BRR : 1366117
Click Here To View Tendering Authority. Aoc City/State :  rewa, Madhya Pradesh
Tender Brief : Tender For Supply Of Chemical And Reagent For Mdru Department Third Call , Mdru Kits And Reagents , Ammonium Chloride 500Gm , Potassium Bi Carbonate 500Gm , Sodium Chloride 500Gm , Tris Hcl 500Gm , Sds 500Gm , Saturated Phenol 500Ml , Chloroform 500Ml , Sodium Acetate 250Gm , Isoamyl Alcohol 500Ml / 1Ltr , Glacial Acetic Acid 500Ml / 1Ltr , Molecular Biology Grade Agarose Powder 250Gm , Bromophenol Blue Dye 2Ml*5=1Pack , Ethidium Bromide 10Ml , Molecular Weight ( Dna Ladder ) 100Bp & 1Kb 1 Vial , Molecular Weight ( Dna Ladder ) 50Bp 1 Vial , M... Read More
Tender Value
Ref. Document
Contract Value
₹ 25,00,000
Submission Date
09-11-2022
Contract Date
21-07-2023
Completion Date
365 days
Participated Bidder List
2 No of Bidder(s)
Sr No. Bidder Name Bid Analytics Technical Bid Financial Bid AOC Bid Value Rank
1 cnet-technologies Bid Analytics 15,00,000 L1
2 cnet-technologies Bid Analytics 10,00,000 L1
Work Detail
tender for supply of chemical and reagent for mdru department third call , mdru kits and reagents , ammonium chloride 500gm , potassium bi carbonate 500gm , sodium chloride 500gm , tris hcl 500gm , sds 500gm , saturated phenol 500ml , chloroform 500ml , sodium acetate 250gm , isoamyl alcohol 500ml / 1ltr , glacial acetic acid 500ml / 1ltr , molecular biology grade agarose powder 250gm , bromophenol blue dye 2ml*5=1pack , ethidium bromide 10ml , molecular weight ( dna ladder ) 100bp & 1kb 1 vial , molecular weight ( dna ladder ) 50bp 1 vial , molecular weight ( dna ladder ) 25bp 1 vial , taq polymerase 500units / vial , amplitaq gold dna polymerase master mix 500units / vial , mgcl2 5ml , dntp mix 1ml , dnase 1000 unit , rnase 1000 unit , proteinase k 1000 unit , tris-edta 500 gm , edta 250gm / 500gm , boric acid 250gm / 500gm , teepol5 liter , xylene cynol 10 gm , dmso 50 ml , tips i. 0.2 - 20 ?l tips , tips ii. 20 - 200 ?l tips , tips iii. 200 - 1000 ?l tips , superscript ii rnase reverse transcriptase / episcript™ rnase h- reverse transcriptase ( episcript rt ) 400 / 500 reaction pack. , power sybrgreen pcr master mix 5 ml , power sybrgreen rt pcr reagent kit 5 ml , oligo ( dt ) 12-18 primer25ug ( 0.5ug / ul ) , absolute ethanol 500ml , pcr plates ( light cycler 480 compatible ) pack of 50 / pack of 100 , sealing foil ( rt pcr / qpcr grade ) ( light cycler 480 compatible ) pack of 50 / pack of 100 , filter tips each pack contains 1000 psc. , i. 0.2 - 20 ?l filter barrier tips , ii. 20 - 200 ?l filter barrier tips , iii. 200 - 1000 ?l filter barrier tips , mct variable tubes each pack contains 1000 psc. , i. 20 -200?l tubes , ii. 200 - 600 ?l tubes , iii. 500 - 2000 ?l tubes , nitrile autodextorous gloves each pack contains 1000 psc. , mctstands for variable tubes sizes each pack contains 10 psc. , i. 20 -200?l tubes stand , ii. 200 - 600 ?l tubes stand , iii. 500 - 2000 ?l tubes stand , filter tip boxes each pack contains 10 psc. , i. 0.2 - 20 ?l filter barrier tip box , ii. 20 - 200 ?l filter barrier tip box , iii. 200 - 1000 ?l filter barrier tip box , rt pcr grade water pack size of 20ml ( 20 ml * 5 ) , tip discard box ( 1-2 liter capacity ) each , graduated measuring cylinders 50, 100, 500, 1000 ml each , graduated beakers 50, 100, 