mailer 2 Slide 1282 Soap Dispenser 1283 Soda Lime ( Imported ) – Changes From White To Violet On Exhaustion 5Kg 1284 Sodium Hypochloride Solution 5Litre 1285 Spreader / Plugger 1286 Steinman Pins:4.5Mm 1287 Steinmann Pins 1288 Sterigage Chemical Indicator ( For Steam ) 3M 1289 Surgical Clipper 1290 Surgical Preparation Razor 1291 Thermal Videographic Printer ( Black & White ) ( Sony, Latest Up Series ) 1292 Tissue Paper For Ultrasound 1293 Ultra Violet Cabinet ( 800 / 500 X 2000 Mm ) 1294 Vacuum Assisted Dressing System 1295 Vascular Debeky Angle ( Medium ) 1296 Vascular Debeky Straight ( Medium ) 1297 Vaseline Gauze 1298 Ventilator 15 Mm Breathing Systems ( With Luer Lock, 1.6 Metre Length And Resealable Water Trap ) For Paediatrics 1299 Ventilator Breathing System With Resealable Water Traps ( Smooth Lumen ) 1300 Waste Management Wheeled Bins. ( 660Lit ; 300Lit; 1100 Lit ) 1301 Wire Cutter 1302 Y-Pieces For Breathing Circuit 1303 Absorbable Gelatin Sponge U.S.P ( Ab-Gel ) 10 X 10 1304 Alginate Impression Materials ( Dust Free ) 1305 Double Swivel With Port 15Mm 1306 Green Pvc Tubing 6Mm For Oxygen / Per Meter 1307 2 Mm Osteotomes 1308 3 Mm Osteotomes 1309 Asepto Pump 1310 Autoclavable Biohazard Plastic Bag 10Liter 1311 Autoclavable Biohazard Plastic Bag 20Liter 1312 Autoclavable Biohazard Plastic Bag 30Liter 1313 Bone Cement ( Plain ) 1314 Bone Cement ( Antibiotics ) 1315 Bougie ( Stylet ) 1316 Burretta 1317 Capd Catheter Tenckhoff With 2 Felt Cuffs Sa 1242 ( 420 Mm ) 1318 Cast Taper Mandrel 1319 Chiesel 1320 Cleaning Brush 1321 Cleaning Solution 1322 Cpr Manikin 1323 Stoma Flatmoldable Small 45Mm 1324 Stoma Flatmoldable Medium 45Mm 1325 Stoma Flatmoldable Regular 57Mm 1326 Stoma Flatmoldable Large 70Mm 1327 Moldable Convex 12 / 22Mm 1328 Moldable Convex 22 / 33Mm 1329 Moldable Convex 33 / 57Mm 1330 Ostomy Appliance Accessories Belt 1331 Coloured Ph Indicator Paper 1332 Dissecting Instrument Box 1333 Double Swivel With Port 15 Mm X 22Mm 1334 Drape Formers Trans Femoral 1335 Drape Formers Trans Tibial 1336 Espocan With Docking System 1337 Eto Chemical Indicator Tape -3M 1338 Eto Packing Sleeves Roll ( 3M ) 12'' 1339 Eto Packing Sleeves Roll ( 3M ) 4'' 1340 Eto Packing Sleeves Roll ( 3M ) 6'' 1341 Surgicel Fibrillar 1963 1342 G- Bone 1343 Gloves Wrapper 1344 Laparoscopic Aspiration Needle 1345 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 3.5Mm 1346 Hemorrhoids And Prolapsed Stapler With Detachable Anvil 4.8Mm 1347 Hose Mount 15Mm Female Male Pair 1348 Hose Mount 22Mm Female Male Pair 1349 Hygrobaby / Hme Filter ( Infant ) 1350 Hygroboy / Hme Filter ( Paediatric ) 1351 Hygrostar / Hme Filter ( Adult ) 1352 Hygrobac S 1353 Intraocular Lense 6Mm Optics Foldable, Square Edge, Hydrophobic 1354 Intraocular Lense Rigid 5.25Mm Optics, Pmma, Square Edge 1355 Intraocular Lense Rigid 5.5Mm Optics 1356 Intraocular Lense Rigid 5.5Mm Optics Foldable 1357 Intraocular Lense Rigid 6Mm Optics 1358 Intraocular Lense Rigid 6Mm Optics Foldable 1359 Intraocular Lense Rigid 6Mm Optics, Pmma, Square Edge 1360 Rigid Anterior Chamber Intraocular Lens: Lens Power +16D ( 6.00Mm ) 1361 Rigid Anterior Chamber Intraocular Lens: Lens Power +19D ( 6.00Mm ) 1362 Rigid Anterior Chamber Intraocular Lens: Lens Power +18D ( 6.00Mm ) 1363 Rigid Anterior Chamber Intraocular Lens: Lens Power +20D ( 6.00Mm ) 1364 Rigid Anterior Chamber Intraocular Lens: Lens Power +21D ( 6.00Mm ) 1365 Rigid Anterior Chamber Intraocular Lens: Lens Power +22D ( 6.00Mm ) 1366 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1367 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.5D ( 5.50Mm ) 1368 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +20.0D ( 5.50Mm ) 1369 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.0D ( 5.50Mm ) 1370 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +21.5D ( 5.50Mm ) 1371 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.0D ( 5.50Mm ) 1372 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +22.5D ( 5.50Mm ) 1373 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.0D ( 5.50Mm ) 1374 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +23.5D ( 5.50Mm ) 1375 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.0D ( 5.50Mm ) 1376 Rigid Posterior Chamber Intraocular Lens ( 5.50Mm Optic Diameter ) : Lens Power +24.5D ( 5.50Mm ) 1377 ( A ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +10.0D 6.0Mm 1378 ( B ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +113.5D 6.0Mm 1379 ( C ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+14.0D 6.0Mm 1380 ( D ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.0D 6.0Mm 1381 ( E ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+15.5D 6.0Mm 1382 ( F ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.0D 6.0Mm 1383 ( G ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+16.5D 6.0Mm 1384 ( H ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.0D 6.0Mm 1385 ( I ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+17.5D 6.0Mm 1386 ( J ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.0D 6.0Mm 1387 ( K ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+18.5D 6.0Mm 1388 ( L ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19..0D 6.0Mm 1389 ( M ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+19.5D 6.0Mm 1390 ( N ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.0D 6.0Mm 1391 ( O ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+20.5D 6.0Mm 1392 ( P ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.0D 6.0Mm 1393 ( Q ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+21.5D 6.0Mm 1394 ( R ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.0D 6.0Mm 1395 ( S ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+22.5D 6.0Mm 1396 ( T ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+23.0D 6.0Mm 1397 ( U ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power: +23.5D 6.0Mm 1398 ( V ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.0D 6.0Mm 1399 ( W ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+24.5D 6.0Mm 1400 ( X ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.0D 6.0Mm 1401 ( Y ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+25.5D 6.0Mm 1402 ( Z ) Foldable Posterior Chamber Intraocular Lens ( Alcon Acrysof Iq ) , Acrylic, Hydrophobic, Square Edge, Uv And Blue Light Filtering, Anterior Asymmetric Buconvec, Planar Haptics, Lens Power:+26.0D 6.0Mm 1403 Mayo Trolly Cover ( Disposable ) 1404 Membrane Assembly 1405 Micro Centrifuge Tube 1.5Ml 1406 Micro Centrifuge Tube 15Ml 1407 Micro Centrifuge Tubes-.2Ml ( With Thin Wall For Pcr ) 1408 Micro Centrifuge Tubes-.5Ml ( With Thin Wall For Pcr ) 1409 Micro Centrifuge Tubes-2Ml 1410 Microscope Bulb- 6V 20W 1411 Mini & Micropates With Screw 1412 Nasal Tubing 70Mm 1413 Needle ( Cutting ) Big 1414 Needle ( Cutting ) Medium 1415 Needle ( Cutting ) Small 1416 Needle ( Round Body ) Big 1417 Needle ( Round Body ) Medium 1418 Needle ( Round Body ) Small 1419 Non Invasive Cardiac Output Monitoring Electrode 1420 Non Invasive Cardiac Pacing Electrode 1421 Ostomy Powder 25Gm 1422 Pneumatic Compression Stocking 1423 Pressure Monitoring Kit With Three Way Disposable Pressure ( For Cvp & Atrerial ) 1424 Rae Tub 7.5 1425 Self Adhesive Urine Sample Bag - Pediatric 1426 Spirit Swabs 1427 Sterile Swab Sticks 1428 Steri-Stripes 1429 Esmarch 4" 1430 Esmarch 6" 1431 Polyester Synthetic Cast Padding 1432 Suction Cannula For Mtp Size Purandre 1433 Ostomy Appliance Accessories Belt 1434 Stomadress Plus Single Pouch - Opaque 1435 Activelife One Pc Drainable Pouch 1436 Tubing Kit 1437 Urianalyser 1438 Urine Control A360 1439 Ventilating Airway Bougies 1440 Ventilator Tubing W / 1 ( Venti Breathing System With Reseable Water Trap ) 1441 Y-Pieces 1442 6Mm Green Pvc Tubing For Oxygen 1443 Alpha Mattress 1444 Analspeculum Size: 25 1445 Ao Universal Clamps 1446 Baby Cradle With Mattress And Net 1447 Blood Gas Quality Control ( 30X1.7Ml ) Level 1 ( Abg ) 1448 Blood Gas Quality Control ( 30X1.7Ml ) Level 2 ( Abg ) 1449 Blood Gas Quality Control ( 30X1.7Ml ) Level 3 ( Abg ) 1450 Bone Cutter 1451 Bone Cutter Big Size 1452 Centrifuge Tube 1453 Centrifuge Tubes, Polypropylene Seal With Capacity 3.5 - 10 Ml 1454 Clavicular Braces 1455 Cider Wood Oil 1456 Debakey’S Bull Dog Clamps, Curved 115Mm ( 4 ½” ) Long 1457 Debakey’S Bull Dog Clamps, Curved 70Mm ( 2 ¾” ) Long 1458 Debakey’S Bull Dog Clamps, Curved 80Mm ( 3 ?” ) Long 1459 Debakey’S Bull Dog Clamps, Straight 120Mm ( 4 ¾” ) 1460 Debakey’S Bull Dog Clamps, Straight 75Mm ( 3” ) 1461 Debakey’S Bull Dog Clamps, Straight 85Mm ( 3 ?” ) 1462 Divided Mattress 1463 Dropper Bottle 250Ml 1464 Dropper Bottle 500Ml 1465 Dropper P.P. 6 Long 1466 Npwt Dressing Kit 1467 Silicone Rubber Heel Cups 1468 Electrodes For Ift ( For Combination Therapy-Ultra Sound Therapy + Electrical Stimulator ) ( Make: Enraf Nonius Sonoplus 491 ) 1469 Episiotomy Scissor Size 15Cm 1470 Fixation Ring ( 904-898 ) 1471 Fixation Ring ( 904-898 ) For Transcutaneous Po2 / Pco2 ( Make: Radiometer, Model: Tcm 40 ) 1472 Fluid Warmer 1473 Fogging Machine 1474 G-Bone 1475 Gigly Saw 1476 Ginevri Capillary Tube ( H ) ( Microbillimeter ) 1477 Glover With Atraumatic Jaws, Curved Jaws, 85Mm ( 3 ?” ) , 45Mm Jaws 1478 Hand Drill 1479 Hand Wash Basin Stand ( Double ) . - Five Legs Base Mounted On 5Cms Dia Castors With One 35Cm S.S Basin.Pre Treated And Epoxy Powder Coated. 1480 Hysterectomy Clamp ‘Faure’ 1481 I.V. Drip Stand 1482 Intra Uterine Cannula ‘Collins’ Plain 3 Size 1483 Intra Uterine Cannula ‘Hayes Provis’ With Rubber Cone 1484 Kidney Wash Machine ( Renatron Ii ) 1485 Knee Immobilizer Oc 2035 1486 Knee Immobilizer Oc 2035 1487 Knee Stabilizer-Dc 2069 1488 Leishmans Stain 1489 Lengenback Retractor 1490 Lengenback Retractor 1491 Lens Cleaning Paper 1492 Lymph Node 1493 Magnet For Ecg 1494 Malleable Stylets With Adjustable Stop, Different Size 1495 Measuring Tape 1496 Measuring Tape ( Clinical ) 1497 Microscope ( For Side Lab ) - Binocular Electric Light Microscope 1498 Molina Sheet 1499 Mosquito Net ( Single Use Patient Specific, Plastic ) 1500 Mouth Gag 1501 Myoma Screw ‘Doyen’ 1502 Na+ - Sensor Casing ( Abg ) 1503 Non Invasive Glucose Monitoring System ( Glucometer ) 1504 Ounce Glass Steel 1505 Oxygen Cylinder Stand / Trolley - B Type 1506 Pad Electrodes For Swd ( Dx 500 Roland ) 1507 Paper Roll ( Abg ) 1508 Patient Breathing Set Infant Reusable ( Galileo Gold ) 1509 Patient Cable For Ift / Mst ( Make / Model: Multidyne 965 ) 1510 Patient Shifting Trolleys With The Facility Of Oxygen Cylinder Carrier 1511 Pelvic Traction Kit With Pulley And Weight 1512 Pile Binder 1513 Plastic Dropping Bottle ( 120Ml ) 1514 Plastic Small Tube 1515 Raos Hand Suction Unit 100 Ml 1516 Ref. - Membrane Shell ( Abg ) 1517 Resucitation Kits Automatics 1518 Resuscitation Kit Emergency 1519 Resuscitation Kit For Neonates 1520 Rubber Sole - 4Mm 1521 Sample Detector 1522 Screw Driver 1523 Sealing Rings 1524 Set Tubing For Roller Pump ( Reagents ) ( Abg ) 1525 Shin Tube Cutting Jig 30Mm 1526 Shin Tube Cutting Jig 35Mm 1527 Short Needle Holder 1528 Side Support ( Meditrin ) 1529 Silicon Tubal Ring 1530 Solid Waste Containers Liners 1531 Solution Valve 1532 Spare Canvas Bag 1533 Spare Lamp For Opthalmoscope 1534 Spare Parts For: Easylyte, 911 , 912 & Others 1535 Spirit Lamp 1536 Stich Scissor 1537 Suture Anchor ( Orthopaedics ) 1538 Syringe Infusion Pump 1539 T- Handle For Orthopaedics 1540 Tailor Thread 1541 Tco2 Sensor 1542 Teley''s Forcep 1543 Vortex Mixer 1544 Vulsellum Forceps 1 X 1 Teeth 25Cm 1545 Wire Cutter 1546 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure ) 1547 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Low Pressure ) 1548 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene. 1549 Ventriculo Peritoneal Shunt- The System Is Supplied Complete With A Ventricular Catheter 15Cm Long, A Unitised Shunt Assembly With A Distal Catheter And Two Straight Connectors, This Pack Is Sterilized By Ethelene Oxide ( Medium Pressure With Bacterial Resistance ) 1550 Manual Hub Cutter – With Biohazard Symbol And Which Can Cut The Plastic Hub And Not The Metal Needle With Temporary And Permanent Locking Mechanism On Complete Filling Of The Disposal Hub Cutter With Clear Demarcation Of Fill Line And Which Can Accomadate Upto 400-600 Needles. 1551 Cerebral Reservior ( Omaya Type ) 1552 Extranal Ventricular Drainage Syatem 1553 Lumbar Extranal Drainage System 1554 Poly Propylene Mesh ( Small ) For Duroplasty 1555 Poly Propylene Mesh ( Medium ) For Duroplasty 1556 Poly Propylene Mesh ( Large ) For Duroplasty 1557 G Bone Cement ( For Cranioplasty ) 1558 Kraniotomy Drape 1559 Iodine Drape Large 1560 Balanced Salt Solution With Na / K / Mg & Chloride Levels Similar To Plasma With Acetate & Gluconate / Malate As Buffer, Must Not Contain Calcium ( Eg.Plasmalyte A / Volulyte Etc ) 1561 Bactiseal Impregnated Shunt - Fda Approved, Fixed Pressure Vp Shunts ( Low, Medium, High ) That Are Antibiotic Impregnated And Can Reduce The Potential For Bacterial Colonization In The Lumen As Well As Its Outer Surface. 1562 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1563 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1564 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1565 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1566 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1567 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1568 Progeammable Shunts - Fda Approved, Programmable Shunts ( Valve Systems ) With 18 Different Pressure Settings For Precise Pressure Adjustment S To Help Control Intracranial Pressure And Ventricle Size. 1569 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1570 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1571 Perforators - Fda Approved, Sterile , Disposables Perforators With Different Size Of 14Mm, 11Mm, 9Mm With Dura Guard Technology. 1572 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1573 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1574 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1575 Dura Form - Fda Approved, Collagen Based, Biocompatible Dural Graft Implants With Greater Tear And Leak Resistance With Capabilities Of Wet Handling And Available In Various Sizes . 1576 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1577 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1578 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1579 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1580 Surgical Patties - Fda Approved, Surgical Patties Made Of Cottonoid Compreessed Rayon Which Is X-Ray Detectable With The Absorboing Power Of More 5 Times Their Weight In Less Than A Second. 1581 Raneys Scalp Disposable Clips - Disposable Raney''s Clips 1582 Cranioplasty Kit - Cranioplasty Kit, Sterile, Pack Of Two Packets Of Methyl Methacrylate And Two Vials Of Liquid. 1583 Universal Extremity Drape- Control Plus Fabric, Us Fda Certified 1584 Impervious Split Sheet- 60" X 70", 4" X 21" Split, Polyethylene Sheet, Us Fda Certified 1585 U-Bar-Pack- 1 Back Table Cover-Reinforced 44" X 88", 1 Mayo Stand Cover Reinforced 23" X 54", 1 Suture Bag, 1U Drape 71" X 124", 1 Bar Drape 71" X 124", 1 Bar Drape 41.5" X 82", Us Fda Certified 1586 Back Table Cover Zone Reinforced- 44" X 99", Us Fda Certified 1587 Impervious Stockinette-12" X 58", Uds Fda 1588 Fluid Shield Mask With Visor -Four Layer Mask, Water Resistant With Water Resistant, -Naosh, Osha Approved 1589 Hip Drape With Leg Pockets -Control Plus Fabric, Us Fda Approved 1590 Hip Drape Without Leg Pockets -Control Plus Fabric, Us Fda Approved 1591 Quattro Fx -Full Face Mask Vented 1592 Mirage Fx- Nasal Mask Vented 1593 Transmission Electron Microscope 1594 G011 / 2 Glut Em 25% Amps 1595 Self Closing Tweezer ( Biology ) T-403 1596 O001 Osmium Tetroxide 1597 Eukitt Mouning Media 1598 Taab Araldite 502 / 812 Kit ( E2o2 ) 1599 Dibutyl Phthalate 1600 E069 Embedding Mould Flat C 1601 Z10 Molecular Seive 3Nm For Drying Acetone 1602 Shaving Razor Blade 1603 300 Mesh Cu Grid With Thin Carbon Film ( Cu - 300Cn 1604 300M Mesh Cu Grid With Holey / Dbl Carbon Film ( Cu-300Hd 1605 G062 Grid Storage Box 1606 U007 Uranyl Acetate 1607 L018 Lead Citrate 1608 Truf 2208-100 1609 Octagon Magnetic Stirrer Bar ( 4151 ) 1610 Consumables 1611 Micro Tips ( 10Micro Litre ) 1612 Microcentrifuge Tube

Corrigendum Details

Sr No CorrigendumDate Corrignedum CorrigendumType NewSubmissionDate
1 20-Jan-202 Extension Date 21-02-2020
2 13-Feb-202 Date Extensionn2 Date 05-03-2020
3 03-Mar-202 Extension2 Date 17-04-2020
4 10-Nov-202 Date Extension November Date 04-12-2020
5 27-Nov-202 Amendment Fee 04-12-2020

Key Value

Document Fees
Refer document
EMD
INR 30000.00 /-
Tender Value
INR 30 Lakhs /-

BOQ Items

Description of Stores /Items: Open e-Tender for processing of Chemicals, Reagents, Glassware, Instruments, Surgicals, Contrast, etc for the Institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later.