500, 1000 ml each , flat bottom tube 5ml ( with screw cap ) pack size of 500 psc. , tube stand ( 15ml falcon, 5ml, 2ml, 0.5ml, 0.2ml mct ) pack size of 10 psc. , graduated conical flask 50, 100, 500, 1000ml pack size of 5 psc. , edta blood collection tube 5ml each pack contains 100 psc. , plain vial ( for clot activator ) each pack contains 100 psc. , fluoride vial each pack contains 100 psc. , test tube 5, 10 ml each pack contains 100 psc. , slide+cover slips ( 25mm*75mm ) each pack contains 100 psc. , tissue paper roll pack size of 12 psc. , fine tissue cloth roll pack size of 12 psc. , cotton pack size of 10 psc. , wash bottle / dropping bottle, 200ml, 500ml, 1ltr each , funnels variable range each , plastic bottle, 200, 500, 1000ml each , syringe + needle 2 ml, 5 ml pack size of 100 psc. each , nitrile gloves; medium and large size box pack size of 1000 psc. , dna isolation kit { blood } per kit , rna isolation kit per kit , phenol 500 ml , hno3 ( nitric acid ) 500 ml , propionaldehyde pure ( 97% ) 500 ml , phthalic anhydride 500 ml , glacialacetic acid ar 500 ml , hydrochloric acid ar 500 ml , sulfuric acid ar 500 ml , 2-amino ethanol 500 ml , pyridine ar 500 ml , ammonia solution ar 500 ml , ammonia chloride ar 500 ml , acetyl salicylic acid 500 ml , acetone ar 500 ml , anthranilic acid ar 500 ml , activated charcoal 500 ml , silica gel g 500 ml , benzoicacid ar 500 ml , sds 500 gm , colin ( cleaning detergent solution ) 500 ml , sterilium ( hand sanitizer ) 100 ml * 5 , dettol / lifeboy alcohol based hand sanitizer 100 ml * 5 , hypo 4% 5 l , floor cleaner phenyl 1 l * 5 , serum separator vial 3.5 ml ( vacutainer tube, 3.5ml, 13 x 75mm, plastic, additive: clot activator / polymer gel, gold hemogard closure, paper label ) pack size of 100 psc. each , labolene 1 l / 5 l , cleaning mop per psc , broom per psc , microwave gloves per pair , brown paper for autoclaving per roll , liquid nitrogen 10 / 25 ltr. , phosphate buffer saline ( 10x; ph 7.4; rnase free ) 500 ml , formalin ( formaldehyde aqueous solution; lab grade ) 500 ml , paraffin wax ( 58-600c for histology ) 500 gm , xylene ( molecular lab grade ) 500 ml , glycerol500 ml , ammonia ( nh4oh; extra pure ) 250 ml / 500 ml , methanol ( methyl alcohol, ch3oh ) 500 ml , acrylamide / bis ar 500 ml , 10x tbe buffer 500 ml , urea ( ultra pure; mol-bio grade ) 500 gm / 1kg , ammonium persulfate 100 gm , temed ( ultra pure; mol-bio grade ) 100 ml / 250 ml , 4’, 6-diamidino-2-phenylindole 50 ml , diethyl pyrocarbonate 5 gm / 25 gm , tae buffer , sybr gold 100ul , restriction enzyme – mnl i250 / 300 / 500 units , restriction enzyme – bcli1000 / 1500 / 2500 / 3000 units , restriction enzyme – hpych4v100 / 500 units , restriction enzyme – hpych4iii200 / 250 / 1000 / 1250 units , restriction enzyme – sau96i 1000 units , restriction enzyme – sfci200 / 1000 units , restriction enzyme – bcci1000 units , restriction enzyme – scrfi500 / 1000 / 2500 units , restriction enzyme – afliii250 / 1250 units , restriction enzyme – scai500 / 1000 / 1250 units , restriction enzyme – avai1000 / 2000 units , restriction enzyme – bsmi200 / 500 / 1000 / 2500 units , restriction enzyme – tspri ( also share cleavage site withtscai ) 1000 units , restriction enzyme – mboii250 / 300 / 1250 / 1500 units , restriction enzyme – bsh1236i500 / 1000 / 2500 units , restriction enzyme – banii1000 / 1500 / 2000 units , restriction enzyme – mph1103i1000 / 5000 units , restriction enzyme – dde i200 / 500 / 1000 / 2500 units , restriction enzyme – bsmb i ( also share cleavage site withesp3i ) 200 / 400 / 1000 units , restriction enzyme – afa i ( also share cleavage site withrsa i ) 1000 / 5000 units , restriction enzyme – bal i ( also share cleavage site withmlu ni ) 50 / 100 / 200 / 250 units , restriction enzyme – fspi ( also share cleavage site withnsbi ) 400 / 500 / 1000 / 2500 units , restriction enzyme – hpa ii ( also share cleavage site withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 units , restriction enzyme-hinf i , restriction enzyme- hpych4 , restriction enzyme-mboii , restriction enzyme-bstui , restriction enzyme- mvai , primers , fmr1 set 1 –f5-tcaggcgctcagctccgtttcggtttca-3 r5-5 aagcgccattggagccccgcacttcc-3 , mecp2 exon 1 set 1- f5-gttatgtctttagtctttgg–3´ r5-tgtgtttatcttcaaaatgt–3´ , exon 2set 1-f5-cctgcctctgctcacttgtt–3´ r5- ggggtcatcatacatgggtc–3´ , exon 2set 2- f5-agcccgtgcagccatcagcc–3´ r5-gttccccccgaccccaccct–3´ , exon 3 set 1 –f5-tttgtcagagcgttgtcacc–3´ r5- cttcccaggacttttctcca–3´ , exon 3 set 2- f5-aaccacctaagaagcccaaa–3´ r5-ctgcacagatcggatagaagac–3´ , exon 3 set 3- f5-ggcaggaagcgaaaagctgag–3´, r5- tgagtggtggtgatggtggtgg–3´ , exon 3 set 4 – f5-5´–tggtgaagcccctgctggt–3´ r5- ctccctcccctcggtgtttg–3´ , exon 3 set 5-f5ggagaagatgcccagaggag–3´ r5- cggtaagaaaaacatccccaa–3´ , exon3 ( l100v ) - f5-aaccacctaagaagcccaaa-3 r5- gcttaagcttccgtgtccagccttcaggta-3 , putative promoter and exon 1. - f5-gggtgcaatgaaacgctta-3 r5- tttaccacagccctctctcc-3 , mc4r rs17782313 - f 5-aagttctacctaccatgttcttgg-3 r 5-ttccccctgaagcttttcttgtcattttgat-3 fto rs9939609-f 5-aactggctcttgaatgaaataggattcaga-3 r5-agagtaacagagactatccaagtgcagtac-3 , adipoqrs2241766 – f5- tgtgtgtgtggggtctgtct-3 r-5-tgtgatgaaagaggccagaa-3 , rs1501299- f5- ctacactgatataaactatatggag-3 r5-ccccaaatcacttcaggttg-3 , pcsk1 rs155971 – f5’tatatgcagccaccaatcca 3’ r5’aaaatgaagggagaagcacaaa3’ , pomcrs6232- f5- ttgtgcccttcatctgaaca-3 r5- tgtagcaactttggcatgga-3 , rs155971- f5tatatgcagccaccaatcca-3 r5-aaaatgaagggagaagcacaaa-3 , ppar-g ( pro12ala ) -f5gcc aat tcaagc cca gtc-3r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctttcc g-3 , kcnj11 ( rs5219 ) -f5-gactctgcagtgaggcccta-3’ r5-acgttgcagttgcctttctt-3’ , capn10 ( rs3792267 ) -f5-cacgcttgctgtgaagtaatgc-3’r5-tgattcc catggtctgtagcac-3’pik3ca-set 1-forward-5’-ggagtatttcatgaaacaaatgaatgatgcg-3’ reverse- 5’-gagctttcattttctcagttatctt-3’ , bat 25-set 1- f 5’-tcgcctccaagaatgtaagt-3’r 5’-tctgcattttaactatggctc-3’bat 26-set 1-f5’-tgactacttttgacttcagcc-3’r5’-aaccattcaacatttttaaccc-3’ , d2s123-set 1- f5’-aaacaggatgcctgccttta-3’ r5’-ggactttccacctatgggac-3’ , d5s346-set 1- f 5’-actcactctagtgataaatcggg-3’ r5-agcagataagacagtattactagtt-3 , d17s250 – set 1- f5’-ggaagaatcaaatagacaat-3’ r5’-gctggccatatatatatttaaacc-3’ , impdh2 set 1- f5- gtttctgcggtatcccaatc -3 r5- cgagcaagtccagcctat-3 bmp6 - rs73719353- f5’-gctcctttgcacttcgctgt-3’ , r5’-aggctctgctg agctcctac-3’ , bmp6- rs73719341- f 5’tgaacttcccattcccctct-3’ r5’ataaaattagcattgatcca-3’ , bmp6- rs73719318 f5’caggtgctgtgcaacttctt-3’ r 5’agagggcaccatggttgcct-3’ , bmp6-rs73381662 f 5’-ctgagattcaattaggccca-3’ r 5’taaagaacagcaaaagtctg-3’ , bmp6-rs73381650 