Sl. No. Item Description Item Code / Make Quantity Units
1 1.01 Albumin Item1 1 per ml
2 1.02 Microalbumin Item2 1 per ml
3 1.03 Gamma Glutamyl Tranferase Item3 1 per ml
4 1.04 (??- GGT) Item4 1 per ml
5 1.05 Amylase Item5 1 per ml
6 1.06 Lipase Item6 1 per ml
7 1.07 CK Item7 1 per ml
8 1.08 CK-MB Item8 1 per ml
9 1.09 LDH Item9 1 per ml
10 1.1 Total Cholesterol Item10 1 per ml
11 1.11 Triglyceride Item11 1 per ml
12 1.12 HDL Item12 1 per ml
13 1.13 LDL Item13 1 per ml
14 1.14 Calcium Item14 1 per ml
15 1.15 Copper Item15 1 per ml
16 1.16 Phosphorus Item16 1 per ml
17 1.17 Zinc Item17 1 per ml
18 1.18 Parameter Item18 1 per ml
19 1.19 Iron Item19 1 per ml
20 1.2 TIBC Item20 1 per ml
21 1.21 ADA Item21 1 per ml
22 1.22 ADA Calibrator Item22 1 per ml
23 1.23 G-6-PD Item23 1 per ml
24 1.24 Glycosylated Hb Item24 1 per ml
25 1.25 Glycosylated Hb Calibrator Item25 1 per ml
26 1.26 CRP Item26 1 per ml
27 1.27 CRP Calibrator Item27 1 per ml
28 1.28 a-1 Acid Glycoprotein Item28 1 per ml
29 1.29 Ammonia Item29 1 per ml
30 1.3 Lactate Item30 1 per ml
31 1.31 Glutathione Peroxidase Item31 1 per ml
32 1.32 Superoxide dismutase Item32 1 per ml
33 1.33 Total Antioxidant Status Item33 1 per ml
34 1.34 Homocysteine Item34 1 per ml
35 1.35 ASO Item35 1 per ml
36 1.36 RF Item36 1 per ml
37 1.37 Lipoprotein (a) Item37 1 per ml
38 1.38 Lipoprotein (a) Calibrator Item38 1 per ml
39 1.39 Transferrin Item39 1 per ml
40 1.4 Cystatin C Item40 1 per ml
41 1.41 Gentamycin Item41 1 per ml
42 1.42 Barbiturates Item42 1 per ml
43 1.43 Valproic Acid Item43 1 per ml
44 1.44 Phenitoin Item44 1 per ml
45 1.45 VMA Item45 1 per ml
46 1.46 Galactosemia Item46 1 per ml
47 1.47 Calcitonin Item47 1 per ml
48 1.48 Calcitriol Item48 1 per ml
49 1.49 Galactokinase Item49 1 per ml
50 1.5 Galactose-1-phosphate uridyl transferase Item50 1 per ml
51 1.51 Renin Item51 1 per ml
52 1.52 ACTH Item52 1 per ml
53 1.53 Interleukin 1 Item53 1 per ml
54 1.54 Interleukin 4 Item54 1 per ml
55 1.55 Interleukin10 Item55 1 per ml
56 1.56 Leukotrine A4 Item56 1 per ml
57 1.57 Leukotrine B4 Item57 1 per ml
58 1.58 Leukotrine C4 Item58 1 per ml
59 1.59 Leukotrine D4 Item59 1 per ml
60 1.6 Leukotrine E4 Item60 1 per ml
61 1.61 TNFa Item61 1 per ml
62 1.62 Cephalosporin Item62 1 per ml
63 1.63 Serum tryptase Item63 1 per ml
64 1.64 Urine fluoride Item64 1 per ml
65 1.65 Anti-dsDNA Antibody Item65 1 per ml
66 1.66 Anti nuclear antibody Item66 1 per ml
67 1.67 Anti-sm Antibody Item67 1 per ml
68 1.68 Sodium carbonate Item68 1 per gm
69 1.69 Potassium Dihydrogen Phosphate Item69 1 per gm
70 1.7 Potassium Dihydrogen Phosphate KH2PO4 (HPLC grade) Item70 1 per gm
71 1.71 Creatinine powder Item71 1 per gm
72 1.72 Isopropyl alcohol, AR Grade Item72 1 per ml
73 1.73 Acetone – AR grade AR grade Item73 1 per ml
74 1.74 Ammonium chloride –AR grade, Item74 1 per gm
75 1.75 Ammonium nitrate – AR grade, Item75 1 per gm
76 1.76 Ammonium persulphate – AR grade, Item76 1 per gm
77 1.77 Calcium chloride dihydrade – AR grade, Item77 1 per gm
78 1.78 Dinitro phenyl hydrazine AR grade, Item78 1 per gm
79 1.79 Magnesium chloride – AR grade, Item79 1 per gm
80 1.8 Magnesium sulfate –AR grade, Item80 1 per gm
81 1.81 Methanol – Acetone free – HPLC grade, Item81 1 per ml
82 1.82 Methanol (HPLC grade) Item82 1 per ml
83 1.83 Potassium dichromate – AR grade, Item83 1 per gm
84 1.84 Silver nitrate – AR grade, Item84 1 per gm
85 1.85 Sodium bicarbonate – AR grade, Item85 1 per gm
86 1.86 Sodium acetate dehydrate –AR grade, Item86 1 per gm
87 1.87 Ammonium acetate – AR grade, Item87 1 per gm
88 1.88 Thio semi carbazide – AR grade, Item88 1 per gm
89 1.89 Ethidium bromide soln 10ml– Biotechnology grade, Item89 1 per ml
90 1.9 Guanidium iso thiocyanate – Biotechnology grade, Item90 1 per gm
91 1.91 IPTG AR grade, Item91 1 per gm
92 1.92 100 bp DNA ladder 1 ml X 5 Item92 1 per gm
93 1.93 Taq Polymerase with PCR buffer 3-5 U/µl, 1000 U per vial Item93 1 per gm
94 1.94 dNTPs 100 millimolar each Item94 1 per ml
95 1.95 EcoRI restriction enzyme 0.5 ml X 1 Item95 1 per ml
96 1.96 BamHI 0.5 ml X 1 Item96 1 per ml
97 1.97 HinDIII 0.5 ml X 1 Item97 1 per ml
98 1.98 DNA ligase 0.5 ml X 1 Item98 1 per ml
99 1.99 DNA extraction kit(column based) for 50 extraction Item99 1 per ml
100 2 RNA extraction kit(column based) for 20 extraction Item100 1 per ml
101 2.01 Plasmid extraction kit(column based) for 50 extraction Item101 1 per ml
102 2.02 Oligo nucleotide primers (HPLC purification) Item102 1 per ml
103 2.03 RNAlater Item103 1 per ml
104 2.04 DEPC mol bio grade Item104 1 per ml
105 2.05 Nuclese K Item105 1 per ml
106 2.06 Milipore Prefiltrate Kit Cartridge Item106 1 pc
107 2.07 Milipore Proguard 2 Pack Cat. No. PROG0002 Item107 1 pc
108 2.08 Milipore Q Guard 1 Cat. No. QGARD00R1 Item108 1 pc
109 2.09 Milipore Tank Vent Filter Cat. No. TANKMPK01 Item109 1 pc
110 2.1 Milipore Sanitization Tablet Cat. No. ZWCL01F50 Item110 1 pc
111 2.11 Millipore millicare Elix cat no JMBM01747 Item111 1 pc
112 2.12 Millipore Quantum Ex cat. No- QTUM000Ex Item112 1 pc
113 2.13 MX cart 5 micron Item113 1 pc
114 2.14 MX cart 1 micron Item114 1 pc
115 2.15 RO cartridge Item115 1 pc
116 2.16 Non sterile millipak 40 Item116 1 pc
117 2.17 Progard TS 2 Item117 1 pc
118 2.18 1 micron filter Item118 1 pc
119 2.19 3 micron filter Item119 1 pc
120 2.2 MX cartridge 5 µm Item120 1 pc
121 2.21 20 '' carbon cartridge Item121 1 pc
122 2.22 Sanitization tablets Item122 1 pc
123 2.23 PM kit Item123 1 pc
124 2.24 XL wash solution Item124 1 per ml
125 2.25 200-1000 µl microtips Item125 1 pc
126 2.26 100-200 µl microtips Item126 1 pc
127 2.27 5-50 µl microtips Item127 1 pc
128 2.28 1-5 ml microtips Item128 1 pc
129 2.29 200-1000 µl micropipette Item129 1 pc
130 2.3 100-200 µl micropipette Item130 1 pc
131 2.31 5-50 µl micropipette Item131 1 pc
132 2.32 2-20 µl micropipette Item132 1 pc
133 2.33 Microcentrifuge tube 1.5ml Item133 1 pc
134 2.34 Ammonium persulphate AR Item134 1 per gm
135 2.35 Potassium iodate (KIO3) Item135 1 per gm
136 2.36 Toluene AR Item136 1 per ml
137 2.37 Arsenous acid(As2O3) Item137 1 per ml
138 2.38 Arsenic trioxide Item138 1 per ml
139 2.39 Ceric ammonium sulphate Item139 1 per gm
140 2.4 20bp DNA ladder Item140 1 pc
141 2.41 TRIS – base AR grade Item141 1 per gm
142 2.42 Fok I & NlaIII restriction enzyme Item142 1 pc
143 2.43 DNA loading buffer Item143 1 pc
144 2.44 DNA sample loading dye Item144 1 pc
145 2.45 Ethiduim bromide Item145 1 pc
146 2.46 Primer (Both forward & reverse) Item146 1 pc
147 2.47 10 X TBE Item147 1 pc
148 2.48 Heparinised vial Item148 1 pc
149 2.49 Disposable syringe Item149 1 pc
150 2.5 Microwave oven Item150 1 pc
151 2.51 Glucose kit Item151 1 per kit
152 2.52 Bilirubin Kit Item152 1 per kit
153 2.53 G6-PD kit Item153 1 per kit
154 2.54 Vacutainer Item154 1 pc
155 2.55 Disposable syringe Item155 1 pc
156 2.56 Cystatin C kit Item156 1 per kit
157 2.57 Bilirubin Kit Item157 1 per kit
158 2.58 Creatinine kit Item158 1 per kit
159 2.59 AST kit Item159 1 per kit
160 2.6 ALT kit Item160 1 per kit
161 2.61 ISE wash 2 solution Item161 1 per ml
162 2.62 ISE cal-3 solution Item162 1 per ml
163 2.63 ISE cal -4 solution Item163 1 per ml
164 2.64 Microcentrifuge tube 2ml Item164 1 pc
165 2.65 SP kit Item165 1 per kit
166 2.66 Rep prep solution Item166 1 per ml
167 2.67 Sample applicator Item167 1 pc
168 2.68 Disposable sample cup Item168 1 pc
169 2.69 AST Item169 1 per test
170 2.7 ALT Item170 1 per test
171 2.71 Creatinine Item171 1 per test
172 2.72 Albumin Item172 1 per test
173 2.73 Glucose Item173 1 per test
174 2.74 GGT Item174 1 per test
175 2.75 BUN Item175 1 per test
176 2.76 HDL cholesterol Item176 1 per test
177 2.77 LDL cholesterol Item177 1 per test
178 2.78 Cholesterol Item178 1 per test
179 2.79 UIBC Item179 1 per test
180 2.8 RF RTG latex Item180 1 per test
181 2.81 CRP Item181 1 per test
182 2.82 Uric acid Item182 1 per test
183 2.83 Triglyceride Item183 1 per test
184 2.84 ALP Item184 1 per test
185 2.85 Total bilirubin Item185 1 per test
186 2.86 IgG Item186 1 per test
187 2.87 Direct bilirubiun Item187 1 per test
188 2.88 IgM Item188 1 per test
189 2.89 Protein Item189 1 per test
190 2.9 IgA Item190 1 per test
191 2.91 Phosphorus Item191 1 per test
192 2.92 C3 Item192 1 per test
193 2.93 Calcium Item193 1 per test
194 2.94 CK-MB Item194 1 per test
195 2.95 Lipase Item195 1 per test
196 2.96 ASO Item196 1 per test
197 2.97 Iron Item197 1 per test
198 2.98 C4 Item198 1 per test
199 2.99 Amylase Item199 1 per test
200 3 CK Item200 1 per test
201 3.01 Acid phosphatase Item201 1 per test
202 3.02 Transferrin Item202 1 per test
203 3.03 LDH Item203 1 per test
204 3.04 Magnessium Item204 1 per test
205 3.05 HB-DH Item205 1 per test
206 3.06 Haptoglobin Item206 1 per test
207 3.07 Lactate Item207 1 per test
208 3.08 Microalbumin Item208 1 per test
209 3.09 Microalbumin calibrator Item209 1 per test
210 3.1 Cholinesterase Item210 1 per test
211 3.11 Urine CSF protein Item211 1 per test
212 3.12 Wash solution Item212 1 per ml
213 3.13 Cleaning solution Item213 1 per ml
214 3.14 Cleaning solution weekly wash Item214 1 per ml
215 3.15 CRP latex calibrator Item215 1 per test
216 3.16 Urine calibrator Item216 1 per test
217 3.17 System calibrator Item217 1 per test
218 3.18 HDL calibrator Item218 1 per test
219 3.19 LDL calibrator Item219 1 per test
220 3.2 CRP calibrator Item220 1 per test
221 3.21 RF calibrator Item221 1 per test
222 3.22 CK-MB calibrator Item222 1 per test
223 3.23 Xl-300/600 cuvette Item223 1 pc
224 3.24 Beckman coulter AU 2700 cuvettes Item224 1 pc
225 3.25 Xl-300/600 Lamp Item225 1 pc
226 3.26 Beckman coulter AU 2700 lamp Item226 1 pc
227 3.27 EQAS (Bio-Rad) Item227 1 per test
228 3.28 ApoA1 & ApoB reagent & calibrator Item228 1 per test
229 3.29 Bio-Rad lipid conrol Item229 1 per test
230 3.3 Ethylene Glycol (Ethandiol Item230 1 pc
231 3.31 Methylene Soluble (working Reagent Item231 1 pc
232 3.32 Tissue Capsule Big Item232 1 pc
233 3.33 Tissue Capsule Small Item233 1 pc
234 3.34 Tissue Cassettes Big Item234 1 pc
235 3.35 Tissue Cassettes Small Item235 1 pc
236 3.36 Stock Phloxine B Item236 1 pc
237 3.37 Progesterone Receptor Item237 1 pc
238 3.38 ANA Kit for SLE (Indirect Immunoflurescence Method) Item238 1 per test
239 3.39 Hb/Cayanaid Method standard Item239 1 pc
240 3.4 Nalidixid 10ug Item240 1 per disc
241 3.41 Netilmycin 10ug Item241 1 per disc
242 3.42 Furozotidime 30ug Item242 1 per disc
243 3.43 Antigen and antibody HCV ELISA test kits Item243 1 per test
244 3.44 Cell counter reagents Item244 1 pc
245 3.45 (Machine available is ABX pentra which is a closed system) Item245 1 per gm
246 3.46 Reagent for APTT Item246 1 per test
247 3.47 Calcium Chloride for APTT estimation Item247 1 per test
248 3.48 Control plasma N Item248 1 per test
249 3.49 Reaction tube Item249 1 per test
250 3.5 CA CLEAN Item250 1 per test
251 3.51 OWRENS Veronal buffer Item251 1 per test
252 3.52 Standard Human Plasma Item252 1 per test
253 3.53 Sodium Azide (NaN3) Item253 1 per test
254 3.54 Bovine thrombin Item254 1 per test
255 3.55 1000 NIH units/ mg of protein Item255 1 per test
256 3.56 Anti DCE Item256 1 per test
257 3.57 Sc(1) Item257 1 per test
258 3.58 Sc(2) Item258 1 per test
259 3.59 Sc(3) Item259 1 per test
260 3.6 Yt(a) Item260 1 per test
261 3.61 Yt(b) Item261 1 per test
262 3.62 Do(a) Item262 1 per test
263 3.63 Do(b) Item263 1 per test
264 3.64 PYR Broth Item264 1 per gm
265 3.65 PYR -Pyrolidonyl-ß naphthylamine Item265 1 per test
266 3.66 Paradimethylaminobenzaldehyde Item266 1 per ml
267 3.67 P-dimethylaminocinamaldehyde Item267 1 pc
268 3.68 p-nitrophenylglycerol Item268 1 pc
269 3.69 Potassium Telurite Item269 1 pc
270 3.7 Potassium Cyanide (KCN) Item270 1 per gm
271 3.71 Para dimethyl aminobenzaldehyde Item271 1 per ml
272 3.72 Potassium hydroxide Item272 1 per gm
273 3.73 Potassium Hydrogen Sulphate Item273 1 per gm
274 3.74 Phenol Crystal (powder) Item274 1 per gm
275 3.75 Phosphate Buffer Saline Item275 1 per ml
276 3.76 Phenethyl alcohol Item276 1 per ml
277 3.77 Phenol red indicator Item277 1 per ml
278 3.78 Phenol red indicator Item278 1 per gm
279 3.79 Phenol red Item279 1 per gm
280 3.8 Phenylpyruvic acid Reagent Item280 1 pc
281 3.81 Potassium dichromate LR Item281 1 per gm
282 3.82 Potassium permanganate LR Item282 1 per gm
283 3.83 Potassium permanganate AR Item283 1 per gm
284 3.84 Potassium Phosphate monobasic Item284 1 per gm
285 3.85 Potassium Nitrate Item285 1 per gm
286 3.86 Phenol (Crystal) Item286 1 per gm
287 3.87 Peptone Item287 1 per gm
288 3.88 Raffinose AR Item288 1 per gm
289 3.89 Rhammnose Item289 1 per gm
290 3.9 Sodium/ Potassium Dichromate Item290 1 pc
291 3.91 Sodium citrate Item291 1 per ml
292 3.92 Sodium Pyruvate AR Item292 1 per gm
293 3.93 Sodium Biocarbonate LR Item293 1 per gm
294 3.94 Sodium acetate Item294 1 per gm
295 3.95 Sodium Iodide Item295 1 per gm
296 3.96 Sulphanilamine-AR Item296 1 per gm
297 3.97 Sugar assimilation disc – Cellobiose Item297 1 pc
298 3.98 Sugar assimilation disc – Dextrose Item298 1 pc
299 3.99 Sugar assimilation disc – Dulcitol Item299 1 pc
300 4 Sugar assimilation disc – Galactose Item300 1 pc
301 4.01 Sugar assimilation disc – Inositol Item301 1 pc
302 4.02 Sugar assimilation disc – Lactose Item302 1 pc
303 4.03 Sugar assimilation disc – Maltose Item303 1 pc
304 4.04 Sugar assimilation disc – Melibiose Item304 1 pc
305 4.05 Sugar assimilation disc - Raffinose Item305 1 pc
306 4.06 Sugar assimilation disc- Sucrose Item306 1 pc
307 4.07 Sugar assimilation disc – Trehalose Item307 1 pc