f 5’cacataaagattgctgcatt-3’ r 5’tagtaatcctaaaaatggga-3’ , anxa2- rs7170178 f 5’-ttcacagcagttcaaaatac-3’ r 5’-ctgggtttccagagatggaa-3’ , anxa2 - rs73435133 f 5’-gagtgcaaggtgctgaggat-3’ r 5’-gatttcagacagcccttgca-3’ , anxa2- rs73418020 f 5’-tctgagagtgaaaggtgcac-3’ r 5’-tcccatcccctgaatccctg-3’ , anxa2- rs72746635 f 5’-cctgactcattgtcacatca-3’ r 5’-aagtggctttccactgccc-3’ , anxa2- rs73418025 f 5’- cttctcatcttactttt-3’ r 5’- agggaaggatacagaggaga-3’ , hsp-70 primer sequence5-agcgt aacac cacca ttcc-3 ( forward ) 5-tggct cccac cctat ctc-3 ( reverse ) , the gapdh sequence forward primer 5-agc cac atc gct gag aca c-3, reverse primer 5- gcc caa tac gaccaa atcc-3. , mthfr f:5-tgtggtctcttcatccctcgc-3;r: 5-ccttttggtgatgcttgttggc-3. , dpyd f:5-actcaatatctttactctttcatcaggac-3. r: 5-acattcaccaacttatgccaattct-3. , tyms f:5’-ggtacaatccgcatccaactatta-3’ r:5’-ctgataggtcacggacagattt-3’ , imp3 forward:5’atgactcctccctacccg3’ reverse:5’gaaagctgcttgatgtgc3’ , cxcl1forward: 5’ccagacccgcctgctg-3’and reverse:5’cctcctcccttctggtcagtt-3’ , cox-2 forward: 5- cagccatacagcaaatcc -3; reverse: 5-tcgcacttatactggtcaa-3 , hmlh1f-5 ttt tga tgt aga tgt ttt att agg gtt gt 3r-5 acc acc tcatcataa cta ccc aca 3 , ppar-g ( pro12ala ) - , f5gcc aat tcaagc cca gtc-3 , r5gat atgttt gca gac agt gta tca gtg aaggaa tcg ctt tcc g-3 , methylated ( hmlh1 ) - f-5 acg tagacg ttt tat tag ggt cgc 3 r- 5 cct catcgtaac tac ccg cg 3 , hmsh2 - f-5 ggt tgt tgt ggt tgg atg ttg ttt 3 r- 5 caa cta caa cat ctc ctt caa cta cac ca 3 , methylated ( hmsh2 ) - f- 5 tcg tgg tcg gac gtc gtt c 3 r-5 caa cgt ctc ctt cga cta cac cg 3 , ?-actin: forward: 5’-ctacgtcgccctggacttcgagc-3’ ß-actin: reverse: 5’-gatggagccgccgatccacacgg-3’ , kras-forward: 5-gactgaatataaacttgtggtagttggacct-3.reverse: 5-ctattgttggatcatattcgtcc-3. , braf- forward: 5-tcataatgcttgctgatagga-3. reverse: 5-ggccaaaaatttaatcagtgga-3. , mthfr ( c677t ) ‘‘5-gcacttgaaggagaaggtgtc-3” and reverse primer ‘‘5-aggacggtgcggtgagagtg-3” , mthfr ( a1298c ) forward ‘‘5-ctt tgg gga gct gaa gga cta cta c-3” and reverse ‘‘5-cac ttt gtg acc att ccg gtt tg-3” primers. , total rna isolation mini kit ( from human skin tissue ) / rneasy fibrous tissue mini kit ( for rna extraction from human skin tissue ) ( qiagen ) per kit ( each kit pack is for 50 reactions ) , purospin™ fibrous tissue rna purification kit ( luna nanotech ) ( for rna extraction from human skin tissue ) per kit ( each kit pack is for 250 reactions ) , aurum™ total rna fatty and fibrous tissue kit ( biorad ) / mp biomedicals fastrna pro green kitper kit ( each kit pack is for 50 reactions ) , human leptin elisa kit per kit ( each kit pack is for 96 reactions ) , human adiponectin elisa kit per kit ( each kit pack is for 96 reactions ) , human adipsin elisa kit per kit ( each kit pack is for 96 reactions ) , human resistin elisa kit per kit ( each kit pack is for 96 reactions ) , human iron elisa kit ( serum iron ) per kit ( each kit pack is for 96 reactions ) , human ferritin elisa kit ( serum / ferritin ) per kit ( each kit pack is for 96 reactions ) , gdf15 human elisa kit per kit ( each kit pack is for 96 reactions ) , spexin human elisa kit per kit ( each kit pack is for 96 reactions ) , human pai-1-elisa kit per kit ( each kit pack is for 96 reactions ) , thyroid estimation kit per kit ( each kit pack is for 96 