308 4.08 Sugar assimilation disc - Xylose Item308 1 pc
309 4.09 Salicin AR Item309 1 per gm
310 4.1 Tarric Acid Item310 1 per gm
311 4.11 Trehalose Ar Item311 1 per gm
312 4.12 Triypticase Item312 1 per gm
313 4.13 Thiosulphate Item313 1 per ml
314 4.14 Tri-Sodium Citrate Item314 1 per gm
315 4.15 Voges proskaeur reagent Item315 1 pc
316 4.16 Vibriostatic (0/129) Agent Item316 1 per ml
317 4.17 Wright’s Stain Item317 1 per gm
318 4.18 Xylose AR Item318 1 per gm
319 4.19 Vibrio cholerae-01 3ml Item319 1 per ml
320 4.2 Vibrio cholerae-0139 3ml Item320 1 per ml
321 4.21 Vibrio cholerae-Ogawa 3ml Item321 1 per ml
322 4.22 Vibrio cholerae-Inaba 3ml Item322 1 per ml
323 4.23 Salmonella Polyvalent O 3ml Item323 1 per ml
324 4.24 Salmonella Polyvalent H 3ml Item324 1 per ml
325 4.25 Salmonella Polyvalent O2 3ml Item325 1 per ml
326 4.26 Salmonella Polyvalent O4 3ml Item326 1 per ml
327 4.27 Salmonella Polyvalent O9 3ml Item327 1 per ml
328 4.28 Salmonella Polyvalent H Phase I a 3ml Item328 1 per ml
329 4.29 Salmonella Polyvalent H Phase Ib 3ml Item329 1 per ml
330 4.3 Salmonella Polyvalent H Phase Ic 3ml Item330 1 per ml
331 4.31 Salmonella Polyvalent H Phase Ii 3ml Item331 1 per ml
332 4.32 Shigella Polyvalent dysenteriae 3ml Item332 1 per ml
333 4.33 Shigella Polyvalent flexnerii 3ml Item333 1 per ml
334 4.34 Shigella Polyvalent sonnei 3ml Item334 1 per ml
335 4.35 Shigella Polyvalent boydii 3ml Item335 1 per ml
336 4.36 Cryptococcus antigen detection kit (latex Agglutination detection) Item336 1 per test
337 4.37 Antigen detection kit for Meningitis (H influenza b, N meningitis A & C, S. pneumonia, GBS, E.coli) Item337 1 per test
338 4.38 Amphotericin Powder Item338 1 per gm
339 4.39 Benzal Pennicillin Powder Item339 1 per gm
340 4.4 Cefoxitin 5gm/vial Item340 1 vial
341 4.41 Clindamycin Powder Item341 1 per gm
342 4.42 Ciprofloxacin 5gm/vial Item342 1 vial
343 4.43 Erythromycin Powder Item343 1 per gm
344 4.44 Gentamicin 5gm/vial Item344 1 vial
345 4.45 Imipenem 5gm/vial Item345 1 vial
346 4.46 Oxacillin 5gm/vial Item346 1 vial
347 4.47 Vancomycin 5gm/vial Item347 1 vial
348 4.48 Anidulafungin (0.015-128µg/ml) Item348 1 per strip
349 4.49 Ceftriaxone (0.016-256 ug /ml.) Item349 1 per strip
350 4.5 Ciprofloxacin (0.001-8ug / ml.) Item350 1 per strip
351 4.51 Ceftazidime+ Clavulanate(0.004-128ug / ml.) Item351 1 per strip
352 4.52 Clindamycin E-test (0.016-256 µg/ml) Item352 1 per strip
353 4.53 Colistin (0.06-0.25µg/ml) Item353 1 per strip
354 4.54 Caspofungin (0.015-128µg/ml Item354 1 per strip
355 4.55 Doripenem(0.002-32 µg/ml) Item355 1 per strip
356 4.56 Ertapenem (0.002-32 µg/ml) Item356 1 per strip
357 4.57 Fluconazole (0.016-256 µg/ml) Item357 1 per strip
358 4.58 Imipenem(0.004-128ug / ml.) Item358 1 per strip
359 4.59 Levofloxacin (0.001-8ug / ml.) Item359 1 per strip
360 4.6 Meropenem (4-256 µg/ml) Item360 1 per strip
361 4.61 Meropenem/EDTA (1-64 µg/ml) Item361 1 per strip
362 4.62 Moxifloxacin (0.001-8ug / ml.) Item362 1 per strip
363 4.63 Candida albicans ATCC 14053 Item363 1 vial
364 4.64 Candida guilliermondii ATCC 6260 Item364 1 vial
365 4.65 Candida Psedotropicalis TCC 4135 Item365 1 vial
366 4.66 Corynebacterium diptheriae ATCC 13812 Vial Item366 1 vial
367 4.67 Escherichia coli ATCC 25922 Vial Item367 1 vial
368 4.68 Escherichia coli ATCC 35218 Vial Item368 1 vial
369 4.69 Enterococcus faecalis ATCC 29212 Vial Item369 1 vial
370 4.7 Haemophilus influenzae ATCC-49766 Vial Item370 1 vial
371 4.71 Pseudomonas aeruginosa ATCC 27853 Vial Item371 1 vial
372 4.72 Positive Control for T.B. (My.TB H37rv strain) Item372 1 vial
373 4.73 Staphylococcus aureus ATCC 25923 Vial Item373 1 vial
374 4.74 Streptococcus pneumoniae ATCC 49619 Vial Item374 1 vial
375 4.75 Staphylococcus aureus ATCC 33591 Vial Item375 1 vial
376 4.76 Salmonella enterica subspecies enterica serovar cholerasuis ATCC-10708 Vial Item376 1 vial
377 4.77 Salmonella enterica subspecies enterica serovar paratyphi A ATCC-9150 Vial Item377 1 vial
378 4.78 Salmonella enterica subspecies enterica serovar typhimurium ATCC-25241 Vial Item378 1 vial
379 4.79 Shigella flexneri ATCC- 9199 Vial Item379 1 vial
380 4.8 AST for GNB AST –N280 Item380 1 per test
381 4.81 Media for Pediatric Sample -259794,BACT/ALERT PF Item381 1 per test
382 4.82 Media for Aerobic Sample – 259791, BACT/ALERT FA Item382 1 per test
383 4.83 Solution for Inoculum Preparation – V1204, 3x500 ml Item383 1 per test
384 4.84 Tubes for Inoculum Preparation - 69285(unsensitised tube) Item384 1 per test
385 4.85 Identification of Fermentes and Non-ferments – 21341(GN TEST KIT VTK) Item385 1 per test
386 4.86 DNA ladder / molecular weight marker size range : 100 to 1200 bp (50µg) Item386 1 per test
387 4.87 DNA Extraction kit Item387 1 per test
388 4.88 Deoxynucleotide triphosphate (dNTP) mixture Item388 1 per test
389 4.89 Anaerogas pack (5 nos/pack) Item389 1 pc
390 4.9 Autoclavable Biohazard plastic bag: size 10 ltr 10ltr Item390 1 pc
391 4.91 Anaerobic Blood Culture bottle – Adult (50/ pack) Item391 1 pc
392 4.92 Anaerobic Blood Culture bottle – Paediatric (50/ pack) Item392 1 pc
393 4.93 Anaerobic System Rubber Ring Item393 1 pc
394 4.94 Anaero Indicator Tablet RT (1x10/pkt) Item394 1 pc
395 4.95 Autoclavable Plastic Vial Flat Bottom,screw capped 11.5 mm x53 mm. Item395 1 pc
396 4.96 Craigie’s tube Item396 1 pc
397 4.97 Durham's tube 25 x 6 mm Item397 1 pc
398 4.98 Durham's tube 37x 6 mm Item398 1 pc
399 4.99 Embading Cassette 1x1000/box Item399 1 pc
400 5 Kline Concavity Slides 75x56x3 mm thick & 12 concavity code GW097 Item400 1 pc
401 5.01 Microtips (Autoclavable) with box (96’s/pack) 0.1ul - 20µl Item401 1 pc
402 5.02 Microtips (Autoclavable) with box (96’s/pack) 2ul - 200µl Item402 1 pc
403 5.03 Microtips (Autoclavable) with box (96’s/pack) 50ul - 1000µl Item403 1 pc
404 5.04 Microtips (Autoclavable) 0.1ul - 20µl Item404 1 pc
405 5.05 Microtips (Autoclavable) 2ul - 20ul Item405 1 pc
406 5.06 Microtips (Autoclavable) 5ul-50ul Item406 1 pc
407 5.07 Microtips (Autoclavable) 20ul-200ul Item407 1 pc
408 5.08 Microtips (Autoclavable) 200ul-1000ul Item408 1 pc
409 5.09 Microtips-1000 ul Item409 1 pc
410 5.1 Microtips-5000 ul Item410 1 pc
411 5.11 Microtitre plate with round bottom wells 96wells Item411 1 pc
412 5.12 Microtitre plate with detachable wells 96wells Item412 1 pc
413 5.13 Micro centrifuge Autoclavable Plastic Tubes with cap 2ml Item413 1 pc
414 5.14 Micro centrifuge Autoclavable Plastic Tubes with cap 5ml Item414 1 pc
415 5.15 Micro centrifuge Autoclavable Plastic Tubes with cap 10ml Item415 1 pc
416 5.16 Mac Cartney bottles Flat bottom with aluminium screw Cap & Rubber Liner. Capacity 30ml Item416 1 pc
417 5.17 Museum Jar, With Cover 160x110x60mm Item417 1 pc
418 5.18 Museum Jar, With Cover 170x130x210 mm Item418 1 pc
419 5.19 Screw capped tubes 20x150mm Item419 1 pc
420 5.2 Serum vials sample storage box & stand for 3ml capacity Item420 1 pc
421 5.21 Sample Container -Wide mouth bottle,125ml Autoclavable (Polypropylene) 125ml Item421 1 pc
422 5.22 Storage vials (autoclavable) 2ml Item422 1 pc
423 5.23 Teasing Needles for moulds Item423 1 pc
424 5.24 Test Tube Stand - Test -tube size - 25mm diametre Item424 1 pc
425 5.25 Test Tube Stand - test -tube size - 16mm diametre Item425 1 pc
426 5.26 Test Tube Stand - Test-tube size - 10mm diametre Item426 1 pc
427 5.27 Test tube basket, large Item427 1 pc
428 5.28 Test tube basket, small Item428 1 pc
429 5.29 Test tube rack to accommodate 3 ml. test tubes 5X15 Item429 1 pc
430 5.3 Test tube rack to accommodate 5 ml. test tubes 5X15 Item430 1 pc
431 5.31 Test tube racks:4 x 13 Item431 1 pc
432 5.32 Test tube cleaning brush (polypropylene filament bunched typed brush for cleaning 6”, 5” & 4” tubes) Item432 1 pc
433 5.33 Test Tube Carrier (stainless steel) Item433 1 pc
434 5.34 V.D.R.L. Slides (75mmx50mm 1.45mm) Item434 1 pc
435 5.35 Wash bottle plastic with delivery Nozzle 200ml Item435 1 pc
436 5.36 Wash bottle plastic with delivery Nozzle 60ml Item436 1 pc
437 5.37 Bunsen burner Item437 1 pc
438 5.38 Bacteriological loop holder with loop (ready to use) Item438 1 pc
439 5.39 Biological indicator for steam Item439 1 pc
440 5.4 Bowie DickTest Pack Steam Item440 1 pc
441 5.41 Ice box 5 litres Item441 1 pc
442 5.42 Labels for Micro centrifuge tubes white Size ½” Item442 1 pc
443 5.43 Metaloops (Changeable Nichrome loop embedded in Brass rod with heat resistant handle with- Item443 1 pc
444 5.44 a. 2 mm diameter Nichrome wire Item444 1 pc
445 5.45 b. 3 mm diameter Nichrome wire Item445 1 pc
446 5.46 c. 4 mm diameter Nichrome wire Item446 1 pc
447 5.47 Metaloops (Fixed straight Nichrome loop embedded in SS rod with heat resistant handle with- Item447 1 pc
448 5.48 Microtome Knife Item448 1 pc
449 5.49 Mops Item449 1 pc
450 5.5 Magnifying glass, big size with handle Item450 1 pc
451 5.51 Mortar - Pestle Item451 1 pc
452 5.52 Nichrome loop-4 mm Item452 1 pc
453 5.53 Nichrome loop-2 mm Item453 1 pc
454 5.54 Nichrome loop-1.3 mm Item454 1 pc
455 5.55 Pipette stand( vertical & horizontal) 4/5 pipettes Item455 1 pc
456 5.56 Staining rack. 20 slide capacity. Item456 1 pc
457 5.57 Sprit Lamp glass/ metal Item457 1 pc
458 5.58 Screwdrivers -multipurpose Item458 1 pc
459 5.59 Silver aluminium foil Item459 1 pc
460 5.6 Surgical Knife (Big) Item460 1 pc
461 5.61 Sterile swab sticks Item461 1 pc
462 5.62 Syringe driven filters PTFE (hydrophilic) pore size 0.22µm Item462 1 pc
463 5.63 Thermometer 37degree C Item463 1 pc
464 5.64 Twine Item464 1 pc
465 5.65 Universal collection vials (Urine pot) Item465 1 pc
466 5.66 Universal Wash Reagents 500ml Item466 1 pc
467 5.67 Anti-CD 56 Item467 1 per ml
468 5.68 Anti-61 Item468 1 per ml
469 5.69 Anti-CD 68 Item469 1 per ml
470 5.7 Anti-CD 33 Item470 1 per ml
471 5.71 Anti-Ki 67 (Mib) Item471 1 per ml
472 5.72 Anti Neurofilament Protein Item472 1 per ml
473 5.73 Anti-Synaptophysin Item473 1 per ml
474 5.74 Anti-GFAP Item474 1 per ml
475 5.75 Anti-CD 99 Item475 1 per ml
476 5.76 Anti-CD 31 Item476 1 per ml
477 5.77 Anti-B HCG Item477 1 per ml
478 5.78 Poly-L.Lysine Item478 1 per ml
479 5.79 Anti-CD 20 (B cells) Item479 1 per ml
480 5.8 Anti-CD 45 (LCA) Item480 1 per ml
481 5.81 Anti-S 100 Item481 1 per ml
482 5.82 Anti- Desmin Item482 1 per ml
483 5.83 Anti-C-erb B-2 (Her-L/Neu) Item483 1 per ml
484 5.84 Anti-ER Item484 1 per ml
485 5.85 Anti-PR Item485 1 per ml
486 5.86 Anti-CD 3 Item486 1 per ml
487 5.87 Anti-CD 20 Item487 1 per ml
488 5.88 Anti-CD 117 Item488 1 per ml
489 5.89 Anti-CD 34 Item489 1 per ml
490 5.9 Anti-CD 30 Item490 1 per ml
491 5.91 Anti-Cyclin D1 Item491 1 per ml
492 5.92 Anti-CD 15 Item492 1 per ml
493 5.93 Anti-CD 5 Item493 1 per ml
494 5.94 FITC-Conjugated Rabbit Item494 1 per ml
495 5.95 Anti-Human IgA (alpha chain) Item495 1 per ml
496 5.96 FITC-Conjugated Rabbit Item496 1 per ml
497 5.97 Anti-Human IgG (Gamma chain) Item497 1 per ml
498 5.98 FITC-Conjugated Rabbit Item498 1 per ml
499 5.99 Anti-Human Kappa Light chain Item499 1 per ml
500 6 FITC-Conjugated Rabbit Item500 1 per ml
501 6.01 Anti-Human C3c Complement Item501 1 per ml
502 6.02 FITC-Conjugated Rabbit Item502 1 per ml
503 6.03 Anti-Human IgM (Mu chain) Item503 1 per ml
504 6.04 FITC-Conjugated Rabbit Item504 1 per ml
505 6.05 Anti-Human Lambda (Light chain) Item505 1 per ml
506 6.06 ANA by Hep-2-cell-line substrate(kit with reagents) Item506 1 pc
507 6.07 Electrodes for µpH System 361 Item507 1 pc
508 6.08 Osmium Tetroxide Item508 1 pc
509 6.09 Chromium trioxide Item509 1 pc
510 6.1 Zinc Chloride Item510 1 pc
511 6.11 Di-Sodium hydrogen phosphate anhydrous Item511 1 per gm
512 6.12 Di-Sodium hydrogen Orthophosphate Dibasic Item512 1 per gm
513 6.13 Sodium dihydrogen orthophosphate monohydrate Item513 1 per gm
514 6.14 Sodium borate Item514 1 per gm
515 6.15 Alpha napthyl butyrate Item515 1 per gm
516 6.16 Anti-CISH kits-HPV16/18DNA Item516 1 per ml
517 6.17 ER/P-R control Item517 1 per ml
518 6.18 Anti-Melanomal(HMB45) Item518 1 per ml
519 6.19 Anti Myeloperoxidase Item519 1 per ml
520 6.2 Anti -NSE Item520 1 per ml
521 6.21 Anti-PLAP Item521 1 per ml
522 6.22 Anti-bc12 oncoprotein Item522 1 per ml
523 6.23 Anti-Cytokeratin7 Item523 1 per ml
524 6.24 Anti-Cytokeratin20 Item524 1 per ml
525 6.25 Anti-BRCA 1Protein Item525 1 per ml
526 6.26 Anti-IgA Item526 1 per ml
527 6.27 Anti-IgM Item527 1 per ml
528 6.28 Anti-IgG Item528 1 per ml
529 6.29 Anti-compliment CD3 Item529 1 per ml
530 6.3 Anti-Rb gene protein Item530 1 per ml
531 6.31 Anti-P53 protein Item531 1 per ml
532 6.32 Anti-WT1 turmor Item532 1 per ml
533 6.33 Anti-Vimentin (V9) Item533 1 per ml
534 6.34 Anti-EMA(E29) Item534 1 per ml
535 6.35 Anti-p169INK4) Item535 1 per ml
536 6.36 Kappa Item536 1 per ml
537 6.37 Lamda Item537 1 per ml
538 6.38 Eosine spirit soluble Item538 1 per ml
539 6.39 PAP Pen Immuno histochemistry Item539 1 per ml
540 6.4 Anti-CD 1a Item540 1 per ml
541 6.41 Anti-SMA Item541 1 per ml
542 6.42 Anti-Myogenin Item542 1 per ml
543 6.43 Fluorescent bchiff reagent Item543 1 per ml
544 6.44 Carmine Item544 1 per ml
545 6.45 Acriffarine Item545 1 per ml
546 6.46 Cresyl fast blue Item546 1 per ml
547 6.47 Luxol fast blue Item547 1 per ml
548 6.48 Cresyl violet Item548 1 per ml
549 6.49 Epinephrine (3x0.5ml) Item549 1 pc
550 6.5 Aggrecetion ristocetion A Sulfate (3x0.5ml) Item550 1 pc
551 6.51 A D P(Adenosine-5l Diphosphate(3x0.5ml) Item551 1 pc
552 6.52 Arachidonic acid lyohillzed sodium Arachidonate Item552 1 pc
553 6.53 Collagen Soluble Calfskin(3x0.5ml) Item553 1 pc
554 6.54 Vw Fator Assay ristocetin cofactor (3x0.5ml) Item554 1 pc
555 6.55 Test tube( siliconized,flate bottom 7x25x55mm) Item555 1 pc
556 6.56 Stri Bars plastic coaled MICRO Item556 1 pc
557 6.57 Cryo Glue (Tissue Embedding Medium)for Cryostat Machine Item557 1 pc
558 6.58 Diposables blades for Cryostat Machine Item558 1 pc
559 6.59 Silicon Tubal Ring Item559 1 pc
560 6.6 Laser Spectacles Item560 1 pc
561 6.61 Fluid Warmer Item561 1 pc
562 6.62 Filter for Suction Machine( Atmos) Item562 1 pc
563 6.63 NIBP Monitor with integrated cuff arm Item563 1 pc
564 6.64 Serum Zinc Item564 1 per ml
565 6.65 Copper Item565 1 per ml
566 6.66 Ceruloplasmin Item566 1 per ml
567 6.67 Ammonia Item567 1 per ml
568 6.68 Ammonia Item568 1 per ml
569 6.69 Alcohol Item569 1 per ml
570 6.7 D- Dimer Item570 1 per ml
571 6.71 Anti ds DNA Item571 1 per ml
572 6.72 Anti sn Antibody Item572 1 per ml
573 6.73 Vitamin D Item573 1 per ml
574 6.74 Vitamin E Item574 1 per ml
575 6.75 NGAL Item575 1 per ml
576 6.76 Cystatin C Item576 1 per ml
577 6.77 G6 PD Item577 1 per ml
578 6.78 Lactate Item578 1 per ml
579 6.79 Apo A1 Item579 1 per ml
580 6.8 Homocysteine Item580 1 per ml
581 6.81 BNP Item581 1 per ml
582 6.82 Urinary VMA Item582 1 per ml
583 6.83 Blood ketones Item583 1 per ml
584 6.84 Lip a Item584 1 per ml
585 6.85 ANA Item585 1 per ml
586 6.86 Anti phospholipid antibody Item586 1 per ml
587 6.87 Vitamin C Item587 1 per ml
588 6.88 ENA Item588 1 per ml
589 6.89 Vitamin K Item589 1 per ml
590 6.9 Iodine Item590 1 per ml
591 6.91 APO B Item591 1 per ml
592 6.92 Troponin T Item592 1 per ml
593 6.93 CK MB1 Item593 1 per ml
594 6.94 CK MB 2 Item594 1 per ml
595 6.95 TIBC Item595 1 per ml
596 6.96 Transferrin Item596 1 per ml
597 6.97 IgG Item597 1 per ml
598 6.98 IgM Item598 1 per ml
599 6.99 IgA Item599 1 per ml
600 7 Inhibin A Item600 1 per ml
601 7.01 ß trace protein Item601 1 per ml
602 7.02 ?eta 2 microgobulin Item602 1 per ml
603 7.03 Alpha 1 Antitrypsin Item603 1 per ml
604 7.04 a -1 Microglobulin Item604 1 per ml
605 7.05 a-2 Macroglobulin Item605 1 per ml
606 7.06 Screening kit for inborn error of metabolism Item606 1 per ml
607 7.07 EQAS for clinical chemistry,Immunoassay, electrolyte, HbA1C. Item607 1 per ml
608 7.08 TPO (Thyroperoxidase) antibody Item608 1 per ml
609 7.09 Control for M-band electrophoresis Item609 1 per ml
610 7.1 TNF-a Item610 1 per ml
611 7.11 IL-2 Item611 1 per ml
612 7.12 Procalcitonin Item612 1 per ml
613 7.13 5'ACAGCGTCATGGCAGAGCAGGTGGC3’ Item613 1 per ml
614 7.14 5'AAAAGCTCTTCCCGCAGGATCCCGC3’ Item614 1 per ml
615 7.15 5'GTGGCTGTTCCGGGATGGCCTTCTG3’ Item615 1 per ml
616 7.16 5'CTTGAAGAAGGGCTCACTCTGTTTG3’ Item616 1 per ml
617 7.17 5'CAGTACGATGATGCAGC3’ Item617 1 per ml
618 7.18 5'CAGGTAGAAGAGGCGGT3’ Item618 1 per ml
619 7.19 amikacin ,neomycin & Item619 1 per ml
620 7.2 tobramycin standard (HPLC grade) Item620 1 per ml
621 7.21 EDTA gel (15%) Item621 1 Per gm
622 7.22 Acrylic - Heat cure-clear Item622 1 Pc
623 7.23 Acrylic - Heat cure-pink Item623 1 Pc
624 7.24 Acrylic - Self cure-clear Item624 1 Pc
625 7.25 Acrylic - Self cure-pink Item625 1 Pc
626 7.26 Agate Spatula Item626 1 Pc
627 7.27 Alginate impression material ( Dustless) Item627 1 Pc
628 7.28 Articulation paper Item628 1 Pc
629 7.29 Bur - Airotor-Diamond Item629 1 Pc
630 7.3 Bur - Airotor-TC- straight fissure Item630 1 Pc
631 7.31 Calcium Hydroxide paste for root canal Item631 1 Pc
632 7.32 Dappen dish Item632 1 Pc
633 7.33 Dental Floss – waxed, 25 m Item633 1 Pc
634 7.34 Dental Stone Item634 1 Pc
635 7.35 Dentin bonding agent Item635 1 Pc
636 7.36 Die stone Item636 1 Pc
637 7.37 Disposable Suction Tips with copper wire Item637 1 Pc
638 7.38 Emery Sheet - 100, 150 and 400 Grade Item638 1 Pc
639 7.39 Endodontic Gutta Percha Points(15-80) Item639 1 Pc
640 7.4 Etchant gel ( 37 % Phosphoric Acid) Item640 1 Pc
641 7.41 Fiber Composite splint Item641 1 Pc
642 7.42 Flexible Composite polishing discs Item642 1 Pc
643 7.43 Formocresol Item643 1 Pc
644 7.44 GIC- High strength pacakable for posteriors Item644 1 Pc
645 7.45 Glass Ionomer Cement Type I Item645 1 Pc
646 7.46 Glass Ionomer Cement Type II Item646 1 Pc
647 7.47 Gluma Dentin Desensitizer Item647 1 Pc
648 7.48 Gutta Percha Sticks Item648 1 Pc
649 7.49 Halogen bulbs- 12V, 55 W Item649 1 Pc
650 7.5 Hydroxyapatite Bone graft Material Item650 1 Pc
651 7.51 K File - all sizes Item651 1 Pc
652 7.52 Light cure composite - Flowable - All shades Item652 1 Pc
653 7.53 Light cure composite - nano-hybrid – all shades Item653 1 Pc
654 7.54 Modelling wax sheet no.2 Item654 1 Pc
655 7.55 Non Eugenol Impression Paste - standard pack Item655 1 Pc
656 7.56 Pinnacle tracing sticks ( minimum three years shelf life) Item656 1 Pc
657 7.57 Polishing brush for dental lathe Item657 1 Pc
658 7.58 Polymer Reinforced Zinc oxide Eugenol cement Item658 1 Pc
659 7.59 Pumice powder for polishing dentures Item659 1 Pc
660 7.6 Silver reinforced Glass Ionomer Item660 1 Pc
661 7.61 Supernal Base Plate Item661 1 Pc
662 7.62 Tissue conditioner ( Soft reliner) Item662 1 Pc
663 7.63 Ultrasonic scaler tip Item663 1 Pc
664 7.64 Vacuum formed sheets - Soft and hard - 2 and 3mm Item664 1 Pc
665 7.65 Vulcanite Trimmer ( TC) Item665 1 Pc
666 7.66 Zinc oxide Eugenol impression paste Item666 1 Pc
667 7.67 Self Cure Acrylic Tooth Colour Temporary Crown Materials (Powder & Liquid) Item667 1 Pc
668 7.68 Cold - Cure Acrylic Powder With Liquid (White Colour) Item668 1 Pc
669 7.69 Pits and Fissure Sealant Item669 1 Pc
670 7.7 Zinc oxide Eugenol impression paste Item670 1 Pc
671 7.71 IRM (Intermediate Restorative Materials) Item671 1 Pc
672 7.72 GIC Fuji Tupe IX Item672 1 Pc
673 7.73 GIC Type -II Restoative Materials Item673 1 Pc
674 7.74 Light Cure Composite Nano- Filling Materials Item674 1 Pc
675 7.75 Alginate impression material ( Dustless) Item675 1 Pc
676 7.76 Dental Stone Item676 1 Pc
677 7.77 Wedges Item677 1 Pc
678 7.78 Miracle Mix Materials Item678 1 Pc
679 7.79 Hand Piece Lubricant Item679 1 Pc
680 7.8 Dycal Item680 1 Pc
681 7.81 Suction Tips Item681 1 Pc
682 7.82 Acrylic Teeth Set Item682 1 Pc
683 7.83 Polishing Paste Item683 1 Pc
684 7.84 Polishing Rubber Cups and Bristle Item684 1 Pc
685 7.85 Disposable Glass Item685 1 Pc
686 7.86 Abrasive Strips for Polishing Proximal Areas of Teeth Item686 1 Pc
687 7.87 Cellophene Matrix Strips for LC Restoration Item687 1 Pc
688 7.88 Applicator Tips for LC Item688 1 Pc
689 7.89 Desensitizing Varnish Item689 1 Pc
690 7.9 Burs For Tooth Reduction Set Item690 1 Pc
691 7.91 Dental stone cutting Burs (Small Size) Item691 1 Pc
692 7.92 H-Files for Both Anterior and Posterior Item692 1 Pc
693 7.93 K- File for Both Anterior and Posterior Item693 1 Pc
694 7.94 Broaches Item694 1 Pc
695 7.95 Reamers for Both Anterior and Posterior Item695 1 Pc
696 7.96 Gutta Percha Item696 1 Pc
697 7.97 Absorbant Paper Point Item697 1 Pc
698 7.98 Titanium Post (All Sizes) Item698 1 Pc
699 7.99 Protapper Gutta Parcha All Size Item699 1 Pc
700 8 Alveogel Item700 1 Pc
701 8.01 RC CAL (Intra Canal Dressing Paste) Item701 1 Pc
702 8.02 Fiber Optics Air Rotor Hand Pieces with Coupling Unit Item702 1 Pc
703 8.03 GP Cutter Item703 1 Pc
704 8.04 Tungsten Carbide Burs For Air Rotor and Micro Motor HandPieces Item704 1 Pc
705 8.05 Sectional Matrixs Item705 1 Pc
706 8.06 Metal Crown Item706 1 Pc
707 8.07 Zinc oxide powder and eugenol (Big Size) Item707 1 Pc
708 8.08 Zinc oxide eugenol (Powder ) Item708 1 Pc
709 8.09 Zinc oxide eugenol (Liquid) Item709 1 Pc
710 8.1 Zinc oxide eugenol (ready mix) Item710 1 Pc
711 8.11 ZnO Impression paste Item711 1 Pc
712 8.12 Dycal Cement Item712 1 Pc
713 8.13 Stone burs (all sizes and shape) Item713 1 Pc
714 8.14 Stone burs for polishing (fine) Item714 1 Pc
715 8.15 Composit polishing disc Item715 1 Pc
716 8.16 Composite Cement Item716 1 Pc
717 8.17 Composite filling kit Item717 1 Pc
718 8.18 Composite finishing and polishing Item718 1 Pc
719 8.19 Composite polishing disc Item719 1 Pc
720 8.2 Composite polishing kit Item720 1 Pc
721 8.21 Composite polishing paste Item721 1 Pc
722 8.22 Endo Wash 5% 450ml Item722 1 Pc
723 8.23 Bristle Brush & Cup Item723 1 Pc
724 8.24 Eugenol 15ml Item724 1 Pc
725 8.25 Eugenol 110ml Item725 1 Pc
726 8.26 DPI Selfcure Item726 1 Pc
727 8.27 Ketac Molar Item727 1 Pc
728 8.28 NT Premium Item728 1 Pc
729 8.29 One Coat Bond Item729 1 Pc
730 8.3 GIC LC (Mini) GC Item730 1 Pc
731 8.31 PIVO Crown & Bridge Kit Item731 1 Pc
732 8.32 Protaper Hand Kit 21/25mm Item732 1 Pc
733 8.33 Mouth Mith Handle (GDC) Item733 1 Pc
734 8.34 Explorer (GDC) Item734 1 Pc
735 8.35 Surgical scissor (BRP) Item735 1 Pc
736 8.36 DPI Alloy Item736 1 Pc
737 8.37 Tri Hawk Item737 1 Pc
738 8.38 Glyde 3mlx1 Item738 1 Pc
739 8.39 GP F4-F5 (Dentsply) Item739 1 Pc
740 8.4 GP (15/35/40 ) Dentsply Item740 1 Pc
741 8.41 Dtech Etchn Item741 1 Pc
742 8.42 H File 15/20/25 Item742 1 Pc
743 8.43 Matrix Band No1 Item743 1 Pc
744 8.44 Diamond Bur Item744 1 Pc
745 8.45 Shofu Crown & Bridge Kit Item745 1 Pc
746 8.46 Vitrebond Item746 1 Pc
747 8.47 AH 26 Item747 1 Pc
748 8.48 Ketac Silver Item748 1 Pc
749 8.49 API Needle Holder Item749 1 Pc
750 8.5 NSK Push Button Airotor Handpiece Item750 1 Pc
751 8.51 Apex Locator Pixi Dentsply Item751 1 Pc
752 8.52 Lightcure Michine Coltene Item752 1 Pc
753 8.53 Sealer Machine with Pouch Item753 1 Pc
754 8.54 Scaller Tips Satellec Item754 1 Pc
755 8.55 Ultrasonic Cleaner Item755 1 Pc
756 8.56 Smart Burs Item756 1 Pc
757 8.57 Anti Fog Mouth Mirror Item757 1 Pc
758 8.58 Flouride Solution with Applicator Item758 1 Pc
759 8.59 Luting Cement Item759 1 Pc
760 8.6 Silicon Base Impression Materials Item760 1 Pc
761 8.61 Base Putty Impression Materials Item761 1 Pc
762 8.62 Light Body Impression Materials Item762 1 Pc
763 8.63 Re Cap Item763 1 Pc
764 8.64 DVI Self Item764 1 Pc
765 8.65 Propopar Band Kit 21/25ml Item765 1 Pc
766 8.66 GHOFU Crown & Bridge Kit Item766 1 Pc
767 8.67 ALT 26 Item767 1 Pc
768 8.68 APL Needle Holder Item768 1 Pc
769 8.69 Giyote 3ml Item769 1 Pc
770 8.7 IA File 15/20/25 Item770 1 Pc
771 8.71 Otech Item771 1 Pc
772 8.72 Flowable Composite Shade Item772 1 Pc
773 8.73 Plastic Filling Instruments Item773 1 Pc
774 8.74 Cement Spatula Item774 1 Pc
775 8.75 Cement Condenser Item775 1 Pc
776 8.76 Ball Burnisher (API) Item776 1 Pc
777 8.77 Extraction Forcept for Pedo (set of 16) Item777 1 Pc
778 8.78 Tweezer Item778 1 Pc
779 8.79 Diamond Round Bur Item779 1 Pc
780 8.8 Diamond Straight Fissure Bur Item780 1 Pc
781 8.81 Diamond Cone Shape Bur Item781 1 Pc
782 8.82 Contra Angle Hand Piece Item782 1 Pc
783 8.83 Paper point (15-40 & 45-80) Item783 1 Pc
784 8.84 Flamed Shaped Diamond Bur (All Sizes) Item784 1 Pc
785 8.85 Spoon Excavator Item785 1 Pc
786 8.86 Cold Mold Seal Item786 1 Pc
787 8.87 Pain Off Item787 1 Pc
788 8.88 Shade Guide Item788 1 Pc
789 8.89 Coe- Pack Item789 1 Pc
790 8.9 Apexit Plus Item790 1 Pc
791 8.91 Fibre Post (yellow, red , blue) Item791 1 Pc
792 8.92 Gingival Retraction Cord Item792 1 Pc
793 8.93 Spreader /Plugger (all sizes) Item793 1 Pc
794 8.94 Disposable Napkin Item794 1 Pc
795 8.95 Crown Cutting Kit Item795 1 Pc
796 8.96 Elevators (straight and periostal) Item796 1 Pc
797 8.97 Extraction Forcept for pedo adult (set of 14) Item797 1 Pc
798 8.98 G-coat Plus Item798 1 Pc
799 8.99 Protemp with tips and gun Item799 1 Pc
800 9 GIC Type IX Item800 1 Pc
801 9.01 Durable Flouride Releasing Coating Item801 1 Pc
802 9.02 Light Curing nano ionomer restorative Item802 1 Pc
803 9.03 Remin pro (protective dental cream) Item803 1 Pc
804 9.04 Chair Bulbs (ocero Infinity) Item804 1 Pc
805 9.05 Cold cure (pink) powder Item805 1 Pc
806 9.06 Cold cure (White) powder Item806 1 Pc
807 9.07 Cold Cure Liquid Item807 1 Pc
808 9.08 Green Sticks Item808 1 Pc
809 9.09 Mercury Item809 1 Pc
810 9.1 Disposable Patient Apron Item810 1 Pc
811 9.11 Bobe Cutter Item811 1 Pc
812 9.12 Bobe ronger Item812 1 Pc
813 9.13 Bone file Item813 1 Pc
814 9.14 Mought Prod Chain Item814 1 Pc
815 9.15 Macet/Hammer Item815 1 Pc
816 9.16 Amalgam Condenser Item816 1 Pc
817 9.17 Amalgam carrier Item817 1 Pc
818 9.18 Amalgam Curver Item818 1 Pc
819 9.19 Wax Knife Item819 1 Pc
820 9.2 Wire Cutter Item820 1 Pc
821 9.21 Plier Item821 1 Pc
822 9.22 Rubber dam Kit Item822 1 Pc
823 9.23 Crown remover Item823 1 Pc
824 9.24 Micromotor drill bits Item824 1 Pc
825 9.25 Compo Roller Item825 1 Pc
826 9.26 GP Holder Item826 1 Pc
827 9.27 Surgical Micromotor Item827 1 Pc
828 9.28 Periodontal Probe Item828 1 Pc
829 9.29 Acrylic Mixing Jar Item829 1 Pc
830 9.3 Air Polisher Item830 1 Pc
831 9.31 S.S. Inter maxillary fixation Screws 2.0mm - 12-14mm Item831 1 Pc
832 9.32 S.S. Inter maxillary fixation Screws 2.5mm - 12-14 mm Item832 1 Pc
833 9.33 Titanium cranial microplates (0.5mm plate thickness)10-18hole straight Item833 1 Pc
834 9.34 Titanium mandible miniplates (1mm plate thickness) 4 hole with bar/gap Item834 1 Pc
835 9.35 Titanium mandible miniplates (1mm plate thickness) 10-12hole straight Item835 1 Pc
836 9.36 Titanium midfacial miniplates (0.5-0.6mm plate thickness) L plate 90 degree long 4 hole with bar/gap Right side Item836 1 Pc
837 9.37 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 90 degree Long 4 hole with bar/gap left side. Item837 1 Pc
838 9.38 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree short 4 hole with bar/gap Right side Item838 1 Pc
839 9.39 Titanum Mid Facial Miniplates (0.5-0.6mm plates thickness) L plate 100-110 degree short 4 hole with bar/ gap Left side Item839 1 Pc
840 9.4 Titannium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree long 4 hole with bar/gap Right side Item840 1 Pc