reactions ) , ice maker machine for laboratory purpose 1 unit , microwave gloves each packet contains one pair of gloves. , pcr mini cooler / coolcube microplate and pcr tube cooler each , pipette 0.5-10ul, 02-20ul, 10-100ul, 20-200ul and 100-1000ul. each , horizontal gel apparatus: 18 – 20 cm ( length ) x 25 – 30 ( breadth ) x 5- 7.5 cm ( height ) , 40-60 samples, multichannel pipette compatible combs and gel caste each , mini-horizontal gel apparatus: 9 cm w x 11 cm l with grooves ( 8.7 cm l x 1.2 cm h ) on the side for gripping the gel tray. it should have two comb slots on the same tray area. buffer capacity should be 600 ml for the buffer tanks and optimum gel runs with a fill line indicator for buffer levels along the unit side each , multi size forceps lab set each packet containsmulti size forceps lab set , liquid nitrogen sample storage tanks each , liquid nitrogen sample handling gloves each packet contains one pair of gloves. , slide tray / rack each , l-mold each , tissue cassette steel each , electric tissue float bath ( thermostate ) each , coupling jar each pack contains 2 psc. , staining rack each , whatman filter paper grade 1 & 2 each packet contains 50 psc.. , harri’s hematoxylin powder 25 / 50 / 100 / 250 / 500 gm , yellow eosin powder 25 / 50 / 100 / 250 / 500 gm , coverslip 18x18 ( microscopic ) each packet contains 100 psc.. , dpx mount 100 ml / 250 ml , hot plate each , mx35 premier microtome blade ( 34 / 80mm ) 50 blades each box contains 50 psc.. , diamond point marker pen ( histopathology use ) each , embedding mold and embedding ring each , qiamp dna ffpe tissue kit ( 50 rxns ) , genomic dna purification kit ( promega ) , rna extraction kit from tissue , cdna synthesis kit , superscript ii rnase reverse transcriptase , sybr green pcr master mix , sodium bisulphite , page loading dye , formamide , n’n’-methylene bisacrylamide , ammonium persulfate , temed , polyacrylamide , wizard dna clean up system ( promega ) , 2-mercaptoethanol , silver stain , hydroquinone , urea , blotting paper , dna ladder 10 bp , pas stain , histopathology plastic cassettes , poly – l – lysine coated slides , deep well mortar and pestle homogenizers ( medium size ) , deep well mortar and pestle ( small size ) , rneasy minielute cleanup kit , phase – lock gel heavy5 prime phase – lock gel heavy5 prime , qiazol lysis reagent , rneasy minielute cleanup kit , cryo-vial 1 pkt contains 50 psc. , deep well mortar and pestle ( small size )
View Original Notice/Document
Result Documents
Tender Documents
Download File Name File Description
Download 097ec2da-934e-4e70-ad04-2d78de4c7b8c
Download boqcomparativechart
Download finance_266634
Download finsummary_266634
Download SM
Download technical_266634
Download techsummary_266634
Download File Name File Description
Download 8dfe5c47-0b43-4c81-bf63-9be01706fd02 Tender Documents
Download BOQ_266634 Tender Documents
Download Tendernotice_1 Tender Documents
Disclaimer

We takes all possible care for accurate & authentic tender information. However users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender

✦ ✦ ✦
Awarded Bidder(s)
1
cnet-technologies
Rank : L1 (Lowest)
Bid Amount : ₹ 1,00,00,000
1
cnet-technologies
Rank : L1 (Lowest)
Bid Amount : ₹ 1,00,00,000
Similar Tenders Results
TenderDetail
Loading tenders