841 9.41 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) L plate 100-110 degree Long 4 hole With bar/gap Left side Item841 1 Pc
842 9.42 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 4 hole With bar/gap Item842 1 Pc
843 9.43 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 6 hole with bar/gap . Item843 1 Pc
844 9.44 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Orbital plate 10 hole Item844 1 Pc
845 9.45 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) T Plates 5 holes Item845 1 Pc
846 9.46 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Y plate 4 holes Item846 1 Pc
847 9.47 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Double Y plate 4 holes Item847 1 Pc
848 9.48 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) X plate 5 holes Item848 1 Pc
849 9.49 Titanium Mid Facial Miniplates (0.5-0.6mm plate thickness) Straight plate 10-12 holes Item849 1 Pc
850 9.5 Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 12-16 holes Item850 1 Pc
851 9.51 Titanium Right Angle Reconstruction plates (2-2.4 mm plate thickness) 20-25 holes Item851 1 Pc
852 9.52 Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 12-16 holes Item852 1 Pc
853 9.53 Titanium Left Angle Reconstruction plates (2-2.4mm plate thickness) 20-25 holes Item853 1 Pc
854 9.54 Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 12-16 holes Item854 1 Pc
855 9.55 Titanium Straight Reconstruction plates (2-2.4mm plate thickness) 20-25 holes Item855 1 Pc
856 9.56 Titanium double angled Reconstruction plates (2-2.4mm plate thickness) 20-25 holes Item856 1 Pc
857 9.57 Titanium Cranial ( outer diameter 1.0-1.2 mm) non self drilling screw- 4-6 mm length Item857 1 Pc
858 9.58 Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -6mm length Item858 1 Pc
859 9.59 Titanium midfacial (outer diameter 1.5/1.6mm) non self- drilling screw -8 mm length Item859 1 Pc
860 9.6 Titanium midfacial (outer diameter 1.8/1.9mm) non self- drilling emergency screw -6 mm length Item860 1 Pc
861 9.61 Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -6mm length Item861 1 Pc
862 9.62 Titanium mandible (outer diameter 1.9/2mm) non self- drilling screw -8mm length Item862 1 Pc
863 9.63 Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -6mm length Item863 1 Pc
864 9.64 Titanium mandible (outer diameter 2.2/2.3mm) non self- drilling emergency screw -8 mm length Item864 1 Pc
865 9.65 Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling screw -10mm length Item865 1 Pc
866 9.66 Titanium Reconstruction (outer diameter 2.3/2.4mm) non self- drilling Maxi screw -12mm length Item866 1 Pc
867 9.67 Titanium Reconstruction (2.4mm) non self- drilling Maxi Emergency screw -8-20mm length Item867 1 Pc
868 9.68 Titanium Lag Screws non self drilling ( outer diameter 2.4/2.5 mm)- 15-20mm length Item868 1 Pc
869 9.69 Drill bit with 6mm stop for Titanium cranial (1.0/1.2mm,1.0 mm pilot hole diameter) non self- drilling screw Item869 1 Pc
870 9.7 Drill bit with 6mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw Item870 1 Pc
871 9.71 Drill bit with 8mm stop for Titanium midfacial (1.5/1.6mm,1.3 mm pilot hole diameter) non self- drilling screw Item871 1 Pc
872 9.72 Drill bit with 6mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw Item872 1 Pc
873 9.73 Drill bit with 8mm stop for Titanium mandible (2mm, 1.6 mm pilot hole diameter) non self-drilling screw Item873 1 Pc
874 9.74 Drill bit with 10-12mm stop for Titanium (2.4mm reconstruction, pilot hole diameter 2mm) non self-drilling screw Item874 1 Pc
875 9.75 Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 4x4 cms Item875 1 Pc
876 9.76 Titanium Mesh for midface (0.5-0.6mm thickness) approx. dimension 6x6 cms Item876 1 Pc
877 9.77 Titanium Mesh for mandible (0.5-0.6mm thickness) approx. dimension 10x8 cms Item877 1 Pc
878 9.78 Titanium orbital reconstruction mesh plates- Small Item878 1 Pc
879 9.79 Titanium orbital reconstruction mesh plates- Medium Item879 1 Pc
880 9.8 Titanium orbital reconstruction mesh plates- Large ( with medial and lateral wall extensions) Item880 1 Pc
881 9.81 Porous Polyethylene Orbital sheets ( 0.8-1.5 mm thickness; 5x5 cms approx) Item881 1 Pc
882 9.82 26 guage Stainless Steel wire spool Item882 1 Pc
883 9.83 32 guage Stainless Steel wire spool Item883 1 Pc
884 9.84 Raney Clips Stainless Steel Item884 1 Pc
885 9.85 022 slot MBT Brackets with weldable convertible UTLD first molar Buccal tubes and NC II molar tubes Item885 1 Pc
886 9.86 Crimpable hooks Item886 1 Pc
887 9.87 016 Multistranded SS wire Item887 1 Pc
888 9.88 Preformed Archwire - 014 NiTi U/ L Item888 1 Pc
889 9.89 Preformed Archwire - 016 NiTi U/ L Item889 1 Pc
890 9.9 Preformed Archwire - 016 x 022 SS – U/L Item890 1 Pc
891 9.91 Preformed Archwire - 017 x 025 SS– U /L Item891 1 Pc
892 9.92 Preformed Archwire - 019 x 025 SS – U / L Item892 1 Pc
893 9.93 Orthodontic stone Item893 1 Pc
894 9.94 Dunaform – soft and hard sheets- 2mm, 3mm Item894 1 Pc
895 9.95 Dental Surgery Item895 1 Pc
896 9.96 Mouth Mirror with Handle Item896 1 Pc
897 9.97 Mouth mirror Item897 1 Pc
898 9.98 Dental probe Item898 1 Pc
899 9.99 Periodontal probe Item899 1 Pc
900 10 Dental Explorer ( Curved and pigtail) Item900 1 Pc
901 10.01 Glass Bead Sterilizer Item901 1 Pc
902 10.02 Airotor handpiece - Mini-head (2 years warranty) Item902 1 Pc
903 10.03 Medesy/Hu Friedy Maxillary Anterior Extraction forceps Item903 1 Pc
904 10.04 Medesy/Hu Friedy Maxillary Reed's Extraction forceps Item904 1 Pc
905 10.05 Medesy/Hu Friedy Maxillary Premolar Extraction forceps Item905 1 Pc
906 10.06 Medesy/Hu Friedy Maxillary Molar Extraction forceps Right/Left Item906 1 Pc
907 10.07 Medesy/Hu Friedy Maxillary Bayonet Extraction forceps Item907 1 Pc
908 10.08 Medesy/Hu Friedy MaxillaryThird molar Extraction forceps Item908 1 Pc
909 10.09 Medesy/Hu Friedy Mandibular Anterior Extraction forceps Item909 1 Pc
910 10.1 Medesy/Hu Friedy Mandibular premolar Extraction forceps Item910 1 Pc
911 10.11 Medesy/Hu Friedy Mandibular molar Extraction forceps Item911 1 Pc
912 10.12 Medesy/Hu Friedy Warwick James Elevator-Straight Item912 1 Pc
913 10.13 Medesy/Hu FriedyWarwick James Elevator-Right/Left Item913 1 Pc
914 10.14 Medesy/Hu FriedyCryer's Elevator-Small size- Right/Left Item914 1 Pc
915 10.15 Medesy/Hu FriedyCryer's Elevator-Medium size- Right/Left Item915 1 Pc
916 10.16 Medesy/Hu FriedyCryer's Elevator- Large Size-Right/left Item916 1 Pc
917 10.17 Double angled Currette- Medium size Item917 1 Pc
918 10.18 Double angled Currette- Large size Item918 1 Pc
919 10.19 Molt's Perisoteal Elevator Item919 1 Pc
920 10.2 Freer Periosteal Elevator Item920 1 Pc
921 10.21 Walsham's nasal Forceps- Pair Item921 1 Pc
922 10.22 Asche Septal Forceps Item922 1 Pc
923 10.23 Hayton's Williams maxillary forceps Item923 1 Pc
924 10.24 Rowe's zygomatic elevator Item924 1 Pc
925 10.25 Sigmoid Notch retractor (Left/Right) Item925 1 Pc
926 10.26 Ramal Retractor Item926 1 Pc
927 10.27 wire cutter Item927 1 Pc
928 10.28 wire twister Item928 1 Pc
929 10.29 Coronoid retractor Item929 1 Pc
930 10.3 Mastoid self retaining retractor Item930 1 Pc
931 10.31 Mandibular Lower Border retractor Item931 1 Pc
932 10.32 Condylar retractor Item932 1 Pc
933 10.33 Dingmann retractor ( Adult) Item933 1 Pc
934 10.34 Vestibular retractor Item934 1 Pc
935 10.35 Swallow Tail retractor Item935 1 Pc
936 10.36 Curved Pterygoid osteotome 8mm Item936 1 Pc
937 10.37 Curved Pterygoid osteotome 10mm Item937 1 Pc
938 10.38 Epker Osteotome 4mm/6mm/8mm Curved Item938 1 Pc
939 10.39 Epker Osteotome 4mm/6mm/8mm Straight with marking Item939 1 Pc
940 10.4 Orthodontic model boxes Item940 1 Pc
941 10.41 Tongue Guard - Medium Item941 1 Pc
942 10.42 Dontrix gauge Item942 1 Pc
943 10.43 Extraoral Force gauge Item943 1 Pc
944 10.44 Orthodontic Typodont set ( With wax ridges and teeth set ) Item944 1 Pc
945 10.45 Plaster Vibrator (Worktop area of at least 20 X 10 cm, adjustable setting, 2 years warranty) Item945 1 Pc
946 10.46 Haematoxylin & Eosin Stain Item946 1 Pc
947 10.47 Eosin & Negrosin stain Item947 1 Pc
948 10.48 V.G. Tube Item948 1 Pc
949 10.49 Manipulation Pipette Item949 1 Pc
950 10.5 Metallic TVS Needle Guided Bracket Item950 1 Pc
951 10.51 Syringe Non Rubber 1ml Item951 1 Pc
952 10.52 Granulocyte colony stimulating factor Item952 1 Pc
953 10.53 Pipelle Aspirator/Vabra Aspirator Item953 1 Pc
954 10.54 Progesterone gel Item954 1 Pc
955 10.55 Injectable Progesterone Item955 1 Pc
956 10.56 Latex Condom without spermicide Item956 1 Pc
957 10.57 Osafe Incubator and Laminar Floor Cleaning Lotion Item957 1 Pc
958 10.58 Fersafe Antiseptic Lotion Item958 1 Pc
959 10.59 Liquid Nitrogen for Cryocan Item959 1 Pc
960 10.6 Immunobeads Reagents( Rabbit Anti Human IgG Item960 1 Pc
961 10.61 Immunobeads Reagents( Rabbit Anti Human IgA Item961 1 Pc
962 10.62 Immunobeads Reagents( Rabbit Anti Human IgM Item962 1 Pc
963 10.63 Conical Dispo Beaker 3.0ml Item963 1 Pc
964 10.64 PRP Lens Item964 1 Each
965 10.65 FAC's Tube (12 x 75mm, 5ml Round Bottom Test Tube, snap, sterile Cat: 352054 Item965 1 Each
966 10.66 Kymograph Paper (100 sheets) Item966 1 Each
967 10.67 Perimetric Chart Paper (100 sheets) Item967 1 Each
968 10.68 Haemocytometer Box Item968 1 Each
969 10.69 Haemoglobinometer sets Item969 1 Each
970 10.7 Dewar Tank 11 litre Item970 1 Each
971 10.71 CRYO PRO - 500ml (Liquid Nitrogen Cryosurgical Equipment Item971 1 Each
972 10.72 Bulb for Telepack Lamp Item972 1 Each
973 10.73 Radiofrequency Electrode Round Loop Big Item973 1 Each
974 10.74 Radiofrequency Electrode Round Loop Small Item974 1 Each
975 10.75 Bacterial Filter Machine sl No:101122008 Item975 1 Each
976 10.76 Indirect Ophthalmoscope Item976 1 Each
977 10.77 20448-000Hgh Pressure Hose(Erbe Cryo Unit)) Item977 1 Each
978 10.78 Bone hand Drill Moore - 8448.28 Item978 1 Each
979 10.79 Hand Drill Jacobs Chuck Item979 1 Each
980 10.8 Demartel Condf/Wire Sawsflex 350mm Item980 1 Each
981 10.81 Twist Drill Set of 3mm, 3.5mm 4mm, 4.5mm Item981 1 Each
982 10.82 Crocodile Forceps (Ear Microsurgery) Item982 1 Each
983 10.83 Ear Microsuction Tips Item983 1 Each
984 10.84 Adaptors for Ear Microsuction Tips Item984 1 Each
985 10.85 Cup Ear Forceps Item985 1 Each
986 10.86 Perforators for Stopedectomy 0.4mm Item986 1 Each
987 10.87 Perforators for Stopedectomy 0.5mm Item987 1 Each
988 10.88 Rigid Pharyngoscope (pediatric) 20cm Item988 1 Each
989 10.89 Tonsil Holding Forceps Item989 1 Each
990 10.9 Straight Pick (Tympanyplasty) Item990 1 Each
991 10.91 Back Biting Forceps for Endoscope Nasal Surgery Item991 1 Each
992 10.92 Fiberoptic Otoscope with Pneumatic Pump Item992 1 Each
993 10.93 Bismith lodopyrrophosphate (BIPP) Paste/Powder Item993 1 Each
994 10.94 Mercurochrome Lotion Item994 1 Each
995 10.95 Haed Light fot ENT Item995 1 Each
996 10.96 Endoscopic Biopsy Forceps with Needle Item996 1 Each
997 10.97 CPR Manikin Item997 1 Each
998 10.98 Intubation Manikin Item998 1 Each
999 10.99 Easy Pump Item999 1 Each
1000 11 MRI Contrast Media - Gadoterate Meglumine Injection 5mmmol /ml. 10 ml vial Item1000 1 vial
1001 11.01 MRI Contrast Media - Gadobenate Dimeglumine Injection 10ml vial Item1001 1 vial
1002 11.02 MRI Contrast Media - Gadopentetate Dimeglumine Injection 0.5mmol/ml. 10 ml vial Item1002 1 vial
1003 11.03 MRI Contrast Media - Gadobutrol Pre -Filled Syringe Injection 5ml Item1003 1 vial
1004 11.04 Non -Ionic Contrast Media - Iopromide Injection: USP 370mg - 50 ml vial Item1004 1 vial
1005 11.05 Non -Ionic Contrast Media - Iopromide Injection: USP 370mg -100ml vial Item1005 1 vial
1006 11.06 Non -Ionic Contrast Media - Iopromide Injection: USP 300mg -100ml vial Item1006 1 vial
1007 11.07 Non -Ionic Contrast Media -Iobitridol 350mg -100ml vial Item1007 1 vial
1008 11.08 Non -Ionic Contrast Media -Iomeprol Injection 300mg -50ml vial Item1008 1 vial
1009 11.09 Non -Ionic Contrast Media -Iomeprol Injection 300mg -100ml vial Item1009 1 vial
1010 11.1 Non -Ionic Contrast Media -Iomeprol Injection 350mg -50ml vial Item1010 1 vial
1011 11.11 Non -Ionic Contrast Media -Iomeprol Injection 350mg -100ml vial Item1011 1 vial
1012 11.12 Non -Ionic Contrast Media -Iomeprol Injection 400mg -50ml vial Item1012 1 vial
1013 11.13 Non -Ionic Contrast Media -Iomeprol Injection 400mg -100ml vial Item1013 1 vial
1014 11.14 Non -Ionic Contrast Media -Iopamidol Injection 370mg -50ml vial Item1014 1 vial
1015 11.15 Non -Ionic Contrast Media -Iopamidol Injection 370mg -100ml vial Item1015 1 vial
1016 11.16 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 20ml vial Item1016 1 vial
1017 11.17 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 50ml vial Item1017 1 vial
1018 11.18 Ionic Contrast Media -Diatrizoate Meglumine & Diatrizoate 100ml vial Item1018 1 vial
1019 11.19 COUPLAND ALL NOS Item1019 1 vial
1020 11.2 ELEVATORS (CRYER) 1 PAIRS Item1020 1 vial
1021 11.21 CASTROVEJO SCISSOR Item1021 1 vial
1022 11.22 SAMLL MICRO SCISSOR Item1022 1 vial
1023 11.23 LIGHT CURE COMPOSITE A2 Item1023 1 vial
1024 11.24 LIGHT CURE COMPOSITE A3 Item1024 1 vial
1025 11.25 LIGHT CURE COMPOSITE A3.5 Item1025 1 vial
1026 11.26 H-FILES FOR SIZE (15-40) 21MM Item1026 1 vial
1027 11.27 TOOTH POLISHING BRUSH Item1027 1 vial
1028 11.28 GLIDE Item1028 1 vial
1029 11.29 GRACY CURRETTE Item1029 1 vial
1030 11.3 Polyester braided suture * 2 75cm HGS-21, Blue 37mm 1/2 circle Taper Point : size-2 Item1030 1 pc
1031 11.31 Polyester braided suture * 2 75cm HOS-10, Blue 26mm 1/2 circle Reserve Cutting : size-2 Item1031 1 pc
1032 11.32 Polyester braided suture * 1 75cm HOS 12, Blue 40mm 1/2 Circle Reserve Cutting size -1 Item1032 1 pc
1033 11.33 Polyester braided suture * 5 75cm HOS-14, Blue 57mm 1/2 Circle Reverse Cutting size-5 Item1033 1 pc
1034 11.34 Polyester braided suture * 25x75cm KV-37, Blue 40mm 1/2 Circle Tapercutting size-2 Item1034 1 pc
1035 11.35 Poleyster braided suture * 54x75cm KV-40, Blue 45mm 1/2 Circle Tapercutting size-5 Item1035 1 pc
1036 11.36 Monofilament Knotless Polyglyconate wound closure device, 0 45cm GS-21, Green 37mm 1/2 Circle Taper Point, box of 12 foils size-0 Item1036 1 pc
1037 11.37 Monofilament Knotless Polyglyconate wound closure device, 2-0 30cm cm V-20, Green 26mm 1/2 Circle Taper Point, box of 12 foils size-2-0 Item1037 1 pc
1038 11.38 Monofilament Knotless Glycomer 631 wound closure device, 3-0 45cm P-14, UNDYED 24mm 3/8 Circle Resverse Cutting, box of 12 foils size- 3-0 Item1038 1 pc
1039 11.39 Polybutester monofilament suture with polytribolate coating size-*6-0 60cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0 Item1039 1 pc
1040 11.4 Polybutester monofilament suture with polytribolate coating size-*6-0 75cm 2XCV-1x36, Blue 9mm 3/8 Circle Taper Point Size:6--0 Item1040 1 pc
1041 11.41 Polybutester monifilament suture with polytribolate coating Size-*5-0, 75cm 2XCV-11X36, Blue 12mm 3/8 Circle Taper Point Item1041 1 pc
1042 11.42 Polybutester monofilament suture with polytribolate coating Size-*4-0 90cm 2XCV-23X36, Blue 17mm 1/2Circle Taper Point size: 4-0 Item1042 1 pc
1043 11.43 Polybutester monofilament suture with polytribulate coating Size-*5-0 90cm2XCV, Blue 17mm 1/2 Circle Taper Point size: 5-0 Item1043 1 pc
1044 11.44 Polybutester moniofilament suture with polytribulate coating Size-*5-0, 75cm 2XKV-11X36, Blue 13mm 3/8 Circle Tapercutting size: 5-0 Item1044 1 pc
1045 11.45 Polybutester monofilament suture with polytribolate coating Size-* 7-0, 60cm 2XMV-175-8, Blue 8mm 3/8 Circle Taper Point size: 7-0 Item1045 1 pc
1046 11.46 Polybutester monofilament suture with polytribolate coating Size-*2-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point Item1046 1 pc
1047 11.47 Polybutester monofilament suture with polytribolate coating Size-*3-0, 90cm 2XV-20X36, Blue 26mm 1/2 Circle Taper Point Item1047 1 pc
1048 11.48 Monofilament Knotless Glycomer 631 wound closure device, 2-0 23cm , VIOLET 27mm 1/2 Circle Taper Point, box of 12 foils size- 2-0 Item1048 1 pc
1049 11.49 Vaccutrend Needle/Syringe 21" x 15" Item1049 1 Each
1050 11.5 Vaccutrend Needle/Syringe 22" x 15" Item1050 1 Each
1051 11.51 Vaccutrent Needle /Syringe Item1051 1 Each
1052 11.52 Immunohistochemistry: Item1052 1 Each
1053 11.53 Anti Pax-5 FFPE Item1053 1 per ml
1054 11.54 Anti EBV FFPE Item1054 1 per ml
1055 11.55 Anti Pan CMV FFPE Item1055 1 per ml
1056 11.56 Anti CD 68 FFPE Item1056 1 per ml
1057 11.57 Anti WTI FFPE Item1057 1 per ml
1058 11.58 Anti PLAP FFPE Item1058 1 per ml
1059 11.59 Anti C3 FFPE Item1059 1 per ml
1060 11.6 Anti SMA FFPE Item1060 1 per ml
1061 11.61 Anti AR FFPE Item1061 1 per ml
1062 11.62 Anti BC16 FFPE Item1062 1 per ml
1063 11.63 Anti Myogenin FFPE Item1063 1 per ml
1064 11.64 Anti IDH-1 FFPE Item1064 1 per ml
1065 11.65 Anti ATRX FFPE Item1065 1 per ml
1066 11.66 Anti P63 FFPE Item1066 1 per ml
1067 11.67 Anti Neurofilament FFPE Item1067 1 per ml
1068 11.68 Anti CD 19 FFPE Item1068 1 per ml
1069 11.69 Anti MSA FFPE Item1069 1 per ml
1070 11.7 Anti Adipophylin FFPE Item1070 1 per ml
1071 11.71 Anti ALK D5F3 FFPE Item1071 1 per ml
1072 11.72 Anti Arginase-1 FFPE Item1072 1 per ml
1073 11.73 Anti B Catenin Item1073 1 per ml
1074 11.74 Bcl 10 FFPE Item1074 1 per ml
1075 11.75 Anti BER-EP4 FFPE Item1075 1 per ml
1076 11.76 Anti Clauclin 4 FFPE Item1076 1 per ml
1077 11.77 Anti D2 - 40 Podolanin FFPE Item1077 1 per ml
1078 11.78 Anti DOG 1 FFPE Item1078 1 per ml
1079 11.79 Anti SALL 4 FFPE Item1079 1 per ml
1080 11.8 Anti ERG FFPE Item1080 1 per ml
1081 11.81 Anti HBMEIgG4 Item1081 1 per ml
1082 11.82 Anti Inhilein FFPE Item1082 1 per ml
1083 11.83 Anti INSM 1 FFPE Item1083 1 per ml
1084 11.84 Anti Mammaglobin FFPE Item1084 1 per ml
1085 11.85 MART 1 FFPE Item1085 1 per ml
1086 11.86 Anti Melan A FFPE Item1086 1 per ml
1087 11.87 Anti MDM2 FFPE Item1087 1 per ml
1088 11.88 Anti Napsin A FFPE Item1088 1 per ml
1089 11.89 Anti P40 FFPE Item1089 1 per ml
1090 11.9 Anti PAX-8 FFPE Item1090 1 per ml
1091 11.91 Anti STAT-6 FFPE Item1091 1 per ml
1092 11.92 Anti TLE-1 FFPE Item1092 1 per ml
1093 11.93 Anti Uroplalcin-2 FFPE Item1093 1 per ml
1094 11.94 Anti Glycophorin FFPE Item1094 1 per ml
1095 11.95 Anti GCET-1 FFPE Item1095 1 per ml
1096 11.96 Anti CD 38/138 FFPE Item1096 1 per ml
1097 11.97 Anti Calcitonin FFPE Item1097 1 per ml
1098 11.98 Anti Caldermon FFPE Item1098 1 per ml
1099 11.99 Anti B Caldermon FFPE Item1099 1 per ml
1100 12 Anti CD 56 FFPE Item1100 1 per ml
1101 12.01 Anti NSM FFPE Item1101 1 per ml
1102 12.02 Anti CD 99 MIC-2 , 013 FFPE Item1102 1 per ml
1103 12.03 Anti CD 138 FFPE Item1103 1 per ml
1104 12.04 Anti CDH 17 Cadherin 17 FFPE Item1104 1 per ml
1105 12.05 Anti HeparII FFPE Item1105 1 per ml
1106 12.06 Anti Glypican-3 FFPE Item1106 1 per ml
1107 12.07 Anti STAB 2 FFPE Item1107 1 per ml
1108 12.08 Anti HRP Polymer Kit Item1108 1 per ml
1109 12.09 FITC Lambda light chain Immunofluorescence Item1109 1 per ml
1110 12.1 FITC IgM Immunofluorescence Item1110 1 per ml
1111 12.11 FITC IgA Immunofluorescence Item1111 1 per ml
1112 12.12 FITC IgG Immunofluorescence Item1112 1 per ml
1113 12.13 FITC C3 Immunofluorescence Item1113 1 per ml
1114 12.14 MLH1, MSH2, MSH6, PMS2 (Together) Item1114 1 per ml
1115 12.15 PDL1 Clone SP142 Item1115 1 per ml
1116 12.16 EGFR Clone 31G7 Item1116 1 per ml
1117 12.17 CDX2 Item1117 1 per ml
1118 12.18 GATA 3 Item1118 1 per ml
1119 12.19 CK 18 Item1119 1 per ml
1120 12.2 Mesothelin Item1120 1 per ml
1121 12.21 Glut 1 Item1121 1 per ml
1122 12.22 GCDFP Item1122 1 per ml
1123 12.23 MYB Item1123 1 per ml
1124 12.24 PLAG 1 Item1124 1 per ml
1125 12.25 HMGA 2 Item1125 1 per ml
1126 12.26 EBER in-situ Hybridization Item1126 1 Kit
1127 12.27 PCR Item1127 1 Each
1128 12.28 EGFR RT PCR Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue Item1128 1 Kit
1129 12.29 MSI detection Kit compatible With Qiagen for Formalin fixed Paraffin embedded FFPE Tissue Item1129 1 Kit
1130 12.3 BCR-Abl1-PCR Kit compatible With Qiagen Item1130 1 Kit
1131 12.31 FISH Item1131 1 Each
1132 12.32 ALK mutation break apart probe in lung adenocarcinoma Item1132 1 Kit
1133 12.33 MYB-NFIB dual colour fusion probe Item1133 1 Kit
1134 12.34 MYB dual colour break apart probe Item1134 1 Kit
1135 12.35 MAML2 dual colour break apart probe Item1135 1 Kit
1136 12.36 ETV6 dual colour break apart rearrangement probe Item1136 1 Kit
1137 12.37 PLAG 1 rearrangement probe Item1137 1 Kit
1138 12.38 HMGA 2 rearrangement probe Item1138 1 Kit
1139 12.39 Immunofluorescence Item1139 1 Each
1140 12.4 Anti p-ANCA direct Immunofluorescence Item1140 1 Kit
1141 12.41 Anti c-ANCA direct Immunofluorescence Item1141 1 Kit
1142 12.42 Anti ANA direct Immunofluorescence Item1142 1 Kit
1143 12.43 Anti Aquaporin 4 Item1143 1 Kit
1144 12.44 C1q Item1144 1 Kit
1145 12.45 Flowcytometry Item1145 1 Each
1146 12.46 CD 16 APC Item1146 1 Kit
1147 12.47 HLA B27 Kit (should be compatible with BD Facscalibur) Item1147 1 Kit
1148 12.48 Elisa (MAGO-4) Item1148 1 Each
1149 12.49 Anti P-ANCA Elisa Item1149 1 Sets
1150 12.5 Anti c-ANCA Elisa Item1150 1 Sets
1151 12.51 Anti Cyclic Citrulinated peptide (CCP) Elisa Item1151 1 Sets
1152 12.52 Anti Smith Elisa Item1152 1 Sets
1153 12.53 Anti Peroxiredoxin VI (Prx VI) Elisa Item1153 1 Sets
1154 12.54 Anti Bmi I Elisa Item1154 1 Sets
1155 12.55 Anti Matrix Metalloproteinase 7 (MMP7) Elisa Item1155 1 Sets
1156 12.56 Anti NY ESO I Item1156 1 Sets
1157 12.57 Anti Scl 70 Item1157 1 Sets
1158 12.58 Anti URNP Item1158 1 Sets
1159 12.59 Chemicals and Consumables Item1159 1 Each
1160 12.6 Proteinase K Item1160 1 Sets
1161 12.61 Pronase Item1161 1 Sets
1162 12.62 FISH Reagents : Item1162 1 Each
1163 12.63 Poly L Lysine Item1163 1 ml
1164 12.64 20X Saline Sodium Citrate (20X SSC) Salt, Molecular Grade Item1164 1 gm
1165 12.65 1 M NaSCN ( 1M Sodium Thiocyanate) Salt, Molecular Grade Item1165 1 gm
1166 12.66 IGEPAL @ CA 630 Item1166 1 gm
1167 12.67 Rubber Cement Item1167 1 tube
1168 12.68 DAPI Item1168 1 ml
1169 12.69 Sodium Chloride (NaCL), 58.44g mol-1 Molecular Grade Item1169 1 gm
1170 12.7 Sodium Citrate (Na3C6H5O7) 258.06g mol-1 Molecular Grade Item1170 1 gm
1171 12.71 Fluorescence microscopic immersion oil Item1171 1 ml
1172 12.72 Immunofluorescence Reagents : Item1172 1 Each
1173 12.73 Trypsin Powder,Molecular Grade Item1173 1 gm
1174 12.74 Additional Consumables / Disposables Item1174 1 Each
1175 12.75 15mm double swivel with port & extension Item1175 1 Each
1176 12.76 72 hours CLOSED VENTILATION SUCTION CATHETER Must have double - lumen siliconised catheter Swivel connector un-coupling wedge, Lockable thumb –Valve end Cap, Softer Sleeve material, 72 hour recommended during of use. Size: 12F, 14F, 16F Item1176 1 Each
1177 12.77 Adjustable circle breathing system (2 Litre bag, 2 metre length and 1.5 metre limb) Item1177 1 Each
1178 12.78 Adjustable circle breathing system (2 mts length) Item1178 1 Each
1179 12.79 Adult curved flared prong with tube1.8m length Item1179 1 Each
1180 12.8 Adult curved nasal prong with tube1.8m length Item1180 1 Each
1181 12.81 Adult Respi-Check high concentration oxygen mask with oxygen tube Item1181 1 Each
1182 12.82 Anti-microbial circle breathing system (1.6 metre length and 0.8 metre limb) Item1182 1 Each
1183 12.83 Anti-microbial circle breathing system (2 litre bag, 1.6 metre Length, 0.8 metre limb) Item1183 1 Each
1184 12.84 Anti-microbial circle breathing system (2 litre bag, 2.4 metre Length, 0.8 metre limb) Item1184 1 Each
1185 12.85 Apron Cloth (Sterile) Item1185 1 Each
1186 12.86 Attest 1292 E Biological Indicator Item1186 1 Each
1187 12.87 Attest Biological Indicator (for styeam) 3M Item1187 1 Each
1188 12.88 Attest Rapid Auto Reader Incubator (For Steam) (Early result for biological test) Item1188 1 Each
1189 12.89 Balanced Salt Solution (BSS) Item1189 1 Each
1190 12.9 Bilbao-Dotter tube with guide wire Item1190 1 Each
1191 12.91 BIS Electrodes Item1191 1 Each
1192 12.92 Bone file Item1192 1 Each
1193 12.93 Bone ronger Item1193 1 Each
1194 12.94 BP blade with handle (no 15 & 17) Item1194 1 Each
1195 12.95 Cardiac Troponin T kit Item1195 1 Each
1196 12.96 Center hole towel Item1196 1 Each
1197 12.97 COBAN Tm 4" Item1197 1 Each
1198 12.98 Cols light source for transillumination Item1198 1 Each
1199 12.99 Contra angle hand piece Item1199 1 Each
1200 13 Disposable Face Mask (Cloth) Item1200 1 Each
1201 13.01 Disposable Head Positioning Device for the Prone Position – Made of latex- free foam with mirror for providing the clinician a clear view of face, eye & endotrachael tube plus sloted design for positioning of Endotracheal on either side of the patient face 8000HDP Item1201 1 Each
1202 13.02 Disposable Kelly's Pad Item1202 1 Each
1203 13.03 ECG monitoring Electrode (Solid Hydrogel) Item1203 1 Each
1204 13.04 ECG monitoring Electrode with foam backing 2223 Item1204 1 Each
1205 13.05 ECG monitoring Electrode with foam backing Large Item1205 1 Each
1206 13.06 Elastometric Infusion Pump for Analgesia 5ml/hour Item1206 1 Each
1207 13.07 Elastometric Infusion Pump for Analgesia 2ml/hour Model SV2 Item1207 1 Each
1208 13.08 Elevators (Straight and Periostal) Item1208 1 Each
1209 13.09 Emergency Cricothyrotomy Device Adult 4mm ID Children 2mm ID Item1209 1 Each
1210 13.1 Eye wear for composite fillings Item1210 1 Each
1211 13.11 Face guard Item1211 1 Each
1212 13.12 Fibre splint Item1212 1 Each
1213 13.13 Fluid Warming Cassette (Disposable) WF-250 Item1213 1 Each
1214 13.14 Fluid Warming Cassette (Disposable) WF-100 Item1214 1 Each
1215 13.15 Gigly Saw Item1215 1 Each
1216 13.16 Glass bead sterilizer Item1216 1 Each
1217 13.17 Tungsen Carbide Burs for Air Rotor and Micro Motor Hand Pieces Item1217 1 Each
1218 13.18 Green PVC tubing for oxygen 6 mm, Length in metres Item1218 1 Each
1219 13.19 Iodixannol 320 mg Iodine/ml-100 ml. Item1219 1 Each
1220 13.2 Iohexol 300 mg-Iodine/ml 100 ml Item1220 1 Each
1221 13.21 Iomeron 400 mg/ml – 50 ml. Item1221 1 Each
1222 13.22 Ioversol/Iopamide/Iopamidol – 50 ml. Item1222 1 Each
1223 13.23 ISO Green Standard Laryngoscope System (Disposable plastic blades) 7 sizes of MAC and Miller blades Item1223 1 Each
1224 13.24 JESS fixtators pediatric/large Item1224 1 Each
1225 13.25 Jobson's Probe Item1225 1 Each
1226 13.26 Kinesiology Color Tap/Taping for Orthopaedic used Item1226 1 Each
1227 13.27 Killian's Nasal Speculum Item1227 1 Each
1228 13.28 K-Wires: 1.8mm Item1228 1 Each
1229 13.29 K-Wires: 4mm Item1229 1 Each
1230 13.3 K-Wires: 1.5 mm Item1230 1 Each
1231 13.31 K-Wires: 2.5 mm Item1231 1 Each
1232 13.32 K-Wires: 2mm Item1232 1 Each
1233 13.33 K-Wires: 3mm Item1233 1 Each
1234 13.34 Macintosh Style blades 2, 4 Item1234 1 Each
1235 13.35 Magill’s forceps Adult child infant Item1235 1 Each
1236 13.36 Manual Plaster cutting saw Item1236 1 Each
1237 13.37 Manual Plaster spreader Item1237 1 Each
1238 13.38 Manual Torniquet (cuff & Pump) Item1238 1 Each
1239 13.39 Mayo stand cover Item1239 1 Each
1240 13.4 Miller style blades 0, Item1240 1 Each
1241 13.41 Miller style blades 1 Item1241 1 Each
1242 13.42 Mortar and Pestle Item1242 1 Each
1243 13.43 Mouth & Cheek retractor Item1243 1 Each
1244 13.44 Mouth mirror Item1244 1 Each
1245 13.45 MRI compatible Laryngoscopes All sizes Item1245 1 Each
1246 13.46 MRI Film 14” x 17” Item1246 1 Each
1247 13.47 Neopuff (Neonatal Resuscitator) Item1247 1 Each
1248 13.48 North Nasal Preformed Cuffed TubeCuffed Must have IVORY PVC Profile Soft Seal Cuff, implantation tested Black intubations depth marker, 15mmconnector with 1S0 5356-1 Larger cuff resting diameter Size: 6To 8mm ID & length 27cm to 30.5 tips to nares Item1248 1 Each
1249 13.49 OVARIAN SHIELD (Kiran) Item1249 1 Each
1250 13.5 Oxygen Supply Tubing for Heat & Moisture Exchanger Oxygen Supply Tubing for Heat & Moisture Exchanger with Connector to attach HME for Tracheostomy Tube Length 15cm Item1250 1 Each
1251 13.51 Oxygen Analyser Item1251 1 Each
1252 13.52 Oxygen Blenders Item1252 1 Each
1253 13.53 Para film roll (size 10cmx125cm) 3 “ dia Item1253 1 Each
1254 13.54 Parafilm, roll Item1254 1 Each
1255 13.55 Perineural catheter for continuous plexus and peripheral nerve blocks. Content: 118 G lacoplex needle with centimeter graduation 1 perinueral Pebax catheter (0.45 x 0.85mm – 50cm long) with centimeter distance markings and open distal tip 1 0.22 antibacterial filter 1 additional extension tube, 50cm long, 1.5 x 2.5 mm dia, priming volume 1.10ml 1 10ml syringe for the aspiration test 1 10 x 15 cm Dermafilm transparent adhesive dressing Item1255 1 Each
1256 13.56 Periostal elevators (small and big) Item1256 1 Each
1257 13.57 Winged infusion set- Non coring needles with injection site to access ports,20G X 1.00(needle) Item1257 1 Each
1258 13.58 Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-7fr,65cm length(Ped) Item1258 1 Each
1259 13.59 Hickman-Broviac 4.2Fr(or smaller) single lumen pediatric cath w STIC PAPAIS Item1259 1 Each
1260 13.6 Hickman-Broviac 6.6Fr single lumen pediatric cath w STIC 90cm Item1260 1 Each
1261 13.61 Hickman-Double Lumen tunneled silicon catheter with sure cuff tissue in growth cuff, size-9fr,90cm length(Adult) Item1261 1 Each
1262 13.62 Plaster Cutter Electric Item1262 1 Each
1263 13.63 Plaster saw Item1263 1 Each
1264 13.64 Plier long nose Item1264 1 Each
1265 13.65 Pneumatic Compression Stocking Item1265 1 Each
1266 13.66 Portable Autoclave Electrically Operated Made of Aluminium size:300mm x 300mm capacity 24 litres Item1266 1 Each
1267 13.67 Portable Autoclave Electrically Operated Made of Aluminium size:350mm x 300mm-325mm Depth: 1.5 Kw Item1267 1 Each
1268 13.68 Pyridin Item1268 1 Each
1269 13.69 Reusable Pressure Monitoring cable With integrity check system by 100mmhg pressure and with reusable modular clamp Item1269 1 Each
1270 13.7 Reusable Pressure Transducer With integrity check system by 100mmhg pressure, with microchip technology, Reusable cable, and with reusable clamp Item1270 1 Each
1271 13.71 Ronguers(down cutter) Item1271 1 Each
1272 13.72 Ronguers(up cutter) Item1272 1 Each
1273 13.73 Rubber Macintosh Item1273 1 Each
1274 13.74 Russian Forceps Item1274 1 Each
1275 13.75 Light Weight Hernia Mesh,PGA Polypropylene 11 x 15 Item1275 1 Each
1276 13.76 Light Weight Hernia Mesh,PGA Polypropylene 6 x 11 Item1276 1 Each
1277 13.77 Seldinger technique catheter for arterial puncture Content: 1 Transparent and XPO cathter (PE) /(PTFE) 1 Intruducer needle 1 straight wire 115.092 115.094 115.118 5118.702 5118.703 Item1277 1 Each
1278 13.78 Self Holding retractors for Spine surgery Item1278 1 Each
1279 13.79 Single Use Resuscitation Mask for CPCR (Non-return valve, Integral Bacterial/Viral filter) Item1279 1 Each
1280 13.8 Slide Mailer 1 slide Item1280 1 Each
1281 13.81 Slide Mailer 2 slide Item1281 1 Each
1282 13.82 Soap Dispenser Item1282 1 Each
1283 13.83 Soda Lime (Imported) – changes from White to Violet on exhaustion 5kg Item1283 1 Each
1284 13.84 Sodium hypochloride solution 5Litre Item1284 1 Each
1285 13.85 Spreader /Plugger Item1285 1 Each
1286 13.86 Steinman pins:4.5mm Item1286 1 Each
1287 13.87 Steinmann Pins Item1287 1 Each
1288 13.88 Sterigage Chemical Indicator (for Steam) 3M Item1288 1 Each
1289 13.89 Surgical Clipper Item1289 1 Each
1290 13.9 Surgical Preparation Razor Item1290 1 Each
1291 13.91 Thermal Videographic Printer (Black & White) (Sony, Latest UP series) Item1291 1 Each
1292 13.92 Tissue paper for Ultrasound Item1292 1 Each
1293 13.93 Ultra violet cabinet (800/500 x 2000 mm) Item1293 1 Each
1294 13.94 Vacuum assisted dressing system Item1294 1 Each
1295 13.95 Vascular Debeky Angle (Medium) Item1295 1 Each
1296 13.96 Vascular Debeky Straight (Medium) Item1296 1 Each
1297 13.97 Vaseline gauze Item1297 1 Each
1298 13.98 Ventilator 15 mm breathing systems (with luer lock, 1.6 metre length and resealable water trap) for Paediatrics Item1298 1 Each
1299 13.99 Ventilator Breathing System with resealable water traps (smooth lumen) Item1299 1 Each
1300 14 Waste Management Wheeled Bins. (660Lit ; 300lit; 1100 lit) Item1300 1 Each
1301 14.01 Wire cutter Item1301 1 Each
1302 14.02 Y-pieces for Breathing Circuit Item1302 1 Each
1303 14.03 Absorbable Gelatin Sponge U.S.P (Ab-Gel) 10 X 10 Item1303 1 Each
1304 14.04 Alginate impression materials(Dust free) Item1304 1 Each
1305 14.05 Double swivel with port 15mm Item1305 1 Each
1306 14.06 Green PVC tubing 6mm for oxygen / per meter Item1306 1 Each
1307 14.07 2 mm Osteotomes Item1307 1 Each
1308 14.08 3 mm Osteotomes Item1308 1 Each
1309 14.09 Asepto Pump Item1309 1 Each
1310 14.1 Autoclavable biohazard plastic bag 10liter Item1310 1 Each
1311 14.11 Autoclavable biohazard plastic bag 20liter Item1311 1 Each
1312 14.12 Autoclavable biohazard plastic bag 30liter Item1312 1 Each
1313 14.13 Bone Cement(Plain) Item1313 1 Each
1314 14.14 Bone Cement(Antibiotics) Item1314 1 Each
1315 14.15 Bougie(stylet) Item1315 1 Each
1316 14.16 Burretta Item1316 1 Each
1317 14.17 CAPD Catheter Tenckhoff with 2 felt cuffs SA 1242 (420 mm) Item1317 1 Each
1318 14.18 Cast Taper Mandrel Item1318 1 Each
1319 14.19 Chiesel Item1319 1 Each
1320 14.2 Cleaning Brush Item1320 1 Each
1321 14.21 Cleaning solution Item1321 1 Each
1322 14.22 CPR manikin Item1322 1 Each
1323 14.23 Stoma Flatmoldable Small 45MM Item1323 1 Each
1324 14.24 Stoma Flatmoldable Medium 45MM Item1324 1 Each
1325 14.25 Stoma Flatmoldable Regular 57MM Item1325 1 Each
1326 14.26 Stoma Flatmoldable Large 70MM Item1326 1 Each
1327 14.27 Moldable convex 12/22MM Item1327 1 Each
1328 14.28 Moldable convex 22/33MM Item1328 1 Each
1329 14.29 Moldable convex 33/57MM Item1329 1 Each
1330 14.3 Ostomy Appliance Accessories Belt Item1330 1 Each
1331 14.31 Coloured Ph indicator Paper Item1331 1 Each
1332 14.32 Dissecting Instrument Box Item1332 1 Each
1333 14.33 Double swivel with port 15 mm x 22mm Item1333 1 Each
1334 14.34 Drape Formers Trans femoral Item1334 1 Each
1335 14.35 Drape Formers Trans tibial Item1335 1 Each
1336 14.36 Espocan with Docking System Item1336 1 Each
1337 14.37 ETO chemical Indicator tape -3M Item1337 1 Each
1338 14.38 ETO packing sleeves roll (3M) 12' Item1338 1 Each
1339 14.39 ETO packing sleeves roll (3M) 4' Item1339 1 Each
1340 14.4 ETO packing sleeves roll (3M) 6' Item1340 1 Each
1341 14.41 Surgicel Fibrillar 1963 Item1341 1 Each
1342 14.42 G- Bone Item1342 1 Each
1343 14.43 Gloves wrapper Item1343 1 Each
1344 14.44 Laparoscopic Aspiration needle Item1344 1 Each
1345 14.45 Hemorrhoids and Prolapsed Stapler with Detachable Anvil 3.5mm Item1345 1 Each
1346 14.46 Hemorrhoids and Prolapsed Stapler with Detachable Anvil 4.8mm Item1346 1 Each
1347 14.47 Hose Mount 15mm female male pair Item1347 1 Each
1348 14.48 Hose Mount 22mm female male pair Item1348 1 Each
1349 14.49 Hygrobaby/HME Filter (Infant) Item1349 1 Each
1350 14.5 Hygroboy/HME Filter (Paediatric) Item1350 1 Each
1351 14.51 Hygrostar/HME Filter (Adult) Item1351 1 Each
1352 14.52 hygrobac S Item1352 1 Each
1353 14.53 Intraocular lense 6mm optics foldable, square edge, Hydrophobic Item1353 1 Each
1354 14.54 Intraocular lense rigid 5.25mm optics,PMMA, square edge Item1354 1 Each
1355 14.55 Intraocular lense rigid 5.5mm optics Item1355 1 Each
1356 14.56 Intraocular lense rigid 5.5mm optics foldable Item1356 1 Each
1357 14.57 Intraocular lense rigid 6mm optics Item1357 1 Each
1358 14.58 Intraocular lense rigid 6mm optics foldable Item1358 1 Each
1359 14.59 Intraocular lense rigid 6mm optics, PMMA, square edge Item1359 1 Each
1360 14.6 Rigid Anterior Chamber Intraocular Lens: Lens Power +16D(6.00mm) Item1360 1 Each
1361 14.61 Rigid Anterior Chamber Intraocular Lens: Lens Power +19D(6.00mm) Item1361 1 Each
1362 14.62 Rigid Anterior Chamber Intraocular Lens: Lens Power +18D(6.00mm) Item1362 1 Each
1363 14.63 Rigid Anterior Chamber Intraocular Lens: Lens Power +20D(6.00mm) Item1363 1 Each
1364 14.64 Rigid Anterior Chamber Intraocular Lens: Lens Power +21D(6.00mm) Item1364 1 Each
1365 14.65 Rigid Anterior Chamber Intraocular Lens: Lens Power +22D(6.00mm) Item1365 1 Each
1366 14.66 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) Item1366 1 Each
1367 14.67 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.5D(5.50mm) Item1367 1 Each
1368 14.68 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +20.0D(5.50mm) Item1368 1 Each
1369 14.69 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.0D(5.50mm) Item1369 1 Each
1370 14.7 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +21.5D(5.50mm) Item1370 1 Each
1371 14.71 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.0D(5.50mm) Item1371 1 Each
1372 14.72 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +22.5D(5.50mm) Item1372 1 Each
1373 14.73 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.0D(5.50mm) Item1373 1 Each
1374 14.74 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +23.5D(5.50mm) Item1374 1 Each
1375 14.75 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.0D(5.50mm) Item1375 1 Each
1376 14.76 Rigid Posterior Chamber Intraocular Lens (5.50mm Optic Diameter) : Lens Power +24.5D(5.50mm) Item1376 1 Each
1377 14.77 (a) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +10.0D 6.0mm Item1377 1 Each
1378 14.78 (b) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +113.5D 6.0mm Item1378 1 Each
1379 14.79 (c) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+14.0D 6.0mm Item1379 1 Each
1380 14.8 (d) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.0D 6.0mm Item1380 1 Each
1381 14.81 (e) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+15.5D 6.0mm Item1381 1 Each
1382 14.82 (f) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.0D 6.0mm Item1382 1 Each
1383 14.83 (g) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+16.5D 6.0mm Item1383 1 Each
1384 14.84 (h) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.0D 6.0mm Item1384 1 Each
1385 14.85 (i) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+17.5D 6.0mm Item1385 1 Each
1386 14.86 (j) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.0D 6.0mm Item1386 1 Each
1387 14.87 (k) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+18.5D 6.0mm Item1387 1 Each
1388 14.88 (l) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19..0D 6.0mm Item1388 1 Each
1389 14.89 (m) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+19.5D 6.0mm Item1389 1 Each
1390 14.9 (n) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.0D 6.0mm Item1390 1 Each
1391 14.91 (o) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+20.5D 6.0mm Item1391 1 Each
1392 14.92 (p) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.0D 6.0mm Item1392 1 Each
1393 14.93 (q) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+21.5D 6.0mm Item1393 1 Each
1394 14.94 (r) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.0D 6.0mm Item1394 1 Each
1395 14.95 (s) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+22.5D 6.0mm Item1395 1 Each
1396 14.96 (t) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+23.0D 6.0mm Item1396 1 Each
1397 14.97 (u)Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power: +23.5D 6.0mm Item1397 1 Each
1398 14.98 (v) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.0D 6.0mm Item1398 1 Each
1399 14.99 (w) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+24.5D 6.0mm Item1399 1 Each
1400 15 (x) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.0D 6.0mm Item1400 1 Each
1401 15.01 (y) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+25.5D 6.0mm Item1401 1 Each
1402 15.02 (z) Foldable Posterior Chamber Intraocular Lens(Alcon Acrysof IQ), Acrylic,hydrophobic,square edge,UV and blue light filtering,anterior asymmetric buconvec, planar haptics,Lens Power:+26.0D 6.0mm Item1402 1 Each
1403 15.03 Mayo trolly cover (disposable) Item1403 1 Each
1404 15.04 Membrane Assembly Item1404 1 Each
1405 15.05 Micro Centrifuge Tube 1.5ml Item1405 1 Each
1406 15.06 Micro Centrifuge Tube 15ml Item1406 1 Each
1407 15.07 micro centrifuge tubes-.2ml (with thin wall for PCR) Item1407 1 Each
1408 15.08 micro centrifuge tubes-.5ml (with thin wall for PCR) Item1408 1 Each
1409 15.09 micro centrifuge tubes-2ml Item1409 1 Each
1410 15.1 Microscope Bulb- 6V 20W Item1410 1 Each
1411 15.11 Mini & micropates with screw Item1411 1 Each
1412 15.12 Nasal Tubing 70mm Item1412 1 Each
1413 15.13 Needle (cutting) big Item1413 1 Each
1414 15.14 Needle (cutting) medium Item1414 1 Each
1415 15.15 Needle (cutting) small Item1415 1 Each
1416 15.16 Needle (round body) big Item1416 1 Each
1417 15.17 Needle (round body) medium Item1417 1 Each
1418 15.18 Needle (round body) small Item1418 1 Each
1419 15.19 Non invasive cardiac output monitoring electrode Item1419 1 Each
1420 15.2 Non invasive cardiac pacing electrode Item1420 1 Each
1421 15.21 Ostomy powder 25gm Item1421 1 Each
1422 15.22 Pneumatic Compression Stocking Item1422 1 Each
1423 15.23 Pressure monitoring kit with three way disposable pressure( For CVP & Atrerial) Item1423 1 Each
1424 15.24 RAE tub 7.5 Item1424 1 Each
1425 15.25 Self adhesive urine sample bag - Pediatric Item1425 1 Each
1426 15.26 Spirit swabs Item1426 1 Each
1427 15.27 Sterile swab sticks Item1427 1 Each
1428 15.28 Steri-Stripes Item1428 1 Each
1429 15.29 Esmarch 4" Item1429 1 Each
1430 15.3 Esmarch 6" Item1430 1 Each
1431 15.31 Polyester Synthetic Cast padding Item1431 1 Each
1432 15.32 Suction cannula for MTP size purandre Item1432 1 Each
1433 15.33 Ostomy Appliance Accessories Belt Item1433 1 Each
1434 15.34 Stomadress Plus Single Pouch - Opaque Item1434 1 Each
1435 15.35 ActiveLife One Pc Drainable Pouch Item1435 1 Each
1436 15.36 Tubing Kit Item1436 1 Each
1437 15.37 urianalyser Item1437 1 Each
1438 15.38 Urine Control A360 Item1438 1 Each
1439 15.39 Ventilating Airway Bougies Item1439 1 Each
1440 15.4 Ventilator Tubing W/1 (venti breathing system with reseable water trap) Item1440 1 Each
1441 15.41 Y-pieces Item1441 1 Each
1442 15.42 6mm Green PVC tubing for oxygen Item1442 1 Each
1443 15.43 Alpha mattress Item1443 1 Each
1444 15.44 Analspeculum Size: 25 Item1444 1 Each
1445 15.45 AO universal clamps Item1445 1 Each
1446 15.46 Baby Cradle with mattress and Net Item1446 1 Each
1447 15.47 Blood Gas Quality Control (30x1.7ml) Level 1 (ABG) Item1447 1 Each
1448 15.48 Blood Gas Quality Control (30x1.7ml) Level 2 (ABG) Item1448 1 Each
1449 15.49 Blood Gas Quality Control (30x1.7ml) Level 3 (ABG) Item1449 1 Each
1450 15.5 Bone Cutter Item1450 1 Each
1451 15.51 Bone cutter Big size Item1451 1 Each
1452 15.52 Centrifuge Tube Item1452 1 Each
1453 15.53 Centrifuge tubes, polypropylene seal with capacity 3.5 - 10 ml Item1453 1 Each
1454 15.54 Clavicular Braces Item1454 1 Each
1455 15.55 Cider wood oil Item1455 1 Each
1456 15.56 DeBakey’s Bull Dog Clamps, Curved 115mm (4 ½”) long Item1456 1 Each
1457 15.57 DeBakey’s Bull Dog Clamps, Curved 70mm (2 ¾”) long Item1457 1 Each
1458 15.58 DeBakey’s Bull Dog Clamps, Curved 80mm (3 ?”) long Item1458 1 Each
1459 15.59 DeBakey’s Bull Dog Clamps, Straight 120mm (4 ¾”) Item1459 1 Each
1460 15.6 DeBakey’s Bull Dog Clamps, Straight 75mm (3”) Item1460 1 Each
1461 15.61 DeBakey’s Bull Dog Clamps, Straight 85mm (3 ?”) Item1461 1 Each
1462 15.62 Divided Mattress Item1462 1 Each
1463 15.63 Dropper bottle 250ml Item1463 1 Each
1464 15.64 Dropper bottle 500ml Item1464 1 Each
1465 15.65 Dropper p.p. 6 long Item1465 1 Each
1466 15.66 NPWT dressing kit Item1466 1 Each
1467 15.67 Silicone Rubber heel cups Item1467 1 Each
1468 15.68 Electrodes for IFT (For Combination therapy-Ultra sound therapy + Electrical Stimulator) (Make: Enraf nonius Sonoplus 491) Item1468 1 Each
1469 15.69 Episiotomy scissor size 15cm Item1469 1 Each
1470 15.7 Fixation Ring (904-898) Item1470 1 Each
1471 15.71 Fixation Ring (904-898) for Transcutaneous PO2/PCO2 (Make: Radiometer, Model: TCM 40) Item1471 1 Each
1472 15.72 Fluid warmer Item1472 1 Each
1473 15.73 Fogging Machine Item1473 1 Each
1474 15.74 G-Bone Item1474 1 Each
1475 15.75 Gigly Saw Item1475 1 Each
1476 15.76 Ginevri Capillary tube (H) (Microbillimeter) Item1476 1 Each
1477 15.77 Glover with Atraumatic jaws, Curved jaws, 85mm (3 ?”), 45mm jaws Item1477 1 Each
1478 15.78 Hand Drill Item1478 1 Each
1479 15.79 Hand wash basin stand (double). - Five legs base mounted on 5cms dia castors with one 35cm s.s basin.Pre treated and epoxy powder coated. Item1479 1 Each
1480 15.8 Hysterectomy clamp ‘FAURE’ Item1480 1 Each
1481 15.81 I.V. drip stand Item1481 1 Each
1482 15.82 Intra uterine cannula ‘COLLINS’ plain 3 size Item1482 1 Each
1483 15.83 Intra uterine cannula ‘HAYES PROVIS’ with rubber cone Item1483 1 Each
1484 15.84 Kidney Wash Machine (Renatron II) Item1484 1 Each
1485 15.85 Knee Immobilizer OC 2035 Item1485 1 Each
1486 15.86 Knee Immobilizer OC 2035 Item1486 1 Each
1487 15.87 Knee Stabilizer-DC 2069 Item1487 1 Each
1488 15.88 Leishmans stain Item1488 1 Each
1489 15.89 Lengenback retractor Item1489 1 Each
1490 15.9 Lengenback retractor Item1490 1 Each
1491 15.91 Lens cleaning paper Item1491 1 Each
1492 15.92 Lymph node Item1492 1 Each
1493 15.93 Magnet for ECG Item1493 1 Each
1494 15.94 Malleable stylets with adjustable stop, different size Item1494 1 Each
1495 15.95 MEASURING TAPE Item1495 1 Each
1496 15.96 Measuring Tape (Clinical) Item1496 1 Each
1497 15.97 Microscope ( for side lab) - Binocular electric light microscope Item1497 1 Each
1498 15.98 Molina Sheet Item1498 1 Each
1499 15.99 Mosquito Net (Single use patient specific, plastic) Item1499 1 Each
1500 16 Mouth gag Item1500 1 Each
1501 16.01 Myoma screw ‘DOYEN’ Item1501 1 Each
1502 16.02 Na+ - sensor casing (ABG) Item1502 1 Each
1503 16.03 Non Invasive Glucose monitoring system (Glucometer) Item1503 1 Each
1504 16.04 Ounce glass steel Item1504 1 Each
1505 16.05 Oxygen cylinder stand /trolley - B Type Item1505 1 Each
1506 16.06 Pad Electrodes for SWD (DX 500 roland) Item1506 1 Each
1507 16.07 Paper Roll (ABG) Item1507 1 Each
1508 16.08 Patient Breathing Set Infant Reusable (Galileo Gold) Item1508 1 Each
1509 16.09 Patient cable for IFT/MST (Make/Model: Multidyne 965) Item1509 1 Each
1510 16.1 Patient shifting trolleys with the facility of Oxygen Cylinder carrier Item1510 1 Each
1511 16.11 Pelvic traction kit with pulley and weight Item1511 1 Each
1512 16.12 Pile Binder Item1512 1 Each
1513 16.13 Plastic dropping bottle (120ml) Item1513 1 Each
1514 16.14 Plastic small tube Item1514 1 Each
1515 16.15 RAOS hand suction unit 100 ml Item1515 1 Each
1516 16.16 Ref. - membrane shell (ABG) Item1516 1 Each
1517 16.17 Resucitation kits Automatics Item1517 1 Each
1518 16.18 Resuscitation kit Emergency Item1518 1 Each
1519 16.19 Resuscitation kit for neonates Item1519 1 Each
1520 16.2 Rubber Sole - 4mm Item1520 1 Each
1521 16.21 Sample detector Item1521 1 Each
1522 16.22 Screw driver Item1522 1 Each
1523 16.23 Sealing rings Item1523 1 Each
1524 16.24 Set tubing for roller pump (reagents) (ABG) Item1524 1 Each
1525 16.25 Shin tube cutting jig 30mm Item1525 1 Each
1526 16.26 Shin tube cutting jig 35mm Item1526 1 Each
1527 16.27 Short needle Holder Item1527 1 Each
1528 16.28 Side Support (Meditrin) Item1528 1 Each
1529 16.29 Silicon Tubal Ring Item1529 1 Each
1530 16.3 Solid waste containers liners Item1530 1 Each
1531 16.31 Solution Valve Item1531 1 Each
1532 16.32 Spare canvas bag Item1532 1 Each
1533 16.33 Spare lamp for Opthalmoscope Item1533 1 Each
1534 16.34 Spare parts for: Easylyte,911 , 912 & others Item1534 1 Each
1535 16.35 Spirit lamp Item1535 1 Each
1536 16.36 Stich scissor Item1536 1 Each
1537 16.37 Suture anchor (orthopaedics) Item1537 1 Each
1538 16.38 Syringe Infusion pump Item1538 1 Each
1539 16.39 T- handle for Orthopaedics Item1539 1 Each
1540 16.4 Tailor Thread Item1540 1 Each
1541 16.41 TCO2 sensor Item1541 1 Each
1542 16.42 Teley's Forcep Item1542 1 Each
1543 16.43 Vortex mixer Item1543 1 Each
1544 16.44 Vulsellum forceps 1 x 1 teeth 25cm Item1544 1 Each
1545 16.45 Wire Cutter Item1545 1 Each
1546 16.46 Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure) Item1546 1 Each
1547 16.47 Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Low Pressure) Item1547 1 Each
1548 16.48 Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene. Item1548 1 Each
1549 16.49 Ventriculo Peritoneal Shunt- The system is supplied complete with a ventricular catheter 15cm long, a unitised shunt assembly with a distal catheter and two straight connectors, this pack is sterilized by ethelene oxide (Medium Pressure with bacterial resistance) Item1549 1 Each
1550 16.5 Manual Hub Cutter – with biohazard symbol and which can cut the plastic hub and NOT the metal needle with temporary and permanent locking mechanism on complete filling of the disposal hub cutter with clear demarcation of fill line and which can accomadate upto 400-600 needles. Item1550 1 Each
1551 16.51 Cerebral Reservior (Omaya Type) Item1551 1 Each
1552 16.52 Extranal Ventricular Drainage Syatem Item1552 1 Each
1553 16.53 Lumbar Extranal Drainage System Item1553 1 Each
1554 16.54 Poly Propylene mesh (small) for Duroplasty Item1554 1 Each
1555 16.55 Poly Propylene Mesh (Medium) for Duroplasty Item1555 1 Each
1556 16.56 Poly Propylene Mesh (Large) for Duroplasty Item1556 1 Each
1557 16.57 G Bone Cement (for Cranioplasty) Item1557 1 Each
1558 16.58 Kraniotomy Drape Item1558 1 Each
1559 16.59 Iodine Drape Large Item1559 1 Each
1560 16.6 Balanced Salt Solution with Na/K/Mg & chloride levels similar to plasma with acetate & gluconate/malate as buffer, must not contain calcium ( eg.Plasmalyte A /Volulyte etc) Item1560 1 Each
1561 16.61 Bactiseal Impregnated Shunt - FDA Approved, fixed pressure VP Shunts (low,medium, high) that are antibiotic impregnated and can reduce the potential for bacterial colonization in the lumen as well as its outer surface. Item1561 1 Each
1562 16.62 Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Item1562 1 Each
1563 16.63 Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Item1563 1 Each
1564 16.64 Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Item1564 1 Each
1565 16.65 Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Item1565 1 Each
1566 16.66 Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Item1566 1 Each
1567 16.67 Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Item1567 1 Each
1568 16.68 Progeammable shunts - FDA approved, programmable shunts (valve systems) with 18 different pressure settings for precise pressure adjustment s to help control intracranial pressure and ventricle size. Item1568 1 Each
1569 16.69 Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. Item1569 1 Each
1570 16.7 Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. Item1570 1 Each
1571 16.71 Perforators - FDA approved, Sterile , disposables perforators with different size of 14mm, 11mm, 9mm with Dura guard technology. Item1571 1 Each
1572 16.72 Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Item1572 1 Each
1573 16.73 Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Item1573 1 Each
1574 16.74 Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Item1574 1 Each
1575 16.75 Dura form - FDA approved, collagen based, biocompatible Dural graft implants with greater tear and leak resistance with capabilities of wet handling and available in various sizes . Item1575 1 Each
1576 16.76 Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Item1576 1 Each
1577 16.77 Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Item1577 1 Each
1578 16.78 Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Item1578 1 Each
1579 16.79 Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Item1579 1 Each
1580 16.8 Surgical Patties - FDA approved, surgical patties made of cottonoid compreessed rayon which is X-ray detectable with the absorboing power of more 5 times their weight in less than a second. Item1580 1 Each
1581 16.81 Raneys scalp disposable clips - Disposable Raney's Clips Item1581 1 Each
1582 16.82 Cranioplasty kit - Cranioplasty kit, sterile, pack of two packets of Methyl methacrylate and two vials of liquid. Item1582 1 Each
1583 16.83 Universal Extremity Drape- Control plus fabric,US FDA certified Item1583 1 Each
1584 16.84 Impervious Split Sheet- 60" x 70", 4" x 21" split, Polyethylene Sheet, US FDA certified Item1584 1 Each
1585 16.85 U-Bar-Pack- 1 back table cover-Reinforced 44" x 88",1 mayo stand cover reinforced 23" x 54",1 suture bag, 1U drape 71" x 124", 1 Bar Drape 71" x 124", 1 Bar Drape 41.5" x 82",US FDA certified Item1585 1 Each
1586 16.86 Back Table Cover Zone Reinforced- 44" x 99", US FDA certified Item1586 1 Each
1587 16.87 Impervious Stockinette-12" x 58", UDS FDA Item1587 1 Each
1588 16.88 Fluid shield Mask with Visor -Four Layer Mask, water resistant with water resistant,-NAOSH, OSHA approved Item1588 1 Each
1589 16.89 HIP Drape with LEG Pockets -control plus fabric, US FDA approved Item1589 1 Each
1590 16.9 HIP Drape without LEG Pockets -Control plus fabric, US FDA approved Item1590 1 Each
1591 16.91 Quattro FX -Full Face Mask Vented Item1591 1 Each
1592 16.92 Mirage FX- Nasal Mask Vented Item1592 1 Each
1593 16.93 Transmission Electron Microscope Item1593 1 Each
1594 16.94 G011/2 Glut Em 25% AMPS Item1594 1 10x2ml
1595 16.95 Self Closing Tweezer (biology) T-403 Item1595 1 Each
1596 16.96 O001 Osmium Tetroxide Item1596 1 1vial/1gm
1597 16.97 EUKITT Mouning Media Item1597 1 1bottle/100ml
1598 16.98 TAAB Araldite 502/812 Kit (E2O2) Item1598 1 Kit
1599 16.99 Dibutyl Phthalate Item1599 1 Bottle
1600 17 E069 Embedding Mould Flat C Item1600 1 1 Piece
1601 17.01 Z10 Molecular Seive 3NM for Drying Acetone Item1601 1 1bottle/Jar
1602 17.02 Shaving Razor Blade Item1602 1 1Packet
1603 17.03 300 mesh Cu Grid with thin carbon film (Cu - 300CN Item1603 1 25grids/pkg
1604 17.04 300M mesh Cu Grid with holey/dbl Carbon film (Cu-300HD Item1604 1 25grids/Pkg
1605 17.05 G062 Grid Storage Box Item1605 1 1x10pcs
1606 17.06 U007 Uranyl Acetate Item1606 1 1 bottle
1607 17.07 L018 Lead Citrate Item1607 1 1 bottle
1608 17.08 TRUF 2208-100 Item1608 1 1 Packet
1609 17.09 Octagon Magnetic Stirrer Bar (4151) Item1609 1 1packet (8x22mm)
1610 17.1 Consumables Item1610 1 Each
1611 17.11 Micro tips(10micro litre) Item1611 1 1x1000pcs
1612 17.12 Microcentrifuge Tube Item1612 1 1.5/2.0ml capacity
Disclaimer :
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tell us about your Product / Services,
We will Find Tenders for you

Copyright © 2021 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail