View Bid Results For Histology Cassettes Tenders

We found 22 Bid Results related to histology cassettes tenders. You can find Contractor details who won histology cassettes tenders along with contract details in Bid awards announcements section.

Filters
Stage
11
10
1
Tender Publishing Platform
1
21
State / UT
9
6
5
3
2
2
1
1
1
1
Contract Value
16
1
4
1
Publish Date
0
0
0
0
0
Sector
5
10
9
1
1
1
Ownership
4
12
7
2
1
Within keyword
Active filters:
Showing 1–1 of 22 tenders matching your filters
1.
Educational and Research Institute #11139982 Technical Bid
Tender For Supply Of Essential Reagents For The Department Of Pathology Gmc Srinagar , Embedding Cassettes With Lid,With Hinge, Resistant To Nearly All Histology Reagents, Loose , Cryo Embedding Compound Tissue Freezing Medium 100-125 Ml , High Profile Microtome Blade 80Mm Long,14Mm High Steel Blade With Special Coating , Adhesive Slide Adhesive 90 Deg Clipped Corner Size Approximately 26X76mm +/- 2Mm Thickness Approximately 1Mm Color Area To Print Or Writing , Adhesive Slides, One End Has 19Mm Special Coating Which Enhance Adhesion, Positive Charge Slides , Adhesive Slides, One End Has 19Mm Special Coating Which Enhance Adhesion, Polysine Slides , Adhesive Slides, One End Has 19Mm Special Coating Which Enhance Adhesion, Silane Slides , Adhesive Slides, One End Has 19Mm Special Coating Which Enhance Adhesion, Hydrophile Slides , Adhesive Slides, One End Has 19Mm Special Coating Which Enhance Adhesion, Cytology Slides , Cover Slips 20 X 40 Mm, Rectangular Compatible With Autostainer Available In Pathology Department , Glass Slides Thickness: 1.00Mm , Activated Carbon Filter-Leica Asp6025 Tissue Processor , Paraffin Wax Pastilles Without Dmso, Solidification Point 58 - 60 0 Embedding Agent For Histology , Low Profile Blade 80 Mm Long And 8 Mm High Steel Blade With Special Coating , Marker Pencil Pencil For Marking Cassettes , Sodium Dihydrogen Phosphate , Disodium Hydrogen Phosphate , Trifluoroacetic Acid (Tfa) , Ammonium Ceric Sulfate Dehydrate Extrapure , Acetone 500 Ml , Disodium Edta-100G , Sodium Nitroprusside-500 G , Cholesterol Esterase , Liquor Ammonia-500 Ml , Methanol Purity (Gc) =99% Density (D 20°C/4°C) 0.791 To 0.792 Evaporation Residue : = 0.001% Water = 0.2% , Isopropanol Purity (Gc) =99% Density (D 20°C/4°C) 0.784 To 0.786 Evaporation Residue : = 0.001% Water = 0.2% , Absolute Ethanol-500Ml , Chloroform Purity (Gc): Chloroform Purity (Gc): = 99.0% Density (D 20°C/4°C) : 1.474 - 1.479 Evaporation Residue : = 0.001% Residue : 0.001% Stabilizer : Stabilized With 0.7 - 1.0% Ethanol , Glycerol Assay (C3h2o23 : = 98% Density (D 20°C/4°C) : 1.255 - 1.261 Water : = 2% , Formaldehyde Solution Assay (Hcho) : 37.0 - 38.0% Density (D 20°C/4°C) : 1.080 - 1.090 Methanol (Gc) : 8 - 14% , Nitric Acid Assay (Hno3) : 68 - 70% Mercury Metals : = 0.001% , Hematoxylin Cryst. (C.I.75290) , Mercuric Oxide , Dextrosechloride = 0.005% Sulphate = 0.005% Arsenic = 0.00005% Iron = 0.001% , Potassium Aluminum Sulphate Heavy Metal Pb = 0.001% , Hydrochloric Acid 35% , Potassium Metabisulphite , Barium Chloride , Formic Acid , Sodium Nitroprusside , Sulphur Powder , Glacial Acetic Acid , Sodium Citrate , Sodium Acetate , Chromic Acid , Tetrahydrochloride , H202 30% , Sorens Salt Sodium , Phosphate Dibasic Diahydrate , Ammonia Solution , Sodium Hydroxide Solution , Potassium Per Magnate , Oxalic Acid , Ferric Alum ( Ammonium Ferricsulphatedodecahydrate) , Acetic Acid Solution , Aluminum Sulphate Powder , Copper Sulphate , Methylene Blue , Pandays Reagent , Spirit , Potassium Hydroxide , Hematoxylin Stain , Bouins Fluid Solution , Hematoxylin Crystal , - Sure Path ™ Gyn Lab Pack (480 Tests/Kit) Inclusinve Of Sure Path™ Gyn Kit. , Cytorich™ Red Non -Gyn Lab Pack (480 Tests/Kit) , Dispo Syringes , Cover Slips , Cover Slips , Cover Slip , Cover Slip , Leishmnans Stain , Dip Quick Stain , Leishmans Powder , Geimsa Powder , Surgical Gloves , Eosin Powder , Slide Labels , Xylene Solution Ph Value Saturated Aqueous Solution 6.0 To 7.6 Value Saturated Aqueous Solution 6.0 To 7.6 Boiling Range (137 To 143° C) =95% V/V Density (D 20° C To 4°C) 0.85 To 0.87 Non Volatile Substance = 0.01 % , Dpx Mountant Density - 0.1915 - 0.925 Density (D 20°/4°C)0.915-0.925 Reflective Index (N D/20°C ) 1.515 -1.525 Acidity =0.05Ml N% , Bone Marrow Aspiration Illinois Needles With Guard ( Disposable ) , Bone Marrow Biopsy Needles With Blunt Stylet , Disposable Bone Marrow Biopsy Needle , Disposable Bone Marrow Biopsy Needle , Disposable Bone Marrow Biopsy Needle , Fully Automatic Core Biopsy Gun With 22 Mm Firing Length , Fully Automatic Core Biopsy Gun With 22 Mm Firing Length , Fully Automatic Core Biopsy Gun With 22 Mm Firing Length , Fully Automatic Core Biopsy Gun With 22 Mm Firing Length , Semi-Automatic Core Biopsy Gun With 10 And 20Mm Firing Length With Coaxial Kit , Semi-Automatic Core Biopsy Gun With 10 And 20Mm Firing Length Without Coaxial , Semi-Automatic Core Biopsy Gun With 10 And 20Mm Firing Length Without Coaxial , Disposable Breast Tissue Marker , Disposable Bone Marrow Aspiration Needles , Coaxial Needle System Compatible With Disposable Automatic Biopsy Gun , Patient Preoperative Skin Preparation Solution , Patient Preoperative Skin Preparation Solution , Sphygmomanometers - Blood Pressure Recording Unit , Vacuum Blood Collection Tubes With Powdered Sodium Fluoride And K3edta For Glucose Estimations (Grey Cap) , Vacuum Blood Collection Tubes With Clot Activator (Red Cap) , Vacuum Blood Collection Tubes With Clot Activator (Red Cap) , Vacuum Blood Collection Tubes With Clot Activator (Red Cap) , Vacuum Blood Collection Tubes With K2edta (Violet Cap) , Vacuum Blood Collection Tubes With K2edta (Violet Cap) , Vacuum Blood Collection Tubes With K2edta (Violet Cap) , Vacuum Blood Collection Tubes With K2edta (Violet Cap) , Vacuum Blood Collection Tubes With K2edta (Violet Cap) , Vacuum Blood Collection Tubes With 3.2% Sodium Citrate (Sky Blue Cap) , Vacuum Blood Collection Tubes With Spray Coated Lithium Heparin (Green Cap) , Blood Collection Tubes For Paediatric Patients , Blood Safety Lancets I. Blood Safety Lancets For High Flow: Size 28G Width X 1.8 Auto Retractable Gamma Sterlized, Auto Disabled, Could Not Be Reused, Tri Bevel Point Needle. It Should Br Ce/ Usfda Approved/ Certified. , Blood Collection Needle For Above Vacutainers. Size 21G X 1 Or 22G X 1 , Syringe Adapter For Vacutainers , Multiparameter Universal Smart Card Code: Si 195-901 , Latex Control Kit Pack Size 30 Test Kit. Code Si 305-300 A (Greiner Tube) Si 305-302 A (Sarstedt Tube) Range 2-120 Mm/Hr , Breast Panel Er Rabbit Monoclonal Antibody, Should Be Rabbit Monoclonal, Clone Should Be Ep1/ Ihc423, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel Periodical Renewal Rabbit Monoclonal Antibody , Should Be Rabbit Monoclonal, Clone Should Be Ep2/ Ihc751, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel C-Erbb-2 Rabbit Monoclonal Antibody, Should Be Rabbit Monoclonal, Clone Should Be Ep3/ Ihc042, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel Ck 7 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ov-Tl 12/30 Or Ihc007, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel Gata-3 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be L50-823 / Ihc583, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel Gcdfp-15 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be D6 / 23A3, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel E-Cadherin Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep6 / Ihc564, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel Calponin Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Cap / Bsb-20, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Breast Panel Ck8/18 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be B22.2 & B23.1 / Ihc559, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Bladder Panel Uroplakin Ii Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bc21, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Bladder Panel Uroplakin Iii Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep321 / Polyclonal, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Bladder Panel P40 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc058/ Zr8, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Bladder Panel P63 Antibody, Should Be Mouse Monoclonal, Clone Should Be 4A4 / Ihc063, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Bladder Panel Ck 20 Antibody, Should Be Mouse Monoclonal, Clone Should Be Ks20.8 / Ihc220, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Bladder Panel Ck 5 & 6 Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc556 / Ep24 & Ep67, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Brain Panel Gfap Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be G-A-5 / Rm246 / Ihc484, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Brain Panel S100 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 4C4.9 / Ihc100, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Brain Panel Neurofilament Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep79 / Ihc639, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Brain Panel Sox10 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-62 / Ep268 / Ihc010, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Colon Panel Cdx2 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc302 / Rbt-Cdx2, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Colon Panel Ck20 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ks20.8 / Ihc220, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Colon Panel Cea Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Polyclonal / Ihc543, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Colon Panel Mlh-1 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc409 / Rbt-Mlh1, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Colon Panel Msh-2 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc510 / Rbt-Msh2, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Colon Panel Msh-6 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc026 / Ep49, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Colon Panel Pms-2 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc422 / Bsb-130, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Kidney Pax 8 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc048 / Rm436, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Kidney Cd10 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rbt-Cd10 / Ihc525, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Kidney Amyloid A Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep335, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Liver Hsa (Hep-Par1) Antibody, Should Be Mouse Monoclonal, Clone Should Be Och135 / Ihc596, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Liver Arginase-1 Rabbit Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc118 / Ep261, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Liver Glypican-3 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 1G12 / Ihc305, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Liver Ck 19 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-34 / Ihc019, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Liver Moc-31 (Ep-Cam) Antibody, Should Be Mouse Monoclonal, Clone Should Be Moc-31 / Ihc567, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Liver Afp Rabbit Polyclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-23 / Ihc714, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung Lung Napsin A Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc635 / Bsb-112, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung Ttf-1 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 8B7g3/1 Or Ihc141, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung Desmoglein 3 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-61 / Ep306, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung Ck 5 & 6 Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep24 & Ep 67 Or Ihc556, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung P63 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc063 / Ep174, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung Ck 7 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ov-Tl 12/30 Or Ihc007, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung Sox-11 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc111 Or Bsb-167, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lung Mash1 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 24B72d11.1, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Lca Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 2B11+Pd7/26 Or Ihc145, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Pax 5 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rbt-Pax5 Or Ihc115, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd-3 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rbt-Cd3 Or Ihc534, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd-43 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Mt-1 Or Bsb-12, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd10 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rbt-Cd10 Or Ihc525, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd-15 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-119 Or Ihc527, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Alk Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rbt-Alk1 Or Ihc509, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Tia-1 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Tia-1 Or Rbt-Tia1, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Tdt Rabbit Polyclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep266 Or Polyclonal Or Ihc771, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Bcl-2 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-5 Or Ihc514, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemicalapplications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Kappa Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-58 Or Ihc610, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Lambda Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ihc709 Or Bsb-16, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cyclind1 Rabbit Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rm241 Or Ihc452, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd5 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rm314 Or Ihc 738, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd7 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep132 Or Ihc541, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd22 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Fpc1, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd23 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep75 Or 1B12 Or Ihc023, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd 57 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-10 Or Ihc539, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Mum-1 Rabbit Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep190 Or Ihc627, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd11c Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep157, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd 71 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 10F11 Or Ihc071, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Lymphoma Cd 33 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rbt-Cd33, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Melanoma S100 Mouse Monoclonal Antibody Antibody Should Be Mouse Monoclonal, Clone Should Be 4C4.9 Or Ihc100, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Melanoma Melanoma Cocktail: Hmb-45, Mart-1 & Tyrosinase, Should Be Mouse Monoclonal, Clone Should Be Hmb-45, A103 & Bsb-6, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Neuroendocrine Chromogranin A Antibody, Should Be Mouse Monoclonal, Clone Should Be Lk2h10 Or Ihc544, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Neuroendocrine Synaptophysin Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep158 Or Polyclonal Or Ihc669, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Neuroendocrine Cd 56 Antibody, Should Be Mouse Monoclonal, Clone Should Be 123C3.D5 Or Ihc066, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Neuroendocrine Neurofilament Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep79 Or Ihc639, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Neuroendocrine Cd 57 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-10 Or Ihc539, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Neuroendocrine Mash1 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 24B72d11.1, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Ovary Pax 8 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Zr-1 Or Ihc008, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Ovary Ca-125 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Och125 Or Ep48 Or Ihc125, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Ovary Ck-7 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ov-Tl 12/30 Or Ihc007, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Ovary Cd117 Rabbit Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rm359 Or Ihc526, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Pancreas Synaptophysin Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep158 Or Polyclonal Or Ihc669, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Prostate Amacr Rabbit Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 13H4 Or Ihc524, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Prostate Erg Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep111 Or Ihc569, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Prostate Hmw Ck Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be 34 Beta E12, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Prostate Nkx3.1 Rabbit Polyclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rm430 Or Ihc640, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Prostate Androgen Receptor Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-4 Or Ihc511, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Skin Factor Xiiia Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep292 Or Ihc572, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Skin Ep-Cam Antibody, Should Be Mouse Monoclonal, Clone Should Be Ber-Ep4 Or Ihc567, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Skin Cd 8 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Ep334 Or Ihc542, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Skin Cd 4 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Rbt-Cd4 Or Ihc535, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Skin Sox10 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Bsb-62 Or Ep268 Or Ihc010, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Skin Cd 34 Mouse Monoclonal Antibody, Should Be Mouse Monoclonal, Clone Should Be Qbend/10 Or Ihc034, Should Store At 2-8°C, Antibodies Should Be Ivd And Ce Approved, Antibodies Is Intended For Use In Immunohistochemical Applications On Formaline-Fixed Paraffin Embedded Tissues (Ffpe), Frozen Tissue Section, And Cell Preparations. , Trps-1, Should Be Ce,Ivd Approved , P-120 (Lobulara), Should Be Ce,Ivd Approved , Olig-2, Should Be Ce,Ivd Approved , Idh 1, Should Be Ce,Ivd Approved , Idh 2, Should Be Ce,Ivd Approved , Atrx, Should Be Ce,Ivd Approved , P53, Should Be Ce,Ivd Approved , Sdh-B, Should Be Ce,Ivd Approved , Atrx, Should Be Ce,Ivd Approved , Aik-1(D5f3), Should Be Ce,Ivd Approved , Cd-20, Should Be Ce,Ivd Approved , Bcl-6, Should Be Ce,Ivd Approved , Cd-38, Should Be Ce,Ivd Approved , Irf-4, Should Be Ce,Ivd Approved , Insm-1, Should Be Ce,Ivd Approved , Inhibin, Should Be Ce,Ivd Approved , Calretinin, Should Be Ce,Ivd Approved , Sf-1, Should Be Ce,Ivd Approved , Vimentim, Should Be Ce,Ivd Approved , Cytokeritin Ae1/Ae3, Should Be Ce,Ivd Approved , Sf-1, Should Be Ce,Ivd Approved , Myogenin, Should Be Ce,Ivd Approved , Sall-4, Should Be Ce,Ivd Approved , Oct -3/4, Should Be Ce,Ivd Approved , Plap, Should Be Ce,Ivd Approved , B-Catenin, Should Be Ce,Ivd Approved , Pdl-1, Should Be Ce,Ivd Approved , Cd-99, Should Be Ce,Ivd Approved , Wt-1, Should Be Ce,Ivd Approved , D2-40 (Podoplanin), Should Be Ce,Ivd Approved , Cd-31, Should Be Ce,Ivd Approved , Cd-34, Should Be Ce,Ivd Approved , Ca-Ix, Should Be Ce,Ivd Approved , Cd30, Should Be Ce,Ivd Approved , Ki67, Should Be Ce,Ivd Approved , Sma, Should Be Ce,Ivd Approved , P63, Should Be Ce,Ivd Approved , Cd45, Should Be Ce,Ivd Approved , Cd15, Should Be Ce,Ivd Approved , Cd56, Should Be Ce,Ivd Approved , Cd4, Should Be Ce,Ivd Approved , Msh6, Should Be Ce,Ivd Approved , Cd8, Should Be Ce,Ivd Approved , Malan A, Should Be Ce,Ivd Approved , Msh2, Should Be Ce,Ivd Approved , Cd3, Should Be Ce,Ivd Approved , Glial Fibrillary Acidic Protien, Should Be Ce,Ivd Approved , Cytokeratin Hmw 34 Be12, Should Be Ce,Ivd Approved , Cd20, Should Be Ce,Ivd Approved , Cytokeratin 20, Should Be Ce,Ivd Approved , Cd45, Should Be Ce,Ivd Approved , Dog1, Should Be Ce,Ivd Approved , Actin Muscle Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Desmin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Pcna Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Hairy Cell Leukemia Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Igm Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd61 Platelet Glycoprotein Illa Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd68 Macrophage Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cmv Cocktail Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Hla-Dr (? Chain Of Dp, Dq & Dr) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Myosin Skeletal (Fast) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Actin Sarcomeric Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Tag-72 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Retinoblastoma Protein Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cytokeratin (45 46 56.4 Kd) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Myod1 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd21 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Glycophorin A Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Ebv Cocktail Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Epithelial Antigen Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Mesothelioma Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cyclin E Protein Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Ercc1 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Mast Cell Chymase Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Mast Cell Tryptase Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Hepatocyte Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Mucin 5Ac Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Vascular Endothelial Growth Factor(Vegf) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Hpv16 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Microphthalmia Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Renal Cell Carcinoma Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd44 H Cam Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd1a,Corticalthymocytes Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Smooth Muscle Myosin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , C4d Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Nkx2.2 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Tracp Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Ema Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , P57kip2 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cytokeratin 17 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , C-Myc Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd63 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Caldesmon Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Tnf-Alpha Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , P27 Kip1 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Insulin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd79a B-Cell Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cytokeratin 16 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Collagen Iv Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Thymidine Phosphorylase Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Elastin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Timp-2 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Hhv8 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Thyroid Peroxidase Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Mgmt Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Bcl-10 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , P120 Catenin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Adipophilin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Galectin-3 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Herpes Simplex Virus Ii (Hsv Ii) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Ca 15.3 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Perforin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Podoplanin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Fascin-1 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Ca 19-9 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Laminin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Hepatitis B Surface Antigen, Hbsag , Pd-1 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Pten Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , P16 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Thyroglobulin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Treponema Pallidum Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Glycophorin C Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd163 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Adrenocorticotropic Hormone (Acth) - (Ah26) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Pneumocystis Carinii Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cd138 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Villin Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Sall4 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cytokeratin 15 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Heat Shock Protein 70 (Hsp 70) (W27) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , A20 (A-12) Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Lba1 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Bap1 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cadherin 17 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Stat6 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Mcm7 Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Egfr Rtu Mouse Monoclonal Antibody Should Be Ce,Ivd Approved , Cathepsin D Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Lysozyme Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Neuron Specific Enolase Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Psa Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Iga Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Igg Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Igm Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Alpha-1-Antitrypsin Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Gastrin Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Hcg Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Hsv I Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Cytokeratin Wide Spectrum Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , P504s Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Myeloperoxidase Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Granzyme B Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Heliocobacter Pylori Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Pin5 Cocktail Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Phosphohistone H3 (Phh3) Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Fibronectin Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Flk-1 Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Caspase 3/Cpp32 Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Smad4 Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Caspase 1 Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Pan-Trk Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Amyloid Precursor Protein (App) Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Hsv Type I And Ii Cocktail Rtu Mouse And Rabbit Cocktail Antibody, Should Be Ce,Ivd Approved , Calcitonin Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Mammaglobin A Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Cyclin D1 Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Mesothelin Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Ros1 Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Prame Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Bob.1 Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Satb2 Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Nut1 Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Claudin 18.2 Rtu Rabbit Monoclonal Antibody, Should Be Ce,Ivd Approved , Cox2 Rtu Rabbit Polyclonal Antibody, Should Be Ce,Ivd Approved , Polymer Hrp Plus Kit , Background Sniper , Betazoid Dab Chromogen Kit , Da Vinci Green Diluent , Diva Declaoker, 20X , Tris-Edta Hier Solution (20X) Ph9.0 , Tbs Auto Wash Buffer, (20X) , Positive Charged Slides , Vulcan Fast Redchromogen Kit , Pap Pen , Ethyl Alcohol Absolute 500Ml Bottle , 3.3 Diaminobenzidine , Hrp Kit With Dab (Hrp/Dab System Should Be 2 Step Polymeric Detection System) Polymer Hrp Kit Should Be Hyperlabelling Technology Used To Directly Label The Anti Link With Fab Immunoglobulins Fragment With Hrp Enzymes To A Biopolymer Backbone Molecule Peroxidase Block, Link Label, Hrp, Dab Substrate, Dab Chromogen. , Hydrogen Peroxide- 500 Ml , Lysol/Phenol 500 Gm , Absolute Ethanol-500Ml , Bond Polymer Refine Detection , Bond Wash Solution 10X - 1L , Bond Slide Label & Print Ribbon , Bond Mixing Stations , Bond Open Containers 7Ml , Universal Covertile In A 160-Pack Format. , Bond Dewax Solution , Bond Epitope Retrieval 1-1L , Bond Epitope Retrieval 2-1L , Leica Microsystems Plus Slides , Bond Aspirating Probe/Cleaning Kit , Titration Kit , Bond Open Containers 30Ml , Micro Tip Yellow , Micro Tip Blue , Esbachs Reagent (Ready To Use) , Esbachs Tubes , Microscope Slide Laboratory Rack Make From Plastic Material Securely Holds 30 Microscope Glass Slides Compatible With The Slide Stainer In The Department , Immersion Oil , Bendicts Solution , Diamond Pencil , Surgical Blade 22G , Periodic Acid Solution (0.5%) , New Fuchsin Stain , Alcian Blue - Pas Stain Kit , Periodic Acid Powder , Schiffs Reagent , Gms Stain , Chromic Acid , Sodium Arc-Biannual Rate Contract Sulphite , Methenamine Silver Solution , Gold Chloride , Sodium Thiosulphate , Light Green , Sudan Black B Powder , Non-Specific Esterase , Reticulin , Silver Nitrate , Acetic Acid Solution , Aluminum Sulphate Powder , Nuclear Fast Red Powder , Potassium Ferricyanide , Absolute Methanol , Methylene Blue , Pas With Diastase , Masson Fontana , Neutral Red , Congo Red , Carbol Fuschin , Warthin Starry , Masson Trichrome Stain , Ferric Chloride , Phosphomolybdlic Acid , Iron Stain , Aniline Blue , Acid Fuschin , Potassium Metabisulphite , Minicap Protein , Control Sera Normal , Hyper Gamma Control , Capiclean , Capi Protect , Minicap Protein(E) 6 Maxi-Kit , Minicap Immunotyping , Minicap Protein , It/If Control (1 Ml) , Minicap Reagents Cups , Capi Protect , Capi Clean , Capillarys/Minicap Urine (Dialysis Buffer) , Capillarys Dialysys System , Control Sera Normal , Hyper Gamma Control , Minicap Protein , Capiclean , Capi Protect , Capillarys/Minicap Urine (Dialysis Buffer) , Capillarys Dialysys System , Minicap Immunotyping , Minicap Protein , It/If Control (1 Ml) , Minicap Reagents Cups , Capiclean , Capi Protect , Minicap Hemoglobin(E) , Hb A2 Normal Control , Control Hba2 Pathological , Hb Afsc Control , Conical Tube For Running Controls , Capiclean , Low Volume Labels , Capi Protect , Minicap Hba1c , Hba1c Calibrators , Hba1c Capillary Control Muti System (2) , Hba1c Capillary Control Muti System (2) , Conical Tube For Running Controls , Capiclean , Low Volume Labels , Capi Protect , Cdt Minicap Calibrators (2 Levels) , Normal Cdt Control , High Cdt Control , Capillarys / Minicap Cdt Samples Treatment Solution , Capiclean , Capi Protect , Seqstudio™ Genetic Analyzer Cathode Buffer Container , Seqstudio Cartridge V2 , Bdt V3.1 Rr-100 & Seq Buffer Each , Bdt V3.1 Rr-1000 & Seq Buffer Each , Bdt V3.1 Rr-5000 & Seq Buffer Each , Tf,Bdt V1.1 Rr-24 & Seq Buffer Each , Bdt V1.1 Rr-100 & Seq Buffer Each , Bdt V1.1 Rr-1000 & Seq Buffer Each , Bdt V1.1 Rr-5000 & Seq Buffer Each , Hi-Di Formamide Bottle 25 Ml , Bigdye Xterminator Kit , Bigdye Xterminator Kit , Bigdye Xterminator Kit , Bigdye Xterminator Kit , Exosap-It 100 Reactions , Hiv-1 Gt: Amplification Module , Hiv-1 Gt: Sequencing Module , Fg- Msi Assay , Magmax™ Ffpe Dna/Rna Ultra Kit , , Micropipette Tips (10 ?L) - , Micropipette Tips (200 ?L) - , Micropipette Tips (1000 ?L) - , Dna Extraction Kit From Tissue/Blood , Nuclease Free Water , Digital Vortex Mixer. , Septa (Catalog Number: A35640) , True Mark ™ Msi Assay (A45295) , Plastic Tubes 0.5 Ml , Plastic Tubes 1.5 Ml , Plastic Tubes 15 Ml , Plastic Tubes 50 Ml , Pcr Master Mix (2X) , Tae Buffer (Tris Acetate -Edta (50X ) , Mass Ruler Dna Loading Dye (6X) , 1 Kb Plus Dna Ladder , Ethidium Bromide Solution (10 /Mg /Ml) , Agarsoe I (Molecular Biology Grade ) , Nuclease Free Water (Am9932) , Nano Drop , Nano Drop For Dna Purification , 1X Ds Dna High Sensitivity , Qubit Tube Catalogue , Test Tube,12X75mm,Blue (250/Pk) , Cd1a (Human); Clone: Bl6; Pe; Asr; 2 Ml , Cd1a (Human); Clone: Bl6; Pc5; Asr; 1 Ml , Cd1a (Human); Clone: Bl6; Apc; Asr; 1 Ml , Cd2 (Human); Clone: 39C1.5; Fitc; Ce/Ivd; 100 Tests , Cd2 (Human); Clone: 39C1.5; Pe; Ce/Ivd; 100 Tests , Cd2 (Human); Clone: 39C1.5; Pc5; Ce/Ivd; 100 Tests , Cd2 (Human); Clone: 39C1.5; Pc7; Asr; 1 Ml , Cd2 (Human); Clone: 39C1.5; Apc; Asr; 1 Ml , Cd2 (Human); Clone: 39C1.5; Apc-A750; Asr; 0.5 Ml , Cd2 (Human); Clone: 39C1.5; Pb; Asr; 0.5 Ml , Cd2 (Human); Clone: 39C1.5; Pc5; Asr; 1 M , Cd3 (Human); Clone: Ucht1; Pc7; Ruo; 100 Tests , Cd3 (Human); Clone: Ucht1; Pc5; Asr; 0.5 Ml , Cd3 (Human); Clone: Ucht1; Fitc; Ce/Ivd; 100 Tests , Cd3 (Human); Clone: Ucht1; Pe; Ce/Ivd; 100 Tests , Cd3 (Human); Clone: Ucht1; Ecd; Ce/Ivd; 100 Tests , Cd3 (Human); Clone: Ucht1; Pc5; Ce/Ivd; 100 Tests , Cd3 (Human); Clone: Ucht1; Pc5.5; Asr; 0.5 Ml , Cd3 (Human); Clone: Ucht1; Pb; Asr; 0.5 Ml , Cd3 (Human); Clone: Ucht1; Apc-A750; Ce/Ivd; 50 Tests , Cd3 (Human); Clone: Ucht1; Kro; Asr; 0.5 Ml , Cd3 (Human); Clone: Ucht1; Apc-A700; Asr; 0.5 Ml , Cd3 (Human); Clone: Ucht1; Apc; Ce/Ivd; 100 Tests , Cd3 (Human); Clone: Ucht1; Apc; Asr; 1 Ml , Cd3 (Human); Clone: Ucht1; Pc5; Asr; 1 Ml , Cd3 (Human); Clone: Ucht1; Ecd; Asr; 1 Ml , Cd4 (Human); Clone: Sfci12t4d11; Pc7; Ce/Ivd; 100 Tests , Cd4 (Human); Clone: 13B8.2; Fitc; Ce/Ivd; 100 Tests , Cd4 (Human); Clone: 13B8.2; Pe; Ce/Ivd; 100 Tests , Cd4 (Human); Clone: 13B8.2; Pc5; Ce/Ivd; 100 Tests , Cd4 (Human); Clone: 13B8.2; Pb; Asr; 0.5 Ml , Cd4 (Human); Clone: 13B8.2; Apc-A750; Ce/Ivd; 50 Tests , Cd4 (Human); Clone: 13B8.2; Kro; Asr; 0.5 Ml , Cd4 (Human); Clone: 13B8.2; Apc-A700; Asr; 0.5 Ml , Cd4 (Human); Clone: 13B8.2; Pc5.5; Asr; 0.5 Ml , Cd4 (Human); Clone: 13B8.2; Apc; Ce/Ivd; 100 Tests , Cd4 (Human); Clone: 13B8.2; Pc5; Asr; 1 Ml , Cd5 (Human); Clone: Bl1a; Pe; Ce/Ivd; 100 Tests , Cd5 (Human); Clone: Bl1a; Fitc; Ce/Ivd; 100 Tests , Cd5 (Human); Clone: Bl1a; Ecd; Asr; 1 Ml , Cd5 (Human); Clone: Bl1a; Pc7; Asr; 1 Ml , Cd5 (Human); Clone: Bl1a; Apc; Asr; 1 Ml , Cd5 (Human); Clone: Bl1a; Pc5.5; Asr; 0.5 Ml , Cd5 (Human); Clone: Bl1a; Apc-A700; Asr; 0.5 Ml , Cd5 (Human); Clone: Bl1a; Apc-A750; Asr; 0.5 Ml , Cd5 (Human); Clone: Bl1a; Pb; Asr; 0.5 Ml , Cd5 (Human); Clone: Bl1a; Pc5; Asr; 1 Ml , Cd7 (Human); Clone: 8H8.1; Pc7; Asr; 1 Ml , Cd7 (Human); Clone: 8H8.1; Apc-A700; Asr; 0.5 Ml , Cd7 (Human); Clone: 8H8.1; Ecd; Asr; 1 Ml , Cd7 (Human); Clone: 8H8.1; Apc; Asr; 0.5 Ml , Cd7 (Human); Clone: 8H8.1; Pb; Asr; 0.5 Ml , Cd7 (Human); Clone: 8H8.1; Apc-A750; Asr; 0.5 Ml , Cd7 (Human); Clone: 8H8.1; Pc5; Asr; 1 Ml , Cd8 (Human); Clone: Sfci21thy2d3; Pc5; Asr; 0.5 Ml , Cd8 (Human); Clone: Sfci21thy2d3; Pc7; Ruo; 100 Tests , Cd8 (Human); Clone: Sfci21thy2d3; Ecd; Ce/Ivd; 50 Tests , Cd8 (Human); Clone: Sfci21thy2d3; Pc7; Ce/Ivd; 100 Tests , Cd8 (Human); Clone: B9.11; Fitc; Ce/Ivd; 100 Tests , Cd8 (Human); Clone: B9.11; Pe; Ce/Ivd; 100 Tests , Cd8 (Human); Clone: B9.11; Pc5; Ce/Ivd; 100 Tests , Cd8 (Human); Clone: B9.11; Pb; Asr; 0.5 Ml , Cd8 (Human); Clone: B9.11; Apc-A750; Ce/Ivd; 50 Tests , Cd8 (Human); Clone: Sfci21thy2d3; Pc5.5; Asr; 0.5 Ml , Cd8 (Human); Clone: Sfci21thy2d3; Apc; Asr; 0.5 Ml , Cd8 (Human); Clone: B9.11; Kro; Asr; 0.5 Ml , Cd8 (Human); Clone: B9.11; Ecd; Asr; 0.5 Ml , Cd8 (Human); Clone: B9.11; Pc5.5; Asr; 0.5 Ml , Cd8 (Human); Clone: B9.11; Apc; Ce/Ivd; 100 Tests , Cd8 (Human); Clone: B9.11; Pc5; Asr; 1 Ml , Cd9 (Human); Clone: Alb6; Pb; Asr; 0.5 Ml , Cd9 (Human); Clone: Alb6; Apc-A750; Asr; 0.5 Ml , Cd9 (Human); Clone: Alb6; Fitc; Asr; 2 Ml , Cd10 (Human); Clone: Alb1; Fitc; Ce/Ivd; 100 Tests , Cd10 (Human); Clone: Alb1; Pc7; Asr; 1 Ml , Cd10 (Human); Clone: Alb1; Apc-A750; Asr; 0.5 Ml , Cd10 (Human); Clone: Alb1; Pc5.5; Asr; 0.5 Ml , Cd10 (Human); Clone: Alb1; Pe; Asr; 2 Ml , Cd10 (Human); Clone: Alb1; Ecd; Asr; 1 Ml , Cd10 (Human); Clone: Alb1; Apc; Asr; 1 Ml , Cd11a (Human); Clone: 25.3; Fitc; Asr; 2 Ml , Cd11a (Human); Clone: 25.3; Pe; Asr; 2 Ml , Cd11b (Human); Clone: Bear1; Pc7; Asr; 1 Ml , Cd11b (Human); Clone: Bear1; Apc; Asr; 0.5 Ml , Cd11b (Human); Clone: Bear1; Apc-A750; Asr; 0.5 Ml , Cd11b (Human); Clone: Bear1; Pb; Asr; 0.5 Ml , Cd11b (Human); Clone: Bear1; Fitc; Ce/Ivd; 100 Tests , Cd11b (Human); Clone: Bear1; Fitc; Asr; 2 Ml , Cd11b (Human); Clone: Bear1; Pe; Asr; 2 Ml , Cd11b (Human); Clone: Bear1; Pc5; Asr; 1 Ml , Cd11c (Human); Clone: Bu15; Pc7; Asr; 1 Ml , Cd11c (Human); Clone: Bu15; Apc; Asr; 0.5 Ml , Cd11c (Human); Clone: Bu15; Pc5.5; Asr; 0.5 Ml , Cd11c (Human); Clone: Bu15; Pe; Ce/Ivd; 100 Tests , Cd11c (Human); Clone: Bu15; Apc-A700; Asr; 0.5 Ml , Cd11c (Human); Clone: Bu15; Pc5; Asr; 1 Ml , Cd13 (Human); Clone: Sj1d1; Pe; Ce/Ivd; 100 Tests , Cd13 (Human); Clone: Immu103.44; Pc5; Ce/Ivd; 100 Tests , Cd13 (Human); Clone: Immu103.44; Ecd; Asr; 1 Ml , Cd13 (Human); Clone: Immu103.44; Pc7; Asr; 1 Ml , Cd13 (Human); Clone: Immu103.44; Pc5.5; Asr; 0.5 Ml , Cd13 (Human); Clone: Immu103.44; Apc; Asr; 0.5 Ml , Cd13 (Human); Clone: 366; Pc7; Asr; 0.5 Ml , Cd14 (Human); Clone: Rmo52; Pe; Ce/Ivd; 100 Tests , Cd14 (Human); Clone: Rmo52; Pc5; Ce/Ivd; 100 Tests , Cd14 (Human); Clone: Rmo52; Pc7; Asr; 1 Ml , Cd14 (Human); Clone: Rmo52; Pc5.5; Asr; 0.5 Ml , Cd14 (Human); Clone: Rmo52; Apc-A750; Asr; 0.5 Ml , Cd14 (Human); Clone: Rmo52; Apc-A700; Asr; 0.5 Ml , Cd14 (Human); Clone: Rmo52; Pb; Asr; 0.5 Ml , Cd14 (Human); Clone: Rmo52; Kro; Asr; 0.5 Ml , Cd14 (Human); Clone: Rmo52; Apc; Asr; 1 Ml , Cd14 (Human); Clone: Rmo52; Ecd; Asr; 1 Ml , Cd15 (Human); Clone: 80H5; Pb; Asr; 0.5 Ml , Cd15 (Human); Clone: 80H5; Kro; Asr; 0.5 Ml , Cd15 (Human); Clone: 80H5; Pc5; Asr; 1 Ml , Cd18 (Human); Clone: 7E4; Fitc; Asr; 2 Ml , Cd18 (Human); Clone: 7E4; Pe; Asr; 2 Ml , Cd19 (Human); Clone: J3-119; Fitc; Ce/Ivd; 100 Tests , Cd19 (Human); Clone: J3-119; Pe; Ce/Ivd; 100 Tests , Cd19 (Human); Clone: J3-119; Ecd; Ce/Ivd; 100 Tests , Cd19 (Human); Clone: J3-119; Pc5; Ce/Ivd; 100 Tests , Cd19 (Human); Clone: J3-119; Pc5.5; Asr; 0.5 Ml , Cd19 (Human); Clone: J3-119; Apc-A700; Asr; 0.5 Ml , Cd19 (Human); Clone: J3-119; Apc-A750; Asr; 0.5 Ml , Cd19 (Human); Clone: J3-119; Pb; Asr; 0.5 Ml , Cd19 (Human); Clone: J3-119; Apc-A750; Ce/Ivd; 50 Tests , Cd19 (Human); Clone: J3-119; Kro; Asr; 0.5 Ml , Cd19 (Human); Clone: J3-119; Fitc; Asr; 2 Ml , Cd19 (Human); Clone: J3-119; Apc; Ce/Ivd; 100 Tests , Cd19 (Human); Clone: J3-119; Apc; Asr; 1 Ml , Cd19 (Human); Clone: J3-119; Ecd; Asr; 1 Ml , Cd19 (Human); Clone: J3-119; Pc7; Ce/Ivd; 100 Tests , Cd19 (Human); Clone: J3-119; Pc7; Asr; 1 Ml , Cd20 (Human); Clone: B9e9; Fitc; Ce/Ivd; 100 Tests , Cd20 (Human); Clone: B9e9; Pc5; Ce/Ivd; 100 Tests , Cd20 (Human); Clone: B9e9; Apc; Asr; 1 Ml , Cd20 (Human); Clone: B9e9; Apc-A750; Asr; 0.5 Ml , Cd20 (Human); Clone: B9e9; Pb; Asr; 0.5 Ml , Cd20 (Human); Clone: B9e9; Apc-A700; Asr; 0.5 Ml , Cd20 (Human); Clone: B9e9; Pe; Asr; 2 Ml , Cd20 (Human); Clone: B9e9; Ecd; Asr; 1 Ml , Cd20 (Human); Clone: B9e9; Pc7; Asr; 1 Ml , Cd21 (Human); Clone: Bl13; Pe; Asr; 2 Ml , Cd21 (Human); Clone: Bl13; Pb; Asr; 0.5 M , Cd21 (Human); Clone: Bl13; Fitc; Asr; 2 Ml , Cd22 (Human); Clone: Sj10.1H11; Apc; Asr; 0.5 Ml , Cd22 (Human); Clone: Sj10.1H11; Pc7; Asr; 1 Ml , Cd22; Clone: Sj10.1H11; Pc5.5; Asr; 0.5 Ml , Cd22 (Human); Clone: Sj10.1H11; Apc-A700; Asr; 0.5 Ml , Cd22 (Human); Clone: Sj10.1H11; Pb; Asr; 0.5 Ml , Cd22 (Human); Clone: Sj10.1H11; Ecd; Asr; 0.5 M , Cd22 (Human); Clone: Sj10.1H11; Pe; Asr; 2 Ml , Cd22 (Human); Clone: Sj10.1H11; Pc5; Asr; 1 Ml , Cd23 (Human); Clone: 9P25; Pe; Asr; 2 Ml , Cd23 (Human); Clone: 9P25; Apc; Asr; 1 Ml , Cd23 (Human); Clone: 9P25; Apc-A700; Asr; 0.5 Ml , Cd23 (Human); Clone: 9P25; Pb; Asr; 0.5 Ml , Cd23 (Human); Clone: 9P25; Pc7; Asr; 0.5 Ml , Cd23 (Human); Clone: 9P25; Fitc; Ce/Ivd; 100 Tests , Cd23 (Human); Clone: 9P25; Ecd; Asr; 1 Ml , Cd24 (Human); Clone: Alb9; Apc; Asr; 0.5 Ml , Cd24 (Human); Clone: Alb9; Apc-A750; Asr; 0.5 Ml , Cd24 (Human); Clone: Alb9; Ecd; Asr; 0.5 Ml , Cd24 (Human); Clone: Alb9; Pe; Asr; 2 Ml , Cd24 (Human); Clone: Alb9; Pc5; Asr; 1 Ml , Cd25 (Human); Clone: B1.49.9; Ecd; Ruo; 100 Tests , Cd25 (Human); Clone: B1.49.9; Pe; Ce/Ivd; 100 Tests , Cd25 (Human); Clone: B1.49.9; Pc7; Asr; 1 M , Cd25 (Human); Clone: B1.49.9; Pc5.5; Asr; 0.5 Ml , Cd25 (Human); Clone: B1.49.9; Pb; Asr; 0.5 Ml , Cd25 (Human); Clone: B1.49.9; Apc-A700; Asr; 0.5 Ml , Cd25 (Human); Clone: B1.49.9; Apc; Asr; 0.5 Ml , Cd25 (Human); Clone: B1.49.9; Apc-A750; Asr; 0.5 Ml , Cd25 (Human); Clone: B1.49.9; Pc5; Asr; 1 Ml , Cd55 (Human); Clone: Js11ksc2.3; Fitc; Asr; 2 Ml , Cd55 (Human); Clone: Js11ksc2.3; Pe; Asr; 2 Ml , Cd56 (Human); Clone: N901; Pe; Ce/Ivd; 100 Tests , Cd56 (Human); Clone: N901; Pc5; Ce/Ivd; 100 Tests , Cd56 (Human); Clone: N901; Pc7; Asr; 1 Ml , Cd56 (Human); Clone: N901; Pc5.5; Asr; 0.5 Ml , Cd56 (Human); Clone: N901; Ecd; Asr; 1 Ml , Cd56 (Human); Clone: N901; Apc-A700; Asr; 0.5 Ml , Cd56 (Human); Clone: N901; Pe; Asr; 2 Ml , Cd56 (Human); Clone: N901; Apc; Ce/Ivd; 100 Tests , Cd56 (Human); Clone: N901; Apc; Asr; 1 Ml , Cd56 (Human); Clone: N901; Pc5; Asr; 1 Ml , Cd58 (Human); Clone: Aicd58; Fitc; Asr; 2 Ml , Cd58 (Human); Clone: Aicd58; Pe; Asr; 2 Ml , Cd58 (Human); Clone: Aicd58; Apc; Asr; 1 Ml , Cd58 (Human); Clone: Aicd58; Pc5; Asr; 1 Ml , Cd61 (Human); Clone: Sz21; Fitc; Ce/Ivd; 100 Tests , Cd61 (Human); Clone: Sz21; Fitc; Asr; 2 Ml , Cd61 (Human); Clone: Sz21; Pe; Asr; 2 Ml , Cd61 (Human); Clone: Sz21; Pc7; Asr; 1 Ml , Cd62p (Human); Clone: Clb-Thromb/6; Fitc; Ce/Ivd; 100 Tests , Cd62p (Human); Clone: Clb-Thromb/6; Pe; Asr; 2 M , Cd63 (Human); Clone: Clb-Gran/12; Fitc; Asr; 2 Ml , Cd63 (Human); Clone: Clb-Gran/12; Pe; Asr; 2 Ml , Cd64 (Human); Clone: 22; Apc-A750; Asr; 0.5 Ml , Cd64 (Human); Clone: 22; Ecd; Asr; 0.5 Ml , Cd64 (Human); Clone: 22; Pc7; Asr; 0.5 Ml , Cd64 (Human); Clone: 22; Pb; Asr; 0.5 Ml , Cd64 (Human); Clone: 22; Fitc; Asr; 2 Ml , Cd64 (Human); Clone: 22; Pe; Asr; 2 Ml , Cd64 (Human); Clone: 22; Pc5; Asr; 1 Ml , Cd65 (Human); Clone: 88H7; Pb; Asr; 0.5 Ml , Cd71 (Human); Clone: Ydj1.2.2; Apc-A750; Asr; 0.5 Ml , Cd71 (Human); Clone: Ydj1.2.2; Apc-A700; Asr; 0.5 Ml , Cd71 (Human); Clone: Ydj1.2.2; Pe; Asr; 2 Ml , Cd79a (Human); Clone: Hm47; Apc; Asr; 1 Ml , Cd79a (Human); Clone: Hm47; Pe; Asr; 2 Ml , Cd79b (Human); Clone: Cb3-1; Apc; Asr; 0.5 Ml , Cd79b (Human); Clone: Cb3-1; Pe; Ce/Ivd; 100 Tests , Cd81 (Human); Clone: Js64; Apc; Asr; 0.5 Ml , Cd81 (Human); Clone: Js64; Pb; Asr; 0.5 Ml , Cd81 (Human); Clone: Js64; Pe; Asr; 2 Ml , Cd90 (Human); Clone: F15-42-1-5; Fitc; Asr; 2 Ml , Cd90 (Human); Clone: F15-42-1-5; Pe; Asr; 2 Ml , Cd90 (Human); Clone: Thy1/310; Pc5; Asr; 1 Ml , Cd95 (Human); Clone: Ub2; Pe; Ruo; 50 Tests , Cd103 (Human); Clone: 2G5; Apc; Asr; 0.5 Ml , Cd103 (Human); Clone: 2G5; Fitc; Asr; 2 Ml , Cd117 (Human); Clone: 104D2d1; Pc5.5; Asr; 0.5 Ml , Cd117 (Human); Clone: 104D2d1; Apc-A750; Asr; 0.5 Ml , Cd117 (Human); Clone: 95C3; Pe; Asr; 2 Ml , Cd117 (Human); Clone: 95C3; Pc5; Asr; 1 Ml , Cd117 (Human); Clone: 104D2d1; Pe; Asr; 2 Ml , Cd117 (Human); Clone: 104D2d1; Pc5; Ce/Ivd; 100 Tests , Cd117 (Human); Clone: 104D2d1; Apc; Asr; 1 Ml , Cd117 (Human); Clone: 104D2d1; Pc7; Asr; 1 Ml , Cd123 (Human); Clone: Ssdcly107d2; Apc; Asr; 0.5 Ml , Cd123 (Human); Clone: Ssdcly107d2; Pc7; Asr; 0.5 Ml , Cd123 (Human); Clone: Ssdcly107d2; Pc5.5; Asr; 0.5 Ml , Cd138 (Human); Clone: B-A38; Pc5; Asr; 1 Ml , Cd138 (Human); Clone: B-A38; Pe; Ce/Ivd; 100 Tests , Cd138 (Human); Clone: B-A38; Pc5; Ce/Ivd; 100 Tests , Cd138 (Human); Clone: B-A38; Apc; Asr; 0.5 Ml , Cd138 (Human); Clone: B-A38; Pc5.5; Asr; 0.5 Ml , Cd183 (Human); Clone: G025h7 ; Af488; Asr; 0.5 Ml , Cd203c (Human); Clone: 97A6; Pc7; Asr; 1 Ml , Cd203c (Human); Clone: 97A6; Pe; Asr; 2 Ml , Cd235a (Human); Clone: 11E4b-7-6; Pc7; Asr; 1 Ml , Cd235a (Human); Clone: 11E4b-7-6; Apc-A750; Asr; 0.5 Ml , Cd243 (Human); Clone: Uic2; Pe; Asr; 2 Ml , Cd309 (Human); Clone: Kdr-1; Pe; Asr; 2 Ml , Cd309 (Human); Clone: Kdr-1; Pc7; Asr; 1 Ml , Ng2 (Human); Clone: 7.1; Pe; Asr; 2 Ml , Fmc7 (Human); Clone: Fmc7; Pb; Asr; 0.5 Ml , Cd66c (Human); Clone: Kor-Sa3544; Fitc; Asr; 1 Ml , Cd66c (Human); Clone: Kor-Sa3544; Pe; Asr; 1 Ml , Lactoferrin (Human); Clone: Clb13.17; Pe; Asr; 2 Ml , Myeloperoxidase (Human); Clone: Clb-Mpo-1; Fitc; Ce/Ivd; 100 , Myeloperoxidase (Human); Clone: Clb-Mpo-1; Pe; Asr; 2 Ml , Tcr Pan ?/? (Human); Clone: Ip26a; Pe; Asr; 1 Ml , Tcr Pan ?/? (Human); Clone: Ip26a; Pc5; Asr; 0.5 Ml , Tcr Pan ?/? (Human); Clone: Ip26a; Apc; Asr; 0.5 Ml , Tcr Pan G/? (Human); Clone: Immu510; Unlb; Ruo; 0.1 Mg , Tcr Pan G/? (Human); Clone: Immu510; Pe; Asr; 1 Ml , Tcr Pan G/? (Human); Clone: Immu510; Pc5; Asr; 0.5 Ml , Tcr Pan G/? (Human); Clone: Immu510; Pc5.5; Asr; 0.5 Ml , Tcr Pan G/? (Human); Clone: Immu510; Pc7; Asr; 0.5 Ml , Hla-Dr (Human); Clone: Immu-357; Pc5; Ce/Ivd; 100 Tests , Hla-Dr (Human); Clone: Immu-357; Pc7; Asr; 0.5 Ml , Hla-Dr (Human); Clone: Immu-357; Pb; Asr; 0.5 Ml , Hla-Dr (Human); Clone: Immu-357; Kro; Asr; 0.5 Ml , Hla-Dr (Human); Clone: Immu-357; Pc5.5; Asr; 0.5 Ml , Hla-Dr (Human); Clone: B8.12.2; Fitc; Asr; 2 Ml , Hla-Dr (Human); Clone: B8.12.2; Pe; Asr; 2 Ml , Hla-Dr (Human); Clone: Immu-357; Pe; Ce/Ivd; 100 Tests , Hla-Dr (Human); Clone: Immu-357; Apc; Asr; 1 Ml , Hla-Dr (Human); Clone: Immu-357; Ecd; Asr; 1 Ml , Cd30 (Human); Clone: Hrs4; Apc; Asr; 0.5 Ml , Cd30 (Human); Clone: Hrs4; Pe; Asr; 2 Ml , Cd31 (Human); Clone: 5.6E; Pb; Asr; 0.5 Ml , Cd31 (Human); Clone: 5.6E; Fitc; Asr; 2 Ml , Cd33 (Human); Clone: D3hl60.251; Pe; Ce/Ivd; 100 Tests , Cd33 (Human); Clone: D3hl60.251; Pc7; Asr; 1 Ml , Cd33 (Human); Clone: D3hl60.251; Pc5.5; Asr; 0.5 Ml , Cd33 (Human); Clone: D3hl60.251; Apc-A750; Asr; 0.5 M , Cd33 (Human); Clone: D3hl60.251; Fitc; Asr; 2 Ml , Cd33 (Human); Clone: D3hl60.251; Pe; Asr; 2 Ml , Cd33 (Human); Clone: D3hl60.251; Apc; Ce/Ivd; 100 Tests , Cd33 (Human); Clone: D3hl60.251; Pc5; Ce/Ivd; 100 Tests , Cd33 (Human); Clone: D3hl60.251; Pc5; Asr; 1 Ml , Cd34 (Human); Clone: 581; Pe; Ce/Ivd; 100 Tests , Cd34 (Human); Clone: 581; Pc5; Ce/Ivd; 100 Tests , Cd34 (Human); Clone: 581; Pc7; Ce/Ivd; 100 Tests , Cd34 (Human); Clone: 581; Pc7; Asr; 1 Ml , Cd34 (Human); Clone: 581; Apc-A700; Asr; 0.5 Ml , Cd34 (Human); Clone: 581; Apc-A750; Asr; 0.5 Ml , Cd34 (Human); Clone: 581; Fitc; Ce/Ivd; 100 Tests , Cd34 (Human); Clone: 581; Apc; Asr; 1 Ml , Cd34 (Human); Clone: 581; Pc5; Asr; 1 Ml , Cd34 (Human); Clone: 581; Ecd; Asr; 1 Ml , Cd36 (Human); Clone: Fa6.152; Apc; Asr; 0.5 Ml , Cd36 (Human); Clone: Fa6.152; Fitc; Asr; 2 Ml , Cd38 (Human); Clone: T16; Fitc; Ce/Ivd; 100 Tests , Cd38 (Human); Clone: Ls198-4-3; Pe; Ce/Ivd; 100 Tests , Cd38 (Human); Clone: Ls198-4-3; Pc5; Ce/Ivd; 100 Tests , Cd38 (Human); Clone: Ls198-4-3; Pc7; Asr; 0.5 Ml , Cd38 (Human); Clone: Ls198-4-3; Apc; Asr; 1 Ml , Cd38 (Human); Clone: Ls198-4-3; Pc5.5; Asr; 0.5 Ml , Cd38 (Human); Clone: Ls198-4-3; Apc-A750; Asr; 0.5 Ml , Cd38 (Human); Clone: Ls198-4-3; Ecd; Asr; 0.5 Ml , Cd38 (Human); Clone: T16; Fitc; Asr; 2 Ml , Cd38 (Human); Clone: Ls198-4-3; Pc5; Asr; 1 Ml , Cd41 (Human); Clone: P2; Ecd; Ruo; 100 Tests , Cd41 (Human); Clone: P2; Pe; Ce/Ivd; 100 Tests , Cd41 (Human); Clone: P2; Apc; Asr; 0.5 Ml , Cd41 (Human); Clone: P2; Fitc; Asr; 2 Ml , Cd41 (Human); Clone: P2; Pe; Asr; 2 Ml , Cd41 (Human); Clone: Sz22; Fitc; Asr; 2 Ml , Cd42a (Human); Clone: Sz1; Fitc; Asr; 2 Ml , Cd42b (Human); Clone: Sz2; Apc; Asr; 0.5 Ml , Cd42b (Human); Clone: Sz2; Fitc; Asr; 2 Ml , Cd42b (Human); Clone: Sz2; Pe; Asr; 2 Ml , Cd44 (Human); Clone: J.173; Pe; Asr; 2 Ml , Cd44 (Human); Clone: J.173; Fitc; Asr; 2 Ml , Cd45 (Human); Clone: J33; Fitc; Ce/Ivd; 100 Tests , Cd45 (Human); Clone: J33; Pe; Ce/Ivd; 100 Tests , Cd45 (Human); Clone: J33; Pc5; Ce/Ivd; 100 Tests , Cd45ro (Human); Clone: Uchl1; Pe; Ce/Ivd; 100 Tests , Cd45 (Human); Clone: J33; Pc5.5; Asr; 1 Ml , Cd45 (Human); Clone: J33; Pb; Asr; 1 Ml , Cd45 (Human); Clone: J33; Apc-A700; Ce/Ivd; 100 Tests , Cd45 (Human); Clone: J33; Apc-A750; Ce/Ivd; 100 Tests , Cd45ra (Human); Clone: 2H4ldh11ldb9; Pb; Asr; 0.5 Ml , Cd45ra (Human); Clone: 2H4ldh11ldb9; Apc-A750; Asr; 0.5 Ml , Cd45 (Human); Clone: J33; Kro; Asr; 1 Ml , Cd45ra (Human); Clone: 2H4ldh11ldb9; Pc7; Asr; 0.5 Ml , Cd45ro (Human); Clone: Uchl1; Pc7; Asr; 0.5 Ml , Cd45ra (Human); Clone: 2H4ldh11ldb9; Apc; Asr; 0.5 Ml , Cd45ra (Human); Clone: Alb11; Fitc; Asr; 2 Ml , Cd45 (Human); Clone: J33; Fitc; Asr; 2 Ml , Cd45ra (Human); Clone: Alb11; Pe; Asr; 2 Ml , Cd45 (Human); Clone: J33; Apc; Ce/Ivd; 100 Tests , Cd45 (Human); Clone: J33; Ecd; Asr; 1 Ml , Cd45ra (Human); Clone: 2H4ldh11ldb9; Ecd; Asr; 1 Ml , Cd45ro (Human); Clone: Uchl1; Ecd; Asr; 1 Ml , Cd45 (Human); Clone: J33; Pc7; Ce/Ivd; 100 Tests , Cd45 (Human); Clone: J33; Pc7; Asr; 1 Ml , Cd49d (Human); Clone: Hp2/1; Apc; Asr; 0.5 Ml , Cd49d (Human); Clone: Hp2/1; Apc-A750; Asr; 0.5 Ml , Cd49d (Human); Clone: Hp2/1; Fitc; Asr; 2 Ml , Pbs Buffer; Luo; 15 Packets , Isoflow Sheath Fluid; Ivd; 1 X 10 L , ? Mark Tcr Vß Repertoire Kit; Ruo; 25 Tests , Stem-Kit Reagents; Ivd; 50 Tests , Flow-Count Fluorospheres; Ivd; 200 Tests , Immuno-Trol Cells; Ivd; 60 Tests , Immuno-Trol Low Cells; Ivd; 60 Tests , Perfix-Nc (No Centrifuge Assay Kit), 75 Tests, Ivd-Ce , Perfix-Nc (No Centrifuge Assay Kit), 150 Tests, Ivd-Ce , Versalyse Lysing Solution; Ivd; 100 Tests , Versalyse Lysing Solution; Ruo; 100 Tests , Optilyse No-Wash Lysing Solutions; Ivd; 200 Tests , Optilyse No-Wash Lysing Solutions; Ruo; 250 Tests , Iotest 3 Lysing Solution; Ivd; 100 Tests , Iotest 3 Lysing Solution; Ruo; 100 Tests , Iotest 3 Fixative Solution; Ivd; 100 - 200 Tests , Iotest 3 Fixative Solution; Ruo; 100 - 200 Tests , 7-Aad Viability Dye; Ivd; 150 Tests , 7-Aad Viability Dye; Ruo; 150 Tests , Cd79a (Human); Clone: Hm47; Pc5.5; Asr; 0.5 Ml , Cd274 (Human); Clone: Pd-L1; Apc; Asr; 0.5 Ml , Cd30 (Human); Clone: Hrs4; Apc-A700; Asr; 0.5 Ml , Cd36 (Human); Clone: Fa6.152; Pb; Asr; 0.5 Ml , Versacomp Antibody Capture Kit; Luo; 2 Vials , Stem-Trol Control Cells; Ivd; 10 Tests , Cd65 (Human); Clone: 88H7; Fitc; Asr; 2 Ml , Cd22 (Human); Clone: Sj10.1H11; Fitc; Asr; 2 M , Cd15 (Human); Clone: 80H5; Fitc; Asr; 2 Ml , Cd16 (Human); Clone: 3G8; Ecd; Asr; 1 Ml , Cd7 (Human); Clone: 8H8.1; Fitc; Ce/Ivd; 100 Tests , Cd7 (Human); Clone: 8H8.1; Pe; Asr; 2 Ml , D10 (Human); Clone: Alb1; Pc5; Ce/Ivd; 100 Tests , Beads, Service Use Only, Flosens, 8 Peak Rainbow Calibration Particle, 5Ml/Vial , Cd279 (Human); Clone: Pd1.3; Pe; Asr; 1 Ml , Cd279 (Human); Clone: Pd1.3; Pc7; Asr; 0.5 Ml , Cd314 (Human); Clone: On72; Pe; Asr; 1 Ml , Intrapreppermeabilization Reagent; Ivd; 150 Tests , Cd2 (Human); Clone: 39C1.5; Ecd; Asr; 0.5 Ml , Cd2 (Human); Clone: 39C1.5; Apc-A700; Asr; 0.5 Ml , Cd8 (Human); Clone: B9.11; Af700; Asr; 0.5 Ml , Cd10 (Human); Clone: Alb1; Apc-A700; Ce/Ivd; 50 Tests , Cd15 (Human); Clone: 80H5; Pe; Asr; 2 Ml , Cd16 (Human); Clone: 3G8; Apc-A700; Asr; 0.5 Ml , Cd26 (Human); Clone: 4El-1C7; Pe; Asr; 2 Ml , Cd27 (Human); Clone: 1A4cd27; Pc5.5; Asr; 0.5 Ml , Cd28 (Human); Clone: Cd28.2; Apc; Asr; 0.5 Ml , Cd36 (Human); Clone: Fa6.152; Apc-A700; Asr; 0.5 Ml , Cd38 (Human); Clone: Ls198-4-3; Apc-A700; Asr; 0.5 Ml , Cd57 (Human); Clone: Nc1; Fitc; Ce/Ivd; 100 Tests , Cd73 (Human); Clone: Ad-2; Pe; Asr; 1 Ml , Cd79b (Human); Clone: Cb3-1; Pc5.5; Asr; 0.5 Ml , Cd81 (Human); Clone: Js64; Fitc; Asr; 1 Ml , Cd86 (Human); Clone: Ha5.2B7; Apc-A750; Asr; 0.5 Ml , Cd94 (Human); Clone: Hp-3B1; Apc; Asr; 0.5 Ml , Cd123 (Human); Clone: Ssdcly107d2; Pe; Asr; 2 Ml , Cd123 (Human); Clone: Ssdcly107d2; Apc-A700; Asr; 0.5 Ml , Cd305 (Human); Clone: Nkta255; Pe; Asr; 1 Ml , Hla-Dr (Human); Clone: Immu-357; Apc-A750; Asr; 0.5 Ml , ? Chain; Fitc; Asr; 2 Ml , ? Chain; Pe; Asr; 2 Ml , Perforin (Human); Clone: Dg9; Pb; Asr; 0.5 Ml , Ki-67 (Human); Clone: Ki-67; Af488; Asr; 0.5 Ml , Duraclone Re Pc Tube; Ruo; 25 Tests , Duraclone Im Dendritic Cells Tube Duraclone Ruo, 25 Tests , Hla-B27-Fitc/Hla-B7-Pe; Ce/Ivd; 50 Tests , Cd157 (Human); Clone: Sy/11B5; Pe; Asr; 1 Ml , Cd105 (Human); Clone: Tea3/17.1.1; Pe; Ce/Ivd; 50 Tests , Cd279 (Human); Clone: Pd1.3; Pc5.5; Asr; 0.5 Ml , Cd274 (Human); Clone: Pd-L1; Pc7; Ruo; 50 Tests , Cd152 (Human); Clone: Bni3; Pe; Ruo; 100 Tests , Foxp3 (Human); Clone: 259D; Af647; Asr; 0.5 Ml , Cd3; Clone: Ucht1; Snv428; Ruo; 50 Tests , Cd19 (Human); Clone: J3-119; Snv428; Asr; 0.5 Ml , Supernova Staining Buffer; Ruo; 100 Tests , Hla-Dr; Clone: Immu-357; Snv786; Ruo; 50 Tests , Cd117; Clone: 104D2d1; Snv428; Ruo; 50 Tests , Cd38; Clone: Ls198-4-3; Snv605; Ruo; 50 Tests , Cd20; Clone: B9e9; Snv605; Asr; 0.5 Ml , Cd22 (Human); Clone: Sj10.1H11; Snv428; Ruo; 50 Tests , Cd62l (Human); Clone: Dreg56; Apc-A750; Asr; 0.5 Ml , Cd54 (Human); Clone: 84H10; Pe; Asr; 2 Ml , Cd99; Clone: 3B2/Ta8; Ecd; Asr; 0.5 Ml , Cd133; Clone: W6b3c1; Apc; Asr; 0.5 Ml , Cd158b1/B2,J (Human); Clone: Gl183; Pe; Asr; 1 Ml , Clearllab Ls (Lymphoid Screen); Ce/Ivd; 25 Tests , Clearllab 10C B Cell Tube; Ivd; 25 Tests , Clearllab 10C T Cell Tube; Ivd; 25 Tests , Clearllab 10C M1 Cell Tube; Ivd; 25 Tests , Clearllab 10C M2 Cell Tube; Ivd; 25 Tests , Clearllab Compensation Kit; Ivd; 5 Tests , Clearllab Compensation Beads; Ivd; 100 Tests , Kaluza Software Kit 1 Year Single User , Dxflex Daily Qc Fluorospheres; Ivd , Dxflex Sheath Fluid; Ivd; 10 L , Contrad 70 Cleaning Solution; 1 L , Pm Kits For Service With Package , Fp,Flow Clean Ivd, 500Ml , Cd45-Fitc/Cd4-Pe/Cd8-Ecd/Cd3-Pc5; Ivd; 50 Tests , Cd45-Fitc/Cd56-Pe/Cd19-Ecd/Cd3-Pc5; Ivd; 50 Tests , Cd15 (Human); Clone: 80H5; Fitc; Ce/Ivd; 100 Tests , ? Chain; Ce/Ivd , Cd235a (Human); Clone: 11E4b-7-6; Fitc; Ce/Ivd; 100 Tests , ? Chain (Human); Ce/Ivd , Cd59 (Human); Clone: Mem-43; Pe; Asr; 1 Ml , Cd24 (Human); Clone: Alb9; Pe; Ce/Ivd; 100 Tests , Cd86 (Human); Clone: Ha5.2B7; Pe; Asr; 2 Ml , Cd20 (Human); Clone: B9e9; Ecd; Ce/Ivd; 100 Tests , Cd117 (Human); Clone: 104D2d1; Pc5.5; Ce/Ivd; 50 Tests , Myeloperoxidase (Human); Clone: Clb-Mpo-1; Pc5.5; Asr; 0.5 Ml , Cd33 (Human); Clone: D3hl60.251; Pc7; Ce/Ivd; 100 Tests , Cd200 (Human); Clone: Ox-104; Pc7; Ce/Ivd; 50 Tests , Cd14 (Human); Clone: Rmo52; Apc; Ce/Ivd; 100 Tests , Cd25 (Human); Clone: B1.49.9; Apc-A700; Ce/Ivd; 50 Tests , Cd38 (Human); Clone: Ls198-4-3; Apc-A750; Ce/Ivd; 50 Tests , Cd11b (Human); Clone: Bear1; Apc-A750; Ce/Ivd; 50 Tests , Cd5 (Human); Clone: Bl1a; Apc-A750; Ce/Ivd; 50 Tests , Cd43 (Human); Clone: Dft1; Apc-A750; Ce/Ivd; 50 Tests , Cd138 (Human); Clone: B-A38; Pb; Asr; 0.5 Ml , Cd15 (Human); Clone: 80H5; Pb; Ce/Ivd; 50 Tests , Cd45 (Human); Clone: J33; Kro; Ce/Ivd; 100 Tests , Cd38 (Human); Clone: Ls198-4-3; Snv428; Asr; 0.5 Ml , Cd25 (Human); Clone: B1.49.9; Snv428; Asr; 0.5 Ml , Cd5; Clone: Clb-T1/1; Snv428; Ruo; 50 Tests , Cd56; Clone: N901; Snv428; Ruo; 50 Tests , Cd200; Clone: Ox-104; Snv428; Ruo; 50 Tests , Cd33; Clone: D3hl60.251; Snv428; Ruo; 50 Tests , Cd25; Clone: B1.49.9; Snv605; Asr; 0.5 Ml , Cd200; Clone: Ox-104; Snv786; Asr; 0.5 Ml , Cd103; Clone: 2G5; Snv786; Asr; 0.5 Ml , Cd31 (Human); Clone: 1F11; Pe; Ruo; 100 Tests , Custom Lucid Anti-Tcrcß1 (Trbc1)-Pe , Custom Lucid Anti-Tcrcß2(Trbc2)-Apc , Duraclone If T Helper Cell; Ruo; 25 Tests , Duraclone Im B Cells Tube, 25 Tests, Ruo , Duraclone Im Count Tube; Ruo; 25 Tests , Duraclone Im Granulocytes Tube; Ruo; 25 Tests , Duraclone Im T Cell Subsets Tube, 25 Tests, Ruo , Duraclone Im Tcrs Tube, 25 Tests, Ruo , Duraclone Im Treg Tube, 25 Tests, Ruo , Duraclone Re Alb Tube; Ruo; 25 Tests , Duraclone Re Clb Tube; Ruo; 25 Tests , Igd (Human); Clone: Ia6-2; Fitc; Ruo; 50 Tests , Igm (Human); Clone: Sa-Da4; Apc; Ruo; 50 Tests , Pkg Control Latron 300Nm , 3300A Psl Spheres .300Um , 4100A Psl Spheres 1.00Um , 3500A Psl Spheres .500Um, 15 Ml , Beads 300Nm Dia Psl , Beads, 1.0?M Dia, Psl , Igd (Human); Clone: Ia6-2; Pe; Ruo; 50 Tests , Cytokeratin Ae1+Ae3 Mouse Monoclonal (Rtu) Fda Approved, Ce Certified , Melanoma (Hmb45) Mouse Monoclonal (Rtu) Fda Approved, Ce Certified , Mart-1 / Melan A103 Mouse Monoclonal (Rtu) Fda Approved, Ce Certified , Sox-10 (Melanoma Marker) Ep268 Mouse Monoclonal (Rtu) Fda Approved, Ce Certified , Specifications For Fitc-Conjugated Antibodies Applications:Immunohistochemistry (Ihc) Fluorescence Microscopy Flow Cytometry Suitability: For Immunofluorescence Staining Of Skin And Renal Biopsies Compatible With Formalin-Fixed, Paraffin-Embedded (Ffpe) Tissue Sections Performance: Bright, Stable Fluorescence Minimal Non-Specific Binding Packaging:Available In 1 Ml And 0.1 Ml Vials Delivery Timeline:Within 2 Weeks From Purchase Order (Po)Certifications:Fda Approved/Ce Certified , Micro Slide Cabinet Made Of Crca Sheet (Powder Coated) For Keeping 75X25mm Slides Individual Slot In Vertical Cap.20000 Slides , Wax Block Cabinet (M.S Sheet) 1X1x1 Block Cabinet And Drawer Are Made Of Mild Sheet Duly Powder Coatedcap 20000 Blocks , Whattman Filter Paper , Humid Chamber , Plastic Slide Folder 1. Holds Upto 20 Standard Microscopic Slides. 2.Recessed Horizanrial Compartments Protect Slides When Folder Is Closed. 3.Thumb Cutout Fore Safe And Easy Slide Removal. 4.Numbered Compartments For Quick Identification. Please Enable Macros To View Boq Information
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 8
Jammu And Kashmir View Result →
2.
Educational and Research Institute #11131817 AOC
Purchase Of Lab Equipments , Lab Equipments , Binocular Microscope- High Quality Objectives,Ergonomic Design, Antifungal Coated Lenses .Head- Binocular Inclined At 30-360 Degree,Rotable,Anti Mould. Eye Piece- Extra Wide Field, Ew 10X/20 With Dipter Adjustment. Objectives-4X,10X,40X(Sl),100Xoil. Magnification-40X-1000X. Nose Piece-Quadraple. Focussing System- Co-Axialcourse, Fineadjustment,13Mm Fine Divoision,0.002Mm With Tension Control And Lockimg Stage. Condensor- Abbe Typena1025 With Iris Diaphram And Filter. Illumination- Hlogen/Led, Brightness Adjustable , Test Tube Borosil ®- 15Ml(15X1.5 Cm) Of 100 Numbers , Test Tube Cleaning Brush-Small Size- 1 Packet Of 100 Nos , Filter Paper Sheet- 3 Packet Of 500 Sheet , Rubber Teats Bulb Type- Medium Size , Centrifuge Tube With Marking Glass Borosil ® , Gas Lighter , Ink Filler With Marking , Measuring Cylinder - 100 Ml , Pipette 1Ml Graduated Borosil , Serological Pipette 0.1 Ml With 0.01 Graduation , Rubber Gloves Surgical 7 Inch , Tips For Micropipette-Size 2-200? (Yellow Tip) , Tips For Micropipette-Size 50- 1000? (Bluetip) , Lancet Needle 31 Guage , Micro Centrifuge Tube (20 Numbers) , Stethescope , Laboratory Centre Hot Plate For Heating Chemical Solutions In Glass Ware , Clinical Thermometer , Surgical Gloves 7.5 Inch(Latex, Sterile, Pre Powdered 25 Pairs Per Packet) , Counting Chamber(Improved Neubar, German Made- The Marked Area Should Be Ina Mercurial Back Ground) , Chrome Plated Percussion Knee Hammer(Thermoplastic Triangular Head With Chrome Plated Handle With A Pointed Tip And Brush) , Lancet (Round Lancet Used In Glucometer Pen 100 Nos Per Packet) , Spirometer Portable Type- Compact , Stethescope, Ordinary, Mechanical-( 70X50x16 Cm) Weight 120 Gm , Syringe With Needle 2 Ml100 Nos Per Packet , Tuning Fork (Set Of 128Hz,256Hz,512 Hz) , Tuning Fork To Test Hearing (32-1000 Hz) As Per Msr , Whatmann No. 1 Filter Paper 90Mm, 100 Nos Per Packet , Torch Battery1.5 V(Clock Battery) , Fine Capillary Tube 200 Nos Per Packet To Test Clotting Time , Heamoglobin Pipette 20? , Heamatocrit Tube (Pcv Tube - Wintrops Graduated) , Cool Chilled Water Jar1l (Double Walled, Stainless Steel Ice Bucket, With Lid And Ice Tong) , Thermoflask 500 Ml( Double Walled, 24 Hour Hot Bolltle Water, Stainless Steel) , Pulseorimeter , Mechanical Rotary Microtome - Designed Forcutting Human And Animal Tissue Embedded In Paraffin-2 Micro & Macro Handles, Specimen Clamp Smooth Running Hand Wheel Including Locking Devices Spaciously Designed Integrated Section Waste Ray Adjustablecutting Angles , Elisa Reader For Serological Test , Diamond Glass Marking Pencil , L Mould (Brass) (50X25x25) , Cassette For Histology Tissue Embeding Cassetes With Dip On Lid And Which Allows Easy Removal , Glass Cylinder - 100 Ml Borosil® - Graduated, Single Metric Scale, With Pour Out And Hexagonal Base , Test Tube Borosil®- A) 6 X1/2 , Test Tube Borosil®- B) 4 X1/2 , Cover Glass - 22X22 Mm/18X18 -(1Boxof 100 Numbers) , Glass Capillary Tubes For Detecting Blood Clotting Time , Portable X- Ray (Led), Illuminator Single , Accucheck Active Blood Glucometer Kit , Peak Expitatory Flow Meter (Sonmol) Electronic , Woods Camp For Skin Care Analyser Dr.Pen , Feeding Tube Silicon-Fr-16 , Iv-Set Non Vested Infusion Pvs , Ambu Bag- Curomed Silicone , Ors Packet , Tracheostomy Tube , Tongue Depressor , Venturi Ask With Valve With Tubing Cruzine , Nasal Canula Adult For Oxygen Therapy , Oxygen Mask Universal Adapter Oxy 99 , Iv Catheter/Canula With Injection Valve And Wings 20G Disposable , Ishihara Test -Chart Book , Snellan Chart , Hand Held Magnifier Iluminated Reading Magnifying Glass , Comparison Microscope , X -Ray View Box Four In One-Led Illumination , Stadiometer For Height Measurement , Measuring Glass /Beaker Dorosilicate 1000 Ml , Volumetric Flask 250Ml , Volumetric Flask 500 Ml , Volumetric Flask , Measuring Jar/Cylinder- 10 Ml , Measuring Jar/Cylinder- 500 Ml , Measuring Jar/Cylinder- 1000 Ml , Tongs For Holding Crucible ( 8 Inch) , Glass Retort- 250 Ml , Glass Phial 30Ml Borosil With Lid , Glass Bottle With 1000Ml , Brown Coloured Glass Bottle - 15 Ml , Brown Coloured Glass Bottle - 30 Ml , Brown Coloured Glass Bottle - 60 Ml , Pill Tile-Glass 15Cmx15cm , China Dish- 7.5 Cm In Diameter , Test Tube Holder Wooden Handle With Stainless Steel Holder , Silica Crucible With Lid 25 Ml , Porcelean Mortar And Pestie 12.5 Cm In Diameter , Iron Mortar And Pedtie 12.5 Cm In Diameter , Water Bath - 6 Holes , Student Type Compound Microscope , Tlc With Uv Chamber , Ph Meter , Analogue Stop Watch , Water Still (Distilled Water Plant) 4 L , Spectroscope Basic Model , Electric Triturator , Needle Holder , Toothedforceps , Non Toothed Forceps , Mayos Scissors , Towel Clip , Foleys Catheter
Contract Date: May 21, 2026 Contract Value : 4.69 Lakh
Boards / Undertakings / PSU No of Bidders 8
Contract Date: Ref. Documents Contract Value : 17.85 Lakh
Government Departments No of Bidders 3
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 3
Himachal Pradesh View Result →
6.
Educational and Research Institute #9302684 Technical Bid
Supply Of Chemical Glass Ware Lab Ware Regents Kit Etc , Isopropyl Alcohol 5 Lt Bottle , Papanicolau O.G.6 125 Mlbottle , Papanicolau E.A 36 125 Mlbottle , Papanicolau E.A 65 125 Mlbottle , May.Grunwald Stain (Mgg) 100 Mlbottle , Giemsa Staining 100 Mlbottle , H2so4 (Sulphuric Acid) 500 Mlbottle , Methanol 500 Mlbottle , Diethy Ethyl Ether L.R 500 Mlbottle , Leishman’S Stain Solution (Cytochrome) 500 Mlbottle , Tincture Benzoin 100 Mlbottle , Semen Diluting Fluid 200 Ml Bottle , Platelet Diluting Fluid 50 Mlbottle , Chloroform 05Ltbottle , Wbc Diluting Fluid 500 Ml Bottle , Rbc Diluting Fluid 500 Mlbottle , N/ 10 Hcl 1000Ml Bottle , Formaldehyde 5 Ltbottle , Xylene 2.5Ltbottle , Conc. Hcl(Hydrochloric Acid) 500Ml Bottle , Liquid Ammonia 500Ml Bottle , D.P.X. 250 Ml Bottle , Conc.Nitric Acid 500Mlbottle , Glycerine 500 Ml Bottle , Glycerine 1000 Ml Bottle , Liquid Paraffin 500 Ml Bottle , Na Oh(Sodium Hydroxide) 500 Ml Bottle , Poly-L Lysine Solution 100 Ml Bottle , Citric Acid (Anhydrous Pure) 1000 Ml Bottle , H 2 O2(Hydrogen Peroxide) 1000 Mlbottle , Deionized Water 5 Lt. Bottle , Schiffsreagent 500 Ml Bottle , Bendictreagent 500 Ml , Drabkinssolution 5Lit , Fouchet’S Reagent 200 Ml , Ehrlich Reagent 200 Ml , Methylene Blue Stain 125Mlbottle , A.F.Bstain Kit , Carbolfuchsin Stain 125Mlbottle , Reticulocytestain(Biolab) 01 Packet , Acetone 500 Mlbottle , Sodium Hypo Chloride 5 Ltr Bottle , Spirit 5Ltr Bottle , Glucose God- Pod Kit 500 Ml , Glacial Acetic Acid 500Ml Bottle , Hematoxylin Stain Powder(Sd Fine) 25Gm/ 5 Gmpacket , Eosin Powder (Water Soluble) 25Gm Packet , Aluminum Potassium Sulphate500 Gmpacket , Mercuric Oxide Red 500 Gm Packet , Wax 600-620 500Gmpacket , Albumin Powder 500 Gmpacket , Periodic Acid 25 Gmpacket , Mercuric Oxide 25Gmpacket , Dextrose (Anhydrous) 500 Gm Packet , Sulphur Powder100 Gm , Barium Chloridepowder500 Gm , Ammonium Sulphate500 Gm , Sodium Sulphate 500 Gm , Sulphosalicylicacid 500 Gm , Gentian Violet100 Gm , Tris Buffer (Sd Fine) 500 Gmpacket , Edta 100 Gmpacket , Low Profiledisposablemicrotome Blade For Cutting Tissue Section , Urinestrip( Distix) Packet (1X100 Strips) , Phosphotungisticacid 100 Gmpacket , Brilliant Crystalblue Stain 100 Gm , Plastictissue Embedding Cassettes Packet(1X1000 Pieces) , Oxalic Acid 500 Gm , Ferric Chloride 500 Gm , Sodium Thio Sulphate 500 Gm , Potassium Ferrocyanide 500 Gm , Sodium Chloride 500 Gm , Sodium Nitroprusside 500 Gm , Orthotoludine Reagent 500 Gm , Benzidinepowder 25 Gm , Diamino Benzidine 25 Gm Powder , Total Protein Kit , Albumin Kit , Serum Creatinine Kit , Serum Urea Kit , Serumsgot Kit , Serum Sgpt Kit , Directs.Bilirubinkit , Serumcalcium Kit , Serumalkalinephosphate Kit , Serumcholesterol Kit , Serumtriglyceride Kit , Serum Hdl Cholesterol Kit , Serumuric Acid Kit , Tpo(Thyroid Peroxidase Antibody) 6 Ml Vial , Mouse/Rabbit Specific Polymer Hrp- Dab Ihc Detection Kit 15 Ml Vial , Desminantibody (Ihc) 6 Ml Vial , Vimentin Antibody (Ihc) 6Ml Vial , Estrogen Receptor Antibody (Er) 6Ml Vial , Anti-Progesterone Receptor Antibody 6Ml Vial , Anti S-100 Antibody 6Ml Vial , Anti Human Her2/Neu Antibody 6Ml Vial , Anti Human Cytokeratin(Pan) Antibody Cocktail 6Ml Vial , Anti Melanoma Antibody( Anti Hmb45 Antibody) 6Ml Vial , Anti Neuron Specific Enolase (Nse) Antibody 6Ml Vial , Anti Cd45 Antibody 6Ml Vial , Anti Hpv-16 Antibody 6Ml Vial , Anti Cd20 Antibody 6Ml Vial , Anti Cd15 Antibody 6Ml Vial , Anti Cd30 Antibody 6Ml Vial , Antibody (Anti C –Kit) 6Ml Vial , Myeloperoxidase Reagent 6Ml Vial , Anti Ki 67 Antibody6ml Vial , Antiecadherin Antibody 6Ml Vial , Anticd- 34 Antibody 6Ml Vial , Anti P-63 Antibody 6Ml Vial , Antip-53 Antibody 6Ml Vial , Anti Smoothmuscle Actin Antibody 6Ml Vial , Anti Ck -6 Antibody 6Ml Vial , Anti Ck -17 Antibody 6Ml Vial , Anti Cd-68 Antibody 6Ml Vial , Whatman Filter Papersheet , Coplin Jar (Plastic) 01Piece , Tuff’S Jar (Glass) Piece , K3 Edta Vacutainar 1 X100 , Plain Vacutainar 1 X100 , Riya Vial( Plastic) 1 X100 , Test Tube Stand(Plastic) Piece , Test Tube Holder Piece , Plastic Beaker 25Ml Piece , Plastic Beaker 100Ml Piece , Semen Collection Container 20 Ml (1X50) Packet , Urine Sample Container 50 Ml (1X50) Packet , Micro Tips Pippt(200- 1000 Ul) , Micro Tips Pippt (20- 200 Ul) , Sprit Lamp 50Ml Piece , Plastic Dropper Piece , Pipettebulb Piece , Glass Testtube 7Ml,Piece , Glass Testtube 10Ml,Piece , Glass Testtube20ml Piece , Glass Slide (Blue Star) Packet , Cover Slip (Blue Star) Packet , Neubauer Chamberpiece , Glass Pipette 5 Ml 20 Micro Lit Piece , Glass Pipette 10 Ml 20 Micro Lit Piece , Glass Pipette 1 Ml 20 Micro Lit Piece , Micropipette 10Microlitre Fix Piece , Micro Pipette 100Microlitre Fix Piece , Micro Pipette(5-50)Microlitrevariablepiece , Micro Pipette 20 Microlitre Fix Piece , Micro Pipette 1000 Microlitrefixpiece , Micro Pipette50 Microlitrefixpiece , Wintrobe Esr Tube With Stand Piece , Westergreen Esrpipette With Stand Piece , Pricking Needileno 23 (1 X100) Packet , Pricking Needileno 24 (1 X100) Packet , Pricking Needileno 21 (1 X100) Packet , Pricking Needileno 20 (1 X100) Packet , Surgicaltray 6X8 “ Inch (Rectangular) Piece , Microscopicslide Tray (Aluminium) Holding Capacity20 (3X1”Inch)Piece , Bone Marrow Aspiration Needle16 No Piece , Bone Marrow Aspiration Needle18 Nopiece , L P Needle Piece , Histology Tissue Base Mold (Steel ) Piece , Bone Marrow Biopsy Needle(Trephinebiopsy) Piece , Glass Rodpiece , Ph Paper Strip (5.0-7.5) Booklet(1X20 Strips) , Ph Paper Strip (2.0-10.5) Booklet(1X20 Strips) , Lens Cleaningpaperbooklet (9Cmx14.5Cm,100 Leaves) , Museum Mounting Jar(With Cover) (10Cm X 5Cmx 20Cm) , Museum Mounting Jar(With Cover) (15Cm X 10Cmx 25Cm) , Museum Mounting Jar(With Cover) (16.2Cm X 6Cmx 18Cm) , Museum Mounting Jar(With Cover) (12Cm X 10Cmx 20Cm) , Museum Mounting Jar(With Cover) (12Cm X 12Cmx 20Cm) , Museum Mounting Jar(With Cover) (17Cm X 8Cmx 18Cm) , Museum Mounting Jar(With Cover) (5.5Cm X 5Cmx 10Cm) , Museum Mounting Jar(With Cover) (17Cm X 9.5Cmx 30Cm) , Museum Mounting Jar(With Cover) (28Cm X 24Cmx 29Cm) , Museum Mounting Jar(With Cover) (21Cm X 19Cmx 27Cm) , Museum Mounting Jar(With Cover) (11Cm X 25Cmx 24Cm) , Hiv Rapid Tridotkit , Hbsag Immunoassay Rapid Kit , Hcv Rapidkit,(Fourth Generation Immunoassay For Core,Ns3,Ns4,Ns5) , Rdt Formprapidkit (Immunochromatographic Kit For Pf/Pan Antigen) , Vdrl Rapid Immunoassay Kit , Typhoidrapidkit (Igg,Igm) , Filaria Rapid Ag Card Test , H3n2 Rtpcr Kit , Zika Virus Rtpcr Kit , Dengue Rapidkit (Immunochromatographic Assay For Ns1,Igg ,Igm) , Plain Vial5 Ml Vial , Abo Rh Anti Sera10 Ml Packet , Ppd Vial 5 Ml Vial , Sodium Citrate Vial 5 Ml Vial , Capillary Tube Piece , A.H.G. 5Ml , Anti A1 Lectin 5Ml , Anti H Lectin 5Ml , Anti D (Igm + Igg Monoclonal) 10Ml , Pt 5Ml , Aptt 3Ml , Calcium Chloride 10Ml , Bovine Albumin 5Ml , Hiv Rapid Kit 4Th Generation , Hiv Rapid Kit 3Th Generation , Hcv Rapidkit,3Th Generation , Hbaag Rapid Kit 4Th Generation , Hbaag Rapid Kit 3Th Generation , Hiv Elisa Kit 4Th Generation , Hcv Elisa Kit 4Th Generation , Hcv Elisa Kit 3Th Generation , Hbaag Elisa Kit 4Th Generation , Hbaag Elisa Kit 3Th Generation , Troniquete , Micro Pipette 10 Ul Fix , Micro Pipette 50 Ul Fix , Micro Pipette 25 Ul Fix , Micro Pipette 100 Ul Fix , Micro Pipette 1000 Ul Fix , Micro Pipette 100-1000 Ul Variable , Micro Pipette 10-100 Ul Variable , Micro Pipette 0-10 Ul Variable , Micro Pipette 20-200 Ul Variable , Micro Pipette Stand (Big) Plastic Make , Micro Pipette Stand (Small) Plastic Make , Transfer Bag Of 300Ml , Double Bag 350Ml With Sagm And Diversion Pouch (With Luer Adapter) , Tripal Blood Bag 350Ml With Sagm And Diversion Pouch (With Luer Adapter) , Leucodepltion Blood Bag 350Ml (Inline Top And Top) , Leucodepltion Blood Bag 350Ml (Lab Side) , Pregnancy Kit Test , Cappilary Tub , Swab Stick , Benedict Reagent Quanitateive 500 Ml , Benedict Reagent Qualitateive 500 Ml , Sulphar Powder 500 Gm , Occult Blood Powder 100Gm , Hydrozen Peroxide 500Ml , Egg Albumin 500Gm , Sulphuric Acid 1000Ml , Sodium Hydroxide 500Gm , Copper Sulphate 500Gm , Picric Acid 500Ml , Arcino Molibate 500Ml , Phaspho Tungstic Acid 500Gm , Sodium Carbonate 500Gm , Nitric Acid 500Ml , Silver Nitrate 25Gm , Hydrochloric Acid 500Ml , Taffers Reagent 250Ml , Bromo Cresol Green Reagent Box , Urea Kit , Protein Kit , Cholesterol Kit , Pipette 1Ml , Pipette 2Ml , Test Tub , Burette With Tip , Burette Stopper , Burette Stand , Filter Paper , Mesauring Cylinder 50Ml , Beaker 250Ml , Beaker 500Ml , Round Bottle Flask 200Ml , Conical Flask 200Ml , Urin Jar Plastic , Funnel Plastic , Cuvette Colouimeton , Dispenser Bottle , Amikacin 30 Mcg / Disc , 100 Disc / Vial , Amoxicillin Clavulanic Acid 20/10 Mcg/ Disc , 100 Disc / Vial , Cefoperazone75 Mcg / Disc , 100 Disc / Vial , Ceftriaxone 30 Mcg / Disc , 100 Disc / Vial , Nitrofurantoin 300 Mcg/ Disc , 100 Disc / Vial , Ceftazidime /Avibacatam 30/10 Mcg / Disc , 100 Disc / Vial , Ofloxacin 5 Mcg/ Disc , 100 Disc / Vial , Ceftazidime /Clavulanic Acid 30/10 Mcg / Disc , 100 Disc / Vial , Ciprofloxacin 5 Mcg / Disc , 100 Disc / Vial , Ertapenem 10 Mcg/ Disc , 100 Disc / Vial , Gentamicin 10 Mcg / Disc , 100 Disc / Vial , Imipenem 10 Mcg / Disc , 100 Disc / Vial , Levofloxacin 5 Mcg / Disc , 100 Disc / Vial , Meropenem 10 Mcg / Disc , 100 Disc / Vial , Moxifloxacin 5 Mcg / Disc , 100 Disc / Vial , Prulifloxacin 5 Mcg / Disc , 100 Disc / Vial , Vancomycin 30 Mcg / Disc , 100 Disc / Vial , Azithromycin 15 Mcg / Disc , 100 Disc / Vial , Erythromycin 15 Mcg / Disc , 100 Disc / Vial , Chloramphenicol 30 Mcg / Disc , 100 Disc / Vial , Piperacillin/Tazobactam 100/10 Mcg / Disc , 100 Disc / Vial , Tobramycin 10 Mcg / Disc , 100 Disc / Vial , Tetracycline 30 Mcg / Disc , 100 Disc / Vial , Cefotaxime 30 Mcg / Disc , 100 Disc / Vial , Fluconazole 10 Mcg / Disc , 100 Disc / Vial , Amphotericin B 100 Units / Disc , 100 Disc / Vial , Itraconazole 30 Mcg / Disc , 100 Disc / Vial , Nystatin 100 Units / Disc , 100 Disc / Vial , Voriconazole 1Mcg / Disc , 100 Disc / Vial , Co-Trimoxazole 25 Mcg/ Disc , 100 Disc / Vial , Clindamycin 2 Mcg/ Disc , 100 Disc / Vial , Teicoplanin 30 Mcg/ Disc , 100 Disc / Vial , Cefdinir 5 Mcg / Disc , 100 Disc / Vial , Cefpirome 30 Mcg / Disc , 100 Disc / Vial , Imipenem –Cilastin 10 Mcg / Disc , 100 Disc / Vial , Ampicillin 2 Mcg / Disc , 100 Disc / Vial , Ampicillin + Sulbactam 6 Mcg / Disc , 100 Disc / Vial , Polymyxin-B 100 Unit / Disc , 100 Disc / Vial , Bacitracin 8 Unit / Disc , 100 Disc / Vial , Cefoxitin 20 Mcg / Disc , 100 Disc / Vial , Linezolid 30 Mcg / Disc , 100 Disc / Vial , Gentamicin (High) 50 Mcg / Disc , 100 Disc / Vial , Faropenem 5 Mcg / Disc , 100 Disc / Vial , Doxycycline 10 Mcg / Disc , 100 Disc / Vial , Aztreonam 50 Mcg / Disc , 100 Disc / Vial , Fosfomycin 50 Mcg / Disc , 100 Disc / Vial , Novobiocin 30 Mcg / Disc , 100 Disc / Vial , Optochin 5 Mcg / Disc , 100 Disc / Vial , Cefuroxime 30 Mcg / Disc , 100 Disc / Vial , Minocyline 30 Mcg / Disc , 100 Disc / Vial , Nalidixicacid 30 Mcg / Disc , 100 Disc / Vial , Norfloxacin 10 Mcg / Disc , 100 Disc / Vial , Tigecycline 15 Mcg / Disc , 100 Disc / Vial , Clarithromycin 15 Mcg / Disc , 100 Disc / Vial , Ketoconazole 30 Mcg / Disc , 100 Disc / Vial , Vancomycin (E Test Strip) 0.5 – 32 Mcg/Ml , Cefepime/Cefepime+Clavulanic Acid (E Test Strip) Cefepime (0.25-16Mcg)/Cefepime+Clavulanic Acid (0.064-4 Mcg) , Imipenem And Imipenem + Edta(E Test Strip) Imipenem (4-256 Mcg) And Imipenem+ Edta (1-64 Mcg) , Macconkey Agar 500G / Bottle , Muller-Hinton-Agar 500G / Bottle , Chrome Universal Agar 500G / Bottle , Lugol’S Iodine 125 Ml/Bottle , Urea Agar Base 100G / Bottle , Simmons Citrate Agar 100G / Bottle , Triple Sugar Iron Agar 100G / Bottle , Blood Agar Base 500G / Bottle , Robertson Cooked Meat Media 500G / Bottle , Sucrose 500G / Bottle , Lactose (Lr) 500G / Bottle , Mannitol (C6h14c6) 500G / Bottle , Peptone, 500G / Bottle , Dextrose Anhydrous(C6h12o6) 500G / Bottle , Bile Esculin Reagent/Agar 500G / Bottle , Methylene Blue For Zn Stain 500Ml / Bottle , Carbol Fuchsin For Zn Stain 500Ml / Bottle , Giemsa Stain 500Ml / Bottle , Periodic Acid Schiff Stain 500Ml / Bottle , Safranine For Zn Stain 500Ml / Bottle , Gentian Violet(Crystal) 100G / Bottle , Phenol (C6h5oh) (Crystal) 500G / Bottle , Methyl Red Reagent 500G / Bottle , Phenyl Pyruvic Acid(Ppa Test) 100G / Bottle , Prepared Oxidase Disc 50 Disc/ Box , Iodine (Crystal)100G / Bottle , Tri-Sodium Citrate ( Na3c6h5o72h2o) 500G / Bottle , Citric Acid (C6h8o7) 500G / Bottle , Kovac’S Indole Reagent 100Ml / Bottle , 40 % Urea (Nh2conh7) 500G / Bottle , Antibiotic Zone Scale 1Pc/Box , Antisera-Salmonella O And H A,2 Ml / Vial , Antisera-Shigella Dysenteriae, 2 Ml / Vial , Antisera-Shigella Flexnari, 2 Ml / Vial , Antisera-Shiegella Sonnie,2 Ml / Vial , Antisera-Vibrio Cholera O139 ,2 Ml / Vial , Atcc Strain - E.Coli 25922,Freeze Dried Lyophilized / Vial , Atcc Strain - E.Coli 35218, Freeze Dried Lyophilized / Vial , Atcc Strain - Pseudomonas Aeruginosa 27853 Freeze Dried Lyophilized / Vial , Atcc Strain - Staphylococcus Aureus 25923 Freeze Dried Lyophilized / Vial , Atcc Strain - Staphylococcus Aureus 29213 Freeze Dried Lyophilized / Vial , Mounted Peripheral Blood Smear Slides For Gametocytes Of Plasmodium Vivax And Falciparum,(1 – Slide) , Potassium Permagnate (Kmno4) 500G / Bottle , Formalin (20%) 500Ml / Bottle , Methanol (Ch3oh) 500Ml / Bottle , Acetone (Lr) (Reagent ) 500Ml / Bottle , 100 % Sulphuric Acid (H2so4) 500Ml / Bottle , Gram’S Iodine 500Ml / Bottle , Boric Acid500g / Bottle , Di- Sodium Hydrogen Ortho-Phosphate500g / Bottle , Formaldehydesolution (37-41)%1000Ml / Bottle , Potassium Iodide (Ki) 500G / Bottle , Hydrogen Peroxide Solution(H2o2) 6%1000Ml / Bottle , Sodium Hydroxide Pellets Purified (Naoh) 500G / Bottle , Potassiumhydroxide Pellets (Koh) 500G / Bottle , Sodium Chloride (Nacl) 500G / Bottle , Amyl Alcohol ( C5h11oh)500Ml / Bottle , Xylene Sulphur 500Ml / Bottle , 70 % Isopropyl Alcohol 500Ml / Bottle , Normal Saline 500Ml / Bottle , Digital Weighing Balance 2Kg/ Machine , Test Tube (Glass 7Ml) 100Pc/ Pkt , Sterile Swab Stick, 100Pc/Pkt , Test Tube Holder (Small)10Pc/Box , Test Tube Holder (Large)10Pc/Box , Petri Disk 90X90 (10Pc/Pkt) , Petri Disk 90X120, (10Pc/Pkt) , Stock Vial (50Pc/Pkt) , Sterile Disposable Square Petri Plates (10Pc/Pkt) , Viral Transport Medium (3Ml/Vial) , Kovac’S Indole Reagent 100 Ml/ Bottle , Centrifuge Tubes 50Ml (Glass) 100Pc/Box , Centrifuge Tubes 15Ml (Glass) (Consumable)100Pc/Box , Erlenmeyer Flask (1000Ml) (Consumable) 1Pc , Microtube Rack (5X16 Holes) Per Rack , Wash Bottle Capacity 500Ml/Pc , Sterile Disposable Forceps (10Pc/Pack) , Steam Indicator Tape Size 18Mm (1-Pc) , Autoclavable Dispo Bag “14” (50/Pack) , Indicator Ph Paper(Ph 5 To 7.5)(5 Bundle / Pack) , Permanent Marker Pen (Red/Black) (Narrow Tip) (1-Pc) , Homogeniser With Serrated Pestle S.P 10Ml (1-Pc) , Nichrome Loop 4Mm, Double Wound (10Pc/Pack) , Nichrome Loop 2Mm, Double Wound (10Pc/Pack) , Semisolid Imrv Medium And Selective Supplement Fd19 -2Vl, 500Gm/Bottle , Sample Discarding Jar 3L Capacity (Borosil) (1-Pc) , Sample Discarding Jar 5L Capacity (Borosil) (1-Pc) , Conical Flask500ml Capacity(Borosil) (1-Pc) , Kala-Azar Detection Rapid Test (25Kit/Box) , Blood Culture Bottle/Bhi (Paediatric) 20Ml Capacity (10Pc/Box) , Blood Culture Bottle /Bhi(Adult) 70Ml Capacity (10Pc/Box) , India Ink Reagent (Nigrosin Stain 10% W/V (100 Ml) And Methylene Blue (125Ml/Bottle) , Scrub Typhus Igm Elisa 96Well Test Kit/Box , Chikungunya Igm Elisa 96Well Test Kit/Box , Je Igm Capture Elisa 96Well Test Kit/Box , Dengue Igm Elisa 96Well Testkit/Box , Dengue Ns-1 Ag Elisa 96Well Test Kit/Box , Cryptococcal Ag Rapid Test (25Kit/Box) , L J Medium Slant 10 Slant/Pack , Capped Collection Tube 1.5Ml Capacity (50Pc/Box) , Microamp Optical Tube 8/Strips (0.2 Ml Capacity) , Microamp Optical 8 Cap Strips (0.2 Ml) , Micro Centrifuge Tube 1.5Ml Capacity (500Pc/Box) , Serological Pipette 10Ml (200Pc/Box) , Serological Pipette 5Ml (250Pc/Box) , Art Barrier Specialty Pipettetips 100-1000?L Racked(96X1 Box) , Art Barrier Specialty Pipette Tips 20-200?L Racked (96X1 Box) , Art Barrier Specialty Pipette Tips 2-20?L Racked (96X1 Box) , Art Barrier Specialty Pipette Tips 50?L Racked (96X1 Box) , Art Barrier Specialty Pipette Tips 0-10?L Racked (96X1 Box) , Safeskin Purple Nitrile Gloves (Medium) 100/Box , N95 Particulate Respirator (Niosh Approved) 1Pc , Kimwipes 37.33X42.16 Cmn (140/Box) , Cryo Vial Sterile 1.8Ml (25Vial/Pkt) , Cryo Box 1.8Ml (9X9 Wells)(1 X 4 / Box) , Fg-Optical Adhesive Covers For Pcr, 1Pc , Microamp Optical 96-Well Reaction Plate(0.2Ml),(1- Plate) , Zip Lock Bag 21.3X18cm (10Bag/Box) , 96 Well Pcr Plate, (1- Plate) , Falcon Tube 10Ml (1Pc) , Falcon Tube50ml (1Pc) , Dacron Swab Stick (Nylon Flocked) (100Pc/Box) , Polypropylene Trigger Sprayers (500Ml), 1Pc , Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( Size 11 X 8 Inch),1Pc , Paraffin Film (M) (1-Roll) , Red Cap Tube 3Ml (1-Pc) , Aluminum Foil (72 Meter) (1-Pc) , Isopropanol 99.9%(500Ml/Bottle) , Spirit Surgical Grade (1Lt/Bottle) , Spirit Absolute (40 Lt/Gallon) , Hypochlorite Soln (5%/4.6%) (1Lt/Bottle) , Sterilium Hand Rub ( 500Ml/Bottle) , Liquid Hand Wash (750Ml/Pack) , Blotting Paper (1-Sheet) , Tourniquets For Blood Collection (1-Pc) , Loose Gloves M (7/7.5)(100/Box) , Surgical Gloves M (7/7.5),(1-Pc) , 3 Ply Surgical Mask , (1-Pc) , Surgical Head Cap, (1-Pc) , Face/Protective Shield , (1-Pc) , Bleaching Powder (25Kg/Bag) , Protective Goggles (1-Pc) , Rna Extraction Kit(1-Rxn) , Rna Zap Water 200Ml /Bottle , Ethanol Absolute Molecular Grade(500Ml/Bottle) , Thermacol Transport Box (18Cm X 12 Cm) (500Pc/Bag) , Tissue Paper (Toilet Paper Roll)(9Pc/Pack) , Labeling Stickers Sheets(St-65A4) (100Sheets/Pack) , Disposable Tongue Depressor (Spatula) (100Pc/Pack) , Nuclease Free Water (Molecular Grade) 1000Ml/Pack , Glucose Strip , Taqpath Multiplex Rt Pcr Kit For The Detection Sars Cov-2 1000 Rxn , Taqman Sequence Detection (Primer + Probe) For Screening (E Gene & Rnp) And Confirmatory (Rdrp, & Hku Orf Ib) , Seegene Allplex 2019-Ncov Assay R , Mylab Patho Detect Covid-19 Qualitative Pcr Kit , A*Star Fortitued Kit 2.0 Covid-19 Rt-Pcr Test , Pandemic H1n109 Assay Set 1000 Rxn , Super Script Iii Platinum Qrt Pcr Reagent 5 Rxn , Agpath One Step Rt Pcr Reagent , Labgun Covid-19 Rt Pcr Kit , Bgi Rt Pcr Kit For Detection Sars Cov-2 , 1-Napthol 200 Gm , 2,4-Dinitrophenyl Hydrazine 300 Gm , 2-Amino Diphenyl Oxalic Acid 500 Gm , 2-Chloro-2H-Azirine 500 Gm , 2-Napthol 250 Gm , 3,5- Dinitrosalicylic Acid 500 Gm , 8-Hydroxy Quinoline 250 Gm , Absolute Ethanol 10 Lit , Acacia 500 Gm , Acetaldehyde 500 Ml , Acetamide 500 Gm , Acetanilide 1 Kg , Acetic Acid 10 Lit , Acetic Anhydride 2.5 Lit. , Acetone 05 Lit , Acetonitrile 05 Lit , Acetophenone 500Ml , Acetyl Acetone 1 Lit , Acetylcholine Iodide 5Gm , Activated Charcoal 1Kg , Nutrient Agar 500Gm , Alcohol /Spirit 25Lit , Almond Oil 1Lit , Aloe Vera Gel 1Kg , Alpha-Amylase 100Gm , Alpha-Napthol 250Gm , Aluminium Chloride 1Kg , Aluminium Hydroxide 500Gm , Aluminium Sulphate 500Gm , Amaranth Red 100Gm , Amino Acid Kit , Ammonia 10 Lit , Ammonium Acetate 1Kg , Ammonium Bicarbonate 500Gm , Ammonium Carbonate 1Kg , Ammonium Chloride 1Kg , Ammonium Citrate (Tri) 500Gm , Ammonium Hydroxide 1Kg , Ammonium Molybdate 500Gm , Ammonium Nitrate 1Kg , Ammonium Oxalate 500Gm , Ammonium Reineckate 1Kg , Ammonium Sulphate 1Kg , Amyloglucosidase 50Ml , Anhydrous Sodium Sulfite 1Kg , Aniline 5Lit , Aniline Acetate 500Gm , Anthranilic Acid 250Gm , Apple Essence 50Ml , Arachis Oil 500Ml , Arsenic Trioxide 500Gm , Ascorbic Acid 500Gm , Ashwagandha 500Gm , Aspartic Acid 100Gm , Aspirin 1Kg , Atropine Sulphate 10Ml , Atropine Sulphate 25Gm , Bahera 1Kg , Barfoed’S Reagent 1Lit , Barium Chloride 1Kg , Barium Sulphate 500Gm , Bay Leaf 500Gm , Beef Extract 500Gm , Beeswax 2Kg , Belladonna Leaf Dry 500Gm , Benedict’S Reagent 1 Lit , Bentonite Powder 1Kg , Benzaldehyde 5 Lit , Benzamide 1Kg , Benzene 2.5 Lit , Benzidine 500 Gm , Benzil 1Kg , Benzoic Acid 5Kg , Benzoic Anhydride 500Gm , Benzoin 500Gm , Benzothiazole 250Gm , Benzoyl Chloride 4 Lit , Benzyl Alcohol 2.5 Lit , Benzylpenicillin 250Gm , Bial’S Reagent 1Lit , Blood Group Test Kit (10 Ml Anti A,B & D) , Borax 1Kg , Boric Acid 500Gm , Bovine Serum Albumin 10Gm , Bramhi 500Gm , Brilliant Blue 5Gm , Bromine 500Ml , Bromocresol Green Solution 250Ml , Butanol 2.5 Lit , Butyl Isocyanate 500 Gm , Cadmium Sulfate 5Gm , Caffeine 500Gm , Calamine 1Kg , Calcium Chloride Anhydrous 2.5Kg , Calcium Gluconate 500Gm , Calcium Hydroxide 5Kg , Camphor 250Gm , Carbolfuchsin 100Gm , Carbon Tetrachloride 2.5 Lit , Cardamom 250 Gm , Carrageenan 500Gm , Castor Oil 2.5 Lit , Catechol 500Gm , Cellulose Acetate Hydrogen Phthalate 500Gm , Ceric Ammonium Sulphate 500Gm , Cetyl Alcohol 500Gm , Chandan Powder 500Gm , Charcoal500gm , Chloral Hydrate 500Gm , Chloroform 10 Lit , Chloroquine Powder250gm , Chlorosulfonic Acid1 Lit , Chlorpheniramine Maleate Powder 250Gm , Chlorpromazine 250Gm , Cinchona 500 Gm , Cinnamic Acid 250 Gm , Cinnamon 500 Gm , Citric Acid 500 Gm , Clove 500 Gm , Cobalt Chloride 500 Gm , Cocoa Butter 200 Gm , Codeine Phosphate 50 Gm , Compound Tartrazine Solution 100Gm , Copper (Ii) Acetate 2.5Kg , Copper (Ii) Oxide 1Kg , Copper (Ii) Sulphate 1Kg , Copper (Metal) Turning 500Gm , Copper Sulfate 1Kg , Coriander 500Gm , Corn Oil 500Ml , Corn Starch 500Gm , Creatinine 100Gm , Crystal Violet 500Ml , Cupric Acetate 500Gm , Dapsone Powder 250Gm , Dextrin 500Gm , Dextrose 1Kg , Dichloro Methane 5Lit , Diethyl Ether10lit , Diethylmalonate500ml , Dioscorea 250Gm , Diphenylamine 500Gm , Disodium Edta 500Gm , Disodium Phosphate Heptahydrate 1Kg , Dmso 5Lit , Dragendroff’S Reagent 1Lit , Ephedra 500Gm , Eriochrome Black T (Solochrome Black T) 25Gm , Ethanol 10Lit , Ethyl Acetate 5Lit , Ethyl Acetoacetate5lit , Ethyl Benzoate 500Ml , Ethyl Cellulose500gm , Ethylene Diamine Tetra Acetic Acid (Edta) 2Kg , Eucalyptus Oil 500Ml , Eudragit 500Gm , Fehling’S Solution A 2Lit , Fehling’S Solution B 2Lit , Ferric Ammonium Sulphate 1Kg , Ferric Chloride 500Gm , Ferric Chloride 1Kg , Ferrous Sulphate 500Gm , Formaldehyde 5Lit , Formic Acid 5Lit , Fructose 1Kg , Furosemide 25Gm , Gelatin 1Kg , Glacial Acetic Acid 5Lit , Glucose 1Kg , Glycine 1Kg , Glycine 100Gm , Glyoxalic Acid 1Lit , Granulated Zinc 500Gm , Gum Trgacanth Powder 1Kg , Hagers Reagent 1Lit , Harde 500Gm , Histamine 25Gm , Honey 1Kg , Hydrazine Hydrate 2.5 Lit , Hydrochloric Acid 10Lit , Hydrogen Peroxide 1 Lit , Hydroxy Napthol Blue 25Gm , Hydroxy Propyl Methyl Cellulose 500Gm , Hydroxylamine Hydrochloride 500Gm , Ibuprofen Powder 500Gm , Iodine 500Gm , Iron Oxide 500Gm , Isabgol 1Kg , Iso Propanolol 2.5 Lit , Isoniazid Powder 250Gm , Jatamansi 500Gm , Kaolin 500Gm , Lactose 1Kg , Lanolin 1Kg , Lead Acetate 1Kg , Lead Nitrate 500Gm , Lead Subacetate 2Lit , Leishman Reagent In Methanol 25Gm , Lemon Essential Oil 250Ml , Leucine 25Gm , Light Magnesium Oxide 500Gm , Light Mineral Oil5lit , Light Petroleum Ether (40 -600) 2.5 Lit , Liquid Paraffin (Heavy) 500Ml , Liquid Paraffin (Light) 500Ml , Liquorice 500Gm , Long Pepper 500Gm , Lwinoff’S Reagent 1 Lit , Magnesium Chloride 1Kg , Magnesium Hydroxide 500Gm , Magnesium Stearate 2Kg , Magnesium Sulfate 2Kg , Magnesium Turning 250Gm , Malonic Acid 1Kg , Maltose 1Kg , Mayer’S Reagent 1Lit , Menthol 500Gm , Mercuric Chloride 50Gm , Mercurous Nitrate 25Gm , Metaphosphoric Acid 1Kg , Methanol 10 Lit , Methi 500Gm , Methyl Blue 25Gm , Methyl Cellulose 500Gm , Methyl Ethyl Ketone 1 Lit , Methyl Orange 100Gm , Methyl Orange Indicator 250Ml , Methyl Paraben 500Gm , Methyl Red 25Gm , Methyl Red 500Ml , Methyl Salicylate 500Ml , Methylene Blue500 Ml , Methylene Chloride 2.5 Lit , Metol Solution 100 Ml , Metronidazole Powder 250 Gm , Microcrystalline Cellulose 1Kg , Millon’S Reagent 1 Lit. , Mineral Oil 500 Ml , Molisch Reagent 100 Ml , Monosodium Phosphate 1 Kg , Morpholino Propane Sulphonic Acid (Mops) 25 Gm , Nagkeshara 500 Gm , Napthol Blue 25 Gm , Napthoquinone100 Gm , N-Hexane 5 Lit , Ninhydrin 100 Gm , Nitric Acid 10 Lit , N-Phenylanthranilic Acid (Ferroin Sulphate) 100 Ml , O-Cresol 500 Ml , Octanol 2.5 Lit , Oil Of Anise 30 Ml , Olive Oil 1 Lit , O-Phenylenediamine 250 Gm , Orange Oil 500 Ml , Orthophosphoric Acid 2.5 Lit , Osmic Acid 500 Gm , Oxalic Acid 500 Gm , O-Xylene 500 Ml , P-Aminobenzoic Acid 1 Kg , Para Amino Benzoic Acid (Paba) 250 Gm , Paracetamol Powder 500 Gm , Paraffin Liquid Heavy5 Lit. , Paraffin Liquid Light5 Lit. , P-Benzoquinone100 Gm , P-Chloromercuribenzoic Acid 1 Kg , Peg 200 2.5 Lit , Peg 3350 500 Gm , Peg 400 500 Ml , Peg 400 2.5 Lit , Peg 6000 500 Gm , Peptone Soya 500 Gm , Perchloric Acid 2.5 Lit , Petroleum Ether 5 Lit , Phenobarbitone 10 Gm , Phenol 1 Kg , Phenophthaline Indicator , Phenyl Hydrazine Hydrochloride 500 Gm , Phenylalanine25 Gm , Phloroglucinol 250 Gm , Phosphoric Acid 1 Kg , Physostigmine 10 Gm , Picric Acid 500 Gm , Picrolonic Acid 500 Gm , Pine Oil 250 Ml , Pineapple Flavour100 Ml , Piper Longum Fruit 500 Gm , Piper Longum Root 500 Gm , Piperazine Citrate 500 Gm , Plumbagoo Zeylanica 500 Gm , Potassiumdichromate 2 Kg , Potassium Bromide 2 Kg , Potassium Chloride 2 Kg , Potassium Dihydrogen Phosphate 500 Gm , Potassium Ferricyanide 1 Kg , Potassium Ferrocyanide 1 Kg , Potassium Hydrogen Phthalate 1 Kg , Potassium Hydroxide 2 Kg , Potassium Iodide 500 Gm , Potassium Permanganate 500 Gm , Potassium Sodium Tartrate 500 Gm , Potassium Sulphate 1Kg , Precipitated Chalk 500 Gm , Precipitated Sulphur 500 Gm , Propanol 05 Lit , Propyl Glycol 1 Kg , Propyl Paraben 500 Gm , Propylene Glycol 2.5 Lit , P-Toluene Sulfonylamide 500 Gm , P-Toluene Sulphonic Acid 2.5 Lit , Pyridine 2.5 Lit , Quinine Sulphate 100 Gm , Rbc Diluting Fluid 500 Ml , Rectified Sprit 5 Lit , Resorcinol 2 Kg , Rose Oil 500 Ml , Ruthenium Red 5 Gm , Saccharin Sodium 500 Gm , Safranine 500 Ml , Salicylic Acid 1 Kg , Seliwanoff’S Reagent 500 Ml , Senna Leaves 500 Gm , Sesame Oil 2.5 Lit , Shakhpushpi 500 Gm , Shatavari 500 Gm , Silica Gel 100-200 Mesh (For Column Chromatography) 2 Kg , Silica Gel 60-120 Mesh (For Column Chromatography) 2 Kg , Silica Gel G 5 Kg , Silver Nitrate 25 Gm , Sodium Acetate 1 Kg , Sodium Arsenate Dibasic 100 Gm , Sodium Benzoate 1 Kg , Sodium Bicarbonate 5 Kg , Sodium Bisulfate 500 Gm , Sodium Carbonate 2 Kg , Sodium Chloride 5 Kg , Sodium Citrate 2 Kg , Sodium Dihydrogen Phosphate 1 Kg , Sodium Dodecyl Sulphate 5 Kg , Sodium Formate500 G , Sodium Hydroxide 2.5 Kg , Sodium Metal 500 Gm , Sodium Methyl Paraben 500 Gm , Sodium Nitrite1 Kg , Sodium Nitropruside 1 Kg , Sodium Oxalate 500 Gm , Sodium Phosphate Dibasic 1 Kg , Sodium Phosphate Monobasic 1 Kg , Sodium Picrate 500 Gm , Sodium Potassium Tartarate 500 Gm , Sodium Propyl Paraben 250 Gm , Sodium Salicylate 500 Gm , Sodium Succinate 500 Gm , Sodium Sulfate 1 Kg , Sodium Thiocyanate 500 Gm , Sodium Thiosulfate 500G , Sodium Tungstate250 Gm , Soft Soap 1 Kg , Solochrome Black T 25 Gm , Sorbitol Solution (70%) 250 Gm , Spermaceti 500 Gm , Standard Cholesterol 25 Gm , Starch 2 Kg , Stearicacid 1 Kg , Strong Ammonium Solution 2.5 Lit , Sucrose 2 Kg , Sudan Red Iii 5 Gm , Sugar 2 Kg , Sulfanilamide 500 Gm , Sulfuric Acid 15 Lit , Sulphamic Acid500 Gm , Sulphanilic Acid 500 G , Sulphosalicylic Acid 500 Gm , Sulphur 1 Kg , Talc 2 Kg , Tannic Acid 1 Kg , Tartaric Acid 1 Kg , Tartrazine Yellow 25 Gm , T-Butyl Alcohol 1 Lit , Tetracycline Hydrochloride 250 Gm , Thioglycollic Acid 500 Ml , Thiourea 500 Gm , Thymol Blue 25 Gm , Titanium Dioxide 500 Gm , Toluene 5 Lit , Tragacanth1 Kg , Triethanol Amine 2.5 Lit , Trisodium Citrate, Dihydrate 500 Gm , Turpentine Oil 300 Ml , Tween 80 500 Gm , Tyrosine 100 Gm , Urea 1 Kg , Uric Acid 25 Gm , Vanillin 100 Gm , Vegetable Oil 1 Lit , Wagners Reagent 1 Lit. , Wbc Diluting Fluid (Turks Fluid) 500 Ml , White Ointment 1 Kg , White Wax 500 Gm , Xylenol Orange 10 Gm , Yellow Soft Paraffin 500 Gm , Zinc Dust 500 Gm , Zinc Oxide 2 Kg , Zinc Stearate 1 Kg , Zinc Sulfate 1 Kg , Zinziberofficinalis500 Gm , Air Condenser 300 Mm (With Joint B-19 Or B-24 And Plain Without Joint) , Ampoules , Arsenic Test Apparatus , Beaker 100Ml , Beaker 250Ml , Beaker 500Ml , Beaker 1000Ml , Boiling Tubes , Borer Dia. 8Mm, Thickness 3Mm , Length 99 , Buchnerfunnel Ceramic And Plastic 70Mm , Buchnerfunnel Ceramic And Plastic 110 Mm , Buchner Flask 250Ml , Buchner Flask 500Ml , Burette Stand , Burette With Rota Flow Stop Cock , Capillaries For Melting Point Determination , Centrifugal Tube Graduated , Centrifugal Tube Plain , China Dish , Clavengerapparatus , Column For Column Chromatography , Conical Flask 100 Ml , Conical Flask250ml , Cover Slips , Dessicator Plain 150 Mm , Dessicator Plain 250 Mm , Distillation Flask Bg , Distillation Set (Condenser Reciever) , Distillation Unit , Droppong Bottle 60 Ml , Droppong Bottle 125 Ml , Eppindroff1.5 Ml , Eppindroff2.0 Ml , Erlenmeyer Flask , Filter Paper Rim 8X22 , Flat Bottom Flask (100 And 250) , Flilter Paper Pkt Round , Funnel (Small, Medium And Large Size) , Glass Rod , Glass Slides , Graduated Measuring Cylinder 10Ml , Graduated Measuring Cylinder 50Ml , Graduated Measuring Cylinder 100Ml , Graduated Measuring Cylinder 500Ml , Graduated Measuring Cylinder 1000 Ml , Ignition Tube (Pkt Of 5 Grs, Superior Quality) , Iodine Flask , Kipps Apparatus , Lens Cleaning Tissue (Paper Book Of 100) , Litmus Paper Red/Blue Pkt Of 100 Lbs , Microtips , Mortar Pastel (Dia 5, 6 And 8) , Nessler Cylinder (50 Ml) , Ostwald Viscometer , Petridish 100 Mm , Petridish 75Mm , Ph Paper In Plastic Box Pkt Of 100 Lbs , Pipette Bulb Rubber , Pipette Pump 2 Ml , Pipette Pump 25Ml , Pipette Pump 10Ml , Pipette Stand Horizontal For 12 Pipettte , Pipette Volumetric20ml , Pipette Volumetric 10Ml , Pipette Volumetric 25Ml , Pipettes 1Ml , Pipettes 2Ml , Pipettes 5Ml , Pipettes 10Ml , Plane Slide With Cavity , Reagent Bottle Narrow Mouth Amber 500 Ml , Reagent Bottle Narrow Mouth Amber 125Ml , Reagent Bottle Narrow Mouth Amber 250Ml , Round Bottom Flask (250 Ml) , Round Bottom Flask (Double And Triple Neck) , Rubber Cork (Extra Soft) Superior Quality (Top Dia 13Mm) , Rubber Tubing Coil (10 Meter) , Separating Funnel 250 Ml , Separating Funnel 100Ml , Silica Crucibles 15 Mm , Soxhlet Apparatus Complete With All Capacity , Specific Gravity Bottle N.G. 25 Ml , Specific Gravity Bottle N.G. 50 Ml , Starch Iodine Paper 100 Leaves , Steam Distillation Assembly , Stoppered Tubes , Suction Pump Made Of Glass , Test Tube , Test Tube Holder , Test Tube Stand , Thermometer 30 Cm Length (10-360 Degree) , Thiele`S Tube , Tlc Chamber With Lid , Tlc Plates , Tlc Sprayer , Volumetric Flask 10Ml , Volumetric Flask 25Ml , Volumetric Flask 100Ml , Volumetric Flask 250Ml , Volumetric Flask 1000Ml , Wash Bottle 250 Ml , Watch Glass , Whatman Filter Paper For Paper Chromatography , White Tiles , Wire Gauge , Rnase/Dnase Away(Ivd, Us Fda, Icmr Approved) 250Ml , Taqpath Covid-19 Combo Kit Multiplex Real-Time Rt-Pcr (Catalog Numbers A47813 And A47814)(Ivd, Us Fda, Icmr Approved) , A* Star Fortitude Kit 2.0 Covid-19 Qualitative Pcr Kit(Ivd, Us Fda, Icmr Approved) , Mylabpatho Detect Covid-19 Qualitative Pcr Kit(Indian Fda/ Central Drugs Standard Control Organisatio (Cdsco),Icmr Approved) , Kilpest (Blackbio) Trupcr Sars-Cov 2Rt-Qpcr Kit Version 2 (Usfda /Or Ce- Approved) , Biomerieux Argene Sars-Cov-2 R-Gene(Ivd, Us Fda, Icmr Approved) , Water, Ultrapure, Free Of Dnase, Rnase, Protease, Endonuclease(Ivd, Indian Fda/ Central Drugs Standard Control Organisatio (Cdsco),Icmr Approved) 1 Litre , N-95 Particulate Respirator (Valved Particulate Respirator, 42Cfr84 Approved Product, 95% Filter Efficiency Level, Effective Against Particulate Aerosols Free Of Oil) , Wipes 37.33X42.16 Cm(Anti-Stat Polyshield: Anti-Static Dispensing System Reduces Lint And Electrostatic Discharge, Easily Wipe Up Liquids, Dust And Tiny Particles And Are Designed For Delicate Tasks) , Cryo Box 1.8Ml (9X9) (Chipboard, 132 X 132 X 51Mm, Square,Durable Plastic Cryoboxes With Keyed Lid Orientation And Printed Via Location Grid.) , Zip Lock Bag 21.3X18cm(Thickness: 52 Micron, Prevents Aroma Transfer, Keep Out Dirt And Moisture, Made From Fda Approved) , Polypropylene Trigger Sprayers (500Ml)(Made From Durable, Chemical Resistant Polypropylene,Trigger Sprayer With Adapters.) , Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides (11X8 Inch) (Stainless Steel, Autoclavable, Chemical Resistantand For Laboratory Use) , Deep Well Storage Plasticware 96 Well Plate(Height 4.1Cm, Wellcut 1 Cm, Length 12.1Cm Polypropylene) , Plasticware Magnetic 8 Strip Comb (Height 4.5Cm, Length 10.2Cm, Distance Between Each Comb=1Cm) , Duo Rna Elution Plate 96 Well (Wall Thiekness 6Mm, Nominal Size 50, Neutral Glass) , Reinelene Solution (Peracetic Acid) 1X 5Lit , Glutaraldehyde 2.4% Solution 1X 5 Lit , Self Lock Pouch (Plastic) , Deep Well 96 Plate (Size 50Mm, 200Ul, Wall Thickness 6Mm Nominal Size 50, Neutral Glass) , 96 Tip Comb For Deep Well Plates (Wall Thickness 5Mm, Nominal Size 90, Neutral Glass) , Volmutric Flask 500Ml , Rose Water 250Ml , Manitol 500Gm , Renelene Solution 5 Litr. , Cidex 5 Litr. , Cidex 1 Litr. , Carbolic Acid 1000Ml , Hplc Variant Ii Bts Test Ket 500Test Packet , Inflamable Sprit 5 Ltr , Rotoquac (Hiv Fourt) Kit , Anti Sera A 10Ml , Anti Sera B 10Ml , Anti Sera D 10Ml , Hcv Rapid Kit 4Th , Medicated Sprit 5Ltr , Savelon 05 Ltr , Savelon 01 Ltr , Distle Water 05 Ltr , Reniplus Solution 05 Ltr , Variant Iind Bts , Albumin Kit , Protein Kit , Nacl 500Ml , Droper 3Ml , Cedarwood Oil 5Ml , Reticulocytes Counting Fluid 100Ml , Improve Newbarcounting Chamber , Rbc Pipette , Wbc Pipette , Reagent Bottle (Glass 250Ml) , Platelet Diluting Fluid 125Ml , Hemoglobino Meter , Acetic Acid 1000Ml , P 16 Antibody 6Ml Vail , Hemaccue Cuvette , Art Barriar Tips 20Ul - 200Ul , Art Barriar Tips 1000 Ul , Art Barriar Tips 10 Ul , Soda Lime , 96 Well Pcr Plate, Sealer (Rtpcr Mechine) , Pre Filled Automated Rna Extraction Plate With Tip Comb (96 Well Zybio) , Vtm , Micri Barrier Tips 20 -200 Ul , Micri Barrier Tips 10 Ul , Micri Barrier Tips 1000 Ul
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 10
Uttar Pradesh View Result →
7.
Educational and Research Institute #9111244 Technical Bid
Auction-Of-Scrap-Items Auction-Of-Scrap-Items , C½ , Scrap Items- Category ( A ) , Scrap Items- Category ( B ) , Scrap Items- Category ( C ) mputer With Accessories - 386 (20MHz) Non cach/2mb RAM/101keys keyboard / 1x1.2mb FEDH 1x360 kb FDD/1x80MB (F) HDD/ 2Serial and 1 Paralled Parts /387@20MHz/60 mb CTD/4”VGA card /MS DOS 4.01/ Tower Model 2. printer LQ1050epson (132 col. 264 (ps) 3. Floppy 48 TPI (box of 10) 4. floppy 96TPI (box of 10), 5. printer stand 6. Ups 1kva 01 1 Compaq pro 7500 Intel pentium 01 1 Hardening Shed 900 m square 2. UPS 1 KVA Sl. No. 10019840802 01 2 Compaq ij printer 01 3. Online UPS 1 KVA 01 3 Compaq s4100 scanner 01 4. Scanner HP 5590 01 4 Acc pac accounting 01 5. Inverter 2 KVA KTMC Sl. No. 098608 01 5 HP DJ 840C ij printer 01 6. Trolley for Inverter PVC 01 6 1 KVA “UPS supported Exide Battery” 01 7. Online UPS 1 KVA 01 7 HP LJ printer 1150 01 8. 42 AH Excide Power SMF Battery Model No. EP 42-12 02 8 UPS 2 KVA 60 min. backup Excide Battery 01 9. Stand Coated Projector SGP 601 01 9 Godrej Typewriter Hindi Machine No. 988322 01 10. Spare Halogen Bulb 01 10 Godrej Lock 7 liver 01 11. Overhead Projector Trolley 01 11 Harrison lock 04 12. Printer Dot Matric 01 12 Wood chair 06 13. COMAQ Presanio Pro 7500 intel Pentium (computer accessories) 01 13 Wood chair 08 14. Extension Board for computer 01 14 Office chair with plastic cane sheet 05 15. UPS 1 KVA APC Smart UPS model no. SU1000 UXINET M/F No. YSO/28211360 01 15 Wooden armed chair sheet with0 plastic 01 16. HP DJ 840C INK JET printer 01 16 Steel arm chair knitted 01 17. Samsung CD Writer 01 17 Table steel top 1500x900x760mm 01 18. Blank media CD 05 18 Wooden table 1220x750x760mm 01 19. Blank media (predictable CD) 05 19 Wooden Table 4‟x‟2‟x2.5‟ 01 20. Zenith Pentium with computer accessories 01 20 Steel Almirah 1525x 760x 460mm 02 21. Dotmatric Printer Sony make 01 21 Rack wooden 02 22. CVT 1 KVA 01 22 Symphony room cooler 01 23. Sound Card speaker with installation 01 23 Portable leaf area meter cable, conveyor image analyzer cable, 24 pin, 80 column Dot matrix printer manual 01 24. Zenith Pentium with computer accessories 01 24 Soil moisture monitor system 01 25. HP Inkjet Printer 01 25 Infrared thermameter 01 26. CVT 1 KVA 01 26 Tree measuring set and accessories I Tree measuring set and accessories II 1set 27. Photocopier Mx5216 01 27 Analytical balance elect. AA200DS 01 28. Lab Table 7‟x2.5‟x3‟ 02 28 Hero Honda CD 100 motor cycle UP42/6939 01 29. Single Pan Analytical Balance Model K-14 K-ray make 01 29 Single Pan Balance 01 30. Electric Oven 24”x24”x24” Aluminium chamber 01 30 Electric Oven size 24”x24”x24” 01 31. Ph Meter Griph 01 31 pH Meter Griph 01 32. Infrared Moisture Balance 01 32 Infra Red Monitor 01 33. Pocket Calculator 01 33 Pocket Calculator DCM 01 34. Analytical Balance K-ray 01 34 Analytical Balance 01 35. Locks 7 lever Harison make 02 35 SICCO Biochemical Digital Flame 01 36. Remington Standard Typewriter English 20”50.80 cm 01 36 Calcium Filter 01 37. Display Board size 6‟x4‟ 05 37 SICCO YORCO Distillation Unit 01 38. Pharsi Dari 12‟x12‟ 01 38 SICCO YORCOO Hot Plat 02 39. Notice Board Jalidar 4‟x3‟ 01 39 Energy Regulator 02 40. Automatic Slide Projector with Remote Control SUVIRA make 01 40 Steel Spatula 10 41. Pressure Tube 10 mt 10 mt 41 Tree pod stand 12 42. Godrej Coffer Stander 1 pc 42 Wire Guage 12 43. Telephone Lock 02 43 Test Tube stand 12 44. Lock Harison 01 44 Pippet Stand 01 45. Lock Small 01 45 Pestil 04 46. Lock Small 01 46 Bottle Brush 24 47. Lock 01 47 Sprit Lamp 03 48. Vernier Calipers 01 48 Secatier Passi 24 49. Hand Retatry Duster 01 49 Hedge Shear 02 50. Iron Table 3/4 inch +1 inch 01 50 Budding, Grafting Knife 24 51. Iron Stool 125 cm h 18x18 inch 01 51 Pruning Saw 04 52. Calliper digitel 01 52 Bill Hook edge 01 53. Digital moisture meter 01 53 Pruning Dey 02 54. Ravi multimeter 01 54 Loping Shear 02 55. Lab table 7x2.5x3‟ 02 55 Pruning Knife 02 56. Lab stool 2x1.5x1‟ 20 56 Grass Shear 01 57. Single pan analytical K-14 1 57 Sward Lawn 02 58. Perforated board 90x60cm 1 58 Ganesh Head Sprayer 01 59. Electric oven 24”x24”x24” 1 59 Ravi Altimeter 02 60. Ph meter griph 1 60 Ravi multimeter complete in leather case 02 61. Infrared moisture balance advance 1 61 Abneys levels in leather case 02 62. Pocket calculater DCM 1 62 Diameter tape 3meter 10 63. Analytecal balance K- Roy 1 63 Field lens 10xfoalding 02 64. Ravi altimeter complete in leather case 2 64 Bubble spirit level 01 65. Ravi multimeter complete in leather case 2 65 Altimeter Barometric 4500mtrs 01 66. Abneys levelsin leather case 2 66 Lux Meter Digital Range upto 200000 MSW562 02 67. Burette stand 06 67 Top Pan Direct Reading Balance Cap. 1 kg, 5 kg, Spring Balance 100 kg cap 03 68. Sico digital spectro photo meter 01 68 Automatic Slide Projector with Remote Control Model No. MP 410 01 69. Sico Hindustan double distillation appartus 01 69 Extra for Bulb in Timer 01 70. Sico biocamp flame photo meter 01 70 Spare 24 Volt 150 w hylogen lamp 01 71. Sico Yarco kgeldal digestion unit 01 71 Pressure Tube 10m 72. Steel spatula 10nos, tripod stand 12, wire gauge 12, test tube stand12, pipette stand 1, pestil mortar 10cm (4), bottle brush 24, sprit lamp 14 08 72 Plastic Container cap. 35 lit., 10 lit cap. 02 73. Godrej refrigerator 300 lit 01 73 Burette Stand 06 74. Voltage staplaizer 01 74 Office table 48x24x30 with 3 drawl 01 75. Analytical balance 01 75 Steel rack 72”x36‟”x15” 5 shutter 02 76. Soil hydrometer 4 76 VDU Table 36”x24”x20” 02 77. Chemical weight box 50gm physical weight box 200gms 1 77 Tubular chair with arm 04 78. Electrical extention board 3 78 VDU Table 36”x24”x20” 01 79. Stabilizer, vacuum distributor 3 79 Trolly 2 wheel 01 80. Digital PH meter with glass reference electrodes 1 80 Canopy imager Model CI-110 01 81. Lux meter 1 81 Godrej Chair PC 4003.PCH7022 650 mmx 650 mm x 820 mm 02 82. Top pan direct reading 1 82 Godrej Monitor PC3006, Table 750mm(H) x 728 mm (W) x 880 mm (D) 01 83. Lab table 5‟x3‟x3‟ 1 83 Godrej Table PC 3417 610 mm x 445 mm x 750 mm 02 84. Gestetner Rotary duplication model 320 1 84 Voltage Stabilizer 01 85. Getner” Photo micrography equipment 1 85 Soil Hydrometer 04 86. Extra charges above in plywood supplied with standard 1 86 SICCO Hindustan Distillation 01 87. Pocket calculator casio fx 82d 1 87 Digital Direct Reading Conductivity 01 88. Hot Air Oven Model No. YSI 431 Sl. No. 97C1822 1 89. Scientific Calculator CASSIO FX 82TL 1 90. Portable Digital Conductivity Meter 1 91. Spare Condenser for 10 lit. distillation 2 92. Spare Condenser for 5 lit. 1 93. Electric Lamp 3 94. Electric Top Loading Balance Cap. 300 g 1 95. Soil Tensiometer size 90 cm 01 96. Multi Chanel Soil Thermometer 01 97. Probe Length 10 cm, 30 cm, 50 cm, 100 cm 04 98. Deonizer Digital Double Bed 01 99. Analytical weight box 1 mg to 20 gm 01 100. Electric Extension Board 01 101. Portable Digital pH Meter Model No. KI 262(a) 01 102. Metallic Dial Scale Balance 10 kg cap 01 103. Spring Balance cap. 100 kg 01 104. Lab Sink 450x300x150 07 105. Lab Stool 2x1.5x1 fit 40pc 106. Vernier Calipers IME type 05 107. Screw Gage 25 mm 05 108. Water Bath Rectingular size 40x30x10 cm with 12 roles 7.5 cm 01 109. YARCO Instrument Lab Stirrer Mode No. YSI 507 01 110. Kjedal Digestion two distribution combined model 37-121-C 01 111. Glass Part-6 set 01 112. Stop Watch 01 113. SUVIRA Transcope Mode No. MP-340A 01 114. Outdoor use 60x90x3 02 115. Heat Convector apparatus Volt 230 w 02 116. Max. Min. Thermameter 02 117. Dicimal Balance for Direct Reading cap. 3000 gms Model No. AB-D12 01 118. Heating Element 02 119. Plier (Pilas) 01,01, 01,01 01 120. Screw Driver big 01 121. Screw Driver small 01 122. Tester 01 123. 3 Pin Tap 6A 01 124. Frot Dial Plastic Body Balance 5 kg cap. 01 125. Electric Extension Board 16 AMP 01 126. Electric Extension Board 10 x12” 01 set 127. Exhibit Panel 180x120cm 01 128. Heating Mantal cap. 2 lit 01 129. Timber Moisture Meter MSW 544 01 130. Microprocessor based water/Soil Analyser Kit 01 131. ORP Platinum Electrode 01 132. Double Beam UV-V15 Spectrophotometer model SL-160 01 133. Interior Illumination with 3NOS 01 134. Automatic Clyclic Timer 01 135. Multi Magnetic Stirres MAC with Hot Plate cap. 2 lit 01 136. Spectrophotometer Sn. No. 177 01 137. Optical Glass Cuvette 01 138. Tala 10lever 01 139. Heating Element 01 140. Table lamp 01 141. Heating element 02 142. Table Lamp 01 143. Extension Board 01 144. Fourt Dial Plastic Body Tap Pan Balance cap 5kg 01 145. Fourt Dial Plastic Body Tap Pan Balance cap 10kg 01 146. Ajanta Clock 04 147. Scientific Calculator 01 148. Remson Table Lamp with Tube 01 149. Scientific Calculator 01 150. Godrej Chair PC 4003.PCH7022 650 mmx 650 mm x 820 mm 01 151. Godrej Monitor PC3006, Table 750mm(H) x 728 mm (W) x 880 mm (D) 01 152. Godrej Table PC 3417 610 mm x 445 mm x 750 mm 01 153. Developer 1025/5216/5223 01 154. P/REC 1025/5216/5223 01 155. Heating Heater 01 156. Box size 46x28x28 inch 01 157. Revolving Chair 01 158. Table Top Fibre 01 159. Office Table 1200x760x760 mm 2nos 160. Steel Almirah 1980x860x480 mm 01 161. Book Case 1675x840 01 162. Agrosaw Seed Sampling Drier 01 163. Agrosaw Seed Germinator 02 164. Agrosaw Hot Air Oven 01 165. Indosaw Economic Electronic Balance 01 166. Indosaw Intelligent Digital Moisture Testing Machine 01 167. Printer for Above Moisture Testing Machine 01 168. Incubator Model YSI-437 YARCO make 01 169. Enamelled Tray 48pc 170. Scientific Calculator 01 171. Voltage Stabilizer YARCO make 01 172. Scientific Calculator 01 173. LT/LK make starter 01 174. Havells make main switch 01 175. Havells /LT Panel Board 01 176. Rem sem Table lamp 01 177. Scientific Calculator 01 178. Hot air oven YARCO model YSI-430 01 179. Lab Willey Grinder YARCO make model MSW-342 01 1.2. MES Agroforestry 1 Torch (Jeep) 01 - - - - - - 2 Torch with cell (Aveready) 01 3 Torch with 3 cell 01 4 Torch with 3 cell (Jeep) 01 5 Torch with 3 cell (Jeep) 01 6 Hazara 07 7 Hazara with Phuhara 15 8 Hazara with Phuhara 02 9 Kirlosker SV1 Sr.II, 8 HP/1800 RPM with accessories 01 set 10 Sign Board 5x3‟ 01 11 Sign Board 3x1‟ 03 12 Sign Board 6x3‟ 03 13 Sign Board 3x1‟ 04 14 Sign Board 5x3‟, 3x3‟ 01 15 Sign Board 5x3‟ 02 16 Spade TATA 10pc 17 Spade TATA Wooden Handle 25pc 18 Spade TATA 20pc 19 Spade TATA with handle 03pc 20 Spade TATA with handle 22pc 21 Big Khurpa 12pc 22 Khurpa 6pc 23 Khurpa 20pc 24 Khurpi 10pc 25 Tape 30 mt 01 26 Tape 15 mt. 01 27 Tape steel 1 mt 02 28 Tape plastic 30 mt 01 29 Tape steel 01 30 Screw gauge (2.6”) girth 3 sut 05 31 Bark guage 6 cm size 01 32 Spade TATA 50 33 Axes 02 34 Axes 03 35 Balti Suraj make 12” 02 36 Balti 11” 01 37 Balti Iron 10” 01 38 Maruti Foot Sprayer MRI -8/VM3BA 01 39 Garden Cart Singal wheel 01 40 Rich (5 piece) 01 set 41 Screw Rich 300 mm 1 pc 42 Pipe Rinch 1 pc 43 Lalten Champion 02 44 Drum Khali (205 lit. Cap.) 02 45 Container Plastic 35 lit cap and 10 lit cap 2 pc 46 Hasiya 5 pc 47 Kudal 03 pc 48 Lawn Mover 18” TRIMO 1 pc 49 Renti 6 inch 01 50 Renti 6 inch 01 51 Renti 01 52 Sabbal 7 kg 01 53 Torch with Cell 01 54 Torch 3 Cell 01 55 Torch 3 Cell 02 56 Iron Table 3/4 inch +1 inch 01 57 Iron Stool 125 cm h 18x18 inch 01 58 Tyre (118430) 04 59 Thresher Automatic 12 HP 18x30 double wheel hydraulic system with accessories 01 60 Rukhani 01 61 Flinch 4 x 4” 05 62 Nut bolt 5 sut 15 63 Rubber Sheet 4 x 4” 04 64 PVC pipe 4” 01 65 Reflex valve 100 x 100 01 66 Flinch 4” 04 67 Bolt 08 68 Bark gauge 6 cm 01 69 Ravi multimeter 01 70 Ravi altimeter complete in leather case 2 71 Ravi multimeter complete in leather case 2 72 Altimeter Barometric 4500mtrs 1 73 Measuring Tap metallic 15mt. 5 74 Soil thermometer 15cm 2 75 Mettlic tape 10m, 20m,30m 3 76 Secateur passi (4),hedge shear (1) budding Knife (4), bill hook (1), pruning Saw (4), Pruning Dey (2), loopping share (2), pruning knife (2), Grass shear (1), sword (2), Ganesh hand sprayer 11 77 Secateur passi 20 78 Sabbal 7kg 01 79 Khurpa big size 07 80 Khurpa small size 07 81 Tape plastic 01 82 Tape steel 01 83 Spade TATA with handle 03 84 Keel big size 08 85 Enameled Tray size 46x30 cm 38pc 86 3‟x2‟ size board sq fit 01 87 16 gage Chadar with hazara 40Nos 88 Sign Board 4x3 inch 01 89 Spade TATA 04 90 Kudal 01 91 Khurpi 05 92 Gainti 10 93 Metalic Tape 30 mt 02 94 3‟x2‟ size board sq fit 01 95 16 gage Chadar with hazara 43Nos 96 4‟x3‟x9‟ size board sq fit 01 97 Spade 04 98 Kudal 01 99 Khurpi 03 100 3‟x2‟ size board sq fit 01 101 16 gage Chadar with hazara 45Nos 102 Iron chhadar 55pc 103 4‟x3‟x9‟ size board sq fit 01 104 Hazara 10lt with fuhara 02 105 Fawda 04 106 Khurpi 05 107 3‟x2‟ size board sq fit 01 109 16 gage Chadar with hazara 30Nos 109 Bandar chhap balti 12” 04 110 10 Lt Hazara with Fuhara 02 111 Shakti power tillor 130 DI model 01 112 Hitesh Barket Assembly 01 113 Tail Wheel flat 01 114 Wheel Changer 01 115 Lugged Wheel 01 1.3. MES Horticulture Fruit Science 1 Sanyo PLCXU -40 (Sanyo LCD Multimedia projector) Model no. SANYO PLCXU -40 with short zoom lens serial no.G -3805494 2000 ANSILM XGA1024X768 resolution 01 1 Tula man balance Cap.0 -1kg model 40 AP ,MC no 7511043 01 - - - 2 BOD Incubator (automatic)TANCO make model PLT -141 size 610x450x410mm cap4 CUFF Alum Chamber 01 2 Tula man balance Cap.0 -1kg model 41SM ,MC no 7912089 01 3 Macro equipment Digital electric top loading balance cat no. 908 cap.100gm LC 0.005g 01 3 Weight box for chainometric 01 4 Seed Storage cabinet “MAC” 72”x30”x14” cat no. MSW 475 30 trays 01 4 Plant grinder (willy mill) 20mm 01 5 Handy cam video camera model 418E sony 01 5 Hot plate 0 -100 0C size -HP - 3 -SHC Sr.no. 54678 01 6 Servel voltage stabilizer 5KVA wider range automatic & auto cut 01 6 Microscope wes -was Optic model 20660 01 7 Exhibits panel board outdoor size 180x90 cm.codeno.RD -116 -03 02 7 Metallic stand for water distillation with cord and plug 01 8 Projection screen tripod model size 150x150cm code no.RD -207 -03 01 8 Pair of tongs 6” 01 9 Over head projector trolley code no.RD 201 -02 01 9 Wood microtome (incomplete) 01 10 Exhibits panel board outdoor size 180x90 cm.codeno.RD -116 -03 02 10 Hot air Oven electrical size 300x300x300mm AJE 01 11 Perforated board 150x90 cm RD -115 - 0 01 11 Water bath size 24”x12”x12” S 35 0 F Sr. no. 65 01 12 Media sterilization system MSW -101 01 12 Digital pH MAC model MSW 552 with pH range 0 -14 0.01 with automatic temperature controller 01 13 Voltage stabilizer automatic model MAC MSW 582 cap.1KVA 01 13 Digital conductivity MAC model MSW 555 range 0 -200 micro with dust cover and stand 01 14 Water still double walled cap.4 litre/hr. load 3.0KW MSW 197 01 14 Digital photo-electric calorimeter 8 filter model MAC MSW 557 wavelength 400- 680mm cavelles photocell detector with voltage stabilizer automatic model MAC MSW 500 cap.1KVA 01 15 Water still double walled cap.10litre/hr. load 5.0KW MSW 197d 01 15 Media sterilization system (auto clave) 01 16 Flame photometer without automatic ignition cat. No. CL361 Elico optional accesseories calcium fitter for above 01 16 Moisture box aluminium cap.250gm for soil 404 17 Seed germinator size 555x605x910mm cap 308lit. MAC(MSW 123)SS Automatic 0-24 hrs timer for regulating illumination cycle 01 18 Kjeldhal digestion unit micro processor based digital temperature indicator cum controller cat MSW437 01 19 Seed germinator(dual chamber) MAC microprocessor controlled with automatic stabilizer inside chamber size 555x605x910 mm SSMSW124b 01 20 BOD Incubator low temperature MAC microprocessor controlled with automatic stabilizer MSW 121C 505x415x830 mm 01 21 Plant growth chamber MAC micro-processor controlled with automatic stabilizer MSW 130 A size 570x875x555 mm 01 22 Auto clave vertical MAC size 305x550mm cap.50 lit. MSW 101(DX) 01 23 Seed storage cabinet sonar 27”x30”x14” cat no. SSC-10 AC 01 24 UPS 100VA PC smart UPS model SOA 1000Ux1 with rocket SMF battery for 30 min. backup time 01 25 26 Ah Exide power safe SMF battery model EP-26-12 03 26 Water purification unit (miliQ) BM9EN1105A 01 27 Microprocessor universal cooling camfuage cat no.CPR-30 A)Rotor head cat no.C-230 B) Voltage stabilizer VS-03 01 01 01 28 Aapurti and fixing iron sheet 18 gaze sixe 3.2 and 8 feet lamba angle iron sahit board 03 29 PC based automatic absorption spectrophotometer 01 double beam with compressor with three hollow cathode lamp to set RS232 interface background corrector with automatic gas box with auto flame alignment spectro analytical make SA1304 30 Regulator N2O 01 31 Regulator Acetylene 01 32 N2O burner 01 33 Backfire arrestor 01 34 PC PIU Branded 01 35 Printer compatible 01 36 Acetylene gas filled cylinder including cylinder cost 01 37 42 AH Exide power safe SMF battery model EP-42-12 03 38 Laminar Air Flow (Horizontal) with S.S. work RH58-07 size 120x60x60cm 01 39 HP Desktop computer 2000 series as per RC sl.no. 1NA912078 01 40 pH Meter systronic type-362 with glass electrode sr.no.009 1 set 41 Elico digital pH meter model L1-120 with electrodes sr.no.P7950 01 41 Elico soil Bridge type CM 84 with electrodes sr. C4151 01 42 Digital Spectrophotometer systronics type 106 sr no. 2640 01 43 Autoclave vertical size 250x450mm Y.ST.-402 sr no. 288 01 44 Analytical balance model KEROY sr.no. 5558 01 45 Chaino metric balance K-8A05620 (KEROY make) cap.9.210gm 01 46 Chaino metric balance (KEROY make) HC-21141 cap.9.10gm 01 47 Top Pan balance electrical type 75201 ELN no.13862212 01 48 Top Pan balance Avon make Cap.500gm sr.no. 542 01 49 Decimal triple beam balance reading 3000gm model ABD11 Avon make Cap.3.110kg 01 50 Digital conductivity meter model -304 Systronics sr.no. 407 01 51 Digital conductivity meter model -304 Systronics sr.no. 864 01 52 Plant grinder (willy mill) Chamber size 40x20mm with motor 0.25 HP Sr. no. 5877 01 53 Laboratory heating plate 30x45x15 cm 2KW Khera 01 54 Klettsumerson Photo electric calorimeter S.no.44154 with blue and green fitter 01 55 Digestion distillation assembly model K.J.121 AJE make 01 56 Rotatory microtome model1090 01 57 Universal Oven electrical memmerty type size 455x465x432mm model YSI 432 york 01 58 YARCO equipments Hot air Oven (memmert type) size 605 x605x605mm stainless steel cat no. YSI931 S.no.9701815 01 59 Plani meter 01 60 Hand refractometer 0-32% Erima Japan 15163 01 61 Hand refractometer 58-92% Erima Japan No.21 01 62 Hand refractometer 0-32% Erima Japan 02 63 Spirit lamp 01 64 Systronics Extraction unit for six test fitted with regulator sr.no. 3189 01 65 Sieve 20,40,60 mesh 02 66 Water distillation apparatus stand monesty type W.D. 50 01 67 Soil Thermometer 12” long 01 68 Soil Thermometer 18” long 01 69 Soil augar screw type 50mm 01 70 A.I.C. tensiometer 6” length 12” length 24” length Tube augar Soil Moisture metre Leather case Gypsum black with 1 meter lead wire 01 01 01 01 01 01 01 71 Screw Guage 25mm 01 72 Screw Guage 50mm 01 73 Vernier Calipers 05 74 Vernier calipers Super 01 75 Tele counter 01 76 Sambross Servo Controlled voltage stabilizer type SS 102 with over voltage under voltage cut out sr.no. 022 (2 KVA) 01 77 Servo Controlled voltage stabilizer cap.3 KVA 02 78 Water bath size 250x125x125mm YSI 413 01 minisizeYARCO 79 Centrifuge Model R-23 REMI sr.no. C06/300 01 80 Gas Generator for flame photometer (Khera) 01 81 Lux meter 50K LX-101 L-275182 01 82 Vaccum pump with 1.5 H.P.motor (Khera make) 01 83 Godrej Refrigerator cap.300lit. with stabilizer 0.5 KVA 01 84 Moisture box cap.250gm for soil sample 99 85 Rapid moisturemeter 0-50% with wet weight cat no. MB293 01 86 YARCO Shaking machine with covered body fixed speed fitted with timer model YSI516 01 87 YARCO Laboratory mill(villy type)0.5HP YSI 527 01 88 Bacteriological Incubator (TANCO) memmer type model PLT-136-INC-5 stainless steel size 600x600x600mm extra air circulation fan 01 89 Measuring tape 30mtr. 01 90 YARCO B.O.D. Incubator model YSI-440 size 565x865x550mm Optional accessories a. Voltage stabilizer 3.00KVA b. Interior illumination with 3 Nos. fluorescent tube 60m 01 01 01 91 TANCO B.O.D. Incubator (automatic TANCO make model PLT 141 Size 610x450x410mm cap.4 caftaluminium chamber 01 92 Seed storage cabinet „MAC‟ cabinet size 72”x30”x14” (approx.) cat no.MSW 475 30 trays 01 93 Macro equipment Digital electronic top loading balance Cat no.908 L.C. 0.005gm 01 94 Poly pouch sealing machine MAC model 24 pedastal model cat no. MSW-665 01 95 U.V. Radiation seed viewing cabinet MAC make app. Outer size 24”x24” cat no. 508 01 1.5. Veg. Science 1. Darati 05 1. Analytical balance Siughl Park-12 01 - - - 2. Sickle 10 2. Auto mix Remi Make 01 3. Banka 01 3. Analytical weight Box 01 4. Power Tiller 01 4. Automatic Pipette washer 01 5. Five time cultivator 01 5. BOD Ineubater 02 6. Trolley with Jeep tyre 01 6. Burette Stand with clamp 03 7. Logged Wheel 01 7. Bearranges Balance caps Kg. 01 8. Furrower 01 8. China matric balance K -8A Kamidas 01 9. Wheel Charger 01 9. Crossing Kit 05 10. Pully for haular 01 10. Digital Flame photometers 01 11. Mould board Plough 01 11. D.C.M Calculator + Desk Calculator 02 12. Hitech Bracket 01 12. Digital Conductivity meter 01 13. Flat Engine Pully 01 13. Heating mental cap2000ml+500ml 02 14. Seed bin 3 Qt 01 14. Dissecting microscope 06 15. Angle Iron 18 15. Elico Spectro photometer 01 16. Petromax 01 16. Epidias cope Getner Projector both 01 17. Lock 01 17. Electric boiler 01 18. Lock 01 18. Gange meter 02 19. Lock 01 19. Hot air oven 03 20. Lock 07 20. Hand Refractometer 02 21. Heat Convector 02 21. Hygrometer 01 22. Calculator 03 22. Hot Plate 02 23. Spade with Handle 20 23. SEW micro Kgeldal appratus 02 24. Measuring tape 02 24. Leonard &All win refrigerator 02 25. Steel Box 02 25. Laboratory vacuum Pump 01 26. Steel box 01 26. Micro Kjelhal D -apparatus 01 27. Steel box 02 27. Maximum Munimum thermameters 01 28. Steel Bokhari 5 Qt 02 28. Non Refrigerated Centrifuge 01 29. Steel Bokhari 3 Qt. 02 29. Oscar Binacular microscope 01 30. Steel Bokhari 2Qt. 01 30. Pocket calculator 02 31. Balance cast iron Wt. 10 kg 01 31. Physical weight box 01 32. Seed bin 2Qt 02 32. Salter spring balance 1 Kg.to 10 Kg 02 33. Plateform Balance with 100 to 10 kg weights 01 33. Sterio binocular microscope 01 34. Grass cutting Talwar 02 34. Sunmica Cap table 07 35. Gator Rockey Sprayer 01 35. Tri Pod Stand 06 36. Bearanger Balance cap 5 kg with weight 05 36. Tongue Stainless steel 01 37. Balance circular 02 37. Tripole Beam Balance 01 38. Maruti Foot Sprayer 03 38. Tensio meter 6,12 & 18 (4+4+4) 12 39. Maruti Foot Sprayer 01 39. Universal Moisture meter 01 40. Torch with 3cells 01 40. Voltage Stabilizer 01 41. Torch with cells 01 41. Wesiox microscope Lamp 01 42. Torch with cells 02 42. Water Steel 01 43. Steel table 07 43. Willey mill 01 44. Seed bin 5 kg 03 44. Water Bath 01 45. Seed bin 2.5 kg 03 45. Soil auger Post Hole 01 46. Official Armed wooden chair 10 46. Soil auger Scrow type 01 47. Hero Honda Cd 100ss 01 47. Steel Soil Auger 01 48. Lab Stool 2x1.5x1.5 06 48. Soil Sample Box 150 49. Mango rack wooden 01 49. Soil therma meter.6‟‟12‟‟& 18‟‟(3+3+3) 09 50. Katedar Patta 01 50. Shot beam balance 01 51. Kudal 10 51. Standard Analytical weight box 01 52. Hazara 02 52. Screen Projector 150×120cm with stand 01 53. Spade 10 53. Slide Projector & Slide carrier 01 54. Khurpi 10 54. Sam brass Portable gas generator 01 55. Hasiya 12 55. Sam brass horizontal shaker 01 56. Steel Trunk 01 56. Sew Magnetic stirrer 02 57. Maruti foot sprayer 03 57. Muffle Furnace 01 58. Tripoline 02 58. Water distillation apparatus 01 59. Aspe Power Sprayer 01 59. San brass stabilizer 01 60. Digita Lop peati from magnatic scale cap. 150 kg ( Macro) Balance 01 60. Extension board 01 61. Lock 03 61. D.C.M. Solar Desk Calculator 01 62. Kudal with wooden bet 06 62. Official chair 02 63. Khurpi 06 63. Official Maize 01 64. Phawara with wooden bet 04 64. Official wooden chair 02 65. Maruti foot sprayer 01 65. Steel officer Ex. Table Sunmica top 01 66. Hazara 02 66. Remington type machine English 01 67. Counter Scale with weight 01 67. Official Maize Sunmica Top 01 68. Power sprayer Aspee Bolomat rised Sprayer 01 68. Computer, Monitor, Keyboard, Mouse, U.P.S., Printer & C.P.U 1 set 69. Aspee Bolomat oriseed cum duster 01 70. Counter scale 20 kg cap. with weight 10 -50 01 71. Kudal 10 72. Phawara 10 73. Khurpi 05 74. Kudal 10 75. Khurpi 10 76. Hasiya 10 77. Phawara with wooden bet 10 78. Maruti foot sprayer 01 79. Ganesh Hand sprayer 01 80. Hand trailer manually operated 01 81. Pen Drive 02 82. Calculator 02 83. Tripoline 20x14 14x115 03 84. Calculator orpat 02 85. Kudal 06 86. Canon Power shot TS 95 Camera 01 87. Maruti hand sprayer 3 lit. 01 88. Phawada 10 89. Kudal 10 90. Khurpi 10 91. Spec Hand Sprayer 3 lit 01 92. Phawada 04 93. Phawada 10 94. Kudal 10 95. Yarco Incubater 01 96. NP-Based Flame photometer+Printer 2+2 97. Hot air oven 01 98. Hot air oven 01 99. Hand Refractometer 01 100. Hand Refractometer 03 101. Hygro meters 01 102. Whirlpool Refrigerator + stabilizer 01 103. Stabilizer Allivin 15 KVA 01 104. Voltage Stabilizer 15 KVA 01 105. Lab willey mill 01 106. Water bath 01 107. Sarvo Stabilizer 5 KVA 01 108. Vernier Callipers 04 109. Diel Vernier callipers 01 110. Pane balance cop. 1 to 2 Kg. 01 111. Weight box in wooden (cap 1 kg) 01 112. Ganesh hand sprayer 01 113. Stove 01 114. Bhagona with cover, Stealness steal slit cap 01 115. Knifer 12 116. Spoon 12 117. Forks 12 118. Chips cutter 02 119. Bhagona Aluminium with cover 02 120. Nova gas with Burner 01 121. Revaling Stool 15 122. Crown Carking Machine 01 123. Extension board 01 124. Extension board 01 125. Test tube Stand (72 tuber) 01 126. Mixes cum juices 01 127. Heating Mental cap 2 litr 02 128. Water Filter 01 129. Over Head Projector with stand 01 130. Hot Plate 01 131. Magnifying Lenss4”dia& 2”dia 04 132. Forceps fine 12 133. Top Pan Balance 01 134. Autolave Model AC-101 01 135. Getner Microscope 01 136. Lock NavTal 01 137. Rado 10 Liver 01 138. Rado 10 Liver 02 139. Devimal Balance 01 140. Medico Centrifuge Machine 01 141. Slide Cabinet 01 142. Pan Balance with Weight 1Kg 01 143. Hot Plate Coil Type 02 144. Analegue Conductivity Meter 01 145. Disc Electrophotesis apparatus 01 146. KjeldnalDistilation apparatus 01 147. Ph-Meter 01 148. Getnor photomicrography equipment 01 149. Standard Camera Lence for retino photo graphy 01 150. Pasturisation Bleaching Tank 01 151. Mufflle Furnace 01 152. W.T.C Deionises 01 153. Yarco Lux meter 01 154. Lab Heating Plate 01 155. Osaw Universal Masture meter 01 156. AT.CO. Electric Balance 02 157. Phone tonica 01 158. Soxter app. With heating mental 01 159. Extension app. 200ml Flask 06 160. Heating Mental cap,100ml,250ml, 100ml. 2000ml (3+3+3+3) 12 161. Hot air oven 01 162. Digital tap Loading Balance 01 163. Hot Air Oven 01 164. Digital Electric top loading balance 01 165. Plane Paper Copies 01 166. Whirlpool Refrigerator 310 litr 01 167. HP Scan Jet 01 168. Lab Stool 20 No +10 No 30 169. Exhibit Panel for outdoor size 01 170. White board 01 171. Calculator 01 172. Spring Balance 20Kg. Cap 01 173. IBM Nest Vista Computer 01 set 174. Portable Loose Steel yard Type balance (250Kg) 01 175. TUS Start U.P.S 01 176. Sharp Aj 800 colour Printer 01 177. Digital top loading balance 01 178. Godrej Refrigerator cap (300ltr) 01 179. Rakmi lock 7 Liver 03 180. U.P.S (AFC) 01 181. RD -116 -03 -Display Board 02 182. Tray dies (seed driver) 01 183. Seed Cabinet Form 03 184. Seed Cabinet Form 02 185. (1) B.O.D In cabateryorea 01 186. (2) Fluaescaltubeni 01 1.6 . MES Veg. Science 1. Rotavator Tractor Machine 01 - - - 1 Steel Almirah 4Nos 2. Terracer Blade 01 2 Grain bin 12Nos 3. Offset Disk Harrow 01 3 Maruti foot Sprayer 2Nos 4. Tractor Messi Forgussan with all instruments 01 4 Orient Hand Duster 1Nos 5. Bag clear Rebo Model DAR machine Sealing Machine 01 5 Torch 5Nos 6 Drum (200 lt cap.) 2Nos 7 Jack (5to10 tons) 1set 8 Stool wooden 6Nos 9 Iron plates 1500 Nos 10 Watering Cane 6 Nos 11 Weight of Iron 18Nos 12 Hasiya 6Nos 13 Steel Box 6Nos 14 Canester Tin 14Nos 15 Table 2Nos 16 PTO Pully 1Nos 17 Wooden Structure Self 2Nos 18 Laltain 1Nos 19 Sealer 1Nos 20 Chair Wooden 3Nos 21 House Pipe 60m 22 Spring Balance (10 kg cap) 2Nos 23 Balance Wooden Structure 1set 24 Network Component 4Nos 25 Maruti Hand Sprayer 1Nos 26 Lock 10Nos 27 Display Board with Stand 3Nos 28 Pump of diesel 1Nos 29 Measuring Cane (5lit cap) 1Nos 30 Measuring Cane (10 lit cap) 1Nos 31 Room Heater 1Nos 32 Weight Box 1Nos 33 Nap sac Sprayer 1Nos 34 Circular Hanging Balance 2Nos 35 Balance Plate (glass body) 1Nos 36 Galaicha (carpet) 1Nos 37 Sabbal Iron 1Nos 38 Iron Top (tasla) 5Nos 39 Kudal 27Nos 40 Spade (ordinary) 67Nos 41 Spade (TATA) 15Nos 42 Khurpa and Khurpi 62Nos 43 Axe 5Nos 44 Bucket Iron 7Nos 45 Ganesh Hand Sprayer 2Nos 46 Fan 4Nos 47 Plastic Drum 4Nos 48 Check Valve 1Nos 49 C. I band 1Nos 50 Flench 1Nos 51 Pan Balance 2Nos 52 Frant Dail Balance Top Balance 3Nos 53 Palastic Hand Sprayer 1Nos 54 Drum 1Nos 55 Cycle Hind 1Nos 56 Type Writer (Hand) Remington No 625576 1 Nos 57 Tripal 4 Nos 58 Book Self(Wooden) 2 Nos 59 Lock 4Nos 60 Hedge Shear 1 Nos 61 Plas (iron) 1 Nos 62 Punch 1 Nos 63 Steplar 1 Nos 64 Screw rinch 1 Nos 65 Nose Player 1 Nos 66 Chheni 1 Nos 67 Hammer 1 Nos 68 Dirbily 2 Nos 69 Penchcas 1 Nos 70 Reti 2 Nos 71 Tractor engine No 12526 Chasis No 002252 1Nos 72 Tractor Trolly 1Nos 73 Screper 1Nos 74 Disc Harrow 1Nos 75 Cultivator 2 Nos 76 Rickshaw 1Nos 77 Table 3Nos 78 Wooden Structure Self 5Nos 79 Diesel Engine 2Nos 80 Chair Wooden 5Nos 81 Cage Wheel 1 Set 82 Ridger (3 Farrow) 1Nos 83 Hand Pump 1Nos 84 Structure Iron 84Nos 85 Hand Cart 1Nos 86 Table Lab (wooden) 1Nos 87 Disc Plough 1Nos 1.7 . College Administration 1 - Resograph Automatic Master Printer K58001 01 No. 1 - Water Cooler 02 Nos. - - - 2 - Digital Copier/Laser Printer 01 No. 2 - Induction Verner 01 No. 3 - Vacum Cleaner Erodean Acc Model 01 No. 3 - Chair Steel 17 Nos. 4 - Sharp Fax FO 650 Machine 01 No. 4 - Power Inverter 01 No. 1.8 . Land Scape 1.9. Medicinal & Aromatic Plant 1. Pocket Refractometer 01 - - - - - - 2. Electronic top pan balance Model LCB -4B 150 g capacity K -Roy make 01 3. Villey grinder inner chamber, blades 40x25 mm Khera make Model KJ -110 (a) 01 4. Juicer cum grinder (Fisher) cap 1.0 litre 01 5. Semi Micro balance Sortorius Model -2004 01 6. Decimal balance Triple beam cap. 3kg Avon 01 7. Triple beam balance cap 0.111g 01 8. Borer set 01 9. Steel cork borer set 01 10. High speed centrifuge type C-24 Remi 01 11. Centrifuge medico Remi 01 12. Chromatography drier 01 13. Thin layer chromatography kit 01 14. IEC-222 Descicator cabinet of thick guage alluminium stand glass door 01 15. Indian Two bed portable Deionizer model C-A- 20 IU 01 16. Sambrass portable gas generator type-12 with burner 01 17. Glass cutter Kohinoor 01 18. Grinding mill (Villey mill type) 100 mm Yorco 01 19. Heating mantle with energy regulator capacity 5000 ml 1000 ml 500 ml 250 ml 100 ml 50 ml 05 02 02 02 02 02 20. Laboratory heating plate with regulator size 45x60 cm 02 21. Hot plate electric(CICE) round size 12” dia. 01 22. Knife steel 02 23. Micro kjeldoll stand (prequel type) 02 24. Lock 01 25. Lock 01 26. Pump plier 01 27. Screw driver 01 28. Muffle furnace MIC make size 12x6x6 01 29. Melting point apparatus with cooling plug 01 30. Moisture meter optics 01 31. Chromatography oven front opening 650x650x600mm 01 32. Sew make oven vacuum size dia. 300x300 mm 01 33. Systronics griph pH meter portable battery operated 01 34. Flame photometer (Systronics) with spare parts- Burner unit ; Galvanometer ; Compressor Each 01 35. Research Polorimeter- Getnor SP-02 01 36. Leonard refrigerator cap. 286 lit. 01 37. Rotary vacuum flask evaporator-Toshniwal 01 38. Abbo type refractometer 01 39. Burrett stand (iron) without clip 02 40. Tripod stand small size long size 04 02 41. Stand & clamp iron AJE make 10 42. Stand for clavenger apparatus 04 43. Flask shaker for 04 flasks AJE 01 44. Reciprocating shaker 01 45. Sand bath electrically heated double walled 01 46. Spectronic-20 Bush & Lomb model USA 01 47. Spatula stainless steel 05 48. Spatula stainless steel Big Small 03 02 49. Scissor stainless steel 03 50. Remi make medium duty stirrer with1/2 HP motor model R.O.1240 01 51. Magnetic stirrer with hot plate cap 2 lit. 01 52. Stop watch 01 53. Soil spoon set 01 54. Temperature control unit with energy regulator MIC make 01 55. Voltage stabilizer 5kva Khera 01 56. Weight box 01 57. Paraffin embedding water bath cooper 01 58. Water bath cylindrical 25x20 cm 01 59. Water bath cylindrical 25x15 cm 01 60. Water bath rectangular 25x35x10 with 6 hole 7.5cm dia. 01 61. Lock Harison lock Prince 01 01 62. Heating mentle cap. 5 lit. Tanco make PLT 165 02 63. Heating mentle cap. 10 lit. Tanco make 01 64. Enamel trey 8”x6” 12”x10” 18”x12” 05 05 04 65. Lab table size 5′x2.5′x3′ (sun mica top) Lab table 5′x2.5′x3′ (ply top) 02 02 66. Chromatography cabinet wooden size 600x600x300 mm 825x825x225 mm 01 01 67. Flask stand seesham wood 04 68. Lab table Sun mica top with rack 7′x2.5′x3′ 02 69. Stool revolving 18”x12”x12” 04 70. Office chair rectangular pipe 01 71. Physical balance Avon make 01 72. Physical weight box 01 73. Single pan balance model K -14 KRoy make 01 74. Stabilizer 1.0 kva sagar make 01 75. Mixer cum grinder cap 1.0 lit. 01 76. Autoclave vertical 250x450 mm 01 77. Hot plate electric CICE round size 12″ dia. 01 78. Cintex heating mantle cap 2.0 lit. 02 79. Laboratory stool with sun mica top 03 80. Tinocular microscope with accessories model METZ779A 01 set 81. Leetz base slide microtone 1400 with flooring 01 82. Sprit lamp 01 83. Wooden hood show case size 2′x1.5′x2.5′ glass covering 01 84. Glass equipment wet & dry thermometer 01 85. Emergency light with battery 01 86. Scientific calculator 01 87. Maruti foot sprayer 01 88. Hazara 04 2. College of Fisheries 2.1 College of Fisheries Farm 1. Almira Steel size 1525×760×460mm 01 - - - - - - 2. Wooden Table Sunmica Top size 4×2×2.5 01 3. Laboratory Table Wooden Top Sunmica 01 4. Chair Arms Wooden 02 5. Chair Teak Wooden Arms 01 6. C.M.C.Chair Revolving 01 7. Chair Wooden Officer 01 8. Calculator 01 9. Iron Box size 4×2.25×2.5 01 10. Tulaman Balance 5kg Cap. 01 11. Tarch Three Cell 01 12. Centrifugal Machine Han Driven Four tube 01 13. Chair Wooden (Teak)Officer 01 14. Chair Officer Teak Wooden 01 15. Chair Arms 03 07 16. Table Steel size1220×760×760mm. 01 17. Table Wooden 4×2×2.5 01 18. Black Board Tigodiya Size6×2×1.5 01 19. Wall Watch (Quartz) 01 20. Almirah Steel size 1525×760×460mm. 01 21. Air Cooler,Symphony 01 22. Dissecting Stand Wooden 02 23. Air Compressor withoutBatery. 01 24. Refrigerator (Godrej) 01 25. Stablizer 01 26. Stablizer Vilex 01 27. Stablizer Stand 01 28. Stapler Small 02 29. Oxygen Gass Cylinder with Regulator 01 30. Pond Aretor 1.2H.P. 01 31. Stool Wooden size 1.5×2.5×1 01 32. Heater 02 33. White Borad size 120×120cm. 01 34. Exibites Pannel for Indoor use size 120×60cm. 01 35. U.P.S.Battery 01 36. Computer Simence 01 37. Scan jet H.P.2300C 01 38. H.P.Inkjet Printer Model SS50 01 39. Wooden Board (deptt.) Size2×1.5 01 40. Pulli 01 41. Lineva Think Desk top Computer 01 42. Spectro Calorimeter 01 43. Streching plate 01 44. Heatingh mental 01 45. Dissolve Oxygen Meter 01 46. Portable Digital ph meter 01 47. Digital Nephelo -Terbidity Meter 01 48. Hot plate 01 49. Slide Projecter 01 50. Type Riter Hindi 01 51. Type Riter English 01 52. Lejar printer colour hp 01 53. White Board 120×120cm. 01 54. Exhibit panel size120×60cm 01 55 Fawada 2 56 Torch Everready Three cell 1 57 Injan Kriloskar 8 H.P.with Assosries 1 58 Trolly Iron 1 59 Khurpi 1 60 Hansiya 1 61 Motar Strater 7.5H.P. 1 62 Kriloskar Pump HWAD100MMFLP 1 63 Plankton net 1 64 Kriloskar Electric Moter 3 Phase 7.5 H.P. 1 65 Main swith 32 AM. 1 66 Moter Stratar 1 3. Directorate of Research photocopier machine 4. D.W.P 1. Steel Almirah Big Size 1 No. - - - 2- e stfjax V si 15 eh0 01 2. M. S. Conduit pipe ¾ 215 Nos. 3- e stfjax V si 03 eh0 01 3. Damage old high level cistern 25 Nos. 4- :e dwyj dsu0LVkj e sd 01 4. G.I. Hooks 3 Bag 5- QksVks dkfi;j ekMy ,p0ih0 420 01 5. C. I. Pipe 3 & 2 ɸ 6´ long 18 Nos. 6- CY;w fizUV e‛khu 01 6. CI Tee 4 size 30 Nos. 7- vksYM Mªe 04 7. C I Bend 4 size 15 Nos. 8- pSu fVfdy 01 8. C I Cowel 4 25 Nos. 9- ,DlkbM cSV ªh 08 9. Old Main Switch 30 Nos. 10- dEI;wVj ,p0lh0,y0 vksYM ekMy 01 10. Old Starter 4 Nos. 11- Q SDl e‛khu 01 11. Old 63 kVA Gen set with Radiater 1 No. 12. Old NRV 6 size 1 No. 13. Scrap C 1 (Sanitary) L. S. 14. Scrap G 1 (Water Supply) L. S. 15. M. S. Pipe 4 Damage 15 Nos. 16. Scrap M. S. Angle pieces L. S. 17. Diesel Tank 200 Lts. old 1 No. 18. Old PVC Scrap L. S. 19. CID Joint 6 size 15 pair 20. Air cooler without fan 4 Nos. 21. Sodium Light fitting 100 Nos. 22. Genset 15 kVA 01 No. 23. Inverter Old Model 1600 VA 01 No. 24. 7.5 K.V.A. Gense . Sports 1 Allgro Cycle 02 1 Chair Wooden 10 - - - 2 Basket Pole with board 1.30mt.x1.2mt. 01 set 2 Score Board Cricket 01 3 Basket Ball Board Ply 01 set 3 Score Board VolleyBall 01 4 Body Boom 02 4 Score Board Foot Ball 01 5 Back - Hiper 01 5 Score Board Hockey 01 6 Cycle Hero 01 6 Almirah Big 01 7 Climbing Stand 01 7 Parallettes Bar 01 8 Clock 01 8 Aeroline Mini Stopper 01 9 Duplex Twist Machine GYM 01 9 Almirah Small 01 10 Dumbles 02 pc 10 Plcetic Chaur 03 11 Dumbles 04 pc 12 Foot Ball Pole 01 set 13 Fabara ¼ QkSvkjk ½ 03 02 14 Khurpa 04 07 15 Hasiya 02 16 Daroti 01 17 Leg Ext Machine 01 18 Multi Hyper 01 19 Bonch Machine 01 20 Hand Cart Pipe 01 21 Stop Watch 03 22 Hammer 16lb 01 01 8lb 01 23 Hammer 12 lb;16lb 01 01 24 Hurdles 30 25 Hurdles 54 10 26 Hand Ball Pole 01 set 27 Hockey Goal Board 01 set 28 Hand cart 01 29 Hazara 02 30 Locks 02 05 01 31 Locks 01 32 Leg Press Machine 01 33 Line Marking Machine 01 34 Casttle amplifire 01 35 Horn Ahiye 02 36 Lunit Driver 02 37 Microphone 02 38 Microphone 01 39 Sound Colum 02 40 Microphone Stand 02 41 Microphone GTP 01 42 100 mire 100 mt 43 One Are 01 44 One Ballog 01 45 Cassettes 06 46 Extension 01 47 Petro Max 01 (2kg) 48 Biven Back 01 ladies 01 Gents 49 Calculator 01 50 Sector 02 51 Stop Watch Table 01 01 52 Starting Block 02 03 53 Basket Board 1.84x1.22 ply 02 pcs 54 Basket Board ply 04 55 Basket Ball 6” Steel Pipe with ring 01 set 56 Basket Ball Board Fibre 01 set 57 Exercise G202 01 58 Power Mistri functional Shocket 01 59 Jogger 01 60 Power Steeper 01 61 Vibretor Massager Sharp 01 62 Multi Gym Station 01 63 Foot Massager 01 64 Twister 01 7 Hospital 7.1. Hospital (A) scrap 8. College of Home Science 8.1. Home science (Dean Ofc) 1. Zerox W.C. Pro 420 Copier 01 - - - - - - 2. Digital Photo Copier Toshiba ES -163 01 3. Zerox photo Copier 5821 -IV 01 4. Calculator 03 5. Digital Multifunction fax 01 6. Godrej Chair CH -4012 With Desk 11 7. Calculator 02 8. Hindi Manual Type writer 01 9. Calculator 01 8.2. Centrel Store (Dean Ofc) 1. Chair Wooden Armetic 01 2. Chair Wooden Armetic 02 3. Chair Wooden Armetic 05 4. Student Chair Wooden 40 5. English Type Writer 01 6. By Language Type Writer 01 7. Mestetner Duplicating machine 01 8. Canon Plus Paper Copier Machine 01 8.3. Textile & Appareal Designing 1. Hot Plate 01 2. Swing Machine Wooden Box Cover 01 3. Press Table 02 4. USHA Sewing Machine Wooden Cover 03 5. Physical Balance 02 6. Thread Box Fiber 01 7. Threader 01 8. Stove 01 9. Patila With Lid 01 10. Single Pan Balance K-14 super 2 K.G 01 8.4 Family Resource Management& Consumer Science 1. Press 2 2. Scissors big 2 3. Scissors small 2 4. Emergency light (ORPAT) 1 5. Remson O.T.G. 1 6. Victimizers model vis-512 1 7. Softel ice cream machine 1 8. Zirob filter 1 9. Domestic flour mill complete unit 1 10. Stabilizer vucum-4 1 11. Stabilizer veelex 110 to 290 1 12. Teaching and documentary education C.D. 1 13. Video recording documentary education C.D. 1 14. Pedelite C.D. SENSORS 3 15. Bajaj water filter 1 16. Montal 1 17. Refrigerator godrej 300 LIT. 1 18. Godrej Refrigerator 165 lit. 1 19. Stabilizer 0.5 KVA 1 20. Towelstand 1 21. Dressing table with glass 3 1 22. Deewan size 6‟x3‟ sunmica posted with box 1 23. Folding cotsize 6x3x1.5 6 24. Folding chair 4 25. Dining table with 6 chair 1 26. Deval watch Quartz 1 27. Table watch with alarm 1 28. Lock 2 29. Charge 6/12 volt 1 30. Sun Hot Emerson rod 2 31. Stabilizer 2 KVA 1 32. Food Processor 6005A00 1 33. Food Processor Jar 1 34. Kodak Camera with real 1 35. Philips steam iron 1 36. Mops 2 37. Merit Universal umbrella Sewing Machine 1 8.5. Food Science & Nutrition 1. Balance 5kg Dial type 2 2. Balance 1 kg dial type 6 3. Personal weighing machine 1 4. Analytical balance double pan AVON Make Model AB-F1 Capacity 200g 1 5. Voltas Stabilizer Vilex EWR 110-290 1 6. Voltas Stabilizer 1 7. Stabilizer 0.5 KVA for Refrigerator 1 8. Stabilizer 850 VA (fitted in refrigerator coca cola) 1 9. Bomb calorie meter with digital display Telco Make Model PLT-300 1 10. Bhagona St. steel with cover 19 cm 4 11. Bhagonaalluminium with cover 1 12. Knife 10 13. ChaklaBelan 7 14. ChaklaBelan 10 15. Cooker 6.5 lit. Howkins 1 16. Cooker Anupam 4 17. Howkins Pressure cooker 2 lit. 10 18. Idly cooker 1 19. Chhani 5 20. Glass steel 12 21. Gas cylinder 1.8 kg with lamp attachment 5 22. Stove Caption 6 23. Electronic Gas lighter 2 24. Gas tandoor (podimin) 1 25. Jug steel 2 26. Jug steel 2 27. Katori St. steel small 10 28. Katori steel 05 29. Chili cutter 1 30. Fanlastique Vegetable cutter 1 31. Kalchhi steel big 2 32. Greater 2 33. Booti mixer 1 34. Juicer attachment 1 35. Food processor singer 1 36. Mug tea 12 37. Muffles furnish regulator lamp model 5 KW Cap. Size 200x 200x300 mm retery J.K.W.9000C Model K1- 180 khera Make 1 38. Maharaja ketli White Line electric Kettle 1.7 lit. 1 39. O.T.G. bajaj Oven 1 40. Super Flame O.T.G oven with glass door with timer 1 41. Renold hot food cabinet box type 1 42. Knife cum peeler 2 43. Pelicane fitter cap. 20 lit. 1 44. Refrigerator Allvinindia ltd. 165 lit. cap. 1 45. Godrej Refrigerator 300 ltr. cold & gold Blue Compressor no. 146105 cabinet no. 146105 1 46. Stove nootan 5 47. Nootan stove 5 48. Tea spoon 12 49. Laboratory Table sheesam wooden top sunmica 60x30x30 1 50. Tava 2 51. Thali (2.400g) 5 52. Balti 1 53. Tea pot Melton 2 lit. 1 54. Container tin 15 kg 4 55. Vaccum pump (yarko make) cap. 45 lit./mit, 0.25 HP 1 single stage cat no. YSI-538-(-) less special discount @ 2% 56. Vaccum pump single stage cap. 25 lit. H.P. motor .25 model K1-106 1 57. Strainer (chalni) 1 9. Guest House 9.1 VC Residence College of Veterinary Science 1 0.1 Vet. Biochemistry 1 Automatic slide projector Getner MP 410 01 - - - - - - 2 Balance cell colorimeter 102 Systronics 01 3 Chinometric balance 01 4 Clinical chemistry analyzer 171 Systronics 01 5 Densitometer 205 Autoscanning computing Systronics 01 6 Flame Photometer CL360 ELICO 01 7 Glucometer 01 8 Lab Heating Plate with cast iron top 01 9 Lab wooden stool 05 10 Muffel Furnace 18x9x9 01 11 Over head projector RG200 -05 01 12 pH analyzer LI612 ELICO 01 13 Refrigerator 300Lit Capacity Godrej 02 14 Spectroflurometer SL 174 ELICO 01 15 Spectronic 20 Milton Roy 01 16 Triple Beam Blance direct reading 0.1 to 111 Grms 01 17 UV -VIS Spectrophotometer 119 Systronics 01 18 UV -VIS Spectrophotometer 117 Systronics 01 19 Wooden chair 05 20 Kyocera Mita Digital Printer (Taskalfa 180) 01 21 Analytical weight box upto 50grm 01 22 Physical Balance 01 23 R - E - G - N -008 Primary Gradient HPLC System with HD 461 SN003 01 24 VDO Cassette;Cell structural unit of life 01 25 VDO Cassette;Cell & What they Do 01 26 VDO Cassette;Cell Biology cytoplasm 01 27 VDO Cassette;Cell Biology Nucleus 01 28 VDO Cassette;Cell Biology the Plasma membrane 01 29 VDO Cassette;Cell Biology structure & composition 01 30 VDO Cassette;Biotechnology 01 31 VDO Cassette; Genetics:Improving plant and animals 01 32 VDO Cassette; Biological science:Molecular Biology 01 33 Transparency sheet Box Code No. 201 -04 Rescholar 01 34 Projection screen tripod model deluxe code No RO 2007 -01 01 35 Transparency Kit Cat. no.RO2001 -05 01 36 APC Back UPS 800 VA 01 37 HP Laserjet printer 2015 01 38 UPS 500 VA Mega Blue Bird 01 39 HP Computer PC DX 2280 Desktop PC 01 10.2 Animal Breeding & Genetics 1. Table VDO Size 04 1. Inclind Student Microscope 05 - - - 2. HP Laser jet 5 01 2. 3. HP Laser jet 1100 & Printer 01 3. 4. HP Desk Jet 970 01 4. Microscope Inclind Getner 01 5. HP Scan Jet 5200 c 01 5. Over Head Projector with Accessories 01 6. Zenith Pentium PC System with Accessories 02 6. Auto Slide Projector 01 7. 1 KVA Eltech UPS 01 7. Accessories for slide projector spare magazine 50 slide spare Halogen Temp 02 02 8. 1 KVA Eltek UPS 01 8. True Power UPS 1KVA 01 9. 3 KVA Eltek UPS 01 9. Kill buen document Binder 28 mm 01 10. Minolta EP 3170 Copier 01 10 . Duplicater Model 145 01 11. 2 KVA Voltage Stabilizer 01 11 . Godrej Type writer 01 12. 5 KVA Voltage Stabilizer 01 13. Window AC 1.5 ton with Accessories 02 14. Compaq Presario Computer with Accessories 04 15. Compaq Presario Computer with Accessories 03 16. Computer HCL with Accessories 03 17. HP Desktop 8000 series with Accessories 02 18. Tripple Beam Balance 01 10.3 Livestock Products Thechnology 1. HP Compaq PC DX 2280 desktop PC 1 No. 1. pH meter pen type digital microprocessor based with temp. campen 1 No - - - 2. HP Laser Printer 1320 N 1 No. 2. Cream Seperator (hand drive) 1 No 1. Transparency Sheet Box 1 No 3. Bottle washing machine 1 No 4. Ice cream freezer electric drive with electric moter 1 /2 hp 1 No 5. Ice Chamber 3 No 6. Milk Stainer 12 No 7. MBR Bath 1 No 8. Iron Bhatti 1 No 9. HP Colour Laser Printer CP 1215 1 No. 10 . 800 VAPC BACK UPS model BE 800 1 11 . 500 VAPC BACK UPS model BE 800 1 12 . Toner Cartridge 1 13 . Calculator 1 14 Battery 02 . 15. Protein Digestion Assembly 01 16. Kjeldahl Apparatus 01 1 0.4 Pharmacology & Toxicology 1 Vaccum Pump 1 1 Computer Compaq Presario 1 - - - 2 Refrigerator + Stabilizer 1 2 Over Head Projector 1 3 Electro -Convelsometer 1 3 Autoanalyser 1 4 Chinametric Analytical Balance 1 4 Chemical Balance 6 5 Pricription Balance 2 6 Perforated Board 1 7 UPS, APC 1 8 Spectrophotometer 1 9 UP Based Ph Analyser 1 10 Room Heater 2 11 Analgesiometer Tail Flick Method 1 12 Rota Rod Apparatus 1 13 Digital Electronic Top Loading Balance 1 14 APS Back UPS 1 15 Deep Freezer 1 16 Water steel Wall Mounting 1 17 Serological Water Bath 1 18 Vertex Shaker 1 19 Micro Tissue Homogenizer 1 20 Electro -Convalsometer 1 21 Isolated Organ Bath 1 22 Pole Climbing Apparatus 1 23 Singal Pan Electrical Balance 1 1 0.5 Public Health & Epidemiology 1. BOD Incubator “Tanco‟ 1 No - - - - - - 2. Refrigerator Godrej 303 Lit 1 No 3. Low Temp. Freezer “Tanco‟ 1 No 4. Quick Freezer “Mac‟ 1 No 5. pH Meter “Tanco‟ 1 No 6. Desk Top Computer HP 8000 Series 1 No 7. Printer HP(colour Laser Jet cp 1515n) 1 No 8. UPS (APC Back UPS RS 800 1 No 10.6 Gynecology & Obstetrics (Category A) Gynecology & Obstetrics (Category B) 1 HP Desktop PC (CPU+Monitor+Mouse+Key Board) 01 1 Dell Laptop (Accessory item) 01 - - - 2 Digital Electronic Top Loading Balance, capacity 300 gm 01 2 Digital Camera Sony Make (Accessory item) 01 3 Rescholar Overhead Projector Supreme 01 3 HP Deskjet Printer (Accessory item) 01 4 HP Laser Printer 01 5 800 VA APC Back UPS 01 6 Computer Table 01 7 Revolving Chair 01 8 Hand-held UV Lamp 01 9 Ultra Low Temperature Research Cabinet Yarco 01 10 Thermo heating Stage 01 11 Universal Trinocular Research Microscope MDILUX 01 12 Advanced digital colored video system 01 13 HP desktop computer set DX2480 01 14 HP laser printer -1005 01 15 650 VA APC UPS 01 16 Eleco FG LI 614Ph meter 01 17 Quick Freezer (Remi) 265 lit 01 18 Submarine Electrophoresis (Sonar) 01 19 Vertical Slab Electrophoresis (Sonar) 01 20 Digital Power Supply for Electrophoresis (Sonar) 01 21 High precision digital scale (Sonar) 01 22 Air Cartel (Sonar) 01 23 UV Sterile Chamber (Sonar) 01 24 Dell E-5410 Laptop 02 25 Reliance Data card 01 26 Analytical Balance Merck, 234 DE 01 27 Godrej Split AC (1.5 TON) Gse18F 3W 1 M 01 28 Digital Copier with printer & trey WC 5020 01 29 Stabilizer (3 kVA) 01 30 Pass Box Micro Make MSW-183 02 31 Economy Executive Chair 01 1 0.7 Vet. Surgery& Radiology 1 - Refrigerator (300Lt Godrej Cold Gold) 1 - - - - - - 2 - Stablizer Velex 0.5 kva 1 3 - Godrej Revolving Chair CHR -7 1014 1 4 - Weighing Machine( Libra make) 1 5 - Perforated Board 1 6 - Electric Emergency Light (Bpl dry battery) 1 7 - Mechanical Balance (200gm Capacity with .001gm readability & 90mm pan size). 1 8 - Auto razor Sharpener 1 9 - HP Computer ( pcd x 2280 desktop PC With CPU,Monitor,keyboard,Mouse) 1 10 - HP Laser jet Printer 1320 1 11 - UPS (800va apc Back ups modal BE800 1 12 - Over head projector (a) Suvira (b)Rescholar 11 13 - Microtome precision rotary 1 14 Microtome Razor 1 15 - Microtome Knife 120mm khera 1 16 - Magenetic Hot Plate stirrer 1 17 - Lab Table( C Cupboard 8x4x2.1‟) 2 1 0.8 Anotomy & Histology 1 Automatic Tissue Processor Deluxe Model SP 40 01 01 Wooden Chair Officer with Arm 01 - - - 2 Triple Beam Balance for direct Reading 3 Kg (Khera Model) 01 3 Triple Beam Balance for direct Reading 3 Kg (Khera Model) 01 4 Refrigeration with Stabilizer 300 lit. 01 5 Black Board with Stand 01 6 Drill Machine (Electric) 01 7 Stool Sunmica Top 06 8 Lab Stool Wooden 09 9 Godrej Chair PCH-1014 (750 x750 x 920 mm) 01 10 Godrej Chair CHR - 7 (560 x560 x 900 mm) with Arm 03 11 Godrej Chair CHR -7 without Arm 01 12 - Wooden Chair with Arm 03 1 0.9 Vet. Parasitalogy 1 Laboratry Centrifuge Machine (MAC) 4×50ml 1 1 H.P.Compaqe PC D×2280 Desk Top 1 - - - 2 B.O.D. Incubator (MAC) 500×830×415 1 2 800VA APC Back UPS 1 3 H.B.Meter Digital M.S.W. 547 1 3 H.P.Inkjet Printer 1 4 Chair (Revolving) Godrej 1 5 Bench (Wooden) 4 seater cat no.23 1 6 Staff Chair (Wooden) 5 10.10 Physiology&Bio Chemistry 1 Olympus Inclined Binacular Microscope 04 1 Sphignomanometer 05 - - - 2 Medilux-12 01 2 Mercury Sphignomanometer 04 3 Getner Binacular Microscope 01 3 Orpat Telephone 01 4 Godrej Refrigerator 300 Lit. 01 4 Isolated Organbath(MAC)MSW-722 02 5 Over Head Projector SUVIRA-301 01 5 Scientific Calculator 01 6 Mediflame Photometer Model -127 01 6 Medzer Monocular Microscope METZ777 03 7 Flame Photometer Model-CL-360 01 7 Officer Chair Wooden Armed 01 8 Stool Sunmica Top 03 8 Microscope Getner 01 9 UPS 800 VA,APC Model-800 01 9 Spare Cutter for Gel 01 10 IEC Electrophoresis 01 11 Disc Electrophoresis 01 10.11 Vet. Pathology 1 Microtome Precision Rotary YSI 114 01 - - - - - - 2 Microtome Precision Rotary Lip Shaw type MAC Make Cat No. MSW 452 01 3 Shaking Machine Type Yarko Make YSPL-516 01 10.12 Vet. Medicine 1. Deep freezer 01 1. PH metre 01 - - - 2. Milk analyser 01 2. PH metre 01 3. UPS 01 3. Stablizer 01 4. UPS 01 4. Stablizer 01 5. UPS 01 6. UPS 01 7. Printer 01 8. Printer 01 9. Rescholar Over Head Projector 01 10 Stablizer 01 10.13 Vet. L.P.M 1 Compact Centrifuge 1 1 Incline Student Microscope 4 1 Erma scope EP 404 1 2 Single Pan Balance 1 2 Steel table sun mica top with side drawers 1 2 Microtome 1 3 Hot Air Oven 1 3 Steel table sun mica 1 3 Mannual Type Writer 1 4 Lab Heating Plate with cast iron top 1 5 Triple Beam Balance 3 Kg 1 6 Triple Beam Balance 111gm 1 7 Microscope Monocular 2 8 Dissecting Microscope 2 9 Incline binocular Microscope 2 10 Trans Cope Compact Portable over head projector 1 11 Godrej chair without arm 1 12 Godrej chair 2 13 Refrigerator 1 14 Voltage stabilizer 1 15 Micro processor stirrer combined 1 16 Office table 1 17 UPS 800VA 1 18 Enameled kidney trey 8ʺ 1 19 Enameled kidney trey 10ʺ 1 20 Enameled kidney trey 12ʺ 1 21 Bull Holder 5 22 Enameled Mug 7cm 1 23 Enameled Mug 12cm 1 24 Enameled Funnel 6ʺ 1 25 Enameled Wash Basin 30cm 1 26 Enameled Wash Basin 36cm 1 27 Enameled Wash Basin 40cm 1 28 Enameled trey without cover 12x10 1 29 Enameled trey without cover 12x14 1 30 Enameled trey without cover 18x24 1 31 Enameled trey with cover 8x10 1 32 Enameled trey without cover 12x10 1 33 Enameled jug 2 point 1 34 Enameled jug 4 point 1 35 Enameled jug 6 point 1 36 Enameled bucket with cover 10ʺ 1 37 Enameled bucket with cover 11ʺ 1 38 Stomach pump set 1 39 Mouth Gag (Wooden ) 3 40 Mouth Gag Vernels 2 41 Tooth Cutter 2 42 Stomach Pump Complete 2 43 Rumenotomy set 2 44 Rumenotomy set best quality 2 45 Hoof Trimmer 5 46 Hoof Cutter 2 47 Curry Comb (horse) 8 48 Dandy Brush 1 49 Body Brush 2 50 Body Brush Super 4 51 Ridding Briddle (single/double) 2 52 Polo Saddle 1set 53 Driving bridle 2 54 Muzzle leather 2 55 Harness collar 2 56 Hobbles casting hitting for horse 4 57 Tooth Rasp Super Quality 1 58 Head Roap 5 59 Hoof Picker (horse) 2 60 Harness Saddle 1set 61 Harness crupper 2 62 Riding Saddle 1set 63 Cellophane roll 1 1 0.14 Vet. Extension Education 1. Computer -IBM 01 1. Student chair - wooden 03 - - - 2. UPS -IMS, 60 min. backup 01 3. UPS -Kukrej -03 min backup. 01 4. Exhibit panel outdoor -150x90 cm 03 5. Dual purpose, half exhibit& white 01 6. Stool - sunmika top 02 7. Chair armless, wooden 10 1 0.15 Animal Nutrition 1. Chainometric Analytical Balane Macromake 3 - - - 1 Autoclave - 2. Chemical Balance 1 3. Triple Beam Balance (110 g) 1 4. Triple Beam Balance (3000 g) 1 5. Triple Beam Balance (5000 g) 1 6. Refrigerator (Allwyn withstand and stabilizer) 1 7. Refrigerator (Godrej with stabilizer) 1 8. Vaccum pump (0.25 H.P) 1 9. Water Bath (10 ×6 steel round) 1 10. Water Bath (Single Wall size) 1 11. Bomb Calorimeter MSW 1 12. Low cost freezer (MAC) 1 13. H.P. Compaq Desktop with printer and UPS 1 14. H.P. Compaq Desktop with printer and UPS 1 15. Metabolic Shaker Chamber 1 16. Vortex Mixture 1 17. Willey grinder mill (0.25 H.P.) 1 18. U controlled based P.H. System (Systronic) 1 19. Spectrophotometer (Systronic) 1 20. HP printer jet1360 1 21. CD writter 1 22. Over Head projector (SUVIRA) 1 23. Over Head projector (Reschlor) 1 24. Over Head projector (Trolley) 1 25. Projection Screen 1 26. Projection Screen 1 27. Lab stool (Wooden) 5 28. Armed Cushion Chair 3 29. Name Plate(Big Size) 8 30. Name Plate(Small Size) 3 31. Perforated Board(180 × 90) 2 10.16 Teaching Veterinary 1. Armed Office Chair Wooden 05 1. Laminated Chart Framed on 6 mm ply with beading (22”x28”) 24 16 1. Street Light fitting (Removed from VCC building and Electric poles for replacement with LED lights) 7 No 2. Christensan‟s teat Slitting scissors 4 2. Name plate on 12 mm Ply (2‟x1‟) 10 2. Tube light Fittings 20 N0 3. Conical Teat Tumor Extractor 4 3. Name plate on 12 mm Ply (6‟‟x11‟‟) 10 3. Ceiling Fan 02 No 4. Dressing Scissors 4 4. Stethoscope 2 1 4. Fan Rod 20 No 5. Ear Cropping Clamp 4 5. Torch 1 5. Guiser 01 No 6. Intestinal Clamp 4 6. Uterine Catheter 4 6. Metallic Window Frame 02 No 7. Orthopedic Hammer 2 7. Uterine Scissors 2 7. Refrigerator 300 Lit Alwin 01 No 8. Orthopaedic wire Saw 2 8. Hug Teat Lancet 4 8. Metal Net Frame 05 No 9. Pliers/ Plas 2 9. Teat Slitter Single Blade 4 9. Wooden Net Door 01 No 10. UP Bsaed double beam UV -Vis Spectrophotometer with accessories 1 10. Teat Tumor Extractor 2 10. Plastic Water Tank 01 No 11. Suture Cutting Scissors 2 11. Teat Plug 4 11. MCV Box/ Main switch 05 No 12. Shadowless Lamp 1 12. B. P. Handle No - 3 4 13. Thumb Forceps 4 13. B. P. Handle No - 4 4 14. Teat Tumor Extractor 4 14. Bistouri 6 15. Teat bistouri with conceal blade 4 15. Mouth Gag 1 16. Teat canula 4 16. Swab Holder 4 17. Wokman scoup 4 17. Sterilizer Hooks 5 18. HP Desk Jet Printer D 4368 (@ 40% / annum) 1 18. Tooth Forceps 10 19. ECG machine Single Channel (MAC -MSW 734) 1 19. Forceps 4 20. Remi revolutionary gen purpose lab Centrifuge 1 20. Scalpal 1 21. Swingout Head with graduated conical tube cat - R -81 Remi (Fixed in Centrifuge) 1 21. Instrument Tray (30x45 cm) 1 22. Sony handicam Model DCR SC 36 E, Sr no. 294249* (@ 40% / annum) 1 22. Kidney Tray 25 cm 1 23. Compact Multimedia Projector Getner make (@ 40% / annum) 1 24. Digital haemoglobinometer HBI „MAC‟ MSW -547 1 25. Stop watch Tanco 2 26. Plastic coated Projector Screen PS.501 tripod Model Suvira 1 27. Suvira Laser Pointer GP -203 Getner 1 28. PC Based Micro Scan (ELISA Reader) with accessories (@ 40% / annum) 1 29. Hoof Plane 2 30. Long Fine Teat Bistouri 4 31. Long Fine Teat Bistouri Probe pointed 4 32. Green Teat slitter 4 33. Teat lancet 5 34. Farrier‟s Hammer 2 35. Probang 2 36. Hoof tester 2 37. Trefine Teat Knife 4 38. PH Meter with ATC probe and combined electrode (CL -51B) Elico LI -614) 1 39. Rescholar Dual Purpose Half Exhibit Half White 1 (150x120cm Cm) 40. Rescholar Perforated Board (180x90 Cm) 1 41. 800 VA APC Back UPS (BE 800 IN (@ 40% / annum) 1 42. Armless Student Chair wooden 10 43. Four Seater Wooden (Shesham) Bench with Plastic cone seat and back 2 44. Chair X-103 (Methodex) 1 45. Burdizzo Castrator LA 1 46. Trocar and Canula for SA 2 47. Triple Beam Balance (Direct Reading) Model ABTi12) 1 48. Whelping Forceps 2 49. Slide Box for 100 slide 4 50. Instrument Pocket Case 1 51. Bowl SS 20 cm 2 52. Paragon Knife 2 53. Artery Forceps 3 54. Test tube Stand Aluminium 3 55. Triple Stand 6 56. Obstetrics Instrument Complete Set 2 57. Wooden bench (6‟x3‟ 1.5‟) 1 58. Liquid Nitrogen Container Model CB-20 cap 20 Lit 2 59. Dark Room Safe Light 2 60. Film Drying Rack 1 61. Film hanger 6”x8” 3 62. Film hanger 8”x10” 3 63. Film hanger 10”x12” 3 64. Film hanger 12”x15” 1 65. Film Holding Clip 4 66. Lead Apron 2 67. Processing Tank 13.5 Lt with Lid 1 68. X-Ray cassette 6”x8” 4 69. X-Ray cassette 8”x10” 4 70. X-Ray cassette 10”x12” 4 71. X-Ray cassette 12”x15” 3 72. X-Ray Film Viewer (Single Plate) 2 73. Seimens X-ray unit Fixed with Rotary anode 300 1 mA machine with accessories 74. Intensifying screen 6”x8” 4 75. Intensifying screen 8”x10” 4 76. Intensifying screen 10”x12” 4 77. Intensifying screen 12”x15” 3 78. Measuring Caliper 1 1 0 . 1 7 LFC,CVSC & AH 53 Mª sflax Mªe 225X225 yarko 400 YSI 01 54 I.M.S. Make UPS 1 KVA 01 55 Desktop Computer HCL Make Pro BL 1225, CD Writer Windo XP 01 56 Online APC UPS RS 1100 01 57 p s;j IykfLVd 16 58 o qMu ps;j 01 59 vkeZ dqku ps;j 07 11. MCAET Ambedkar Nagar 11.1 Group (A) Group (B) 1. Laboratory cooler motor with water pump 1 1 Budding Crafting knife 1 - - - 2. Drum Cap 200lit 1 2 Fruit catcher with pipe 1 3. Call Bell 1 3 Hedge shear 8ᶥᶥ 1 4. Stapler HP 45 2 4 Loaping shear rol cut type 1 5. Stapler 10No. 2 5 Loaping shear shearing type 1 6. Panching 0.45mm 2 6 2X6 ear Loaper 1 7. Godrej work chair 01 7 Angular Long Reach Pruner 1 8. Godrej printer work 01 8 Fruit Gatherer with pipe 1 9. Godrej INT Computer work 01 9 Pruning Saw 1 10. I.I.S.R sugar cane cutter planter 01 10 Weeding Fork 1 11. Allen key 01 set 11 Hand cultivator 1 12. Water pump plier 250 mm 01 12 Garden tool 1 13. Combination plier 200mm 01 13 Garden hoe 1 14. Bent nose plier 200mm 01 14 Dutch hoe 1 15. Chisel 02 15 Garden Rake (16 teeth) 1 16. Chiisel 02 16 Shovel 1 17. Claw hammer 450 gram 02 17 Digging Fork 1 18. Screwdriver 01 set 18 Khurpa 4 19. Nose plier 02 19 Spade 1 20. CVT 2kva 01 20 Leather Waist Belt 1 21. HP laser printer 01 21 Power tiller oprated Rice transplanter 1 22. Kamco power reaper 01 22 Till Plant Machine 4 23. Auto slide projector 01 23 P.T.Potato Planter 1 24. Display notice board 3 into 4 inch 01 24 Moister Box 50 25. A P kising letter 18,24,12mm 5 box 25 Hazara 1 26. Figure asp 18,24mm 02 box 26 Husk Sow Frame 12 27. Sony camera with accessories 01 27 Screw Driver 8/250 04 28. B.D speed drill 3 row 01 28 Screw Driver Set 2 set 29. Compaq computer 01 29 Screw Driver Tester 2 no. 30. HP laser printer 01 30 Mini Rice Mill 01 31. Photo copier machine Aficio & attachment -1-9 01 31 Nap Sak Sprayer 01 32. Old drum 01 32 Pocket Calculator 01 33. TRAINGULAR FILE 1 33 Spring Balance 03 34. FIRMER CHISEL 1 34 Steel Box 4”*2.5”*2.5” 05 35. DOVETAIL CHISEL 1 35 6 Disk Harrow 01 36. TRAINNEES CHAIR-SS-2 30 36 Working Bench 02 37. Digital Electronic Top loading balance 1 37 Stool 40 38. Laboratory Heater with Power 1 38 Dynamo Pulley 01 39. Calculater cyber desk 1 39 Pulley Small Size 01 40. PoketCalculater cyber 1 40 Pulley Big Size 01 41. Sc. Calculater cyber 3 41 D/E Spanner 04 42. Al. Box (Sample) 30D3h 42 Grease Gun Bucket 02 43. Top Pan Blance 500gm 1 43 Welding Transformer 01 44. Spring Blance 20kg 1 44 Valve Refacer 01 - - - 45. Stop Watch 1 45 Double Shoe Brake Model 01 46. Fawada 5 46 Model Internal Exoanding Shoe Brake 01 47. Box 177 X 66X 66 4 47 Model Band Brake 01 48. Sample Box Al. 10D3h 48 Model Disc Brake 01 49. Duplicater med EF112 1 49 Model Impeller Of Pump 01 50. Parshell Flume 3‟ 2 50 Model Turbine Pump 01 51. Parshell Flume 6‟ 2 51 Model Different Type Of Valve 01 52. Board 8‟X 4‟ 3 52 Model Cam Reciprocating Follower 01 53. Board 3‟X 2‟ 5 53 Model Different Type Of Seal 01 54. Parshell Flume 3‟ 2 54 Model Reciprocating Engine Mechanism 01 55. Board 2x2 13 55 Model Oscillating Cylinder Mechanism 01 56. Hot Air Oven 1 56 Model Single Plate Clutch 01 57. Pan Blance Plastic 1Kg 1 57 Model Multi Plate Clutch 01 58. Plastic Pan Blance 2Kg 1 58 Model Centrifugal Clutch 01 59. Plastic Pan Blance 4Kg 1 59 Lecture Stand 01 60. Parshall Flume 3‟‟ 2 60 Steel Lock 65mm 12 61. ParmeabilityAppratus 2set 61 Steel Lock 40mm 12 62. Core Sampler 1set 62 Godrej Lock 01 63. Core Cylinder 24 pair 63 Wooden Laboratory Bench 7inch*2.5inch 05 64. Tensiometer 2” (22.5 cm.) 10Pc 64 Wooden Table 4inch*2inch 02 65. Tensiometer 2” (30 cm.) 10Pc 65 Ring Spanner 6 -22 08 66. Tensiometer 2” (45 cm.) 10Pc 66 Spirit Level 02 67. Soil infiltometer with set 1 67 Plumb Bob 05 68. Top Pan Balance Mech. Cap-1000g 1 68 Aspa Cyno Gas Pump 01 69. Front Dial Top loading –Balance Cap 500gm 1 69 Cut Model Petrol Engine 01 70. Cooler for complet 20” 2 70 Model End Cam Reciprocating 01 71. Hot –Air Oven Hindustan 1 71 Seesham Table 6”*3”*2.5” 01 72. Bond 1‟ *1‟* 3‟ 30 72 Seesham Table 6”*2.5”*3” 01 73. Lock 65m 2 73 Lab Table 6”*2.5”*3” 10 74. Bycycleherculish ,complete 3 74 Slide Projector Etc 01 75. Lock 65 mm 2 75 Table Wooden 4”*2”*2.5” 02 76. Infrared moisture meter 152720with core cutter 1000mm dia 1 set 76 Table Wooden 4”*2”*2.5” 01 77. Shine Board 3‟ * 2‟-1, i* 1-30 31 77 Table Wooden 4”*2”*2.5” 01 78. Shine Board 2‟ * 2‟*8 -1 12 78 Steel Almirah Small 01 79. Shine Board 3‟ * 2‟ 1 79 Steel Almirah Small 1525*760*460mm 01 80. Angle board 3‟* 2‟ 3 80 Rack Wooden 02 81. Plate 1*1 15 81 Office Chair Wooden 02 82. Aspeejublee duster 1+1 82 Type Writer English 158998 01 83. Triple beam balance box type 1+1 83 Type Writer Hindi 179770 01 84. AspeeNospat sprayer 16lit 1+1 84 Steel Table 1370*760*760mm 01 85. Marutihonda compression stronger cap 3.5 lit 1 85 Steel Table 1370*760*760mm 01 86. U.S.A vivration Pan 2 86 Steel Table 1500*910*760mm 01 - - - 87. Board 1‟* 1‟* 3‟ 60 87 Steel Table 1500*910*760mm 01 88. SLR camara (Asia Painter ) 1 no 88 Steel Table 1830*220*760mm 01 89. Heating Maritles 200ml 1 no 89 Steel Chair 1. With Arm 1. Without Arm 02 90. Lab heating Plate 1 no 90 Wooden Chair With Arm 02 91. Single pan balance 2 kg 2 91 Wooden Chair With Arm 04 92. Spring balance- 20 kg 1 92 Wooden Chair With Arm 03 93. Spring balance -50 kg 1 93 Wooden Chair Teak 02 94. Screw auger 2 94 Steel Chair With Arm 01 95. Digital conductivity metre 1 95 Wooden Chair 03 96. Digital PH meter 1 96 Wooden Chair With Arm 02 97. Water still (barrasted) 1 97 Steel Almirah Big 01 98. Point gauge 7.5 CM 2 98 Steel Almirah Big 01 99. Soil hydrometer 6 99 Steel Almirah Small 01 100. Planimetre 1 100 Steel Almirah Big 01 101. Digital spectro photo meter 1 101 Steel Almirah Big 01 102. Electric sounder 100 deep 1 102 Filing Cabinet 01 103. Stopwatch 2 103 Hind Cycle 01 104. Water current metre small 2 104 Packet Calckulater(Dcm) 01 105. Water current metre medium 1 105 Rack Wooden 01 106. Pressure bomb apparatus 1 106 Wooden Glass Chair 30 107. Self propelled and row rice transplanter 1 108. Wheel hoe 2 109. B.D.Harrowpatela 2 110. B.D. multicrop planter 2 111. B.D. lugged wheel planter 2 112. Compaq desk computer 1 113. H.P. laser jet printer 1 114. Mitshubishishakt power tiller and attachment 1 115. Computer table CT - 1 2 116. Computer chair 1 117. APC -1 KVA 1 118. stop watch 2 119. Sc. calculator 1 120. Calculator official 1 121. Measuring tape 2 122. Motor 1 h.p. P.I. Phase everest 1 123. Vpulley 10” FittedBurrMipp 1 124. Vpulley 4” Fitted motor 1 125. Hot air oven hindustan 1 126. Lock harrson 1 127. Sc. calculator 1 128. Room heater 1 - - - - - - 129. Digital temperature indicator 1 130. Electronic top pan balance 1 131. Slide film projector 1 132. Stop watch 1 133. Starter I Phase 2 134. Main switch 2 135. Oil cane 1 136. Emergency Light 2 137. Display Board-4‟*5‟ 4 138. Lock Nav Tal 2 139. Torpoulin 1 140. Desk Calculator 1 141. Typewriter English 1 142. Plier-8” 1 143. DPR Daff Mill with Motor 1 144. Lock 1 145. Lock (Godrej) 1 146. Combination Plier 1 147. Pipe Wrench-12” 1 148. Screw Driver-934 1 149. Screw Driver-824 1 150. Hack Saw Frame 1 151. Wooden Rasp File 1 152. Drill Machine 1 153. Drill bit Set 1set 154. Scale 2 155. Tap 3M 2 156. Adjustable Wrench 1 157. File square 1 158. File half round 1 159. Hand saw -450mm 1 160. Hand saw -350mm 1 161. Gim pet 1 162. Container 1 163. Imerson rod 1 164. Bhagona 3 165. Kalchul 2 166. Palta 1 167. Parat 1 168. Calculator 10 digit 1 169. Spark regulator for above fillar cabinet sndicator Card and plug 1 170. Nozzeltoslav cap1 lit 1 171. Tripal 7/4 1 172. Tripal7*4 1 173. Portable moning AC voltmeter 20 174. ATCO balance with platform 1 175. Kirbskar motor 7.5 k 10 H.P 1 176. L&T make starter delta rang 6-10 AMP 1 177. Orpet calculator 1 178. Tripal 6*5 squ yard 1 179. Cello tax board a* 2.5 2 180. Sanye LCD Multiprojector model -PLC 2 181. Exhubit Panel with acrylic 120 60 RD-117- 11 1 182. Plastic Body Front Top Balance cap-1Kg 5 183. Plastic Body Front Top Balance cap-1Kg 5 184. Dari Parsi12‟*12‟ 12*15‟ 2 185. Voltage stabilizer 3 kw ----- 186. Kangaroo Heavy duty Stapler ----- 187. Electric Hot Air Oven 01 188. National Power triller attachment 01 189. Tamilnadu conveyor reaper 01 190. Cage wheel 02 191. Scientific calculator DCM 01 192. Hand shearing machine 01 193. Grass cutter 01 194. Mitsubishi power triller attachment 01 195. Thressur with fan 5 HP 01 196. Disc Harrow 8 disc 01 197. Triple beam balance 300 gm 01 198. Triple beam balance 111 gm 01 199. Physical weigh box made from Beam 01 200. Kisan paddy thresher 01 201. Box size 3 * 1.5 *1 inch 01 202. Lock 01 203. Stopwatch 01 204. Hazara 01 205. Hydraulic dynamometer 01 206. Ground Net potato digger 01 207. Temperature indicator 01 208. Temperature probe 02 209. General probe 01 210. KAMCO Power tiller with attachment 01 211. Power tiller auger 01 212. Tall tree duster 01 213. Potato planter 3 row 01 214. Power triller tech book 01 215. Hi tech frame 01 216. Lugged Wheel 02 217. Tail wheel 01 218. Mitsubishi Shakti Power triller 01 219. Calcuater cyber 02 220. Socket set gedor 1 Set 221. Long nose plier 02 222. Side cutting plier 01 223. Socket 10,20,22,24 mm 4 Pc. 224. Night duty drill welf 13mm 01 - - - - - - 225. Angle grinder attachment 01 226. Energy metre 01 227. Vane Shear Apparatus 01 228. Stand MB 343 01 229. I.I.S.R Sett Cutting Machine 01 230. BD sugarcane planter 01 231. G -1 Bin 5Qt &1Qt 2 232. Desk Calculator 1 233. Load Ceff (0 -500kgl) 1 234. Load Ceff (0 -2500kgl) 1 235. Load Ceff indicator 1 236. Knap Sake Sprayer -16 lit 1 237. Gas Analyser Apparatus 1 238. P.T. Repeater 1.6 M 1 239. S - S -column Porapack 1 240. S - S - column Modicular 1 241. Gas sampling syringe 1 242. 8 Row paddy Transplanter 1 243. Oxygen Analyser 1 244. P.T. Axial flow pump 1 245. 6 Row Rice Transplanter 1 246. Stop Watch 1 247. Electronic Top Pan Balance 1 248. Rechargable Battery 1 249. Air Shield Case 1 250. Yorco Hot Air Oven 1 251. Nozzel Tester 1 252. Mechanical Jack 5Ton 1 253. Reamer Set-15 Pc. 1set 254. Steel Scale 30cm 2 255. SARACHI Power Trillerchinease with attachment 1 256. Flexible shaft 5/8 11 x 3 M 1 257. P.T Potato Planter 1 258. Digital Pulse Monitor 1 259. Motor Cycle bajaj Kawasaki 1 260. D.E. Spanner Set 1 set 261. Ring Spanner Set 1 set 262. Pipe Wrench 1 263. Socket S etc
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 5
Uttar Pradesh View Result →
8.
Health and Family Welfare #9040904 Technical Bid
Purchasing Of Chemical Re Agent Equipment And Consumables Items , Items : , Absolute Alcohol , Acetone , Albumin Reagent Kit (Colorimetric Mehtod) , Alcohol 70% , Aliquote Stand , Alkaline Peptone Dehydrated Water , Alkaline Phosphatase Reagent Kit , Aluminium Foils (.14 Mm Thickness) , Ammonium Hydroxide , Ammonium Sulphate , Analytical Balance , Antibiotic Disc Amikacin (30 Mcg) , Antibiotic Disc Amoxycillin (30 Mcg 20/10Mcg) , Antibiotic Disc Ampicillin (10 Mcg) , Antibiotic Disc Ampicillin Sulbactam (20 Mcg 10/10 Mcg) , Antibiotic Disc Azithromycin (15 Mcg) , Antibiotic Disc Aztreonam(30 Mcg) , Antibiotic Disc Bacitracin Discs , Antibiotic Disc Cefepime (30Mcg) , Antibiotic Disc Cefoperazone (75 Mcg) , Antibiotic Disc Cefotaxim (30 Mcg) , Antibiotic Disc Cefoxitin (30 Mcg) , Antibiotic Disc Cefpodoxine(10 Mcg) , Antibiotic Disc Ceftazidime (30 Mcg) , Antibiotic Disc Ceftriaxone (30 Mcg) , Antibiotic Disc Chloramphenicol (30 Mcg) , Antibiotic Disc Ciprofloxacin (5 Mcg) , Antibiotic Disc Clindamycin (2 Mcg) , Antibiotic Disc Colistin (10 Mcg) Mic Kit , Antibiotic Disc Cotrimoxazole (Cot) (25 Mcg) , Antibiotic Disc Doxycycline (30 Mcg) , Antibiotic Disc Erythromycin (15 Mcg) , Antibiotic Disc Gentamycin (120 Mcg) , Antibiotic Disc Gentamycin 10 Mcg) , Antibiotic Disc Imipenem (10 Mcg) , Antibiotic Disc Levofloxacin (5 Mcg) , Antibiotic Disc Linezolid (10 Mcg) , Antibiotic Disc Meropenem (10 Mcg) , Antibiotic Disc Moxifloxacin (5 Mcg) , Antibiotic Disc Nalidixic Acid (30 Mcg) , Antibiotic Disc Nitrofurantoin (100 Mcg) , Antibiotic Disc Norfloxacin (10Mcg) , Antibiotic Disc Novobiocin , Antibiotic Disc Ofloxacin (01 Mcg) , Antibiotic Disc Pipracillin-Tazobactam (Pit) (30/6 Mcg) , Antibiotic Disc Polymyxin B (300 Units) , Antibiotic Disc Spaxfloxacin (5 Mcg) , Antibiotic Disc Vancomycin (5 Mcg , E-Strips) , Antisera -Salmonella Typhi , Antisera -Vibrio Cholarae (O1,O139) , Applicator , Apron Full Sleeves (Lab Coat) , Atcc Strain - E.Coli 25922 , Atcc Strain - Psendomonas Aeruginosa 27853 , Atcc Strain - Staphylococcus Aureus 25923 , Autoclavable Bags (Bmw) , Autoclave Bag , Ayre’S Spatula , Barcode/Barcode Readerstrip , Benedict Reagent , Benedicts Quantitative Solution , Benzidine Reagent Powder , Bijous Bottle (For Blood Culture ) 15 Ml Vial , Bile Broth Base , Bile Esculin Agar Base , Bile Esculin Discs , Binocular Microscope With Led Light Source , Biomedical Waste Bag , Bismuth Sulphite Agar , Black Bag (Biomedical Waste Bag) , Black Bucket , Bleaching Powder , Blood Agar Base (For Haemolysis Activity) , Blood Culture Bottle 50 Ml , Blood Culture Media (Prepared) , Blood Grouping Anti Rh , Blood Grouping(Anti A, Anti B) Anti Rh , Blotting Paper , Brain Heart Infusion Agar , Bunsen Burner , Calcium Reagent Kit (Calcium Estimation) , Calcium Reagent Kit (Coloriometric Method) , Cavity Slides For Bacterial Mobility , Chocholate Agar Base , Cholesterol Reagent Kit (Colorimetric Method) , Citrate Agar Base (Simmons)Dehydrated , Cled Agar , Corn Meal Agar(Dehydrated) , Cotton (500Gm Net) , Couplin Jars , Coverslip Large Size , Coverslip Small Size , Creatinine Reagent Kit (Colorimetric Mehtod) , Cromogenic Cled Agar Base , Crystal Violet , Dengue Card Test(Igm/Igg Antibody) , Dengue Card Test(Ns1 Antigen) , Deoxy Chocholate Citrate Agar , Diamond Pencil , Dil. Acetic Acid , Disposable Gloves , Disposable Scalpel Blades , Disposable Syringe With Needle 10 Ml , Disposable Syringe With Needle 20 Ml , Disposable Syringe With Needle 3Ml , Disposable Syringe With Needle 5Ml , Distilled Water , Dropping Bottles , Drum (Net) For Autoclave (11X9) , Durham Tubes , Duster Cloth , Edta Vial , Elisa Testing Kit For Dengue Nsi Antigen , Elisa Testing Kit For Hav , Elisa Testing Kit For Hev , Face Shield / Goggles , Filter Paper , Flasks 1000 Ml , Flasks 500 Ml , Formaldehyde 40% , Fungus Teasing Needle , Gas Cylinder With Regulator & Pipe , Glacial Acetic Acid , Glass Slides (1X3 Inch) , Gloves (Nitrile) M Size Disposable , Glucose Broth , Gown (Disposable) , Grams Iodine , H2so4 (100% ) Conc , Hand Washing Liquid Soap , Harris Hematoxylin , Head Cover , Hematoxylin And Eosin Stain Set , Histology Slide Trey(Not Box) , Hydrogen Peroxide (H2o2 ,3%) , Hydrochloric Acid Dilute , India Ink. , Inoculating Loop (Nichrome) , Insulin Pen , Isopropyl Alcohol , Jamshidi Bone Marrow Biopsy Needle(18G, Steel) , Jamshidi Bone Marrow Biopsy Needle(20G, Steel) , Kahns Test Tube (5Ml) , Klimas Bone Marrow Aspiration Needle(18G, Steel) , Klimas Bone Marrow Aspiration Needle(20G, Steel) , Kovacsreagent Strip , Kovacs Indole Reagent , L. J. Medium Slant (Ready To Use) , Laboratory Refrigerator (Minimum 400L) - 02 To 08 Degree Celcius , Laminar Hood , Lancet , Leishman’S Stain , Lens Cleaner , Leukart L Blocks/Molds , Liquide Paraffin , Liquor Ammonia , Lowenstein Jensen Prepared Media , Lumbar Puncture Needle(18G, Steel) , Mac Conkey Agar (Dehydrated Powder) , Mannitol Salt Agar Base , Masks (Dispoable) , Mc Cartney Bottles , Mc Intosh , Metal Rod - 48 Cm/ 20 Inch Length , Metered Dose Inhalers , Methanol 500Ml , Methylene Blue , Mbi Kit For Iodine Test , Micro Auto Pipette 10?L - 100?L , Micro Auto Pipette 100?L- 1000?L , Micro Fixed Pipette 05?L- 50?L , Micro Fixed Pipette 10?L- 100?L , Mp Card Test Kit , Muller Hinton Agar Base , Museum Jars (Size 200X150x100) , Museum Jars (Size 360X150x100) , Museum Jars(Size200x195x80) , N/10 Hcl , N-95 Mask , Nasal Sprays , Needle (Pricking) , Needle Burner & Syringe Destroyer (Electrical) , Nichrome Loop /Loop Holder , Nitric Acid 500Ml , Nuclease Free Water , Nutrient Agar Base , Nutrient Broth , Optochin Discs , Oxidase Discs , Oxidase Reagent , Paraffin , Paraffin Wax (Solid) , Parafilm , Pcr Kit (Detection) Covid -19 , Pcr Plate And Pcr Sealer , Pcr Tube And Cap Stripe , Pen , Permanent Marker (Fine Tip) , Petri Plates (Disposable) , Phenolphthalein Red Indicator , Phosphorus Reagent Kit (Colorimetric Method) , Platelet Diluting Fluid , Potassium Oxalate , Potassium Iodide , Powder Latex Gloves , Ppe Kit/Gown , Protein Reagent Kit (Colorimetric Method) , Puncture Proof Container , Rapid Pap Stain Kit , Rbc Diluting Fluid , Record File , Redbag (Bmw) , Redbucket , Register , Rna Extraction Kit (Covid -19) , Robertsons Cooked Meat Medium(Prepared) , Rotahalers , Safranin Oil , Salahs Bone Marrow Aspiration Needle(18G, Steel) , Salahs Bone Marrow Aspiration Needle(20G, Steel) , Sanitizer , Scalpel Handle No.3 , Scissor , Sda Agar(Dehydrated) , Sgot Reagent Kit (Colorimetric Method) , Sgpt Reagent Kit (Colorimetric Method0 , Sharp Container , Shoe Cover , Silver Nitrate , Silver Nitrate Solution , Simmohs Citrate Agar Base , Sodium Carbonate , Sodium Chloride , Sodium Chloride (0.9%) , Sodium Hypochloride (4%) , Sodium Hypochloride 5% , Sodium Nitroprusside , Sodium Potassium Dihydrate , Spirit Lamp , Spray Fixative , Sprit , Stand For Handling 20 Ml Test Tube , Starch Soluble (Extrapure) , Sterile Cotton Swab , Stop Watch Reading At 1/15 Second , Stopwatch , Straight Wire , Sugar (God/Pod Method) Kit , Sulphide Indole Motility Media , Sulphuric Acid Conc. , Surgical Mask , Swab Stick ( Nasopharyngeal) , Swab Stick (Oropharyngeal ) , Test Tube Rack , Test Tube Rack (16 Mm , 31 Hole ) , Test Tube Rack/Stand For Holding 10 Ml Testtubes , Test Tube Stand (12 Mm ,24 Hole) , Tips 10 Micro Liter Filter Tips (Sterile) , Tips 1000 Micro Liter Filter Tips (Sterile) , Tips 20 Micro Liter Filter Tips (Sterile) , Tips 200 Micro Liter Filter Tips (Sterile) , Tissue Embedding Cassette , Tissue Embedding Mold , Tissue Paper Roll , Transparent Tape , Triglyceride Reagent Kit (Colorimetric Method) , Triplesugar Iron Agar , Turpentine Oil , Urea Agar Base-Christensen (Dehydrate) , Urea Reagent Kit , Uric Acid Reagent , Urine Culture Pot , Vim Silverman Liver Biopsy Needle(18G, Steel) , Vtm , Vtm Stand , Watch Glass , Wbc Diluting Fluid , Westergren Pipette And Stand , Westergrens Esr Pipette , Westergrens Esr Stand , White Board Duster , White Board Marker , Widal Test Kit , Wintrobes Esr Stand , Wintrobes Esr Tube , Xld Agar , Xylene , Yellow Bag (Bmw) , Yellow Bucket (Bmw) , Zip Lock Pouch , 0.1 Ml Pcr Tube , 0.5 Mac Farland Solution , 1.5 Ml Centrifuge Tube , 2 Ml Centrifuge Tube , A 4 Size Paper
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 7
9.
Health and Family Welfare #9030991 Technical Bid
For Purchasing/Rate Contract Of Chemicals Reagents, Equipments And Consumables Items , Items : , Absolute Alcohol , Acetone , Albumin Reagent Kit (Colorimetric Mehtod) , Alcohol 70% , Aliquote Stand , Alkaline Peptone Dehydrated Water , Alkaline Phosphatase Reagent Kit , Aluminium Foils (.14 Mm Thickness) , Ammonium Hydroxide , Ammonium Sulphate , Analytical Balance , Antibiotic Disc Amikacin (30 Mcg) , Antibiotic Disc Amoxycillin (30 Mcg 20/10Mcg) , Antibiotic Disc Ampicillin (10 Mcg) , Antibiotic Disc Ampicillin Sulbactam (20 Mcg 10/10 Mcg) , Antibiotic Disc Azithromycin (15 Mcg) , Antibiotic Disc Aztreonam(30 Mcg) , Antibiotic Disc Bacitracin Discs , Antibiotic Disc Cefepime (30Mcg) , Antibiotic Disc Cefoperazone (75 Mcg) , Antibiotic Disc Cefotaxim (30 Mcg) , Antibiotic Disc Cefoxitin (30 Mcg) , Antibiotic Disc Cefpodoxine(10 Mcg) , Antibiotic Disc Ceftazidime (30 Mcg) , Antibiotic Disc Ceftriaxone (30 Mcg) , Antibiotic Disc Chloramphenicol (30 Mcg) , Antibiotic Disc Ciprofloxacin (5 Mcg) , Antibiotic Disc Clindamycin (2 Mcg) , Antibiotic Disc Colistin (10 Mcg) Mic Kit , Antibiotic Disc Cotrimoxazole (Cot) (25 Mcg) , Antibiotic Disc Doxycycline (30 Mcg) , Antibiotic Disc Erythromycin (15 Mcg) , Antibiotic Disc Gentamycin (120 Mcg) , Antibiotic Disc Gentamycin 10 Mcg) , Antibiotic Disc Imipenem (10 Mcg) , Antibiotic Disc Levofloxacin (5 Mcg) , Antibiotic Disc Linezolid (10 Mcg) , Antibiotic Disc Meropenem (10 Mcg) , Antibiotic Disc Moxifloxacin (5 Mcg) , Antibiotic Disc Nalidixic Acid (30 Mcg) , Antibiotic Disc Nitrofurantoin (100 Mcg) , Antibiotic Disc Norfloxacin (10Mcg) , Antibiotic Disc Novobiocin , Antibiotic Disc Ofloxacin (01 Mcg) , Antibiotic Disc Pipracillin-Tazobactam (Pit) (30/6 Mcg) , Antibiotic Disc Polymyxin B (300 Units) , Antibiotic Disc Spaxfloxacin (5 Mcg) , Antibiotic Disc Vancomycin (5 Mcg , E-Strips) , Antisera -Salmonella Typhi , Antisera -Vibrio Cholarae (O1,O139) , Applicator , Apron Full Sleeves (Lab Coat) , Atcc Strain - E.Coli 25922 , Atcc Strain - Psendomonas Aeruginosa 27853 , Atcc Strain - Staphylococcus Aureus 25923 , Autoclavable Bags (Bmw) , Autoclave Bag , Ayre’S Spatula , Barcode/Barcode Readerstrip , Benedict Reagent , Benedicts Quantitative Solution , Benzidine Reagent Powder , Bijous Bottle (For Blood Culture ) 15 Ml Vial , Bile Broth Base , Bile Esculin Agar Base , Bile Esculin Discs , Binocular Microscope With Led Light Source , Biomedical Waste Bag , Bismuth Sulphite Agar , Black Bag (Biomedical Waste Bag) , Black Bucket , Bleaching Powder , Blood Agar Base (For Haemolysis Activity) , Blood Culture Bottle 50 Ml , Blood Culture Media (Prepared) , Blood Grouping Anti Rh , Blood Grouping(Anti A, Anti B) Anti Rh , Blotting Paper , Brain Heart Infusion Agar , Bunsen Burner , Calcium Reagent Kit (Calcium Estimation) , Calcium Reagent Kit (Coloriometric Method) , Cavity Slides For Bacterial Mobility , Chocholate Agar Base , Cholesterol Reagent Kit (Colorimetric Method) , Citrate Agar Base (Simmons)Dehydrated , Cled Agar , Corn Meal Agar(Dehydrated) , Cotton (500Gm Net) , Couplin Jars , Coverslip Large Size , Coverslip Small Size , Creatinine Reagent Kit (Colorimetric Mehtod) , Cromogenic Cled Agar Base , Crystal Violet , Dengue Card Test(Igm/Igg Antibody) , Dengue Card Test(Ns1 Antigen) , Deoxy Chocholate Citrate Agar , Diamond Pencil , Dil. Acetic Acid , Disposable Gloves , Disposable Scalpel Blades , Disposable Syringe With Needle 10 Ml , Disposable Syringe With Needle 20 Ml , Disposable Syringe With Needle 3Ml , Disposable Syringe With Needle 5Ml , Distilled Water , Dropping Bottles , Drum (Net) For Autoclave (11X9) , Durham Tubes , Duster Cloth , Edta Vial , Elisa Testing Kit For Dengue Nsi Antigen , Elisa Testing Kit For Hav , Elisa Testing Kit For Hev , Face Shield / Goggles , Filter Paper , Flasks 1000 Ml , Flasks 500 Ml , Formaldehyde 40% , Fungus Teasing Needle , Gas Cylinder With Regulator & Pipe , Glacial Acetic Acid , Glass Slides (1X3 Inch) , Gloves (Nitrile) M Size Disposable , Glucose Broth , Gown (Disposable) , Grams Iodine , H2so4 (100% ) Conc , Hand Washing Liquid Soap , Harris Hematoxylin , Head Cover , Hematoxylin And Eosin Stain Set , Histology Slide Trey(Not Box) , Hydrogen Peroxide (H2o2 ,3%) , Hydrochloric Acid Dilute , India Ink. , Inoculating Loop (Nichrome) , Insulin Pen , Isopropyl Alcohol , Jamshidi Bone Marrow Biopsy Needle(18G, Steel) , Jamshidi Bone Marrow Biopsy Needle(20G, Steel) , Kahns Test Tube (5Ml) , Klimas Bone Marrow Aspiration Needle(18G, Steel) , Klimas Bone Marrow Aspiration Needle(20G, Steel) , Kovacsreagent Strip , Kovacs Indole Reagent , L. J. Medium Slant (Ready To Use) , Laboratory Refrigerator (Minimum 400L) - 02 To 08 Degree Celcius , Laminar Hood , Lancet , Leishman’S Stain , Lens Cleaner , Leukart L Blocks/Molds , Liquide Paraffin , Liquor Ammonia , Lowenstein Jensen Prepared Media , Lumbar Puncture Needle(18G, Steel) , Mac Conkey Agar (Dehydrated Powder) , Mannitol Salt Agar Base , Masks (Dispoable) , Mc Cartney Bottles , Mc Intosh , Metal Rod - 48 Cm/ 20 Inch Length , Metered Dose Inhalers , Methanol 500Ml , Methylene Blue , Mbi Kit For Iodine Test , Micro Auto Pipette 10?L - 100?L , Micro Auto Pipette 100?L- 1000?L , Micro Fixed Pipette 05?L- 50?L , Micro Fixed Pipette 10?L- 100?L , Mp Card Test Kit , Muller Hinton Agar Base , Museum Jars (Size 200X150x100) , Museum Jars (Size 360X150x100) , Museum Jars(Size200x195x80) , N/10 Hcl , N-95 Mask , Nasal Sprays , Needle (Pricking) , Needle Burner & Syringe Destroyer (Electrical) , Nichrome Loop /Loop Holder , Nitric Acid 500Ml , Nuclease Free Water , Nutrient Agar Base , Nutrient Broth , Optochin Discs , Oxidase Discs , Oxidase Reagent , Paraffin , Paraffin Wax (Solid) , Parafilm , Pcr Kit (Detection) Covid -19 , Pcr Plate And Pcr Sealer , Pcr Tube And Cap Stripe , Pen , Permanent Marker (Fine Tip) , Petri Plates (Disposable) , Phenolphthalein Red Indicator , Phosphorus Reagent Kit (Colorimetric Method) , Platelet Diluting Fluid , Potassium Oxalate , Potassium Iodide , Powder Latex Gloves , Ppe Kit/Gown , Protein Reagent Kit (Colorimetric Method) , Puncture Proof Container , Rapid Pap Stain Kit , Rbc Diluting Fluid , Record File , Redbag (Bmw) , Redbucket , Register , Rna Extraction Kit (Covid -19) , Robertsons Cooked Meat Medium(Prepared) , Rotahalers , Safranin Oil , Salahs Bone Marrow Aspiration Needle(18G, Steel) , Salahs Bone Marrow Aspiration Needle(20G, Steel) , Sanitizer , Scalpel Handle No.3 , Scissor , Sda Agar(Dehydrated) , Sgot Reagent Kit (Colorimetric Method) , Sgpt Reagent Kit (Colorimetric Method0 , Sharp Container , Shoe Cover , Silver Nitrate , Silver Nitrate Solution , Simmohs Citrate Agar Base , Sodium Carbonate , Sodium Chloride , Sodium Chloride (0.9%) , Sodium Hypochloride (4%) , Sodium Hypochloride 5% , Sodium Nitroprusside , Sodium Potassium Dihydrate , Spirit Lamp , Spray Fixative , Sprit , Stand For Handling 20 Ml Test Tube , Starch Soluble (Extrapure) , Sterile Cotton Swab , Stop Watch Reading At 1/15 Second , Stopwatch , Straight Wire , Sugar (God/Pod Method) Kit , Sulphide Indole Motility Media , Sulphuric Acid Conc. , Surgical Mask , Swab Stick ( Nasopharyngeal) , Swab Stick (Oropharyngeal ) , Test Tube Rack , Test Tube Rack (16 Mm , 31 Hole ) , Test Tube Rack/Stand For Holding 10 Ml Testtubes , Test Tube Stand (12 Mm ,24 Hole) , Tips 10 Micro Liter Filter Tips (Sterile) , Tips 1000 Micro Liter Filter Tips (Sterile) , Tips 20 Micro Liter Filter Tips (Sterile) , Tips 200 Micro Liter Filter Tips (Sterile) , Tissue Embedding Cassette , Tissue Embedding Mold , Tissue Paper Roll , Transparent Tape , Triglyceride Reagent Kit (Colorimetric Method) , Triplesugar Iron Agar , Turpentine Oil , Urea Agar Base-Christensen (Dehydrate) , Urea Reagent Kit , Uric Acid Reagent , Urine Culture Pot , Vim Silverman Liver Biopsy Needle(18G, Steel) , Vtm , Vtm Stand , Watch Glass , Wbc Diluting Fluid , Westergren Pipette And Stand , Westergrens Esr Pipette , Westergrens Esr Stand , White Board Duster , White Board Marker , Widal Test Kit , Wintrobes Esr Stand , Wintrobes Esr Tube , Xld Agar , Xylene , Yellow Bag (Bmw) , Yellow Bucket (Bmw) , Zip Lock Pouch , 0.1 Ml Pcr Tube , 0.5 Mac Farland Solution , 1.5 Ml Centrifuge Tube , 2 Ml Centrifuge Tube , A 4 Size Paper
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 5
10.
Educational and Research Institute #8948032 Technical Bid
Supply Of Chemical , Reagents , Diagnostic Kit Etc-1 Isopropyl Alcohol 2.5 Lt Bottle 2 Papanicolau O.G.6 125 Ml Bottle 3 Papanicolau E.A 36 125 Ml Bottle 4 Papanicolau E.A 65 125 Ml Bottle 5 May.Grunwald Stain ( Mgg ) 100 Ml Bottle 6 Giemsa Staining 100 Ml Bottle 7 H2so4 ( Sulphuric Acid ) 500 Ml Bottle 8 Methanol 500 Ml Bottle 9 Diethy Ethyl Ether L.R 500 Ml Bottle 10 Leishman’S Stain Solution ( Cytochrome ) 500 Ml Bottle 11 Tincture Benzoin 100 Ml Bottle 12 Semen Diluting Fluid 200 Ml Bottle 13 Platelet Diluting Fluid 50 Ml Bottle 14 Chloroform 2.5 Lt Bottle 15 Wbc Diluting Fluid 50 Ml Bottle 16 Rbc Diluting Fluid 50 Ml Bottle 17 N / 10 Hcl 500Ml Bottle 18 Formaldehyde 5 Lt Bottle 19 Xylene 2.5 Lt Bottle 20 Conc. Hcl ( Hydrochloric Acid ) 500 Ml Bottle 21 Liquid Ammonia 500 Ml Bottle 22 D.P.X. 250 Ml Bottle 23 Conc.Nitric Acid 500Ml Bottle 24 Glycerine 500 Ml Bottle 25 Liquid Paraffin 500 Ml Bottle 26 Na Oh ( Sodium Hydroxide ) 500 Ml Bottle 27 Poly-L Lysine Solution 100 Ml Bottle 28 Citric Acid ( Anhydrous Pure ) 500 Ml Bottle 29 H 2 O2 ( Hydrogen Peroxide ) 100 Ml Bottle 30 Deionized Water 5 Lt. Bottle 31 Schiffs Reagent 500 Ml Bottle 32 Bendict Reagent 500 Ml 33 Drabkins Solution 5 Lit 34 Fouchet’S Reagent 200 Ml 35 Ehrlich Reagent 200 Ml 36 Methylene Blue Stain 125 Ml Bottle 37 Rapid A.F.B Stain Kit 38 Carbol Fuchsin Stain 125 Ml Bottle 39 Reticulocyte Stain ( Biolab ) 01 Packet 40 Acetone 500 Ml Bottle 41 Sodium Hypo Chloride 5 Ltr Bottle 42 Spirit 5 Ltr Bottle 43 Glucose God- Pod Kit 500 Ml 44 Glacial Acetic Acid 500 Ml Bottle 45 Hematoxylin Stain Powder ( Sd Fine ) 25Gm / 5 Gm Packet 46 Eosin Powder ( Water Soluble ) 25Gm Packet 47 Aluminum Potassium Sulphate 500 Gm Packet 48 Mercuric Oxide Red 100 Gm Packet 49 Wax 600-620 500 Gm Packet 50 Albumin Powder 500 Gm Packet 51 Periodic Acid 25 Gm Packet 52 Mercuric Oxide 25 Gm Packet 53 Dextrose ( Anhydrous ) 500 Gm Packet 54 Sulphur Powder 100 Gm 55 Barium Chloride Powder 500 Gm 56 Ammonium Sulphate 500 Gm 57 Sodium Sulphate 500 Gm 58 Sulphosalicylic Acid 500 Gm 59 Gentian Violet 100 Gm 60 Tris Buffer ( Sd Fine ) 500 Gm Packet 61 Edta 100 Gm Packet 62 Low Profile Disposable Microtome Blade For Cutting Tissue Section 63 Urine Strip ( Distix ) Packet ( 1X100 Strips ) 64 Phosphotungistic Acid 100 Gm Packet 65 Brilliant Crystal Blue Stain 100 Gm 66 Plastic Tissue Embedding Cassettes Packet ( 1X1000 Pieces ) 67 Oxalic Acid 50 Gm 68 Ferric Chloride 500 Gm 69 Sodium Thio Sulphate 500 Gm 70 Potassium Ferrocyanide 500 Gm 71 Sodium Chloride 500 Gm 72 Sodium Nitroprusside 500 Gm 73 Orthotoludine Reagent 500 Gm 74 Benzidine Powder 25 Gm 75 Diamino Benzidine 25 Gm Powder 76 Total Protein Kit 77 Albumin Kit 78 Serum Creatinine Kit 79 Serum Urea Kit 80 Serum Sgot Kit 81 Serum Sgpt Kit 82 Direct S. Bilirubin Kit 83 Serum Calcium Kit 84 Serum Alkaline Phosphate Kit 85 Serum Cholesterol Kit 86 Serum Triglyceride Kit 87 Serum Hdl Cholesterol Kit 88 Serum Uric Acid Kit 89 Tpo ( Thyroid Peroxidase Antibody ) 3 Ml Vial 90 Mouse / Rabbit Specific Polymer Hrp- Dab Ihc Detection Kit 5 Ml Vial 91 Desmin Antibody ( Ihc ) 3 Ml Vial 92 Vimentin Antibody ( Ihc ) 3Ml Vial 93 Estrogen Receptor Antibody ( Er ) 3Ml Vial 94 Anti-Progesterone Receptor Antibody 3Ml Vial 95 Anti S-100 Antibody 3Ml Vial 96 Anti Human Her2 / Neu Antibody 3Ml Vial 97 Anti Human Cytokeratin ( Pan ) Antibody Cocktail 3Ml Vial 98 Anti Melanoma Antibody ( Anti Hmb45 Antibody ) 3Ml Vial 99 Anti Neuron Specific Enolase ( Nse ) Antibody 3Ml Vial 100 Anti Cd45 Antibody 3Ml Vial 101 Anti Hpv-16 Antibody 3Ml Vial 102 Anti Cd20 Antibody 3Ml Vial 103 Anti Cd15 Antibody 3Ml Vial 104 Anti Cd30 Antibody 3Ml Vial 105 Antibody ( Anti C –Kit ) 3Ml Vial 106 Myeloperoxidase Reagent 3Ml Vial 107 Anti Ki 67 Antibody 3Ml Vial 108 Anti E Cadherin Antibody 3Ml Vial 109 Anti Cd- 34 Antibody 3Ml Vial 110 Anti P-63 Antibody 3Ml Vial 111 Anti P-53 Antibody 3Ml Vial 112 Anti Smooth Muscle Actin Antibody 3Ml Vial 113 Anti Ck -6 Antibody 3Ml Vial 114 Anti Ck -17 Antibody 3Ml Vial 115 Anti Cd-68 Antibody 3Ml Vial 116 Whatman Filter Paper Sheet 117 Coplin Jar ( Plastic ) 01 Piece 118 Tuff’S Jar ( Glass ) Piece 119 K3 Edta Vacutainar 1 X100 120 Plain Vacutainar 1 X100 121 Riya Vial ( Plastic ) 1 X100 122 Test Tube Stand ( Plastic ) Piece 123 Test Tube Holder Piece 124 Plastic Beaker 25Ml Piece 125 Plastic Beaker 100Ml Piece 126 Semen Collection Container 20 Ml ( 1X50 ) Packet 127 Urine Sample Container 50 Ml ( 1X50 ) Packet 128 Micro Tips Large ( 200- 2000 Micro Liter ) Packet ( 1X500 Pieces ) 129 Micro Tips Small ( 20- 200 Micro Liter ) Packet ( 1X1000 Pieces ) 130 Sprit Lamp 50Ml Piece 131 Plastic Dropper Piece 132 Pipette Bulb Piece 133 Glass Test Tube 7Ml, Piece 134 Glass Test Tube 10Ml, Piece 135 Glass Test Tube 20Ml Piece 136 Glass Slide ( Blue Star ) Packet 137 Cover Slip ( Blue Star ) Packet 138 Neubauer Chamber Piece 139 Glass Pipette 5 Ml 20 Micro Lit Piece 140 Glass Pipette 10 Ml 20 Micro Lit Piece 141 Glass Pipette 1 Ml 20 Micro Lit Piece 142 Micro Pipette 10 Microlitre Fix Piece 143 Micro Pipette 100 Microlitre Fix Piece 144 Micro Pipette ( 5-50 ) Microlitre Variable Piece 145 Micro Pipette 20 Microlitre Fix Piece 146 Micro Pipette 1000 Microlitre Fix Piece 147 Micro Pipette 50 Microlitre Fix Piece 148 Wintrobe Esr Tube With Stand Piece 149 Westergreen Esr Pipette With Stand Piece 150 Pricking Needile No 23 ( 1 X100 ) Packet 151 Pricking Needile No 24 ( 1 X100 ) Packet 152 Pricking Needile No 21 ( 1 X100 ) Packet 153 Pricking Needile No 20 ( 1 X100 ) Packet 154 Surgical Tray 6X8 “ Inch ( Rectangular ) Piece 155 Microscopic Slide Tray ( Aluminium ) Holding Capacity 20 ( 3X1”Inch ) Piece 156 Bone Marrow Aspiration Needle 16 No Piece 157 Bone Marrow Aspiration Needle 18 No Piece 158 L P Needle Piece 159 Histology Tissue Base Mold ( Steel ) Piece 160 Bone Marrow Biopsy Needle ( Trephine Biopsy ) Piece 161 Glass Rod Piece 162 Ph Paper Strip ( 5.0-7.5 ) Booklet ( 1X20 Strips ) 163 Ph Paper Strip ( 2.0-10.5 ) Booklet ( 1X20 Strips ) 164 Lens Cleaning Paper Booklet ( 9Cmx14.5Cm, 100 Leaves ) 165 Museum Mounting Jar ( With Cover ) ( 10Cm X 5Cm X 20Cm ) 166 Museum Mounting Jar ( With Cover ) ( 15Cm X 10Cm X 25Cm ) 167 Museum Mounting Jar ( With Cover ) ( 16.2Cm X 6Cm X 18Cm ) 168 Museum Mounting Jar ( With Cover ) ( 12Cm X 10Cm X 20Cm ) 169 Museum Mounting Jar ( With Cover ) ( 12Cm X 12Cm X 20Cm ) 170 Museum Mounting Jar ( With Cover ) ( 17Cm X 8Cm X 18Cm ) 171 Museum Mounting Jar ( With Cover ) ( 5.5Cm X 5Cm X 10Cm ) 172 Museum Mounting Jar ( With Cover ) ( 17Cm X 9.5Cm X 30Cm ) 173 Museum Mounting Jar ( With Cover ) ( 28Cm X 24Cm X 29Cm ) 174 Museum Mounting Jar ( With Cover ) ( 21Cm X 19Cm X 27Cm ) 175 Museum Mounting Jar ( With Cover ) ( 11Cm X 25Cm X 24Cm ) 176 Hiv Rapid Tridot Kit 177 Hbsag Immunoassay Rapid Kit 178 Hcv Rapid Kit, ( Fourth Generation Immunoassay For Core, Ns3, Ns4, Ns5 ) 179 Rdt For Mp Rapid Kit ( Immunochromatographic Kit For Pf / Pan Antigen ) 180 Vdrl Rapid Immunoassay Kit 181 Typhoid Rapid Kit ( Igg, Igm ) 182 Dengue Rapid Kit ( Immunochromatographic Assay For Ns1, Igg , Igm ) 183 Plain Vial 5 Ml Vial 184 Abo Rh Anti Sera 10 Ml Packet 185 Ppd Vial 5 Ml Vial 186 Sodium Citrate Vial 5 Ml Vial 187 Capillary Tube Piece 188 A.H.G. 5Ml 189 Anti A1 Lectin 5Ml 190 Anti H Lectin 5Ml 191 Anti D ( Igm + Igg Monoclonal ) 10Ml 192 Pt 5Ml 193 Aptt 3Ml 194 Calcium Chloride 10Ml 195 Bovine Albumin 5Ml 196 Hiv Rapid Kit 4Th Generation 197 Hiv Rapid Kit 3Th Generation 198 Hcv Rapid Kit, 3Th Generation 199 Hbaag Rapid Kit 4Th Generation 200 Hbaag Rapid Kit 3Th Generation 201 Hiv Elisa Kit 4Th Generation 202 Hcv Elisa Kit 4Th Generation 203 Hcv Elisa Kit 3Th Generation 204 Hbaag Elisa Kit 4Th Generation 205 Hbaag Elisa Kit 3Th Generation 206 Troniquete 207 Micro Pipette 10 Ul Fix 208 Micro Pipette 50 Ul Fix 209 Micro Pipette 25 Ul Fix 210 Micro Pipette 100 Ul Fix 211 Micro Pipette 1000 Ul Fix 212 Micro Pipette 100-1000 Ul Variable 213 Micro Pipette 10-100 Ul Variable 214 Micro Pipette 0-10 Ul Variable N 215 Micro Pipette 20-200 Ul Variable 216 Micro Pipette Stand ( Big ) Plastic Make 217 Micro Pipette Stand ( Small ) Plastic Make 218 Transfer Bag Of 300Ml 219 Double Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 220 Tripal Blood Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 221 Leucodepltion Blood Bag 350Ml ( Inline Top And Top ) 222 Leucodepltion Blood Bag 350Ml ( Lab Side ) 223 Pregnancy Kit Test 224 Cappilary Tub 225 Swab Stick 226 Benedict Reagent Quanitateive 500 Ml 227 Benedict Reagent Qualitateive 500 Ml 228 Sulphar Powder 500 Gm 229 Occult Blood Powder 100Gm 230 Hydrozen Peroxide 500Ml 231 Egg Albumin 500Gm 232 Sulphuric Acid 500Ml 233 Sodium Hydroxide 500Gm 234 Copper Sulphate 500Gm 235 Picric Acid 500Ml 236 Arcino Molibate 500Ml 237 Phaspho Tungstic Acid 500Gm 238 Sodium Carbonate 500Gm 239 Nitric Acid 500Ml 240 Silver Nitrate 25Gm 241 Hydrochloric Acid 500Ml 242 Taffers Reagent 250Ml 243 Bromo Cresol Green Reagent Box 244 Urea Kit 245 Protein Kit 246 Cholesterol Kit 247 Pipette 1Ml 248 Pipette 2Ml 249 Test Tub 250 Burette With Tip 251 Burette Stopper 252 Burette Stand 253 Filter Paper 254 Mesauring Cylinder 50Ml 255 Beaker 250Ml 256 Beaker 500Ml 257 Round Bottle Flask 200Ml 258 Conical Flask 200Ml 259 Urin Jar Plastic 260 Funnel Plastic 261 Cuvette Colouimeton 262 Dispenser Bottle 263 Amikacin 30 Mcg / Disc , 100 Disc / Vial 264 Amoxicillin Clavulanic Acid 20 / 10 Mcg / Disc , 100 Disc / Vial 265 Cefoperazone75 Mcg / Disc , 100 Disc / Vial 266 Ceftriaxone 30 Mcg / Disc , 100 Disc / Vial 267 Nitrofurantoin 300 Mcg / Disc , 100 Disc / Vial 268 Ofloxacin 5 Mcg / Disc , 100 Disc / Vial 269 Ceftazidime / Clavulanic Acid 30 / 10 Mcg / Disc , 100 Disc / Vial 270 Ciprofloxacin 5 Mcg / Disc , 100 Disc / Vial 271 Ertapenem 10 Mcg / Disc , 100 Disc / Vial 272 Gentamicin 10 Mcg / Disc , 100 Disc / Vial 273 Imipenem 10 Mcg / Disc , 100 Disc / Vial 274 Levofloxacin 5 Mcg / Disc , 100 Disc / Vial 275 Meropenem 10 Mcg / Disc , 100 Disc / Vial 276 Moxifloxacin 5 Mcg / Disc , 100 Disc / Vial 277 Prulifloxacin 5 Mcg / Disc , 100 Disc / Vial 278 Vancomycin 30 Mcg / Disc , 100 Disc / Vial 279 Azithromycin 15 Mcg / Disc , 100 Disc / Vial 280 Chloramphenicol 30 Mcg / Disc , 100 Disc / Vial 281 Piperacillin / Tazobactam 100 / 10 Mcg / Disc , 100 Disc / Vial 282 Tobramycin 10 Mcg / Disc , 100 Disc / Vial 283 Tetracycline 30 Mcg / Disc , 100 Disc / Vial 284 Cefotaxime 30 Mcg / Disc , 100 Disc / Vial 285 Fluconazole 10 Mcg / Disc , 100 Disc / Vial 286 Amphotericin B 100 Units / Disc , 100 Disc / Vial 287 Itraconazole 30 Mcg / Disc , 100 Disc / Vial 288 Nystatin 100 Units / Disc , 100 Disc / Vial 289 Voriconazole 1Mcg / Disc , 100 Disc / Vial 290 Co-Trimoxazole 25 Mcg / Disc , 100 Disc / Vial 291 Clindamycin 2 Mcg / Disc , 100 Disc / Vial 292 Teicoplanin 30 Mcg / Disc , 100 Disc / Vial 293 Cefdinir 5 Mcg / Disc , 100 Disc / Vial 294 Cefpirome 30 Mcg / Disc , 100 Disc / Vial 295 Imipenem –Cilastin 10 Mcg / Disc , 100 Disc / Vial 296 Ampicillin 2 Mcg / Disc , 100 Disc / Vial 297 Polymyxin-B 100 Unit / Disc , 100 Disc / Vial 298 Bacitracin 8 Unit / Disc , 100 Disc / Vial 299 Cefoxitin 200 Mcg / Disc , 100 Disc / Vial 300 Linezolid 30 Mcg / Disc , 100 Disc / Vial 301 Gentamicin ( High ) 50 Mcg / Disc , 100 Disc / Vial 302 Faropenem 5 Mcg / Disc , 100 Disc / Vial 303 Doxycycline 10 Mcg / Disc , 100 Disc / Vial 304 Aztreonam 50 Mcg / Disc , 100 Disc / Vial 305 Fosfomycin 50 Mcg / Disc , 100 Disc / Vial 306 Novobiocin 30 Mcg / Disc , 100 Disc / Vial 307 Optochin 5 Mcg / Disc , 100 Disc / Vial 308 Cefuroxime 30 Mcg / Disc , 100 Disc / Vial 309 Minocyline 30 Mcg / Disc , 100 Disc / Vial 310 Nalidixicacid 30 Mcg / Disc , 100 Disc / Vial 311 Norfloxacin 10 Mcg / Disc , 100 Disc / Vial 312 Tigecycline 15 Mcg / Disc , 100 Disc / Vial 313 Clarithromycin 15 Mcg / Disc , 100 Disc / Vial 314 Ketoconazole 30 Mcg / Disc , 100 Disc / Vial 315 Vancomycin ( E Test Strip ) 0.5 – 32 Mcg / Ml 316 Cefepime / Cefepime+Clavulanic Acid ( E Test Strip ) Cefepime ( 0.25-16Mcg ) / Cefepime+Clavulanic Acid ( 0.064-4 Mcg ) 317 Imipenem And Imipenem + Edta ( E Test Strip ) Imipenem ( 4-256 Mcg ) And Imipenem+ Edta ( 1-64 Mcg ) 318 Macconkey Agar 500G / Bottle 319 Muller-Hinton-Agar 500G / Bottle 320 Chrome Universal Agar 500G / Bottle 321 Lugol’S Iodine 125 Ml / Bottle 322 Urea Agar Base 100G / Bottle 323 Simmons Citrate Agar 100G / Bottle 324 Triple Sugar Iron Agar 100G / Bottle 325 Blood Agar Base 500G / Bottle 326 Robertson Cooked Meat Media 500G / Bottle 327 Sucrose 500G / Bottle 328 Lactose ( Lr ) 500G / Bottle 329 Mannitol ( C6h14c6 ) 500G / Bottle 330 Peptone, 500G / Bottle 331 Dextrose Anhydrous ( C6h12o6 ) 500G / Bottle 332 Bile Esculin Reagent / Agar 500G / Bottle 333 Methylene Blue For Zn Stain 500Ml / Bottle 334 Carbol Fuchsin For Zn Stain 500Ml / Bottle 335 Giemsa Stain 500Ml / Bottle 336 Periodic Acid Schiff Stain 500Ml / Bottle 337 Safranine For Zn Stain 500Ml / Bottle 338 Gentian Violet ( Crystal ) 100G / Bottle 339 Phenol ( C6h5oh ) ( Crystal ) 500G / Bottle 340 Methyl Red Reagent 500G / Bottle 341 Phenyl Pyruvic Acid ( Ppa Test ) 100G / Bottle 342 Prepared Oxidase Disc 50 Disc / Box 343 Iodine ( Crystal ) 100G / Bottle 344 Tri-Sodium Citrate ( Na3c6h5o72h2o ) 500G / Bottle 345 Citric Acid ( C6h8o7 ) 500G / Bottle 346 Kovac’S Indole Reagent 100Ml / Bottle 347 40 % Urea ( Nh2conh7 ) 500G / Bottle 348 Antibiotic Zone Scale 1Pc / Box 349 Antisera-Salmonella O And H A, 2 Ml / Vial 350 Antisera-Shigella Dysenteriae, 2 Ml / Vial 351 Antisera-Shigella Flexnari, 2 Ml / Vial 352 Antisera-Shiegella Sonnie, 2 Ml / Vial 353 Antisera-Vibrio Cholera O139 , 2 Ml / Vial 354 Atcc Strain - E.Coli 25922, Freeze Dried Lyophilized / Vial 355 Atcc Strain - E.Coli 35218, Freeze Dried Lyophilized / Vial 356 Atcc Strain - Pseudomonas Aeruginosa 27853 Freeze Dried Lyophilized / Vial 357 Atcc Strain - Staphylococcus Aureus 25923 Freeze Dried Lyophilized / Vial 358 Atcc Strain - Staphylococcus Aureus 29213 Freeze Dried Lyophilized / Vial 359 Mounted Peripheral Blood Smear Slides For Gametocytes Of Plasmodium Vivax And Falciparum, ( 1 – Slide ) 360 Potassium Permagnate ( Kmno4 ) 500G / Bottle 361 Formalin ( 20% ) 500Ml / Bottle 362 Methanol ( Ch3oh ) 500Ml / Bottle 363 Acetone ( Lr ) ( Reagent ) 500Ml / Bottle 364 100 % Sulphuric Acid ( H2so4 ) 500Ml / Bottle 365 Gram’S Iodine 500Ml / Bottle 366 Boric Acid 500G / Bottle 367 Di- Sodium Hydrogen Ortho-Phosphate 500G / Bottle 368 Formaldehyde Solution ( 37-41 ) % 1000Ml / Bottle 369 Potassium Iodide ( Ki ) 500G / Bottle 370 Hydrogen Peroxide Solution ( H2o2 ) 6% 1000Ml / Bottle 371 Sodium Hydroxide Pellets Purified ( Naoh ) 500G / Bottle 372 Potassium Hydroxide Pellets ( Koh ) 500G / Bottle 373 Sodium Chloride ( Nacl ) 500G / Bottle 374 Amyl Alcohol ( C5h11oh ) 500Ml / Bottle 375 Xylene Sulphur 500Ml / Bottle 376 70 % Isopropyl Alcohol 500Ml / Bottle 377 Normal Saline 500Ml / Bottle 378 Digital Weighing Balance 24Kg / Machine 379 Test Tube ( Glass 7Ml ) 100Pc / Pkt 380 Sterile Swab Stick, 100Pc / Pkt 381 Test Tube Holder ( Small ) 10Pc / Box 382 Test Tube Holder ( Large ) 10Pc / Box 383 Petri Disk 90X90 ( 10Pc / Pkt ) 384 Petri Disk 90X120, ( 10Pc / Pkt ) 385 Stock Vial ( 50Pc / Pkt ) 386 Sterile Disposable Square Petri Plates ( 10Pc / Pkt ) 387 Viral Transport Medium ( 3Ml / Vial ) 388 Kovac’S Indole Reagent 100 Ml / Bottle 389 Centrifuge Tubes 50Ml ( Glass ) 100Pc / Box 390 Centrifuge Tubes 15Ml ( Glass ) ( Consumable ) 100Pc / Box 391 Erlenmeyer Flask ( 1000Ml ) ( Consumable ) 1Pc 392 Microtube Rack ( 5X16 Holes ) Per Rack 393 Wash Bottle Capacity 500Ml / Pc 394 Sterile Disposable Forceps ( 10Pc / Pack ) 395 Steam Indicator Tape Size 18Mm ( 1-Pc ) 396 Autoclavable Dispo Bag “14” ( 50 / Pack ) 397 Indicator Ph Paper ( Ph 5 To 7.5 ) ( 5 Bundle / Pack ) 398 Permanent Marker Pen ( Red / Black ) ( Narrow Tip ) ( 1-Pc ) 399 Homogeniser With Serrated Pestle S.P 10Ml ( 1-Pc ) 400 Nichrome Loop 4Mm, Double Wound ( 10Pc / Pack ) 401 Nichrome Loop 2Mm, Double Wound ( 10Pc / Pack ) 402 Semisolid Imrv Medium And Selective Supplement Fd19 -2Vl, 500Gm / Bottle 403 Sample Discarding Jar 3L Capacity ( Borosil ) ( 1-Pc ) 404 Sample Discarding Jar 5L Capacity ( Borosil ) ( 1-Pc ) 405 Conical Flask 500Ml Capacity ( Borosil ) ( 1-Pc ) 406 Kala-Azar Detection Rapid Test ( 25Kit / Box ) 407 Blood Culture Bottle / Bhi ( Paediatric ) 20Ml Capacity ( 10Pc / Box ) 408 Blood Culture Bottle / Bhi ( Adult ) 70Ml Capacity ( 10Pc / Box ) 409 India Ink Reagent ( Nigrosin Stain 10% W / V ( 100 Ml ) And Methylene Blue ( 125Ml / Bottle ) 410 Scrub Typhus Igm Elisa 96 Well Test Kit / Box 411 Chikungunya Igm Elisa 96 Well Test Kit / Box 412 Je Igm Capture Elisa 96 Well Test Kit / Box 413 Dengue Igm Elisa 96 Well Test Kit / Box 414 Dengue Ns-1 Ag Elisa 96 Well Test Kit / Box 415 Cryptococcal Ag Rapid Test ( 25Kit / Box ) 416 L J Medium Slant 10 Slant / Pack 417 Capped Collection Tube 1.5Ml Capacity ( 50Pc / Box ) 418 Microamp Optical Tube 8 / Strips ( 0.2 Ml Capacity ) 419 Microamp Optical 8 Cap Strips ( 0.2 Ml ) 420 Micro Centrifuge Tube 1.5Ml Capacity ( 500Pc / Box ) 421 Serological Pipette 10Ml ( 200Pc / Box ) 422 Serological Pipette 5Ml ( 250Pc / Box ) 423 Art Barrier Specialty Pipette Tips 1000Μl Racked ( 96X1 Box ) 424 Art Barrier Specialty Pipette Tips 20-200Μl Racked ( 96X1 Box ) 425 Art Barrier Specialty Pipette Tips 2-20Μl Racked ( 96X1 Box ) 426 Art Barrier Specialty Pipette Tips 50Μl Racked ( 96X1 Box ) 427 Art Barrier Specialty Pipette Tips 0-10Μl Racked ( 96X1 Box ) 428 Safeskin Purple Nitrile Gloves ( Medium ) 100 / Box 429 N95 Particulate Respirator ( Niosh Approved ) 1Pc 430 Kimwipes 37.33X42.16 Cmn ( 140 / Box ) 431 Cryo Vial Sterile 1.8Ml ( 25Vial / Pkt ) 432 Cryo Box 1.8Ml ( 9X9 Wells ) ( 1 X 4 / Box ) 433 Fg-Optical Adhesive Covers For Pcr, 1Pc 434 Microamp Optical 96-Well Reaction Plate ( 0.2Ml ) , ( 1- Plate ) 435 Zip Lock Bag 21.3X18cm ( 10Bag / Box ) 436 384 Well Pcr Plate, ( 1- Plate ) 437 Falcon Tube 10Ml ( 1Pc ) 438 Falcon Tube 50Ml ( 1Pc ) 439 Dacron Swab Stick ( Nylon Flocked ) ( 100Pc / Box ) 440 Polypropylene Trigger Sprayers ( 500Ml ) , 1Pc 441 Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( Size 11 X 8 Inch ) , 1Pc 442 Paraffin Film ( M ) ( 1-Roll ) 443 Red Cap Tube 3Ml ( 1-Pc ) 444 Aluminum Foil ( 72 Meter ) ( 1-Pc ) 445 Isopropanol 99.9% ( 500Ml / Bottle ) 446 Spirit Surgical Grade ( 1Lt / Bottle ) 447 Spirit Absolute ( 40 Lt / Gallon ) 448 Hypochlorite Soln ( 5% / 4.6% ) ( 1Lt / Bottle ) 449 Sterilium Hand Rub ( 500Ml / Bottle ) 450 Liquid Hand Wash ( 750Ml / Pack ) 451 Blotting Paper ( 1-Sheet ) 452 Tourniquets For Blood Collection ( 1-Pc ) 453 Loose Gloves M ( 7 / 7.5 ) ( 100 / Box ) 454 Surgical Gloves M ( 7 / 7.5 ) , ( 1-Pc ) 455 3 Ply Surgical Mask , ( 1-Pc ) 456 Surgical Head Cap, ( 1-Pc ) 457 Face / Protective Shield , ( 1-Pc ) 458 Bleaching Powder ( 25Kg / Bag ) 459 Protective Goggles ( 1-Pc ) 460 Rna Extraction Kit ( 1-Rxn ) 461 Rna Zap Water 200Ml / Bottle 462 Ethanol Absolute Molecular Grade ( 500Ml / Bottle ) 463 Thermacol Transport Box ( 18Cm X 12 Cm ) ( 500Pc / Bag ) 464 Tissue Paper ( Toilet Paper Roll ) ( 9Pc / Pack ) 465 Labeling Stickers Sheets ( St-65A4 ) ( 100Sheets / Pack ) 466 Disposable Tongue Depressor ( Spatula ) ( 100Pc / Pack ) 467 Nuclease Free Water ( Molecular Grade ) 1000Ml / Pack 468 Glucose Strip 469 Taqpath Multiplex Rt Pcr Kit For The Detection Sars Cov-2 1000 Rxn 470 Taqman Sequence Detection ( Primer + Probe ) For Screening ( E Gene & Rnp ) And Confirmatory ( Rdrp, & Hku Orf Ib ) 471 Seegene Allplex 2019-Ncov Assay R 472 Mylab Patho Detect Covid-19 Qualitative Pcr Kit 473 A*Star Fortitued Kit 2.0 Covid-19 Rt-Pcr Test 474 Pandemic H1n109 Assay Set 1000 Rxn 475 Super Script Iii Platinum Qrt Pcr Reagent 5 Rxn 476 Agpath One Step Rt Pcr Reagent 477 Labgun Covid-19 Rt Pcr Kit 478 Bgi Rt Pcr Kit For Detection Sars Cov-2 479 1-Napthol 200 Gm 480 2, 4-Dinitrophenyl Hydrazine 300 Gm 481 2-Amino Diphenyl Oxalic Acid 500 Gm 482 2-Chloro-2H-Azirine 500 Gm 483 2-Napthol 250 Gm 484 3, 5- Dinitrosalicylic Acid 500 Gm 485 8-Hydroxy Quinoline 250 Gm 486 Absolute Ethanol 10 Lit 487 Acacia 500 Gm 488 Acetaldehyde 500 Ml 489 Acetamide 500 Gm 490 Acetanilide 1 Kg 491 Acetic Acid 10 Lit 492 Acetic Anhydride 2.5 Lit. 493 Acetone 05 Lit 494 Acetonitrile 05 Lit 495 Acetophenone 500Ml 496 Acetyl Acetone 1 Lit 497 Acetylcholine Iodide 5Gm 498 Activated Charcoal 1Kg 499 Agar 500Gm 500 Alcohol / Spirit 25Lit 501 Almond Oil 1Lit 502 Aloe Vera Gel 1Kg 503 Alpha-Amylase 100Gm 504 Alpha-Napthol 250Gm 505 Aluminium Chloride 1Kg 506 Aluminium Hydroxide 500Gm 507 Aluminium Sulphate 500Gm 508 Amaranth Red 100Gm 509 Amino Acid Kit 510 Ammonia 10 Lit 511 Ammonium Acetate 1Kg 512 Ammonium Bicarbonate 500Gm 513 Ammonium Carbonate 1Kg 514 Ammonium Chloride 1Kg 515 Ammonium Citrate ( Tri ) 500Gm 516 Ammonium Hydroxide 1Kg 517 Ammonium Molybdate 500Gm 518 Ammonium Nitrate 1Kg 519 Ammonium Oxalate 500Gm 520 Ammonium Reineckate 1Kg 521 Ammonium Sulphate 1Kg 522 Amyloglucosidase 50Ml 523 Anhydrous Sodium Sulfite 1Kg 524 Aniline 5Lit 525 Aniline Acetate 500Gm 526 Anthranilic Acid 250Gm 527 Apple Essence 50Ml 528 Arachis Oil 500Ml 529 Arsenic Trioxide 500Gm 530 Ascorbic Acid 500Gm 531 Ashwagandha 500Gm 532 Aspartic Acid 100Gm 533 Aspirin 1Kg 534 Atropine Sulphate 10Ml 535 Atropine Sulphate 25Gm 536 Bahera 1Kg 537 Barfoed’S Reagent 1Lit 538 Barium Chloride 1Kg 539 Barium Sulphate 500Gm 540 Bay Leaf 500Gm 541 Beef Extract 500Gm 542 Beeswax 2Kg 543 Belladonna Leaf Dry 500Gm 544 Benedict’S Reagent 1 Lit 545 Bentonite Powder 1Kg 546 Benzaldehyde 5 Lit 547 Benzamide 1Kg 548 Benzene 2.5 Lit 549 Benzidine 500 Gm 550 Benzil 1Kg 551 Benzoic Acid 5Kg 552 Benzoic Anhydride 500Gm 553 Benzoin 500Gm 554 Benzothiazole 250Gm 555 Benzoyl Chloride 4 Lit 556 Benzyl Alcohol 2.5 Lit 557 Benzylpenicillin 250Gm 558 Bial’S Reagent 1Lit 559 Blood Group Test Kit ( 10 Ml Anti A, B & D ) 560 Borax 1Kg 561 Boric Acid 500Gm 562 Bovine Serum Albumin 10Gm 563 Bramhi 500Gm 564 Brilliant Blue 5Gm 565 Bromine 500Ml 566 Bromocresol Green Solution 250Ml 567 Butanol 2.5 Lit 568 Butyl Isocyanate 500 Gm 569 Cadmium Sulfate 5Gm 570 Caffeine 500Gm 571 Calamine 1Kg 572 Calcium Chloride Anhydrous 2.5Kg 573 Calcium Gluconate 500Gm 574 Calcium Hydroxide 5Kg 575 Camphor 250Gm 576 Carbolfuchsin 100Gm 577 Carbon Tetrachloride 2.5 Lit 578 Cardamom 250 Gm 579 Carrageenan 500Gm 580 Castor Oil 2.5 Lit 581 Catechol 500Gm 582 Cellulose Acetate Hydrogen Phthalate 500Gm 583 Ceric Ammonium Sulphate 500Gm 584 Cetyl Alcohol 500Gm 585 Chandan Powder 500Gm 586 Charcoal 500Gm 587 Chloral Hydrate 500Gm 588 Chloroform 10 Lit 589 Chloroquine Powder 250Gm 590 Chlorosulfonic Acid 1 Lit 591 Chlorpheniramine Maleate Powder 250Gm 592 Chlorpromazine 250Gm 593 Cinchona 500 Gm 594 Cinnamic Acid 250 Gm 595 Cinnamon 500 Gm 596 Citric Acid 500 Gm 597 Clove 500 Gm 598 Cobalt Chloride 500 Gm 599 Cocoa Butter 200 Gm 600 Codeine Phosphate 50 Gm 601 Compound Tartrazine Solution 100Gm 602 Copper ( Ii ) Acetate 2.5Kg 603 Copper ( Ii ) Oxide 1Kg 604 Copper ( Ii ) Sulphate 1Kg 605 Copper ( Metal ) Turning 500Gm 606 Copper Sulfate 1Kg 607 Coriander 500Gm 608 Corn Oil 500Ml 609 Corn Starch 500Gm 610 Creatinine 100Gm 611 Crystal Violet 500Ml 612 Cupric Acetate 500Gm 613 Dapsone Powder 250Gm 614 Dextrin 500Gm 615 Dextrose 1Kg 616 Dichloro Methane 5Lit 617 Diethyl Ether 10Lit 618 Diethylmalonate 500Ml 619 Dioscorea 250Gm 620 Diphenylamine 500Gm 621 Disodium Edta 500Gm 622 Disodium Phosphate Heptahydrate 1Kg 623 Dmso 5Lit 624 Dragendroff’S Reagent 1Lit 625 Ephedra 500Gm 626 Eriochrome Black T ( Solochrome Black T ) 25Gm 627 Ethanol 10Lit 628 Ethyl Acetate 5Lit 629 Ethyl Acetoacetate 5Lit 630 Ethyl Benzoate 500Ml 631 Ethyl Cellulose 500Gm 632 Ethylene Diamine Tetra Acetic Acid ( Edta ) 2Kg 633 Eucalyptus Oil 500Ml 634 Eudragit 500Gm 635 Fehling’S Solution A 2Lit 636 Fehling’S Solution B 2Lit 637 Ferric Ammonium Sulphate 1Kg 638 Ferric Chloride 500Gm 639 Ferric Chloride 1Kg 640 Ferrous Sulphate 500Gm 641 Formaldehyde 5Lit 642 Formic Acid 5Lit 643 Fructose 1Kg 644 Furosemide 25Gm 645 Gelatin 1Kg 646 Glacial Acetic Acid 5Lit 647 Glucose 1Kg 648 Glycine 1Kg 649 Glycine 100Gm 650 Glyoxalic Acid 1Lit 651 Granulated Zinc 500Gm 652 Gum Trgacanth Powder 1Kg 653 Hagers Reagent 1Lit 654 Harde 500Gm 655 Histamine 25Gm 656 Honey 1Kg 657 Hydrazine Hydrate 2.5 Lit 658 Hydrochloric Acid 10Lit 659 Hydrogen Peroxide 1 Lit 660 Hydroxy Napthol Blue 25Gm 661 Hydroxy Propyl Methyl Cellulose 500Gm 662 Hydroxylamine Hydrochloride 500Gm 663 Ibuprofen Powder 500Gm 664 Iodine 500Gm 665 Iron Oxide 500Gm 666 Isabgol 1Kg 667 Iso Propanolol 2.5 Lit 668 Isoniazid Powder 250Gm 669 Jatamansi 500Gm 670 Kaolin 500Gm 671 Lactose 1Kg 672 Lanolin 1Kg 673 Lead Acetate 1Kg 674 Lead Nitrate 500Gm 675 Lead Subacetate 2Lit 676 Leishman Reagent In Methanol 25Gm 677 Lemon Essential Oil 250Ml 678 Leucine 25Gm 679 Light Magnesium Oxide 500Gm 680 Light Mineral Oil 5Lit 681 Light Petroleum Ether ( 40 -600 ) 2.5 Lit 682 Liquid Paraffin ( Heavy ) 500Ml 683 Liquid Paraffin ( Light ) 500Ml 684 Liquorice 500Gm 685 Long Pepper 500Gm 686 Lwinoff’S Reagent 1 Lit 687 Magnesium Chloride 1Kg 688 Magnesium Hydroxide 500Gm 689 Magnesium Stearate 2Kg 690 Magnesium Sulfate 2Kg 691 Magnesium Turning 250Gm 692 Malonic Acid 1Kg 693 Maltose 1Kg 694 Mayer’S Reagent 1Lit 695 Menthol 500Gm 696 Mercuric Chloride 50Gm 697 Mercurous Nitrate 25Gm 698 Metaphosphoric Acid 1Kg 699 Methanol 10 Lit 700 Methi 500Gm 701 Methyl Blue 25Gm 702 Methyl Cellulose 500Gm 703 Methyl Ethyl Ketone 1 Lit 704 Methyl Orange 100Gm 705 Methyl Orange Indicator 250Ml 706 Methyl Paraben 500Gm 707 Methyl Red 25Gm 708 Methyl Red 500Ml 709 Methyl Salicylate 500Ml 710 Methylene Blue 500 Ml 711 Methylene Chloride 2.5 Lit 712 Metol Solution 100 Ml 713 Metronidazole Powder 250 Gm 714 Microcrystalline Cellulose 1 Kg 715 Millon’S Reagent 1 Lit. 716 Mineral Oil 500 Ml 717 Molisch Reagent 100 Ml 718 Monosodium Phosphate 1 Kg 719 Morpholino Propane Sulphonic Acid ( Mops ) 25 Gm 720 Nagkeshara 500 Gm 721 Napthol Blue 25 Gm 722 Napthoquinone 100 Gm 723 N-Hexane 5 Lit 724 Ninhydrin 100 Gm 725 Nitric Acid 10 Lit 726 N-Phenylanthranilic Acid ( Ferroin Sulphate ) 100 Ml 727 O-Cresol 500 Ml 728 Octanol 2.5 Lit 729 Oil Of Anise 30 Ml 730 Olive Oil 1 Lit 731 O-Phenylenediamine 250 Gm 732 Orange Oil 500 Ml 733 Orthophosphoric Acid 2.5 Lit 734 Osmic Acid 500 Gm 735 Oxalic Acid 500 Gm 736 O-Xylene 500 Ml 737 P-Aminobenzoic Acid 1 Kg 738 Para Amino Benzoic Acid ( Paba ) 250 Gm 739 Paracetamol Powder 500 Gm 740 Paraffin Liquid Heavy 5 Lit. 741 Paraffin Liquid Light 5 Lit. 742 P-Benzoquinone 100 Gm 743 P-Chloromercuribenzoic Acid 1 Kg 744 Peg 200 2.5 Lit 745 Peg 3350 500 Gm 746 Peg 400 500 Ml 747 Peg 400 2.5 Lit 748 Peg 6000 500 Gm 749 Peptone Soya 500 Gm 750 Perchloric Acid 2.5 Lit 751 Petroleum Ether 5 Lit 752 Phenobarbitone 10 Gm 753 Phenol 1 Kg 754 Phenophthaline Indicator 755 Phenyl Hydrazine Hydrochloride 500 Gm 756 Phenylalanine 25 Gm 757 Phloroglucinol 250 Gm 758 Phosphoric Acid 1 Kg 759 Physostigmine 10 Gm 760 Picric Acid 500 Gm 761 Picrolonic Acid 500 Gm 762 Pine Oil 250 Ml 763 Pineapple Flavour 100 Ml 764 Piper Longum Fruit 500 Gm 765 Piper Longum Root 500 Gm 766 Piperazine Citrate 500 Gm 767 Plumbagoo Zeylanica 500 Gm 768 Potassium Dichromate 2 Kg 769 Potassium Bromide 2 Kg 770 Potassium Chloride 2 Kg 771 Potassium Dihydrogen Phosphate 500 Gm 772 Potassium Ferricyanide 1 Kg 773 Potassium Ferrocyanide 1 Kg 774 Potassium Hydrogen Phthalate 1 Kg 775 Potassium Hydroxide 2 Kg 776 Potassium Iodide 500 Gm 777 Potassium Permanganate 500 Gm 778 Potassium Sodium Tartrate 500 Gm 779 Potassium Sulphate 1Kg 780 Precipitated Chalk 500 Gm 781 Precipitated Sulphur 500 Gm 782 Propanol 2.5 Lit 783 Propyl Glycol 1 Kg 784 Propyl Paraben 500 Gm 785 Propylene Glycol 2.5 Lit 786 P-Toluene Sulfonylamide 500 Gm 787 P-Toluene Sulphonic Acid 2.5 Lit 788 Pyridine 2.5 Lit 789 Quinine Sulphate 100 Gm 790 Rbc Diluting Fluid 500 Ml 791 Rectified Sprit 5 Lit 792 Resorcinol 2 Kg 793 Rose Oil 500 Ml 794 Ruthenium Red 5 Gm 795 Saccharin Sodium 500 Gm 796 Safranine 500 Ml 797 Salicylic Acid 1 Kg 798 Seliwanoff’S Reagent 500 Ml 799 Senna Leaves 500 Gm 800 Sesame Oil 2.5 Lit 801 Shakhpushpi 500 Gm 802 Shatavari 500 Gm 803 Silica Gel 100-200 Mesh ( For Column Chromatography ) 2 Kg 804 Silica Gel 60-120 Mesh ( For Column Chromatography ) 2 Kg 805 Silica Gel G 5 Kg 806 Silver Nitrate 25 Gm 807 Sodium Acetate 1 Kg 808 Sodium Arsenate Dibasic 100 Gm 809 Sodium Benzoate 1 Kg 810 Sodium Bicarbonate 5 Kg 811 Sodium Bisulfate 500 Gm 812 Sodium Carbonate 2 Kg 813 Sodium Chloride 5 Kg 814 Sodium Citrate 2 Kg 815 Sodium Dihydrogen Phosphate 1 Kg 816 Sodium Dodecyl Sulphate 5 Kg 817 Sodium Formate 500 G 818 Sodium Hydroxide 2.5 Kg 819 Sodium Metal 500 Gm 820 Sodium Methyl Paraben 500 Gm 821 Sodium Nitrite 1 Kg 822 Sodium Nitropruside 1 Kg 823 Sodium Oxalate 500 Gm 824 Sodium Phosphate Dibasic 1 Kg 825 Sodium Phosphate Monobasic 1 Kg 826 Sodium Picrate 500 Gm 827 Sodium Potassium Tartarate 500 Gm 828 Sodium Propyl Paraben 250 Gm 829 Sodium Salicylate 500 Gm 830 Sodium Succinate 500 Gm 831 Sodium Sulfate 1 Kg 832 Sodium Thiocyanate 500 Gm 833 Sodium Thiosulfate 500G 834 Sodium Tungstate 250 Gm 835 Soft Soap 1 Kg 836 Solochrome Black T 25 Gm 837 Sorbitol Solution ( 70% ) 250 Gm 838 Spermaceti 500 Gm 839 Standard Cholesterol 25 Gm 840 Starch 2 Kg 841 Stearic Acid 1 Kg 842 Strong Ammonium Solution 2.5 Lit 843 Sucrose 2 Kg 844 Sudan Red Iii 5 Gm 845 Sugar 2 Kg 846 Sulfanilamide 500 Gm 847 Sulfuric Acid 15 Lit 848 Sulphamic Acid 500 Gm 849 Sulphanilic Acid 500 G 850 Sulphosalicylic Acid 500 Gm 851 Sulphur 1 Kg 852 Talc 2 Kg 853 Tannic Acid 1 Kg 854 Tartaric Acid 1 Kg 855 Tartrazine Yellow 25 Gm 856 T-Butyl Alcohol 1 Lit 857 Tetracycline Hydrochloride 250 Gm 858 Thioglycollic Acid 500 Ml 859 Thiourea 500 Gm 860 Thymol Blue 25 Gm 861 Titanium Dioxide 500 Gm 862 Toluene 5 Lit 863 Tragacanth 1 Kg 864 Triethanol Amine 2.5 Lit 865 Trisodium Citrate, Dihydrate 500 Gm 866 Turpentine Oil 300 Ml 867 Tween 80 500 Gm 868 Tyrosine 100 Gm 869 Urea 1 Kg 870 Uric Acid 25 Gm 871 Vanillin 100 Gm 872 Vegetable Oil 1 Lit 873 Wagners Reagent 1 Lit. 874 Wbc Diluting Fluid ( Turks Fluid ) 500 Ml 875 White Ointment 1 Kg 876 White Wax 500 Gm 877 Xylenol Orange 10 Gm 878 Yellow Soft Paraffin 500 Gm 879 Zinc Dust 500 Gm 880 Zinc Oxide 2 Kg 881 Zinc Stearate 1 Kg 882 Zinc Sulfate 1 Kg 883 Zinziber Officinalis 500 Gm 884 Air Condenser 300 Mm ( With Joint B-19 Or B-24 And Plain Without Joint ) 885 Ampoules 886 Arsenic Test Apparatus 887 Beaker 100Ml 888 Beaker 250Ml 889 Beaker 500Ml 890 Beaker 1000Ml 891 Boiling Tubes 892 Borer Dia. 8Mm, Thickness 3Mm , Length 99 893 Buchner Funnel Ceramic And Plastic 70Mm 894 Buchner Funnel Ceramic And Plastic 110 Mm 895 Buchner Flask 250Ml 896 Buchner Flask 500Ml 897 Burette Stand 898 Burette With Rota Flow Stop Cock 899 Capillaries For Melting Point Determination 900 Centrifugal Tube Graduated 901 Centrifugal Tube Plain 902 China Dish 903 Clavenger Apparatus 904 Column For Column Chromatography 905 Conical Flask 100 Ml 906 Conical Flask 250Ml 907 Cover Slips 908 Dessicator Plain 150 Mm 909 Dessicator Plain 250 Mm 910 Distillation Flask Bg 911 Distillation Set ( Condenser Reciever ) 912 Distillation Unit 913 Droppong Bottle 60 Ml 914 Droppong Bottle 125 Ml 915 Eppindroff 1.5 Ml 916 Eppindroff 2.0 Ml 917 Erlenmeyer Flask 918 Filter Paper Rim 8X22 919 Flat Bottom Flask ( 100 And 250 ) 920 Flilter Paper Pkt Round 921 Funnel ( Small, Medium And Large Size ) 922 Glass Rod 923 Glass Slides 924 Graduated Measuring Cylinder 10Ml 925 Graduated Measuring Cylinder 50Ml 926 Graduated Measuring Cylinder 100Ml 927 Graduated Measuring Cylinder 500Ml 928 Graduated Measuring Cylinder 1000 Ml 929 Ignition Tube ( Pkt Of 5 Grs, Superior Quality ) 930 Iodine Flask 931 Kipps Apparatus 932 Lens Cleaning Tissue ( Paper Book Of 100 ) 933 Litmus Paper Red / Blue Pkt Of 100 Lbs 934 Microtips 935 Mortar Pastel ( Dia 5, 6 And 8 ) 936 Nessler Cylinder ( 50 Ml ) 937 Ostwald Viscometer 938 Petridish 100 Mm 939 Petridish 75Mm 940 Ph Paper In Plastic Box Pkt Of 100 Lbs 941 Pipette Bulb Rubber 942 Pipette Pump 2 Ml 943 Pipette Pump 25Ml 944 Pipette Pump 10Ml 945 Pipette Stand Horizontal For 12 Pipettte 946 Pipette Volumetric 20Ml 947 Pipette Volumetric 10Ml 948 Pipette Volumetric 25Ml 949 Pipettes 1Ml 950 Pipettes 2Ml 951 Pipettes 5Ml 952 Pipettes 10Ml 953 Plane Slide With Cavity 954 Reagent Bottle Narrow Mouth Amber 500 Ml 955 Reagent Bottle Narrow Mouth Amber 125Ml 956 Reagent Bottle Narrow Mouth Amber 250Ml 957 Round Bottom Flask ( 250 Ml ) 958 Round Bottom Flask ( Double And Triple Neck ) 959 Rubber Cork ( Extra Soft ) Superior Quality ( Top Dia 13Mm ) 960 Rubber Tubing Coil ( 10 Meter ) 961 Separating Funnel 250 Ml 962 Separating Funnel 100Ml 963 Silica Crucibles 15 Mm 964 Soxhlet Apparatus Complete With All Capacity 965 Specific Gravity Bottle N.G. 25 Ml 966 Specific Gravity Bottle N.G. 50 Ml 967 Starch Iodine Paper 100 Leaves 968 Steam Distillation Assembly 969 Stoppered Tubes 970 Suction Pump Made Of Glass 971 Test Tube 972 Test Tube Holder 973 Test Tube Stand 974 Thermometer 30 Cm Length ( 10-360 Degree ) 975 Thiele`S Tube 976 Tlc Chamber With Lid 977 Tlc Plates 978 Tlc Sprayer 979 Volumetric Flask 10Ml 980 Volumetric Flask 25Ml 981 Volumetric Flask 100Ml 982 Volumetric Flask 250Ml 983 Volumetric Flask 1000Ml 984 Wash Bottle 250 Ml 985 Watch Glass 986 Whatman Filter Paper For Paper Chromatography 987 White Tiles 988 Wire Gauge 989 Rnase / Dnase Away ( Ivd, Us Fda, Icmr Approved ) 250Ml 990 Taqpath Covid-19 Combo Kit Multiplex Real-Time Rt-Pcr ( Catalog Numbers A47813 And A47814 ) ( Ivd, Us Fda, Icmr Approved ) 991 A* Star Fortitude Kit 2.0 Covid-19 Qualitative Pcr Kit ( Ivd, Us Fda, Icmr Approved ) 992 Mylabpatho Detect Covid-19 Qualitative Pcr Kit ( Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 993 Kilpest ( Blackbio ) Trupcr Sars-Cov 2Rt-Qpcr Kit Version 2 ( Usfda / Or Ce- Approved ) 994 Biomerieux Argene Sars-Cov-2 R-Gene ( Ivd, Us Fda, Icmr Approved ) 995 Water, Ultrapure, Free Of Dnase, Rnase, Protease, Endonuclease ( Ivd, Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 1 Litre 996 N-95 Particulate Respirator ( Valved Particulate Respirator, 42Cfr84 Approved Product, 95% Filter Efficiency Level, Effective Against Particulate Aerosols Free Of Oil ) 997 Wipes 37.33X42.16 Cm ( Anti-Stat Polyshield: Anti-Static Dispensing System Reduces Lint And Electrostatic Discharge, Easily Wipe Up Liquids, Dust And Tiny Particles And Are Designed For Delicate Tasks ) 998 Cryo Box 1.8Ml ( 9X9 ) ( Chipboard, 132 X 132 X 51Mm, Square, Durable Plastic Cryoboxes With Keyed Lid Orientation And Printed Via Location Grid. ) 999 Zip Lock Bag 21.3X18cm ( Thickness: 52 Micron, Prevents Aroma Transfer, Keep Out Dirt And Moisture, Made From Fda Approved ) 1000 Polypropylene Trigger Sprayers ( 500Ml ) ( Made From Durable, Chemical Resistant Polypropylene, Trigger Sprayer With Adapters. ) 1001 Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( 11X8 Inch ) ( Stainless Steel, Autoclavable, Chemical Resistantand For Laboratory Use ) 1002 Deep Well Storage Plasticware 96 Well Plate ( Height 4.1Cm, Wellcut 1 Cm, Length 12.1Cm Polypropylene ) 1003 Plasticware Magnetic 8 Strip Comb ( Height 4.5Cm, Length 10.2Cm, Distance Between Each Comb=1Cm ) 1004 Duo Rna Elution Plate 96 Well ( Wall Thiekness 6Mm, Nominal Size 50, Neutral Glass ) 1005 Reinelene Solution ( Peracetic Acid ) 1X 5Lit 1006 Glutaraldehyde 2.4% Solution 1X 5 Lit 1007 Self Lock Pouch ( Plastic ) 1008 Deep Well 96 Plate ( Size 50Mm, 200Ul, Wall Thickness 6Mm Nominal Size 50, Neutral Glass ) 1009 96 Tip Comb For Deep Well Plates ( Wall Thickness 5Mm, Nominal Size 90, Neutral Glass ) 1010 Volmutric Flask 500Ml 1011 Rose Water 250Ml 1012 Manitol 500Gm 1013 Renelene Solution 5 Litr. 1014 Cidex 5 Litr. 1015 Fully Automatic Pre Filled Rna Extraction Kit ( Compatible To Zybio Rna Extractor Machine ) 1016 Carbolic Acid 500Ml 1017 Hplc Variant Ii Bts Test Ket 500Test Packet
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 11
Uttar Pradesh View Result →
11.
Educational and Research Institute #8869773 Technical Bid
Supply Of Chemical , Regents , Plastic Ware Etc .-1 Papanicolau O.G.6 125 Ml Bottle 2 Papanicolau E.A 36 125 Ml Bottle 3 Poly-L Lysine Solution 100 Ml Bottle 4 Urine Strip ( Distix ) Packet ( 1X100 Strips ) 5 Plastic Tissue Embedding Cassettes Packet ( 1X1000 Pieces ) 6 Diamino Benzidine 25 Gm Powder 7 Tpo ( Thyroid Peroxidase Antibody ) 3 Ml Vial 8 Mouse / Rabbit Specific Polymer Hrp- Dab Ihc Detection Kit 5 Ml Vial 9 Desmin Antibody ( Ihc ) 3 Ml Vial 10 Vimentin Antibody ( Ihc ) 3Ml Vial 11 Estrogen Receptor Antibody ( Er ) 3Ml Vial 12 Anti-Progesterone Receptor Antibody 3Ml Vial 13 Anti S-100 Antibody 3Ml Vial 14 Anti Human Her2 / Neu Antibody 3Ml Vial 15 Anti Human Cytokeratin ( Pan ) Antibody Cocktail 3Ml Vial 16 Anti Melanoma Antibody ( Anti Hmb45 Antibody ) 3Ml Vial 17 Anti Neuron Specific Enolase ( Nse ) Antibody 3Ml Vial 18 Anti Cd45 Antibody 3Ml Vial 19 Anti Hpv-16 Antibody 3Ml Vial 20 Anti Cd20 Antibody 3Ml Vial 21 Anti Cd15 Antibody 3Ml Vial 22 Anti Cd30 Antibody 3Ml Vial 23 Antibody ( Anti C –Kit ) 3Ml Vial 24 Myeloperoxidase Reagent 3Ml Vial 25 Anti Ki 67 Antibody 3Ml Vial 26 Anti E Cadherin Antibody 3Ml Vial 27 Anti Cd- 34 Antibody 3Ml Vial 28 Anti P-63 Antibody 3Ml Vial 29 Anti P-53 Antibody 3Ml Vial 30 Anti Smooth Muscle Actin Antibody 3Ml Vial 31 Anti Ck -6 Antibody 3Ml Vial 32 Anti Ck -17 Antibody 3Ml Vial 33 Anti Cd-68 Antibody 3Ml Vial 34 Tuff’S Jar ( Glass ) Piece 35 Pricking Needile No 23 ( 1 X100 ) Packet 36 Pricking Needile No 24 ( 1 X100 ) Packet 37 Pricking Needile No 21 ( 1 X100 ) Packet 38 Pricking Needile No 20 ( 1 X100 ) Packet 39 Surgical Tray 6X8 “ Inch ( Rectangular ) Piece 40 Microscopic Slide Tray ( Aluminium ) Holding Capacity 20 ( 3X1”Inch ) Piece 41 Bone Marrow Aspiration Needle 16 No Piece 42 Bone Marrow Aspiration Needle 18 No Piece 43 L P Needle Piece 44 Histology Tissue Base Mold ( Steel ) Piece 45 Bone Marrow Biopsy Needle ( Trephine Biopsy ) Piece 46 Museum Mounting Jar ( With Cover ) ( 10Cm X 5Cm X 20Cm ) 47 Museum Mounting Jar ( With Cover ) ( 15Cm X 10Cm X 25Cm ) 48 Museum Mounting Jar ( With Cover ) ( 16.2Cm X 6Cm X 18Cm ) 49 Museum Mounting Jar ( With Cover ) ( 12Cm X 10Cm X 20Cm ) 50 Museum Mounting Jar ( With Cover ) ( 12Cm X 12Cm X 20Cm ) 51 Museum Mounting Jar ( With Cover ) ( 17Cm X 8Cm X 18Cm ) 52 Museum Mounting Jar ( With Cover ) ( 5.5Cm X 5Cm X 10Cm ) 53 Museum Mounting Jar ( With Cover ) ( 17Cm X 9.5Cm X 30Cm ) 54 Museum Mounting Jar ( With Cover ) ( 28Cm X 24Cm X 29Cm ) 55 Museum Mounting Jar ( With Cover ) ( 21Cm X 19Cm X 27Cm ) 56 Museum Mounting Jar ( With Cover ) ( 11Cm X 25Cm X 24Cm ) 57 Ppd Vial 5 Ml Vial 58 A.H.G. 5Ml 59 Pt 5Ml 60 Aptt 3Ml 61 Hbaag Rapid Kit 4Th Generation 62 Hbaag Elisa Kit 4Th Generation 63 Transfer Bag Of 300Ml 64 Double Blood Bag 350Ml With Sagm 65 Triple Blood Bag 350Ml With Sagm 66 Double Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 67 Triple Blood Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 68 Leucodepletion Blood Bag 350Ml ( Inline Top And Top ) 69 Leucodepletion Blood Bag 350Ml ( Lab Side ) 70 Occult Blood Powder 100Gm 71 Arcino Molibate 500Ml 72 Taffers Reagent 250Ml 73 Bromo Cresol Green Reagent Box 74 Protein Kit 75 Urin Jar Plastic 76 Cuvette Colouimeton 77 Dispenser Bottle 78 Prulifloxacin 5 Mcg / Disc , 100 Disc / Vial 79 Amphotericin B 100 Units / Disc , 100 Disc / Vial 80 Itraconazole 30 Mcg / Disc , 100 Disc / Vial 81 Co-Trimoxazole 25 Mcg / Disc , 100 Disc / Vial 82 Cefoxitin 200 Mcg / Disc , 100 Disc / Vial 83 Optochin 5 Mcg / Disc , 100 Disc / Vial 84 Cefuroxime 30 Mcg / Disc , 100 Disc / Vial 85 Minocyline 30 Mcg / Disc , 100 Disc / Vial 86 Nalidixicacid 30 Mcg / Disc , 100 Disc / Vial 87 Norfloxacin 10 Mcg / Disc , 100 Disc / Vial 88 Tigecycline 15 Mcg / Disc , 100 Disc / Vial 89 Clarithromycin 15 Mcg / Disc , 100 Disc / Vial 90 Ketoconazole 30 Mcg / Disc , 100 Disc / Vial 91 Vancomycin ( E Test Strip ) 0.5 – 32 Mcg / Ml 92 Cefepime / Cefepime+Clavulanic Acid ( E Test Strip ) Cefepime ( 0.25-16Mcg ) / Cefepime+Clavulanic Acid ( 0.064-4 Mcg ) 93 Imipenem And Imipenem + Edta ( E Test Strip ) Imipenem ( 4-256 Mcg ) And Imipenem+ Edta ( 1-64 Mcg ) 94 Periodic Acid Schiff Stain 500Ml / Bottle 95 Phenyl Pyruvic Acid ( Ppa Test ) 100G / Bottle 96 40 % Urea ( Nh2conh7 ) 500G / Bottle 97 Antibiotic Zone Scale 1Pc / Box 98 Antisera-Salmonella O And H A, 2 Ml / Vial 99 Antisera-Shigella Dysenteriae, 2 Ml / Vial 100 Antisera-Shigella Flexnari, 2 Ml / Vial 101 Antisera-Shiegella Sonnie, 2 Ml / Vial 102 Antisera-Vibrio Cholera O139 , 2 Ml / Vial 103 Mounted Peripheral Blood Smear Slides For Gametocytes Of Plasmodium Vivax And Falciparum, ( 1 – Slide ) 104 Normal Saline 500Ml / Bottle 105 Stock Vial ( 50Pc / Pkt ) 106 Microtube Rack ( 5X16 Holes ) Per Rack 107 Homogeniser With Serrated Pestle S.P 10Ml ( 1-Pc ) 108 Nichrome Loop 4Mm, Double Wound ( 10Pc / Pack ) 109 Nichrome Loop 2Mm, Double Wound ( 10Pc / Pack ) 110 Semisolid Imrv Medium And Selective Supplement Fd19 -2Vl, 500Gm / Bottle 111 Sample Discarding Jar 3L Capacity ( Borosil ) ( 1-Pc ) 112 Kala-Azar Detection Rapid Test ( 25Kit / Box ) 113 Cryptococcal Ag Rapid Test ( 25Kit / Box ) 114 Capped Collection Tube 1.5Ml Capacity ( 50Pc / Box ) 115 Spirit Absolute ( 40 Lt / Gallon ) 116 Sterilium Hand Rub ( 500Ml / Bottle ) 117 Bleaching Powder ( 25Kg / Bag ) 118 Thermacol Transport Box ( 18Cm X 12 Cm ) ( 500Pc / Bag ) 119 Labeling Stickers Sheets ( St-65A4 ) ( 100Sheets / Pack ) 120 Disposable Tongue Depressor ( Spatula ) ( 100Pc / Pack ) 121 Taqman Sequence Detection ( Primer + Probe ) For Screening ( E Gene & Rnp ) And Confirmatory ( Rdrp, & Hku Orf Ib ) 122 Labgun Covid-19 Rt Pcr Kit 123 Bgi Rt Pcr Kit For Detection Sars Cov-2 124 Tscd Wafers 125 Exercising Ball ( Gripper ) 126 Rnase / Dnase Away ( Ivd, Us Fda, Icmr Approved ) 250Ml 127 Taqpath Covid-19 Combo Kit Multiplex Real-Time Rt-Pcr ( Catalog Numbers A47813 And A47814 ) ( Ivd, Us Fda, Icmr Approved ) 128 A* Star Fortitude Kit 2.0 Covid-19 Qualitative Pcr Kit ( Ivd, Us Fda, Icmr Approved ) 129 Mylabpatho Detect Covid-19 Qualitative Pcr Kit ( Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 130 Kilpest ( Blackbio ) Trupcr Sars-Cov 2Rt-Qpcr Kit Version 2 ( Usfda / Or Ce- Approved ) 131 Biomerieux Argene Sars-Cov-2 R-Gene ( Ivd, Us Fda, Icmr Approved ) 132 Water, Ultrapure, Free Of Dnase, Rnase, Protease, Endonuclease ( Ivd, Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 1 Litre 133 N-95 Particulate Respirator ( Valved Particulate Respirator, 42Cfr84 Approved Product, 95% Filter Efficiency Level, Effective Against Particulate Aerosols Free Of Oil ) 134 Wipes 37.33X42.16 Cm ( Anti-Stat Polyshield: Anti-Static Dispensing System Reduces Lint And Electrostatic Discharge, Easily Wipe Up Liquids, Dust And Tiny Particles And Are Designed For Delicate Tasks ) 135 Cryo Box 1.8Ml ( 9X9 ) ( Chipboard, 132 X 132 X 51Mm, Square, Durable Plastic Cryoboxes With Keyed Lid Orientation And Printed Via Location Grid. ) 136 Zip Lock Bag 21.3X18cm ( Thickness: 52 Micron, Prevents Aroma Transfer, Keep Out Dirt And Moisture, Made From Fda Approved ) 137 Polypropylene Trigger Sprayers ( 500Ml ) ( Made From Durable, Chemical Resistant Polypropylene, Trigger Sprayer With Adapters. ) 138 Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( 11X8 Inch ) ( Stainless Steel, Autoclavable, Chemical Resistantand For Laboratory Use ) 139 Deep Well Storage Plasticware 96 Well Plate ( Height 4.1Cm, Wellcut 1 Cm, Length 12.1Cm Polypropylene ) 140 Plasticware Magnetic 8 Strip Comb ( Height 4.5Cm, Length 10.2Cm, Distance Between Each Comb=1Cm ) 141 Duo Rna Elution Plate 96 Well ( Wall Thiekness 6Mm, Nominal Size 50, Neutral Glass ) 142 Reinelene Solution ( Peracetic Acid ) 1X 5Lit 143 Glutaraldehyde 2.4% Solution 1X 5 Lit 144 Self Lock Pouch ( Plastic ) 145 Deep Well 96 Plate ( Size 50Mm, 200Ul, Wall Thickness 6Mm Nominal Size 50, Neutral Glass ) 146 96 Tip Comb For Deep Well Plates ( Wall Thickness 5Mm, Nominal Size 90, Neutral Glass )
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 5
Uttar Pradesh View Result →
12.
Educational and Research Institute #8855101 Technical Bid
Supply Of Chemical Reagents And Glass Ware And Others-1 Papanicolau O.G.6 125 ml bottle 2 Papanicolau E.A 36 125 ml bottle 3 Poly-L lysine solution 100 ml bottle 4 Urine Strip ( Distix) Packet (1x100 strips) 5 Plastic Tissue Embedding Cassettes Packet (1x1000 pieces) 6 Diamino Benzidine 25 gm Powder 7 TPO(Thyroid peroxidase antibody) 3 ml vial 8 Mouse/Rabbit Specific Polymer HRP- DAB IHC detection kit 5 ml vial 9 Desmin Antibody (IHC) 3 ml vial 10 Vimentin Antibody (IHC) 3ml vial 11 Estrogen receptor antibody (ER) 3ml vial 12 Anti-Progesterone receptor antibody 3ml vial 13 Anti S-100 antibody 3ml vial 14 Anti Human HER2/neu antibody 3ml vial 15 Anti Human cytokeratin(Pan) Antibody cocktail 3ml vial 16 Anti melanoma Antibody( Anti HMB45 Antibody) 3ml vial 17 Anti neuron specific enolase (NSE) Antibody 3ml vial 18 Anti CD45 Antibody 3ml vial 19 Anti HPV-16 Antibody 3ml vial 20 Anti CD20 Antibody 3ml vial 21 Anti CD15 Antibody 3ml vial 22 Anti CD30 Antibody 3ml vial 23 Antibody (Anti c –kit) 3ml vial 24 Myeloperoxidase Reagent 3ml vial 25 Anti Ki 67 Antibody 3ml vial 26 Anti E Cadherin Antibody 3ml vial 27 Anti CD- 34 Antibody 3ml vial 28 Anti P-63 Antibody 3ml vial 29 Anti P-53 Antibody 3ml vial 30 Anti Smooth Muscle Actin Antibody 3ml vial 31 Anti CK -6 Antibody 3ml vial 32 Anti CK -17 Antibody 3ml vial 33 Anti CD-68 Antibody 3ml vial 34 Tuff’s jar (glass) Piece 35 Pricking Needile no 23 (1 x100) Packet 36 Pricking Needile no 24 (1 x100) Packet 37 Pricking Needile no 21 (1 x100) Packet 38 Pricking Needile no 20 (1 x100) Packet 39 Surgical Tray 6x8 “ Inch (Rectangular) Piece 40 Microscopic Slide Tray (Aluminium) Holding Capacity 20 (3x1”Inch) Piece 41 Bone Marrow aspiration Needle 16 No Piece 42 Bone Marrow aspiration Needle 18 No Piece 43 L P Needle Piece 44 Histology tissue base mold ( Steel ) Piece 45 Bone Marrow Biopsy Needle (Trephine Biopsy) Piece 46 Museum mounting jar (With Cover) (10cm x 5cm x 20cm) 47 Museum mounting jar (With Cover) (15cm x 10cm x 25cm) 48 Museum mounting jar (With Cover) (16.2cm x 6cm x 18cm) 49 Museum mounting jar (With Cover) (12cm x 10cm x 20cm) 50 Museum mounting jar (With Cover) (12cm x 12cm x 20cm) 51 Museum mounting jar (With Cover) (17cm x 8cm x 18cm) 52 Museum mounting jar (With Cover) (5.5cm x 5cm x 10cm) 53 Museum mounting jar (With Cover) (17cm x 9.5cm x 30cm) 54 Museum mounting jar (With Cover) (28cm x 24cm x 29cm) 55 Museum mounting jar (With Cover) (21cm x 19cm x 27cm) 56 Museum mounting jar (With Cover) (11cm x 25cm x 24cm) 57 HCV RAPID KIT, (Fourth generation immunoassay for core,NS3,NS4,NS5) 58 PPD VIAL 5 ml VIAL 59 A.H.G. 5ml 60 PT 5ml 61 APTT 3ml 62 HBaAg Rapid Kit 4th Generation 63 HCV Elisa Kit 4th Generation 64 HBaAg Elisa Kit 4th Generation 65 Transfer Bag of 300ml 66 Double Bag 350ml with SAGM 67 Tripal Blood Bag 350ml with SAGM 68 Double Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 69 Tripal Blood Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 70 Leucodepltion blood bag 350ml (inline TOP and TOP) 71 Leucodepltion blood bag 350ml (Lab Side) 72 Occult Blood Powder 100gm 73 Arcino Molibate 500ml 74 Taffers Reagent 250ml 75 Bromo Cresol Green Reagent Box 76 Protein Kit 77 Urin Jar Plastic 78 Cuvette Colouimeton 79 Dispenser Bottle 80 Prulifloxacin 5 Mcg / disc , 100 disc / vial 81 Amphotericin B 100 Units / disc , 100 disc / vial 82 Itraconazole 30 Mcg / disc , 100 disc / vial 83 Co-Trimoxazole 25 Mcg / disc , 100 disc / vial 84 Cefoxitin 200 Mcg / disc , 100 disc / vial 85 Optochin 5 Mcg / disc , 100 disc / vial 86 Cefuroxime 30 Mcg / disc , 100 disc / vial 87 Minocyline 30 Mcg / disc , 100 disc / vial 88 Nalidixicacid 30 Mcg / disc , 100 disc / vial 89 Norfloxacin 10 Mcg / disc , 100 disc / vial 90 Tigecycline 15 Mcg / disc , 100 disc / vial 91 Clarithromycin 15 Mcg / disc , 100 disc / vial 92 Ketoconazole 30 Mcg / disc , 100 disc / vial 93 Vancomycin (E test strip) 0.5 – 32 Mcg/ML 94 Cefepime/Cefepime+Clavulanic acid (E test strip) Cefepime (0.25-16mcg)/Cefepime+clavulanic acid (0.064-4 mcg) 95 Imipenem and Imipenem + EDTA (E test strip) Imipenem (4-256 mcg) and Imipenem+ EDTA (1-64 mcg) 96 Periodic acid Schiff stain 500ml / Bottle 97 Phenyl Pyruvic Acid (PPA Test) 100g / Bottle 98 40 % Urea (NH2CONH7) 500g / Bottle 99 Antibiotic zone scale 1pc/box 100 Antisera-Salmonella O and H A, 2 ml / vial 101 Antisera-Shigella dysenteriae, 2 ml / vial 102 Antisera-Shigella flexnari, 2 ml / vial 103 Antisera-Shiegella sonnie, 2 ml / vial 104 Antisera-Vibrio cholera O139 , 2 ml / vial 105 Mounted Peripheral blood smear slides for Gametocytes of Plasmodium vivax and falciparum, (1 – Slide) 106 Normal saline 500ml / Bottle 107 Stock vial (50pc/pkt) 108 Microtube rack (5x16 holes) per rack 109 Homogeniser with serrated pestle S.P 10ml (1-Pc) 110 Nichrome loop 4mm, Double wound (10pc/Pack) 111 Nichrome loop 2mm, Double wound (10pc/Pack) 112 Semisolid IMRV Medium and selective supplement FD19 -2vl, 500gm/Bottle 113 Sample Discarding jar 3L capacity (Borosil) (1-pc) 114 Kala-azar detection rapid test (25kit/box) 115 Cryptococcal Ag rapid test (25kit/box) 116 Capped Collection tube 1.5ml capacity (50pc/box) 117 Safeskin purple nitrile gloves (Medium) 100/Box 118 N95 Particulate Respirator (NIOSH Approved) 1pc 119 wipes 37.33x42.16 cm 120 Cryo Box 1.8ml (9x9 wells) (1 x 4 / box) 121 FG-optical Adhesive Covers for PCR, 1pc 122 MicroAmp Optical 96-Well Reaction Plate (0.2ml), (1- Plate) ABI supported 123 Zip lock bag 21.3x18cm (10bag/Box) 124 384 WELL PCR PLATE, (1- Plate) 125 Polypropylene Trigger Sprayers (500ml), 1pc 126 Stainless steel rectangular pan with sliding lid and handles tapered sides ( size 11 x 8 inch) , 1pc 127 Spirit absolute (40 Lt/Gallon) 128 Sterilium hand rub ( 500ml/Bottle) 129 bleaching powder (25kg/Bag) 130 RNA Zap water 200ml /bottle 131 Thermacol transport Box (18cm x 12 cm) (500pc/bag) 132 Tissue Paper (Toilet paper roll) (9pc/Pack) 133 Labeling Stickers sheets(ST-65A4) (100sheets/Pack) 134 Disposable Tongue depressor (spatula) (100pc/Pack) 135 Nuclease Free Water (molecular grade) 1000ml/pack 136 Taqman Sequence detection (Primer + Probe) for Screening (E Gene & RNP) and Confirmatory (RdrP, & HKU ORF Ib) 137 Mylab Patho Detect Covid-19 Qualitative PCR kit 138 A*Star Fortitued kit 2.0 Covid-19 RT-PCR Test 139 Super Script III Platinum qRT PCR Reagent 500 Tests Kit 140 LabGun Covid-19 RT PCR kit 141 BGI RT PCR kit for detection SARS Cov-2 142 TSCD Wafers 143 Exercising Ball (Gripper) 144 One step RT-PCR Reagent AgPath (IVD, US FDA, ICMR APPROVED) 145 Pendemic H1N1 09 Assay set (PN-4456927) (IVD, US FDA, ICMR APPROVED) 146 RNASE/DNASE AWAY (IVD, US FDA, ICMR APPROVED) 250ml 147 Rapid Diagnostic Kit for IgG/IgM to COVID-19 (IVD, US FDA, ICMR APPROVED) 148 Super Script III Platinum qRT (IVD, US FDA, ICMR APPROVED) 149 TaqPath COVID-19 Combo Kit Multiplex real-time RT-PCR (Catalog Numbers A47813 and A47814) (IVD, US FDA, ICMR APPROVED) 150 A* Star Fortitude kit 2.0 COVID-19 Qualitative PCR Kit (IVD, US FDA, ICMR APPROVED) 151 MylabPatho Detect COVID-19 Qualitative PCR Kit (Indian FDA/ Central Drugs Standard Control Organisatio (CDSCO),ICMR Approved) 152 KILPEST (BLACKBIO) TRUPCR SARS-CoV 2RT-qPCR Kit version 2 (USFDA /OR CE- approved) 153 BIOMERIEUX ARGENE SARS-COV-2 R-GENE (IVD, US FDA, ICMR APPROVED) 154 Water, Ultrapure, Free of Dnase, Rnase, Protease, Endonuclease (IVD, Indian FDA/ Central Drugs Standard Control Organisatio (CDSCO),ICMR Approved) 1 Letter 155 Collection tube 1.5 ml (Durable—able to tolerate centrifuge speeds up to 20,000 RCF• Compatible—suitable for IP and mass spectrometry applicationsPurity: Rnase/Dnase freeShipping : RTMaterial PolypropyleneTube type: microfuge tube) 156 MicroAmp Optical tube 8/strips (0.2 ml) (Reaction speed : standard Colour: opticalVolume: 0.2mlFor use with instrument: Quant studio 7 flexTube type: strip of 8) 125x8 157 MicroAmp Optical 8 cap strips (0.2 ml) (Reaction speed : standard Colour: opticalFor use with MicroAmp Optical tube 8/strips (0.2 ml)Cap type: 8 cap strip) 300x8 Rxn 158 MicroAmp Optical 96-well Reaction Plate (For use with ABI RT-PCR machinesColour: opticalPlate type: 96 well) 159 96 well plates (For use with Agilent RT-PCR machinesPlate type: 96 well, Rigid, skirted) 160 96 well optical plates (For use with Agilent RT-PCR machines Colour: opticalPlate type: 96 well) 161 96 tube strips (Reaction speed : standardColour: opticalFor use with Agilent RT-PCR machines) 162 Optical cap, 8x strip (For use with Agilent RT-PCR machinesCap type: 8 cap stripColour: optical) 163 Safeskin purple nitrile gloves (Medium) (Gloves are powder free, minimizing the potential for powder related complications, irritation and dermatitis.) 164 N-95 Particulate Respirator (Valved particulate respirator, 42CFR84 approved product, 95% filter efficiency level, effective against particulate aerosols free of oil) 165 wipes 37.33x42.16 cm (Anti-stat polyshield: Anti-static dispensing system reduces lint and electrostatic discharge, easily wipe up liquids, dust and tiny particles and are designed for delicate tasks) 166 Cryo Box 1.8ml (9x9) (Chipboard, 132 x 132 x 51mm, Square,durable plastic cryoboxes with keyed lid orientation and printed via location grid.) 167 FG-optical Adhesive clear Covers (Plate compatibility: 384/96 well plates, colour: optical, Easy to apply-will not stick to your glove, For use with instrument: Quant studio 7 flex) 168 MicroAmp Optical 96-Well Reaction Plate (0.2ml) (Holds: 96x0.2ml of tubes, Reaction speed : standardColour: opticalVolume: 0.2ml For use with instrument: Quant studio 7 flex) 169 Zip lock bag 21.3x18cm (Thickness: 52 micron, prevents aroma transfer, keep out dirt and moisture, made from FDA approved) 170 384 WELL PCR PLATE (Holds: 384 well plate Reaction speed : standardColour: optical40 µL maximum well volume, 25 µL working volumeFor use with instrument: Quant studio 7 flex) 171 POLYPROPYLENE TRIGGER SPRAYERS (500ml) (Made from durable, chemical resistant polypropylene,Trigger sprayer with adapters.) 172 Stainless steel rectangular pan with sliding lid and handles tapered sides (11x8 inch) (Stainless steel, Autoclavable, chemical resistantand for laboratory use) 173 Deep well storage plasticware 96 well plate (For use with Zybio extraction machines) 174 Plasticware magnetic 8 strip comb (For use with Zybio extraction machines) 175 Duo elution strip (For use with Genetix 96 well extraction machines) 176 Duo cap for elution strip (For use with Genetix 96 well extraction machines) 177 Deep well 96 plate (For use with Genetix96 well extraction machines) 178 96 tip comb for deep well magnets (For use with Genetix96 well extraction machines)
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 7
Uttar Pradesh View Result →
13.
Educational and Research Institute #8827360 Technical Bid
Supply Of Chemical Reagents And Glass Ware And Others-1 Isopropyl Alcohol 2.5 LT bottle 2 Papanicolau O.G.6 125 ml bottle 3 Papanicolau E.A 36 125 ml bottle 4 Papanicolau E.A 65 125 ml bottle 5 May.Grunwald Stain (MGG) 100 ml bottle 6 Giemsa Staining 100 ml bottle 7 H2So4 (Sulphuric acid) 500 ml bottle 8 Methanol 500 ml bottle 9 Diethy Ethyl Ether L.R 500 ml bottle 10 Leishman’s Stain Solution (Cytochrome) 500 ml bottle 11 Tincture Benzoin 100 ml bottle 12 Semen Diluting Fluid 200 ml bottle 13 Platelet diluting Fluid 50 ml bottle 14 Chloroform 2.5 Lt bottle 15 WBC diluting Fluid 50 ml bottle 16 RBC diluting Fluid 50 ml bottle 17 N/ 10 HCL 500ml bottle 18 Formaldehyde 5 Lt bottle 19 Xylene 2.5 Lt bottle 20 Conc. HCL(Hydrochloric acid) 500 ml bottle 21 Liquid Ammonia 500 ml bottle 22 D.P.X. 250 ml bottle 23 Conc.Nitric Acid 500ml bottle 24 Glycerine 500 ml bottle 25 Liquid Paraffin 500 ml bottle 26 Na OH(Sodium Hydroxide) 500 ml bottle 27 Poly-L lysine solution 100 ml bottle 28 Citric Acid (anhydrous pure) 500 ml bottle 29 H 2 O2 (Hydrogen peroxide) 100 ml bottle 30 Deionized water 5 Lt. Bottle 31 Schiffs reagent 500 ml bottle 32 Bendict reagent 500 ml 33 Drabkins Solution 5 Lit 34 Fouchet’s reagent 200 ml 35 Ehrlich Reagent 200 ml 36 Methylene Blue stain 125 ml bottle 37 Rapid A.F.B stain kit 38 Carbol Fuchsin stain 125 ml bottle 39 Reticulocyte stain (Biolab) 01 Packet 40 Acetone 500 ml bottle 41 Sodium Hypo Chloride 5 LTR bottle 42 Spirit 5 LTR bottle 43 Glucose God- Pod Kit 500 ml 44 Glacial Acetic Acid 500 ml bottle 45 Hematoxylin Stain Powder(sd fine) 25gm / 5 gm Packet 46 Eosin powder (water soluble) 25gm Packet 47 Aluminum Potassium Sulphate 500 gm Packet 48 Mercuric Oxide Red 100 gm Packet 49 Wax 600-620 500 gm Packet 50 Albumin Powder 500 gm Packet 51 Periodic Acid 25 gm Packet 52 Mercuric Oxide 25 gm Packet 53 Dextrose (Anhydrous) 500 gm Packet 54 Sulphur Powder 100 gm 55 Barium Chloride Powder 500 gm 56 Ammonium Sulphate 500 gm 57 Sodium Sulphate 500 gm 58 Sulphosalicylic Acid 500 gm 59 Gentian Violet 100 gm 60 Tris buffer (SD Fine) 500 gm Packet 61 EDTA 100 gm Packet 62 Low Profile Disposable Microtome blade for cutting tissue section 63 Urine Strip ( Distix) Packet (1x100 strips) 64 Phosphotungistic Acid 100 gm Packet 65 Brilliant Crystal Blue stain 100 gm 66 Plastic Tissue Embedding Cassettes Packet (1x1000 pieces) 67 Oxalic Acid 50 gm 68 Ferric Chloride 500 gm 69 Sodium Thio Sulphate 500 gm 70 Potassium Ferrocyanide 500 gm 71 Sodium chloride 500 gm 72 Sodium Nitroprusside 500 gm 73 Orthotoludine reagent 500 gm 74 Benzidine Powder 25 gm 75 Diamino Benzidine 25 gm Powder 76 Total Protein Kit 77 Albumin Kit 78 Serum Creatinine kit 79 Serum Urea Kit 80 Serum SGOT Kit 81 Serum SGPT Kit 82 Direct S. Bilirubin Kit 83 Serum Calcium Kit 84 Serum Alkaline Phosphate Kit 85 Serum Cholesterol Kit 86 Serum Triglyceride Kit 87 Serum HDL Cholesterol Kit 88 Serum Uric Acid Kit 89 TPO(Thyroid peroxidase antibody) 3 ml vial 90 Mouse/Rabbit Specific Polymer HRP- DAB IHC detection kit 5 ml vial 91 Desmin Antibody (IHC) 3 ml vial 92 Vimentin Antibody (IHC) 3ml vial 93 Estrogen receptor antibody (ER) 3ml vial 94 Anti-Progesterone receptor antibody 3ml vial 95 Anti S-100 antibody 3ml vial 96 Anti Human HER2/neu antibody 3ml vial 97 Anti Human cytokeratin(Pan) Antibody cocktail 3ml vial 98 Anti melanoma Antibody( Anti HMB45 Antibody) 3ml vial 99 Anti neuron specific enolase (NSE) Antibody 3ml vial 100 Anti CD45 Antibody 3ml vial 101 Anti HPV-16 Antibody 3ml vial 102 Anti CD20 Antibody 3ml vial 103 Anti CD15 Antibody 3ml vial 104 Anti CD30 Antibody 3ml vial 105 Antibody (Anti c –kit) 3ml vial 106 Myeloperoxidase Reagent 3ml vial 107 Anti Ki 67 Antibody 3ml vial 108 Anti E Cadherin Antibody 3ml vial 109 Anti CD- 34 Antibody 3ml vial 110 Anti P-63 Antibody 3ml vial 111 Anti P-53 Antibody 3ml vial 112 Anti Smooth Muscle Actin Antibody 3ml vial 113 Anti CK -6 Antibody 3ml vial 114 Anti CK -17 Antibody 3ml vial 115 Anti CD-68 Antibody 3ml vial 116 Whatman Filter paper Sheet 117 Coplin Jar (plastic) 01 Piece 118 Tuff’s jar (glass) Piece 119 K3 EDTA Vacutainar 1 x100 120 Plain Vacutainar 1 x100 121 Riya vial ( Plastic) 1 x100 122 Test Tube Stand (plastic) Piece 123 Test tube holder Piece 124 Plastic beaker 25ml Piece 125 Plastic beaker 100ml Piece 126 Semen collection container 20 ML (1x50) Packet 127 Urine sample container 50 ML (1x50) Packet 128 Micro tips Large (200- 2000 Micro Liter) Packet (1x500 pieces) 129 Micro tips Small (20- 200 Micro Liter) Packet (1x1000 pieces) 130 Sprit lamp 50ml Piece 131 Plastic dropper Piece 132 Pipette bulb Piece 133 Glass Test tube 7ml, Piece 134 Glass Test tube 10ml, Piece 135 Glass Test tube 20ml Piece 136 Glass Slide (Blue Star) Packet 137 Cover Slip (Blue Star) Packet 138 Neubauer Chamber Piece 139 Glass Pipette 5 ml 20 Micro lit Piece 140 Glass Pipette 10 ml 20 Micro lit Piece 141 Glass Pipette 1 ml 20 Micro lit Piece 142 Micro pipette 10 microlitre FIX Piece 143 Micro pipette 100 microlitre FIX Piece 144 Micro pipette (5-50) microlitre Variable Piece 145 Micro pipette 20 microlitre FIX Piece 146 Micro pipette 1000 microlitre FIX Piece 147 Micro pipette 50 microlitre FIX Piece 148 Wintrobe ESR tube With Stand Piece 149 Westergreen ESR Pipette with Stand Piece 150 Pricking Needile no 23 (1 x100) Packet 151 Pricking Needile no 24 (1 x100) Packet 152 Pricking Needile no 21 (1 x100) Packet 153 Pricking Needile no 20 (1 x100) Packet 154 Surgical Tray 6x8 “ Inch (Rectangular) Piece 155 Microscopic Slide Tray (Aluminium) Holding Capacity 20 (3x1”Inch) Piece 156 Bone Marrow aspiration Needle 16 No Piece 157 Bone Marrow aspiration Needle 18 No Piece 158 L P Needle Piece 159 Histology tissue base mold ( Steel ) Piece 160 Bone Marrow Biopsy Needle (Trephine Biopsy) Piece 161 Glass Rod Piece 162 pH paper strip (5.0-7.5) Booklet (1x20 strips) 163 pH paper strip (2.0-10.5) Booklet (1x20 strips) 164 Lens cleaning paper Booklet (9cmx14.5cm, 100 leaves) 165 Museum mounting jar (With Cover) (10cm x 5cm x 20cm) 166 Museum mounting jar (With Cover) (15cm x 10cm x 25cm) 167 Museum mounting jar (With Cover) (16.2cm x 6cm x 18cm) 168 Museum mounting jar (With Cover) (12cm x 10cm x 20cm) 169 Museum mounting jar (With Cover) (12cm x 12cm x 20cm) 170 Museum mounting jar (With Cover) (17cm x 8cm x 18cm) 171 Museum mounting jar (With Cover) (5.5cm x 5cm x 10cm) 172 Museum mounting jar (With Cover) (17cm x 9.5cm x 30cm) 173 Museum mounting jar (With Cover) (28cm x 24cm x 29cm) 174 Museum mounting jar (With Cover) (21cm x 19cm x 27cm) 175 Museum mounting jar (With Cover) (11cm x 25cm x 24cm) 176 HIV RAPID TRIDOT KIT 177 HBSAG immunoassay RAPID KIT 178 HCV RAPID KIT, (Fourth generation immunoassay for core,NS3,NS4,NS5) 179 RDT FOR MP RAPID KIT (immunochromatographic kit for pf/pan antigen) 180 VDRL Rapid IMMUNOASSAY KIT 181 TYPHOID RAPID KIT (IgG,IgM) 182 DENGUE RAPID KIT (IMMUNOCHROMATOGRAPHIC ASSAY FOR NS1,IgG ,IgM) 183 PLAIN VIAL 5 ml VIAL 184 ABO RH ANTI SERA 10 ml PACKET 185 PPD VIAL 5 ml VIAL 186 SYRINGE 3ML (1x100) Packet 187 SYRINGE 5ML (1x100) Packet 188 SYRINGE 5ML (1x100) Packet 189 SODIUM CITRATE VIAL 5 ml VIAL 190 CAPILLARY TUBE PIECE 191 A.H.G. 5ml 192 Anti A1 Lectin 5ml 193 Anti H Lectin 5ml 194 Anti D (IgM + IgG Monoclonal) 10ml 195 PT 5ml 196 APTT 3ml 197 Calcium Chloride 10ml 198 Bovine Albumin 5ml 199 HIV Rapid Kit 4Th Generation 200 HIV Rapid Kit 3Th Generation 201 HCV RAPID KIT, 3Th Generation 202 HBaAg Rapid Kit 4th Generation 203 HBaAg Rapid Kit 3th Generation 204 HIV Elisa Kit 4th Generation 205 HCV Elisa Kit 4th Generation 206 HCV Elisa Kit 3th Generation 207 HBaAg Elisa Kit 4th Generation 208 HBaAg Elisa Kit 3th Generation 209 Troniquete 210 Micro Pipette 10 ul Fix 211 Micro Pipette 50 ul Fix 212 Micro Pipette 25 ul Fix 213 Micro Pipette 100 ul Fix 214 Micro Pipette 1000 ul Fix 215 Micro Pipette 100-1000 ul Variable 216 Micro Pipette 10-100 ul Variable 217 Micro Pipette Stand (Big) Plastic Make 218 Micro Pipette Stand (Small) Plastic Make 219 Transfer Bag of 300ml 220 Double Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 221 Tripal Blood Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 222 Leucodepltion blood bag 350ml (inline TOP and TOP) 223 Leucodepltion blood bag 350ml (Lab Side) 224 Pregnancy Kit Test 225 Cappilary Tub 226 Swab Stick 227 Benedict Reagent Quanitateive 500 ml 228 Benedict Reagent Qualitateive 500 ml 229 Sulphar Powder 500 gm 230 Occult Blood Powder 100gm 231 Hydrozen Peroxide 500ml 232 Egg Albumin 500gm 233 Sulphuric Acid 500ml 234 Sodium Hydroxide 500gm 235 Copper Sulphate 500gm 236 Picric Acid 500ml 237 Arcino Molibate 500ml 238 Phaspho Tungstic Acid 500gm 239 Sodium Carbonate 500gm 240 Nitric Acid 500ml 241 Silver Nitrate 25gm 242 Hydrochloric Acid 500ml 243 Taffers Reagent 250ml 244 Bromo Cresol Green Reagent Box 245 Urea Kit 246 Protein Kit 247 Cholesterol Kit 248 Pipette 1ml 249 Pipette 2ml 250 Test Tub 251 Burette with Tip 252 Burette Stopper 253 Burette Stand 254 Filter Paper 255 Mesauring Cylinder 50ml 256 Beaker 250ml 257 Beaker 500ml 258 Round Bottle Flask 200ml 259 Conical Flask 200ml 260 Urin Jar Plastic 261 Funnel Plastic 262 Cuvette Colouimeton 263 Dispenser Bottle 264 Amikacin 30 Mcg / disc , 100 disc / vial 265 Amoxicillin Clavulanic acid 20/10 Mcg / disc , 100 disc / vial 266 Cefoperazone75 Mcg / disc , 100 disc / vial 267 Ceftriaxone 30 Mcg / disc , 100 disc / vial 268 Nitrofurantoin 300 Mcg / disc , 100 disc / vial 269 Ofloxacin 5 Mcg / disc , 100 disc / vial 270 Ceftazidime /clavulanic acid 30/10 Mcg / disc , 100 disc / vial 271 Ciprofloxacin 5 Mcg / disc , 100 disc / vial 272 Ertapenem 10 Mcg / disc , 100 disc / vial 273 Gentamicin 10 Mcg / disc , 100 disc / vial 274 Imipenem 10 Mcg / disc , 100 disc / vial 275 Levofloxacin 5 Mcg / disc , 100 disc / vial 276 Meropenem 10 Mcg / disc , 100 disc / vial 277 Moxifloxacin 5 Mcg / disc , 100 disc / vial 278 Prulifloxacin 5 Mcg / disc , 100 disc / vial 279 Vancomycin 30 Mcg / disc , 100 disc / vial 280 Azithromycin 15 Mcg / disc , 100 disc / vial 281 Chloramphenicol 30 Mcg / disc , 100 disc / vial 282 Piperacillin/Tazobactam 100/10 Mcg / disc , 100 disc / vial 283 Tobramycin 10 Mcg / disc , 100 disc / vial 284 Tetracycline 30 Mcg / disc , 100 disc / vial 285 Cefotaxime 30 Mcg / disc , 100 disc / vial 286 Fluconazole 10 Mcg / disc , 100 disc / vial 287 Amphotericin B 100 Units / disc , 100 disc / vial 288 Itraconazole 30 Mcg / disc , 100 disc / vial 289 Nystatin 100 units / disc , 100 disc / vial 290 Voriconazole 1Mcg / disc , 100 disc / vial 291 Co-Trimoxazole 25 Mcg / disc , 100 disc / vial 292 Clindamycin 2 Mcg / disc , 100 disc / vial 293 Teicoplanin 30 Mcg / disc , 100 disc / vial 294 Cefdinir 5 Mcg / disc , 100 disc / vial 295 Cefpirome 30 Mcg / disc , 100 disc / vial 296 Imipenem –Cilastin 10 Mcg / disc , 100 disc / vial 297 Ampicillin 2 Mcg / disc , 100 disc / vial 298 Polymyxin-B 100 UNIT / disc , 100 disc / vial 299 Bacitracin 8 UNIT / disc , 100 disc / vial 300 Cefoxitin 200 Mcg / disc , 100 disc / vial 301 Linezolid 30 Mcg / disc , 100 disc / vial 302 Gentamicin (High) 50 Mcg / disc , 100 disc / vial 303 Faropenem 5 Mcg / disc , 100 disc / vial 304 Doxycycline 10 Mcg / disc , 100 disc / vial 305 Aztreonam 50 Mcg / disc , 100 disc / vial 306 Fosfomycin 50 Mcg / disc , 100 disc / vial 307 Novobiocin 30 Mcg / disc , 100 disc / vial 308 Optochin 5 Mcg / disc , 100 disc / vial 309 Cefuroxime 30 Mcg / disc , 100 disc / vial 310 Minocyline 30 Mcg / disc , 100 disc / vial 311 Nalidixicacid 30 Mcg / disc , 100 disc / vial 312 Norfloxacin 10 Mcg / disc , 100 disc / vial 313 Tigecycline 15 Mcg / disc , 100 disc / vial 314 Clarithromycin 15 Mcg / disc , 100 disc / vial 315 Ketoconazole 30 Mcg / disc , 100 disc / vial 316 Vancomycin (E test strip) 0.5 – 32 Mcg/ML 317 Cefepime/Cefepime+Clavulanic acid (E test strip) Cefepime (0.25-16mcg)/Cefepime+clavulanic acid (0.064-4 mcg) 318 Imipenem and Imipenem + EDTA (E test strip) Imipenem (4-256 mcg) and Imipenem+ EDTA (1-64 mcg) 319 MacConkey Agar 500g / Bottle 320 Muller-Hinton-Agar 500g / Bottle 321 Chrome Universal Agar 500g / Bottle 322 Lugol’s Iodine 125 ml/Bottle 323 Urea Agar Base 100g / Bottle 324 Simmons Citrate Agar 100g / Bottle 325 Triple Sugar Iron Agar 100g / Bottle 326 Blood Agar Base 500g / Bottle 327 Robertson cooked Meat Media 500g / Bottle 328 Sucrose 500g / Bottle 329 Lactose (LR) 500g / Bottle 330 Mannitol (C6H14C6) 500g / Bottle 331 Peptone, 500g / Bottle 332 Dextrose Anhydrous (C6H12O6) 500g / Bottle 333 Bile esculin Reagent/Agar 500g / Bottle 334 Methylene Blue for ZN stain 500ml / Bottle 335 Carbol Fuchsin for ZN stain 500ml / Bottle 336 Giemsa stain 500ml / Bottle 337 Periodic acid Schiff stain 500ml / Bottle 338 Safranine for ZN stain 500ml / Bottle 339 Gentian Violet (crystal) 100g / Bottle 340 Phenol (C6H5OH) (crystal) 500g / Bottle 341 Methyl red reagent 500g / Bottle 342 Phenyl Pyruvic Acid (PPA Test) 100g / Bottle 343 Prepared Oxidase disc 50 Disc/ Box 344 Iodine (crystal) 100g / Bottle 345 Tri-Sodium Citrate ( Na3C6H5O72H2O) 500g / Bottle 346 Citric Acid (C6H8O7) 500g / Bottle 347 Kovac’s indole reagent 100ml / Bottle 348 40 % Urea (NH2CONH7) 500g / Bottle 349 Antibiotic zone scale 1pc/box 350 Antisera-Salmonella O and H A, 2 ml / vial 351 Antisera-Shigella dysenteriae, 2 ml / vial 352 Antisera-Shigella flexnari, 2 ml / vial 353 Antisera-Shiegella sonnie, 2 ml / vial 354 Antisera-Vibrio cholera O139 , 2 ml / vial 355 ATCC strain - E.coli 25922, Freeze dried lyophilized / Vial 356 ATCC strain - E.coli 35218, Freeze dried lyophilized / Vial 357 ATCC strain - Pseudomonas aeruginosa 27853 Freeze dried lyophilized / Vial 358 ATCC strain - Staphylococcus aureus 25923 Freeze dried lyophilized / Vial 359 ATCC strain - Staphylococcus aureus 29213 Freeze dried lyophilized / Vial 360 Mounted Peripheral blood smear slides for Gametocytes of Plasmodium vivax and falciparum, (1 – Slide) 361 Potassium permagnate (KMnO4) 500g / Bottle 362 Formalin (20%) 500ml / Bottle 363 Methanol (CH3OH) 500ml / Bottle 364 Acetone (LR) (Reagent ) 500ml / Bottle 365 100 % Sulphuric Acid (H2SO4) 500ml / Bottle 366 Gram’s Iodine 500ml / Bottle 367 Boric Acid 500g / Bottle 368 di- Sodium Hydrogen ortho-phosphate 500g / Bottle 369 Formaldehyde Solution (37-41)% 1000ml / Bottle 370 Potassium Iodide (KI) 500g / Bottle 371 Hydrogen Peroxide Solution (H2O2) 6% 1000ml / Bottle 372 Sodium hydroxide Pellets Purified (NaOH) 500g / Bottle 373 Potassium hydroxide Pellets (KOH) 500g / Bottle 374 Sodium Chloride (NaCl) 500g / Bottle 375 Amyl Alcohol ( C5H11OH) 500ml / Bottle 376 Xylene Sulphur 500ml / Bottle 377 70 % Isopropyl alcohol 500ml / Bottle 378 Normal saline 500ml / Bottle 379 Digital weighing Balance 24Kg/ machine 380 Test Tube (Glass 7ml) 100pc/ pkt 381 Sterile Swab Stick, 100pc/pkt 382 Test tube holder (small) 10pc/box 383 Test tube holder (Large) 10pc/box 384 Petri disk 90x90 (10pc/pkt) 385 Petri disk 90x120, (10pc/pkt) 386 Stock vial (50pc/pkt) 387 Sterile disposable square petri plates (10pc/pkt) 388 Viral transport medium (3ml/Vial) 389 Kovac’s indole reagent 100 ml/ Bottle 390 Centrifuge tubes 50ml (Glass) 100pc/box 391 Centrifuge tubes 15ml (Glass) (Consumable)100pc/box 392 Erlenmeyer flask (1000ml) (Consumable) 1pc 393 Microtube rack (5x16 holes) per rack 394 Wash bottle capacity 500ml/pc 395 Sterile Disposable Forceps (10pc/pack) 396 Steam indicator tape size 18mm (1-Pc) 397 Autoclavable Dispo bag “14” (50/Pack) 398 Indicator pH paper(pH 5 to 7.5) (5 Bundle / Pack) 399 Permanent Marker Pen (Red/Black) (narrow tip) (1-Pc) 400 Homogeniser with serrated pestle S.P 10ml (1-Pc) 401 Nichrome loop 4mm, Double wound (10pc/Pack) 402 Nichrome loop 2mm, Double wound (10pc/Pack) 403 Semisolid IMRV Medium and selective supplement FD19 -2vl, 500gm/Bottle 404 Sample Discarding jar 3L capacity (Borosil) (1-pc) 405 Sample Discarding jar 5L capacity (Borosil) (1-pc) 406 Conical flask 500ml capacity (Borosil) (1-pc) 407 Kala-azar detection rapid test (25kit/box) 408 Blood culture bottle/BHI (paediatric) 20ml capacity (10pc/box) 409 Blood culture bottle /BHI(adult) 70ml capacity (10pc/box) 410 India Ink reagent (Nigrosin stain 10% w/v (100 ml) and Methylene blue (125ml/Bottle) 411 Scrub typhus IgM ELISA 96 well test kit/box 412 Chikungunya IgM ELISA 96 well test kit/box 413 JE IgM capture ELISA 96 well test kit/box 414 Dengue IgM ELISA 96 well test kit/box 415 Dengue NS-1 Ag ELISA 96 well test kit/box 416 Cryptococcal Ag rapid test (25kit/box) 417 L J medium slant 10 Slant/pack 418 Capped Collection tube 1.5ml capacity (50pc/box) 419 MicroAmp Optical tube 8/strips (0.2 ml capacity) (8 x 125 Strip) 420 MicroAmp Optical 8 cap strips (0.2 ml) (8 x 300 strip) 421 Micro Centrifuge Tube 1.5ml capacity (500pc/Box) 422 Serological pipette 10ml (200pc/box) 423 Serological pipette 5ml (250pc/box) 424 ART Barrier Specialty Pipette Tips 1000µl racked (96x1 Box) 425 ART Barrier Specialty Pipette Tips 20-200µl racked (96x1 Box) 426 ART Barrier Specialty Pipette Tips 2-20µl racked (96x1 Box) 427 ART Barrier Specialty Pipette Tips 50µl racked (96x1 Box) 428 ART Barrier Specialty Pipette Tips 0-10µl racked (96x1 Box) 429 Safeskin purple nitrile gloves (Medium) 100/Box 430 N95 Particulate Respirator (NIOSH Approved) 1pc 431 Kimwipes 37.33x42.16 cmn (140/box) 432 Cryo Vial Sterile 1.8ml (25vial/pkt) 433 Cryo Box 1.8ml (9x9 wells) (1 x 4 / box) 434 FG-optical Adhesive Covers for PCR, 1pc 435 MicroAmp Optical 96-Well Reaction Plate (0.2ml), (1- Plate) 436 Zip lock bag 21.3x18cm (10bag/Box) 437 384 WELL PCR PLATE, (1- Plate) 438 Falcon tube 10ml (1pc) 439 Falcon tube 50ml (1pc) 440 Dacron Swab Stick (Nylon flocked) (100pc/Box) 441 Polypropylene Trigger Sprayers (500ml), 1pc 442 Stainless steel rectangular pan with sliding lid and handles tapered sides ( size 11 x 8 inch) , 1pc 443 Paraffin film (M) (1-Roll) 444 Syringe 3mL (1-Pc) 445 Ria Vial 3ML (1-Pc) 446 Red cap tube 3ml (1-Pc) 447 Aluminum foil (72 meter) (1-pc) 448 Isopropanol 99.9% (500ml/Bottle) 449 Cotton (500gm/Pack) 450 Spirit Surgical grade (1Lt/Bottle) 451 Spirit absolute (40 Lt/Gallon) 452 Hypochlorite soln (5%/4.6%) (1Lt/Bottle) 453 Sterilium hand rub ( 500ml/Bottle) 454 Liquid hand wash (750ml/Pack) 455 Blotting paper (1-Sheet) 456 Tourniquets for blood collection (1-pc) 457 Loose gloves M (7/7.5) (100/Box) 458 Surgical gloves M (7/7.5), (1-pc) 459 3 ply surgical mask , (1-pc) 460 Surgical Head cap, (1-pc) 461 Face/protective shield , (1-pc) 462 bleaching powder (25kg/Bag) 463 Protective Goggles (1-pc) 464 RNA extraction Kit (1-Rxn) 465 RNA Zap water 200ml /bottle 466 Ethanol absolute molecular grade (500ml/Bottle) 467 Thermacol transport Box (18cm x 12 cm) (500pc/bag) 468 Tissue Paper (Toilet paper roll) (9pc/Pack) 469 Labeling Stickers sheets(ST-65A4) (100sheets/Pack) 470 Disposable Tongue depressor (spatula) (100pc/Pack) 471 Nuclease Free Water (molecular grade) 1000ml/pack 472 Glucose Strip 473 Taqpath Multiplex RT PCR kit for the detection SARS CoV-2 474 Taqman Sequence detection (Primer + Probe) for Screening (E Gene & RNP) and Confirmatory (RdrP, & HKU ORF Ib) 475 Seegene Allplex 2019-nCoV assay R 476 Mylab Patho Detect Covid-19 Qualitative PCR kit 477 A*Star Fortitued kit 2.0 Covid-19 RT-PCR Test 478 Pandemic H1N109 assay set 479 Super Script III Platinum qRT PCR Reagent 480 Agpath One step RT PCR Reagent 481 LabGun Covid-19 RT PCR kit 482 BGI RT PCR kit for detection SARS Cov-2
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 9
Uttar Pradesh View Result →
14.
Agriculture #8726704 Technical Bid
Supply Of Laboratory Consumables -1 Aluminium Foil 2 Autoclavable Dispo Bags ( Small ) 3 Autoclavable Dispo Bags Large 4 Absorbent Cotton 5 Non- Absorbent Cotton 6 Coplin Jar 7 Cryobox ( For 2 Ml Tube ) 8 Cryobox ( 5 Ml Tube ) 9 Cryobox 10 Cryogenic Permanent Marker 11 Cryogenic Permanent Marker 12 Cryogenic Permanent Marker 13 Permanant Marker Pen 14 Permanant Marker Pen 15 Cryotubes-100 Nos 16 Cryotags-100 Nos 17 Diamond Marking Pencil 18 Disposable Plastic Inoculation Loop-100Nos 19 Filter Paper - 100Nos 20 Hiviral Transport Medium 21 Indicator Strips For Steam Sterilization 22 Indicator Strips For Dry Heat Sterilization- 23 Carboy 24 Poly Propylene Scissor Type Forceps 25 Mortar And Pestle 26 Parafilm 27 Pasteur Pipettes - 100Nos 28 Pasteur Pipettes - 500 Nos 29 Pasteur Pipettes - 500 Nos 30 Reversible Rack For 1 Ml Or 0.5 Ml Tubes 31 Scalpel Blade 32 Slide Mailer 33 Slide Mailer 34 Sterile Cotton Swab 35 Sterile Cotton Swab 36 Sterilizable Vials With Screw Cap 37 Tissue Paper Rolls 38 Lens Cleaning Tissue Paper 39 Waste Disposal Bags 40 Waste Disposal Bags 41 Dispenser Bottles 42 15 Ml Tube Stand 43 50 Ml Tube Stand 44 Universal Tube Stand / Rack 45 Ice Bucket 46 Self Adhesive Labels 47 Self Adhesive Labels 48 Nitrile Gloves 49 Scalp Vein Set For Blood Collection 50 Disposable Syringe With Needle 51 Disposable Syringe With Needle 52 Disposable Syringe With Needle 53 Pvdf Syringe Filters 54 Sharp Container 55 Reagent Reservoir 56 Micro Tips 20 Μl 57 Micro Tips 100 Μl 58 Micro Tips 1000 Μl 59 Coverslip 60 Coverslip 61 Coverslip 62 Coverslip 63 Haemocytometer Cover Glass 64 Basin Stand 65 Basin 66 Basin 67 Basin 68 Basin 69 Bp Handle 70 Bp Handle 71 Camel Hair Brush 72 Camel Hair Brush 73 Camel Hair Brush 74 Embedding Cassette 75 Haemoglobinometer 76 Haemoglobin Pipette 77 Round Haemometer Measuring Tube 78 Histology Sample Containers 79 Bone Saw 80 Knife For Microtome 81 Kidney Tray 82 Kidney Tray 83 Microslides 84 Star Frost Slides 85 18 Guage Disposable Needle 86 18 Guage Disposable Needle 87 20 Guage Disposable Needle 88 Slide Rack For Staining 10 Slides 89 Slide Rack For Staining 25 Slides 90 Microscope Slide Holder 91 Slide Box ( Holding 25 Slides ) 92 Slide Box ( Holding 50 Slides ) 93 Slide Box ( Holding 100 Slides ) 94 Spirit Lamp 95 Scissors 96 Scissors 97 Scissors 98 Scissors 99 Scissors 100 Thump Forceps 101 Thump Forceps 102 Timer 103 Vacutanier Tubes ( Serum Collection ) 104 Vacutanier Tubes ( Edta ) 105 Vernier Calipers 106 Aspirator Bottle 107 Thermo Hygrometer 108 Gel Pack 109 Thermocol Box 110 Thermocol Box 111 Thermocol Box 112 Filter Paper Sheets 113 Hair Dryer 114 Micropipette 115 Micropipette 116 Haemocytometer 117 Zip Lock Cover 118 Zip Lock Cover 119 Zip Lock Cover 120 Zip Lock Cover 121 Plastic Cover 122 Cellotape 123 Cellotape 124 Thump Forceps 125 Plastic Boxes
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 3
15.
Educational and Research Institute #7441919 AOC
Tender For Supply Of Kits ,Consumables, Office Equipment, Furniture, Supply Of Kits, Chemicals, Consumables, Stationary, Glass Ware, Office Equipment & Furniture , Kits/Chemicals/Office Equipment , Cover Slip 22X22mm , Slide Box (50Nos In Each Pkt.) , Hb Tube Round&Square Tube , Hemoglobinometre Set (Sahlis) , Esrtube (Western Green) , Esr Tube (Wintrobe) , Esbach Tube Set , Glass Beaker(100Ml) , Glassbeaker(200Ml/250Ml) , Glassbeaker(250Ml) , Glassbeaker(500Ml) , Glassbeaker(1000Ml) , Testtube 3 Inch , (Test Tube)6 Inches , Copline Jar , Measuring Cylender 500Ml,1000Ml , Conical Flask500 Ml,1000Ml , Urinometer (Specific Gravity ) , Hemocytometer Set , Urine Test Glass Graduated , Microscope Glass Slide Frosted One End (Size 76 X26 Mm.) Thickness 1.35 Mm-1.45 Mm (50 Slides) (Make– Sunbeam , Bluestar,Roche) , Cover Slip (Size 22Mmx30mm), (20 Small Boxes Per Pack ) (Make- Sunbean, Blue Star) , Cover Slip (Size 22Mmx40mm), (20 Small Boxes Per Pack ) (Make- Sunbean, Blue Star) , Cover Slip (Size 24Mmx60mm), (20 Small Boxes Per Pack ) (Make- Sunbean, Blue Star) , Cover Slip (Size 24Mmx50mm), (20 Small Boxes Per Pack ) (Make- Sunbean, Blue Star) , Cover Slip (Size 22Mmx50mm), (20 Small Boxes Per Pack ) (Make- Sunbean, Blue Star) , Erlich Reagent(250Ml) , Ammonium Sulphate(500Gm) , Magnesium Sulphate(500Gm) , Benedict Regent(5 Lit) , Sodium Nitroproside(500Gm) , Citric Acid 500Gm(500Gm) , Sulpher Powder(500Gm) , Liquor Amonia(500Ml) , Conc. Hcl 2.5Lit(500Ml) , Glacial Acitic Acid 2.5Litr(2.5Lit) , Barium Chloride 500Gm(500Gm) , Brilliant Cryshyl Blue() , Retic Solution (200Ml) , N/10 Hcl(500Ml) , Leishman Stain(200Ml) , Fauchet Reagent(200Ml) , Rectified Spirit () , Benzene (2.5 Ltr) (Make– Merck ,Rankem , Thermo Fisher , Qualigens ) , Xylene (2.5 Ltr) (Make– Merck ,Rankem , Thermo Fisher , Qualigens ) , Isopropyl Alcohol (2.5 Ltr) (Make– Merck ,Rankem , Thermo Fisher , Qualigens ) , Paraffin Wax ( Melting Point 60-62 Degree Celsius )(Company – Merck , Rankem, Thermo Fisher , Qualigens, Himedia , Formaline (37-41 %)(5 Lit.) (Make-Merck , Rankem, Thermo Fisher , Qualigens) , Sodium Hypochloride (5Ltr) , Hand Sanitizer (500Ml) , Nitric Acid 500 Ml , Hematoxyline Powder Orhematoxyline Stain Solution (5 Gms) ((Make- Thermo Fisher, Loba, Himedia, Sigma Etc.) , Liquor Ammonia (500Ml) , Eosin Yellow Or Eosin Stain Solution (25 Gms) (Make- Thermo Fisher, Loba, Himedia, Qualigens, Sigma Etc.) , Dpx 500 Ml (Make-Merck , Thermo Fisher , Qualigens) , Aluminium Potassium Alum (500Gms) , Mercuric Oxide Yellow (Make-Merck , Thermo Fisher , Qualigens) , Glycerine (400 Gms) , Rapid Pap Stain Kit , Afb Stain , Diff Quick Kit , Ammonium Potassium Sulphate (500 Gms) , Filter Paper Sheet (100Nos/Pkt.) , Watesman Round Filter Paper , Esr Tube Stand (Westerngreen) , Esr Tube Stand(Wintrobe) , Plastic Pippet (5Ml) , Rubber Bulb (Small) , Rubber Bulb(Big) , Plastic Beaker(100Ml) , Plastic Beaker(200Ml) , Plastic Beaker(500Ml) , Plastic Beaker(1000Ml) , Slide Tray Size 5.5 , Slide Stand , Test Tube Cleaning Brush , L.Mould (Brass) , Rubber Bulb (Small) , Micro Pippete (500Micro L.) , Micro Pippete (1000Micro L.) , Micro Pippete (01 To 500 Micro L.) , Litmus Paper ( Red & Blue)Each , Woodenstand (50 Testtube) , Enamel Tray Big , Enamel Tray Small , Bone Marrow Needle , Slide Stain Stand Metal(25 Slide) , Test Tube Holder 8 Testube , Wooden Slide Box , Micro Tips01-200 Micro Lit , Micro Tips01-1000 Micro Lit , Spirit Lamp , Syringe 5Ml , Syringe 10 Ml , High Profile Microtome Blade1 Pack = 50 Blades , Histology Filter Paper 500 Mmx5oomm Or 460Mmx570mm, , Tissue Capsule/Embedding Cassettes (Stainless Steel) 20X20x10mm In Dimension , Tissue Capsule/Embedding Cassettes (Stainless Steel) 20X20x10mm In Dimension , Tissue Embedding Cassettesplastic , Diamond Pencil , Face Shields , Needle Disposal 22 Gauge 1’’ , L.P. Needle22 Gauze X 89 Mm , Disposable Aprin , Grossing Instrument Set Including ( Long Scalpel Dissecting,Scissors,Toothed Forces,Long Blunt Forceps,Knife,Long Scalpel Dissecting,Bone Saw, Bone Cutter) , Surgical Gloves Pair 6.5 , Surgical Gloves Pair 7 , Spirit 500Ml , Sanitezer 500Ml , Sodium Hypo Chloride 500 Ml , Hiv Kit Elisa(96 Test)(Tulip/ Transasia/ Span/Sd/ J.Mitra / Meril) , Hiv Kit Rapid(Each)(Tulip/ Transasia/ Span/ Meril /Avantor/Oscar) , Hcvkit Elisa(96 Test)(Tulip/ Transasia/ Span/Sd/ J.Mitra / Meril) , Hcv Kit Rapid(Each)(Tulip/ Transasia/ Span/Sd/ J.Mitra / Meril/Oscar) , Hbsag Kit Elisa(96 Test)(Tulip/ Transasia/ Span/Sd/ J.Mitra / Meril) , Hbsag Kit Rapid(Each)(Tulip/ Transasia/ Span/Sd/ J.Mitra / Meril/Oscar) , Rpr (Vdrl) Kit(100Tesr)(Tulip/ Span / Reckon/ Beacon/Pathozyme) , Rpr (Vdrl) Kit(100Test)(Tulip/ Span / Reckon/ Beacon/Pathozyme) , Shyphilis Strip(100Tesr)(Tulip/ Span / Reckon/ Beacon) , Malaria Pf/Pv Test Kit(25Test)(Tulip/Span/Sd/ J.Mitra / Meril/Oscar) , Blood Grouping Anti Seraamonoclonal (Igm) (1X 10Ml)(Tulip/Span/Bio Lab/J.Mitra) , Blood Grouping Anti Serab Monoclonal (Igm)(1X 10Ml)(Tulip/Span/Bio Lab/J.Mitra) , Blood Grouping Anti Seradmonoclonal ( Igm )(1X 10Ml)(Tulip/J.Mitra) , Blood Grouping Anti Seradblend , Monoclonal( Igm + Igg) Anti Sera(1X 10Ml)(Tulip/J.Mitra) , Blood Grouping Anti Seraabd Set Monoclonal(10Ml) (Tulip/J.Mitra) , Anti – A1 Lectin (10Ml)(Tulip/Span) , Anti – Ab Monoclanal(5Ml)(Tulip/Span) , Anti -H(10 Ml)(Tulip/Span) , Anti – C (2 Ml)(Tulip/Span) , Anti - E (2 Ml)(Tulip/Span) , Anti - E (2 Ml)(Tulip/Span) , Coombs Anti Sera (5 Ml)(Tulip/Span) , Id Gel Cross Match Card (Ahg)(Coombs) Test Card(Each)(Tulip/Diamed) , Gel Diluent -2 Liss(1X 250 Ml)(Tuip/Diamed) , Blood Bag Double 350Ml (Mitra/Hll/ Terumo Penpol/Polymed) , Blood Bag Double450ml ( Mitra/Hll/ Terumo Penpol/Polymed) , Blood Bag Triple350ml ( Mitra/Hll/ Terumo Penpol/Polymed) , Blood Bag Triple 450Ml (Mitra/Hll/ Terumo Penpol ) , Micro Pipette Tips0-200 Ul(1X 1000 Nospack) , Micro Pipette Tips 1000 Ul(1X500 Nospack) , Multi Channal Micro Pipet0-100 Ul , Micro Pipet(10 Ul) , Micro Pipet(25 Ul) , Micro Pipet(50 Ul) , Micro Pipet (100 Ul) , Sodium Hypochloride(1X 5 Literpack) , Leishman Stain Solution(1 X 500 Ml) , Cuso4 Crystal (1 X 250G) , Glassslide ( Size 75Mm X 25Mm) , Jar Glass ( Size2 Litre) , Measuring Cylinder (Size100ml) , Measuring Cylinder (Size 500Ml) , Measuring Cylinder (Size1000 Ml) , Beaker ( Size100ml) , Beaker ( Size 200Ml ) , Beaker (Size 500Ml) , Measuring Cylinder (100 Ml) , Absolute Alcohal (500Ml) , Formaldehyde 37-41% (200 Liter Pack) , Glycerin (5 Liter) , Haemotoxilline Stain (For Histology Staining) (100Gm) , Eosin Stain (For Histology Staining) (100Gm) , Potasium Alum (500Mg) , Xylene (2.5 Lit) , Hydrochloric Acid (100 Ml) , Thymol Crystal 500 Gm , Picric Acid 5 Ltr , Murcuric Oxide 200 Gms , Wax Solid (Paraffin Wax) 1 Kg , Glacial Acetic Acid 100 Ml , H2o2 Solution 20% 5 Ltr , Bleaching Powder 5Kg , Running Water Chamber , Cuplin Jar With Cover(Plastic) , Nutrient Agar Powder Veg. (500Gm) , Mac Conkey’S Agar Powder Veg. (500Gm) , Cled Agar Medium (Cystein Lactose Electrolyte Deficient) (500Gm) , Muller Hinton Agar Medium Powder (500Gm) , Agar Agar Powder (500Gm) , Peptone Water (500Gm) , Glucose Phosphate Broth (500Gm) , Mr-Vp Broth (500Gm) , Citrate Agar (500Gm) , Simmon’S Citrate Agar Medium (500Gm) , Urea Agar With Urea Supplement (500Gm) , Urea Agar Base (Christensen) With Urea Supplement (500Gm) , Tsi Agar (500Gm) , Moellers Decarboxylase Broth With Arginine (100Gm) , Moellers Decarboxylase Broth With Lysine (100Gm) , Moellers Decarboxylase Broth With Ornithine (100Gm) , Moellers Decarboxylase Broth Base (100Gm) , Nitrate Broth (100Gm) , Of Basal Medium (100Gm) , Phenylalanine Agar (100Gm) , Selenite F Broth (Twin Pack) (100Gm) , Tetrathionate Broth Medium (100Gm) , Gram Negative Broth Medium (100Gm) , Nutrient Broth (500Gm) , Macconkey Broth W/ Neutral Red (500Gm) , Macconkey Broth Purple W/ Bcp (100Gm) , Bile Broth (500Gm) , Tryptic Soy Broth (500Gm) , Tryptic Soy Agar (500Gm) , Brain Heart Infusion Broth (Bhi) (500Gm) , Brain Heart Infusion Agar (500Gm) , Columbia Blood Agar Base (500Gm) , Robertson Cooked Meat Media (500Gm) , Bile Esculin Agar (100Gm) , T.C.B.S.Agar Powder Veg (100Gm) , Xld Agar (100Gm) , Salmonela-Shigella Agar (100Gm) , Deoxycholate Citrate Agar (100Gm) , Bile Salt Agar (500Gm) , Alkaine Bile Salt Agar(500Gm) , Wilson Blair Agar (100Gm) , Potasium Tellurite Agar(100Gm) , Potassium Telurite Blood Agar (100.Gm) , Triptycase Tellurite Agar (100Gm) , Thioglycolate Broth (500Gm) , Cetrimide Agar (100Gm) , Dnase Agar (100Gm) , Mannitol Salt Agar (100Gm) , Pyr Agar(Pyrrolidonyl Arylamidase) (100Gm) , Lofflers Medium Base (100Gm) , Caryblair Transport Medium(100Gm) , Gelatin Agar (100Gm) , Hektoen Enteric Agar (100Gm) , Bordet Gengoue Media (100Gm) , Monsur’S Gelatin Tourochalate Trypticase Agar(100Gm) , Lj Media Slants (100 Tubes) , Lj Media With First Line Anti-Tubercrular Drugs (50 Tests) , Hi.Viral Transport Medium(100 Tubes) , Sabouraud Dextrose Agar(500Gm) , Sabouraud Dextrose Agar With Chloramphenicol (500Gm) , Sabouraud Dextrose Agar With Cyclohexamide (500Gm) , Neutral Sda Agar Medium (500Gm) , Sda Broth (100Gm) , Hicrom Candida Differential Agar Medium (100Gm) , Muller Hinton Agar With Dextrose & Methylene Blue (500Gm) , Rpmi 1240 Agar (500Gm) , Dermatophytes Test Medium (500Gm) , Dermatophytes Identification Medium (500Gm) , Corn Meal Agar (500Gm) , Oat Meal Agar (100Gm) , Rice Starch Agar (100Gm) , Malt Extract Agar (100Gm) , Bird Seed Agar/ Niger Seed Agar (100Gm) , Sunflower Seed Agar (100Gm) , Cgb Agar (100Gm) , Tetrazolium Reduction Medium (100Gm) , Modified Dixon Agar (100Gm) , Leeming & Notman Agar (100Gm) , Alphacel Yeast Extract Agar (100Gm) , Yeast Nitrogen Base (100Gm) , Yeast Carbon Base (100Gm) , Cystein Heart & Hb Agar (100Gm) , Czapek Dox Agar (100Gm) , Pyg Agar Medium (100Gm) , Dichloran Rose Bengal Chloramphenicol (Drbc) Agar (100Gm) , Sabouraud Dextrose Agar With Cyclohexamide And Chloramphenicol (100Gm) , Albert’S Stain Kit (1 Kit (125 Ml Each)) , Lpcb Stain Kit (100 Ml) , Gram’S Stain Kit (1 Kit (125 Ml Each)) , Afb/Z-N Stain Kit (1 Kit (125 Ml Each)) , Trichome Stain (1 Kit (500 Ml)) , Wright Stain (5 Gm) , Calcofluor White (5 Gm) , Leishman Stain (1 Kit (500 Ml)) , Giemsa Stain(1 Kit (500 Ml)) , Field’S Stain(1 Kit (500 Ml)) , Jsb Stain (1 Kit (500 Ml)) , H & E Stain (1 Kit (500 Ml)) , Pas Stain (Periodic Acid Schiff’S Stain) (1 Kit (500 Ml)) , Masson’S Fontana Stain (1 Kit (500 Ml)) , Gomori’S Methanamine Silver Stain (1 Kit (500 Ml)) , May Grunwald’S Dye (1 Kit (500 Ml)) , India Ink(5Ml ) , Nigrosin Stain (50 Ml ) , Acridine Orange (5 Gm) , Kovac’S Indole Reagent (100 Ml) , Methyl Red Reagent (125 Ml) , Barrit Reagent A (For Vp Test) (125 Ml) , Barrit Reagent B (For Vp Test) (125 Ml) , Sulphanilic Acid (500 Gm) , Alpha- Naphthylamine (500 Gm) , Zinc Dust Powder (500 Gm) , Nnnn- Tetramethyl-P-Phenylenediamine Dihydrochloride (Oxidase Reagent) (5 Gm ) , Pyrreagent (Pyrrolidonyl Arylamidase) (500 Gm) , Glucose/ Dextrose Powder (500 Gm ) , Lactose Powder (100 Gm ) , Mannitol Powder (100 Gm ) , Maltose Powder (100 Gm ) , Sucrose Powder (100 Gm) , Trehalose Powder (100 Gm ) , Sorbitol Powder (100 Gm) , Raffinose Powder (100 Gm) , Arabinose Powder (100 Gm) , Xylose Powder (100 Gm) , Cellobiose Powder (100 Gm) , Dulcitol (100 Gm) , Acetic Acid (1 Lt. ) , Glacial Acetic Acid (1 Lt. ) , Trichloro Acetic Acid (1 Lt. ) , Concentrated Hydrochloric Acid (Hcl) (1 Lt.) , Concentrated Sulphuric Acid (H2so4) (1 Lt.) , Lactic Acid (1 Lt.) , Oleic Acid (1 Lt.) , Phosphotungstic Acid (1 Lt.) , Liquorammonia Solution (1 Lt.) , Ammonium Oxalate (100Gm) , Etanol/ Absolute Ethyl Alcohol (1 Lt.) , Methanol/ Methyl Alcohol (1 Lt.) , Iso Propyl Alcohol/ Propanol (1 Lt.) , Amyl/ Isoamyl Alcohol (1 Lt.) , Polyvinyl Alcohol (1 Lt.) , Formalin (1 Lt.) , Xylene (500Ml) , Hydrogen Peroxide (1 Lt.) , Acetone Solution (1 Lt.) , Ether Solution (1 Lt.) , Tween80 Solution (300 Ml) , Tween20 Solution (300 Ml) , Glycerin (1 Lt.) , Glycerol Solution (1 Lt. ) , Liquid Paraffin Heavy (1 Lt.) , Paraffin Wax (500Gm) , Andrade’S Indicator (300 Ml) , Sodium Taurocholate (Bile Salt) (500Gm ) , Sodium Deoxycholate (500Gm ) , P-Dimethyl-Aminobenzaldehyde (500 Gm ) , ?-Naphthol (500 Gm ) , Phenolphthalein(100Gm ) , Potassium Hydroxide Powder/ Pellates (500 Gm ) , Iodide Crystals/ Powder (500 Gm ) , Potassium Iodide Crystals/ Powder (500 Gm ) , Mercuric Iodide (100 Gm) , Sodium Hippurate (300 Ml) , Ninhydrin Solution (300 Ml) , Peptone Powder (500 Gm) , Proteoses Petone (500 Gm) , Neopeptone Powder (500 Gm) , Biopeptone Powder (500 Gm) , Bactopeptone Powder (500 Gm) , Yeast Extract Powder (500 Gm) , Meat Extract Powder (500 Gm) , Beef Extract Powder (500 Gm) , Phenol Crystal (500 Gm) , Methylviolet (500 Gm) , Crystal Violet (500 Gm) , Methylene Blue (500 Gm) , Saffranine (500 Gm) , Basic Fuschin (500 Gm) , Giemsa Stain Powder (500 Gm) , Acridine Orange Dye (100 Gm) , Fontana Stain (100 Gm) , Eosin (100 Gm) , Hematoxylin Crystals (25Gm) , Malachite Green (25Gm) , Methyl Red (Ph Indicator) (25Gm) , Neutral Red Indicator (25Gm) , Phenol Red Indicator (25Gm) , Bromothymol Blue (5Gm) , Thymol Blue (5Gm) , Bromo-Cresol Purple (5Gm) , Cresol Red (5Gm) , Acriflavin Solution (5Gm) , Merthiolate (5Gm) , Chromotrope 2R (5Gm) , Light Green Sf (5Gm) , Dpx Mount Solution (300 Ml ) , Azure I (5Gm) , Azure B (5Gm) , Iron Alum Sulphate (25Gm) , Iron Ammonium Sulphate (25Gm) , Sodium Carbonate (1Kg ) , Sodium Bicarbonate (1Kg) , Calcium Carbonate ( Caco3 ) (100Gm) , Sodium Chloride (1Kg) , Sodium Dihydrogen Phosphate (100Gm) , Disodium Hydrogen Phosphate (100Gm) , Sodium Hydroxide (5 Lt ) , Sodium Hydroxide (Naoh) Pellates (500 Gm) , Ammonium Di Hydrogen Phosphate (500 Gm) , Di Pot. Hydrogen Phosphate (100Gm) , Di Sodium Ortho Phosphate (500Gm) , Lysozyme (5Gm ) , Thallus Acetate /Thallium (I) Acetate (5Gm ) , Dibasic Sod. Phosphate (100Gm) , Bismuth Ammonium Citrate (100Gm) , N-Acetyl-L-Cystine (Nalc) Powder (25Gm ) , Urea Powder (100Gm ) , Ph Strips (Ph 1-10) (1 Pack (200 Strips)) , Dipotassium Hydrogen Phosphate ( K2hpo4 ) (100Gm) , Potassium Phosphate ( K2hpo4 ) (100Gm) , Magnesium Sulphate ( Mgso4 ) (100Gm) , Ammonium Dihydrogen Phosphate ( Nh4h2po4 ) (100Gm) , Potassium Dihydrogen Phosphate ( Kh2po4 ) (100Gm) , Monopotassium Phoshate (100Gm) , Sodium Citrate ( Na3c6h5o7.2H2o ) (100Gm) , Ferric Citrate (100Gm) , Ferric Chloride (100Gm) , Ferric Ammonium Citrate (100Gm) , Sodium Thiosulfate (100Gm) , Potassium Nitrate, Kno3(Nitrite Free) (100Gm) , Pyridoxal (100Gm) , L. Asparagine (100Gm) , L-Lysine Hydrochloride (25 Gm ) , L-Ornithine Hydrochloride (25 Gm) , L-Arginine Hydrochloride (25 Gm) , L-Lysine (25 Gm) , L-Cystine (25 Gm) , Dl-Phenylalanine(Or L-Phenylalanine ) (25 Gm) , Tryptose(100Gm ) , Deoxyribonucleic Acid (100Gm) , Sodium Phenolphthalein Diphosphate (100Gm) , Phosphatase Substrate Tablet (300Mg) (10 Gm) , Phenolphthaleindiphosphate (100Gm) , Sodium Hippurate (100Gm) , Ninhydrin Solution(100Gm) , Ox Bile (Purified & Dehydrated) (100Gm) , Aesculin (100Gm) , Tryptone (100Gm) , Sodium Pyruvate (100Gm) , L-Pyrrolidonyl-?-Naphthalamide (100Gm) , Cinnamaldehyde Reagent (100 Ml ) , Potassium Tellurite ( K2teo3 ) (100 Ml ) , Vitamin Growth Supplement (10 Vials) , Corn Starch (100 Gm) , Egg Powder (100 Gm) , Saponinsolution (100 Ml) , Lysed Horse Blood (100 Ml) , Blood (Sheep Or Rabbit), Defibrinated (100 Ml) , Rabbit Plasma (100 Ml) , Haemoglobin(100 Gm) , Serum Of Ox, Sheep Or Horse (500 Ml) , Calf Serum (500 Ml) , Bovine Serum(750 Ml) , Thiosulphate Solution (500 Ml) , Sodium Thiosulphate ( Na2s2o3 ) (100 Gm) , Bismuth Ammonio-Citrate Scales (100 Gm) , Bismuth Sulphite (100 Gm) , Sodium Sulphite ( Na2so3 ) (100 Gm) , Sodium Hydrogen Selenite ( Nahseo3 ) (100 Gm) , Acetamide ( Ch3conh2 ) (100 Gm) , Phyton (25 Gm) , Hemin (25 Gm) , Vitamin K1 (3-Phytylmenadione) (25 Gm) , Immersion Oil (30 Ml) , Lens Cleanser Solution (150Ml ) , Spirit(500 Ml) , Phenol 5% -10 % (5 Lt.) , Bakout(5 Lt.) , Finit(10 Lt.) , Labolene Solution (5 Lt. ) , Alkyl Dimethyl Benzyl Ammonium Chloride 13.805%(500Ml) (500Ml) , Ethanol (500Ml) (500Ml) , Sulfanilic Acid (500Ml) (500Ml) , Bile Esculin(Be) Discs (1Pk (5 Vl X 50 Discs) ) , Optochin (Op) Discs (5 ?G) (1Pk (5 Vl X 50 Discs)) , Bacitracin (Ba) Discs (0.04 Units) (1Pk (5 Vl X 50 Discs)) , Furazolidine (Fr) Discs (100 ?G) (1Pk (5 Vl X 50 Discs)) , Novobiocin (Nv) Discs (5 ?G) (1Pk (5 Vl X 50 Discs)) , Polymyxin B (Pb) Discs (50 U)(1Pk (5 Vl X 50 Discs)) , Polymyxin B (Pb) Discs (300 U)(1Pk (5 Vl X 50 Discs)) , Onpg Discs (1Pk (5 Vl X 50 Discs)) , Lysine Hydrochloride Discs (1 Vl X 50 Discs) , Ornithine Hydrochloride Discs (1 Vl X 50 Discs) , Arginine Hydrochloride Discs (1 Vl X 50 Discs) , Glucose/ Dextrose Discs (1 Vl X 50 Discs) , Lactose Discs (1 Vl X 50 Discs) , Mannitol Discs (1 Vl X 50 Discs) , Maltose Discs (1 Vl X 50 Discs) , Sucrose Discs (1 Vl X 50 Discs) , Trehalose Discs (1 Vl X 50 Discs) , Sorbitol Discs (1 Vl X 50 Discs) , Raffinose Discs (1 Vl X 50 Discs) , Arabinose Discs (1 Vl X 50 Discs) , Xylose Discs (1 Vl X 50 Discs) , Cellobiose Discs (1 Vl X 50 Discs) , Dulcitol Discs (1 Vl X 50 Discs) , Ampicillin (10 ?G) (1Pk (5 Vl X 50 Discs)) , Ampicillin-Sulbactum (10/10 ?G) (1Pk (5 Vl X 50 Discs)) , Amoxycillin (20 ?G) (1Pk (5 Vl X 50 Discs)) , Amoxicillin-Clvulanic Acid (20/10 ?G) (1Pk (5 Vl X 50 Discs)) , Azithromycin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Amikacin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Ciprofloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Norfloxacin (10 ?G) (1Pk (5 Vl X 50 Discs)) , Ofloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Levofloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Moxifloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Sparfloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Clarithromycin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Clindamycin (2 ?G) (1Pk (5 Vl X 50 Discs)) , Cloxacillin (1Pk (5 Vl X 50 Discs)) , Trimethoprim-Sulfamethoxazole (1.25/23.75 ?G) Or Co-Trimoxazole (1Pk (5 Vl X 50 Discs)) , Cefuroxime Sodium (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefaclor (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefezolin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefepime (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefepime-Tazobactum (30/10 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftolozone- Tazobactum (30/10 ?G) (1Pk (5 Vl X 50 Discs)) , Cefoxitin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefoperazone (75 ?G) (1Pk (5 Vl X 50 Discs)) , Cefoperazone-Sulbactam (1Pk (5 Vl X 50 Discs)) , Ceftazidime (30 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftazidime- Clvulanic Acid (30/10 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftazidime-Avibactum (30/20 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftizoxime (30 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftriaxone (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefotaxime (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefotaxime- Clvulanic Acid (30/10 ?G) (1Pk (5 Vl X 50 Discs)) , Chloramphenicol (30Ug) (1Pk (5 Vl X 50 Discs)) , Cefixime (5Ug) (1Pk (5 Vl X 50 Discs)) , Cefopodoxime (10 ?G) (1Pk (5 Vl X 50 Discs)) , Cefdinir (5 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftaroline (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefotetan (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefamandole(30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefmetazole (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefonicid (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefidecoral (30 ?G) (1Pk (5 Vl X 50 Discs)) , Moxalactum (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefaclor(30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefprozil (30 ?G) (1Pk (5 Vl X 50 Discs)) , Cefetamet (10 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftibuten (30 ?G) (1Pk (5 Vl X 50 Discs)) , Loracarbef (30 ?G) (1Pk (5 Vl X 50 Discs)) , Plazomicin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Colistin (1Pk (5 Vl X 50 Discs)) , Polymixin B (1Pk (5 Vl X 50 Discs)) , Tetracyclin (30Ug) (1Pk (5 Vl X 50 Discs)) , Minocyclin (30Ug) (1Pk (5 Vl X 50 Discs)) , Tigecyclin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Doxcycline (30 ?G) (1Pk (5 Vl X 50 Discs)) , Erythromycin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Neomycin (1Pk (5 Vl X 50 Discs)) , Netillin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Nalidixic Acid (30 ?G) (1Pk (5 Vl X 50 Discs)) , Nitrofurantoin (300 ?G) (1Pk (5 Vl X 50 Discs)) , Teicoplanin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Vancomycin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Linezolid (30 ?G) (1Pk (5 Vl X 50 Discs)) , Penicillin (10 Units) (1Pk (5 Vl X 50 Discs)) , Carbenicillin (100 ?G) (1Pk (5 Vl X 50 Discs)) , Ertapenem (10 ?G) (1Pk (5 Vl X 50 Discs)) , Imipenem (10 ?G) (1Pk (5 Vl X 50 Discs)) , Meropenem (10 ?G) (1Pk (5 Vl X 50 Discs)) , Doripenem (10 ?G) (1Pk (5 Vl X 50 Discs)) , Imipenem-Cilastatin (1Pk (5 Vl X 50 Discs)) , Imipenem-Relebactum (10/25 ?G) (1Pk (5 Vl X 50 Discs)) , Meropenem-Vaborbactum (20/10 ?G) (1Pk (5 Vl X 50 Discs)) , Piperacillin (100 ?G) (1Pk (5 Vl X 50 Discs)) , Piperacillin- Tazobactum (100/10 ?G) (1Pk (5 Vl X 50 Discs)) , Ticarcillin (75 ?G) (1Pk (5 Vl X 50 Discs)) , Ticarcillin-Clavulanic Acid (75/10 ?G) (1Pk (5 Vl X 50 Discs)) , Aztreonam (30 ?G) (1Pk (5 Vl X 50 Discs)) , Tobramicin (10 ?G) (1Pk (5 Vl X 50 Discs)) , Gentamicin (10 ?G) (1Pk (5 Vl X 50 Discs)) , High-Level Gentamicin (120 ?G) (1Pk (5 Vl X 50 Discs)) , Fosfomycin (200 ?G) (1Pk (5 Vl X 50 Discs)) , Cinoxacin (100 ?G) (1Pk (5 Vl X 50 Discs)) , Enoxacin (10 ?G) (1Pk (5 Vl X 50 Discs)) , Garenoxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Gatifloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Gemifloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Lomefloxacin (10 ?G) (1Pk (5 Vl X 50 Discs)) , Grepafloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Fleroxacin(5 ?G) (1Pk (5 Vl X 50 Discs)) , Perfloxacin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftaroline (30 ?G) (1Pk (5 Vl X 50 Discs)) , Rifampin (5 ?G) (1Pk (5 Vl X 50 Discs)) , Quinpristin-Dalfopristin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Lefamulin (20 Ug) (1Pk (5 Vl X 50 Discs)) , Spectinomycin (100 ?G) (1Pk (5 Vl X 50 Discs)) , Dirithromycin(15 ?G) (1Pk (5 Vl X 50 Discs)) , Fusidic Acid (10 ?G) (1Pk (5 Vl X 50 Discs)) , Mecillinam (10 ?G) (1Pk (5 Vl X 50 Discs)) , Moxalactum (30 ?G) (1Pk (5 Vl X 50 Discs)) , Eravacyclin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Gepotidacin (10 ?G) (1Pk (5 Vl X 50 Discs)) , Iclaprim (5 ?G) (1Pk (5 Vl X 50 Discs)) , Faropenem (5 ?G) (1Pk (5 Vl X 50 Discs)) , Razupenem (10 ?G) (1Pk (5 Vl X 50 Discs)) , Tebipenem (10 ?G) (1Pk (5 Vl X 50 Discs)) , Sulopenem (2 ?G) (1Pk (5 Vl X 50 Discs)) , Naficillin (1 ?G) (1Pk (5 Vl X 50 Discs)) , Nafithromycin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Omdacicyclin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Solithromycin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Telithromycin (15 ?G) (1Pk (5 Vl X 50 Discs)) , Trospectomycin (30 ?G) (1Pk (5 Vl X 50 Discs)) , Trovafloxacin (10 ?G) (1Pk (5 Vl X 50 Discs)) , Aztreonam-Avibactum (30/20 ?G) (1Pk (5 Vl X 50 Discs)) , Cefepime –Enmetazobactum (30/20 ?G) (1Pk (5 Vl X 50 Discs)) , Cefepime –Zidebatum (30/30 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftibuten-Ledaborbactum (5/2.5 ?G) (1Pk (5 Vl X 50 Discs)) , Ceftibuten (30 ?G) (1Pk (5 Vl X 50 Discs)) , Vancomycin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Colistin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Levofloxacin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Ofloxacin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Polymyxin B Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Tigecyclin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Tedizolid Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Televancin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Dalbavancin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Oritavancin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Daptomycin Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Ceftolzone-Tazobactum Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Metronidazole Mic E-Strip (1Pk (5 Vl X 50 Discs)) , Fluconazole (Flc) Disc (25 Mcg) (1Pk (5 Vl X 50 Discs)) , Voriconazole (Vrc) Disc (1 Mcg) (1Pk (5 Vl X 50 Discs)) , Itraconazole (It) Disc (10 Mcg) (1Pk (5 Vl X 50 Discs)) , Posaconazole (5 Mcg) Disc (1Pk (5 Vl X 50 Discs)) , Miconazole (Mic) Disc (30 Mcg) (1Pk (5 Vl X 50 Discs)) , Clotrimazole (Cc) Disc (10 Mcg) (1Pk (5 Vl X 50 Discs)) , Ketoconazole(Kt) Disc (30 Mcg) (1Pk (5 Vl X 50 Discs)) , Nystatin (Ns) Disc (50 Mcg) (1Pk (5 Vl X 50 Discs)) , Amphotericin B (Ap) Disc (20 Mcg) (1Pk (5 Vl X 50 Discs)) , Caspofungin (5 Mcg) Disc (1Pk (5 Vl X 50 Discs)) , Oxidase Disc (1Pk (5 Vl X 50 Discs)) , E.Coli Atcc25922 (2 Sticks X 1) , E.Coli Atcc35218 (2 Sticks X 1) , Pseudomonas Aeruginosa Atcc 27853 (2 Sticks X 1) , Klebsiella Pneuminiae Atcc 700603 (2 Sticks X 1) , Staphylococcus Aureus Atcc 25923 (2 Sticks X 1) , Staphylococcus Aureus Atcc 29213 (2 Sticks X 1) , Enterococcus Faecalis Atcc 29213(2 Sticks X 1) , Enterococcus Faecalis Atcc 51299 (2 Sticks X 1) , Salmonella Typhi Atcc 14028 (2 Sticks X 1) , Proteus Mirabilis Atcc 122453(2 Sticks X 1) , Haemophilus Influezae Atcc 49247 (2 Sticks X 1) , Haemophilus Influezae Atcc 49766 (2 Sticks X 1) , Streptococcus Pneumoniae Atcc 49619 (2 Sticks X 1) , Neisseria Gonorrhoeae Atcc 49226 (2 Sticks X 1) , Bacteroides Fragilis Atcc 25285 (2 Sticks X 1) , Bacteroides Thetaiotaomicron Atcc 29741 (2 Sticks X 1) , Clostridiodes Difficile Atcc 700057 (2 Sticks X 1) , Eggerthela Lenta Atcc 43055 (2 Sticks X 1) , Candida Albicans Atcc 90028 (2 Sticks X 1) , Candida Parapsilosis Atcc 22019 (2 Sticks X 1) , Candida Tropicalis Atcc 750 (2 Sticks X 1) , Candida Krusei Atcc 6258 (2 Sticks X 1) , Antisera Shigella Polyvalent ‘O’ (10 Ml) , Antisera Shigella Dysneriae Poly A & A1 (10 Ml) , Antisera Shigella Fleneri Poly B (10 Ml) , Antisera Shigella Boydii Poly C (1-7) (10 Ml) , Antisera Shigella Boydii Poly C1 (8-11) (10 Ml) , Antisera Shigella Boydii Poly C2 (12-14) (10 Ml) , Antisera Shigella Sonnei Poly D (10 Ml) , Antiserasalmonella Poly “O” A-G (10 Ml) , Antisera Salmonella O-2 (10 Ml) , Antisera Salmonella O-9 (10 Ml) , Antisera Salmonella O-4 (10 Ml) , Antisera Salmonella H-A (10 Ml) , Antisera Salmonella H-B (10 Ml) , Antisera Salmonella H-D (10 Ml) , Antisera Salmonella H-I (10 Ml) , Antisera Salmonella V-I (10 Ml) , V. Choleraepoly (10 Ml) , V. Choleraeinaba (10 Ml) , V. Choleraeogawa (10 Ml) , Antisera E. Coli(5 Ml) , Antisera Klebsiella (5 Ml) , Antisera Proteus (5 Ml) , Antisera Staph. Aureus (5 Ml) , Antisera Pseudomonas (5 Ml) , Antisera Enterococcus Faecalis (5 Ml) , Antisera Salmonella Poly “O” A-G (1 Ampoule (1Ml)) , Antisera Salmonella O-2 (1 Ampoule (1Ml)) , Antisera Salmonella O-9 (1 Ampoule (1Ml)) , Antisera Salmonella O-4 (1 Ampoule (1Ml)) , Antisera Salmonella H-A (1 Ampoule (1Ml)) , Antisera Salmonella H-B (1 Ampoule (1Ml)) , Antisera Salmonella H-D (1 Ampoule (1Ml)) , Antisera Salmonella H-I (1 Ampoule (1Ml)) , Antisera Salmonella V-I (1 Ampoule (1Ml)) , Antisera Vibrio Choleraepoly (1 Ampoule (1Ml)) , Antisera Vibrio Choleraeinaba (1 Ampoule (1Ml)) , Antisera Vibrio Choleraeogawa (1 Ampoule (1Ml)) , Antisera Shigella Polyvalent O (1 Ampoule (1Ml)) , Antisera Shigella Dysenteriae Poly A & A1 (1 Ampoule (1Ml)) , Antisera Shigella Flexneri Poly B (1 Ampoule (1Ml)) , Antisera Shigella Boydii Poly C (1-7) (1 Ampoule (1Ml)) , Antisera Shigella Boydii Poly C1 (8-11) (1 Ampoule (1Ml)) , Antisera Shigella Boydii Poly C2 (12-14) (1 Ampoule (1Ml)) , Antisera Shigella Sonnei Poly D (1 Ampoule (1Ml)) , Salmonella Typhi Atcc 14028 (1 Pk ( 2 Sticks)) , Corynebacterium Diphtheria Atcc 13812 (1 Pk ( 2 Sticks)) , Shigella Dysenteriae Atcc 13313 (1 Pk ( 2 Sticks)) , Shigella Flexneri Atcc 12022 (1 Pk ( 2 Sticks)) , Shigella Sonnei Atcc 25931 (1 Pk ( 2 Sticks)) , Shigella Boydii Atcc 8700 (1 Pk ( 2 Sticks)) , Glass Petridishes With Lid (90 Mm) That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (5000 No.) , Glass Petridishes With Lid (120 Mm) That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (3000 No.) , Glass Test Tubes 12Mm X 100Mm (7Ml) That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (5000 No.) , Glass Test Tubes 15Mm X 125Mm (13Ml) That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (5000 No.) , Glass Test Tubes 18Mm X 150Mm (27Ml) That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (5000 No.) , Glass Test Tubes (5Ml) That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (5000 No.) , Glass Rods Borosil (50 No.) , Glass Slides 25Mmx 75 Mm Borosil (100 Packet) , Glass Cover Slips 20Mm X 20Mm Borosil (100 Packet) , Glass Cover Slips 20Mm X 50Mm Borosil (100 Packet) , Glasscavity Slides Borosil (50 Packet) , Small Size (20Mm) Durham’S Tubes Borosil (100 Packet) , Felix Glass Tubes (Round Bottom 5Ml Capacity) Borosil (200 No.) , Drayer’S Glass Tubes (Conical Bottom 5Ml Capacity) Borosil (200 No.) , Funnel Borosil(24 No.) , Reagent Bottle(2000Cc) Borosil (12 No.) , Reagent Bottle (1000Cc) Borosil (48 No.) , Reagent Bottle (500Cc) Borosil (24 No.) , Reagent Bottle(250Cc) Borosil (24 No.) , Reagent Bottle (100Cc) Borosil (60 No.) , Reagent Bottle (50Cc) Borosil (60 No.) , Mackartaney’Sbottle That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (500 No.) , Beaker [1000 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (10No.) , Beaker [500 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (10 No.) , Beaker [100 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (20 No.) , Beaker [50 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (20 No.) , Conical Flask Flat Bottom[1000 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (20 No.) , Conical Flask Flat Bottom[500 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (50 No.) , Conical Flask Flat Bottom[250 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. Borosil (20 No.) , Conical Flask Flat Bottom[50 Cc] That Can Resist Dry Heat Temperature 180°C And Moist Heat Temperature 121 °C. / Borosil (20 No.) , Museum Jar [Rectangular With Lid] Borosil (10 No.) , Glass Trough Pneumatic Borosil (10 No.) , Rubber Teats Various Volume Borosil (100 No.) , Glass Pipetts Each Of Each Size (10 No.) , Test Tube Stand (Small/5Mm) (30) , Test Tube Stand (12 Mm) (30) , Test Tube Stand (15 Mm) (30) , Test Tube Stand (18 Mm) (30) , Rack For Petridish (10) , Staining Racks (10) , Test Tube Holders (60) , Antibiotic Zone Scale (5 Sets) , Sterile Wooden Stick Swabs (10000) , Filter Paper(No.1 & No.2) (2000) , Blunt Forceps 8 Inch & 10 Inch (Large & Medium Size) (10 Set) , Teasing Needles (100) , Metaloop Changeable Handle For Inoculation (24) , Nichrome Loop Wire (4Mm)(50) , Nichrome Straight Wire (50) , Autoclavable Vial With Screw Cap (10 Ml Capacity) (500 X 2) , Mcfarland’S Standard Tubes Set (0.5, 1, 2 & 3) (5 Sets) , Autoclavable, Unbreakable Plastic Petridishes With Lid (90 Mm) That Can Resist Moist Heat Temperature At 121 °C. (5000 No.) , Serum Storage Vials 2 Ml (Screw Cap) (10000) , Eppendorf Tubes1.5 Ml (Flip Top Conical Bottom) (10000) , Eppendorftubes 2.0 Ml (Flip Top Round Bottom) (10000) , Micro Tips Yellow Size Small (2-200?L) (20000 No.) , Micro Tips Blue Big Size (1000?L) (5000 No.) , Collection Vial 5Ml (5000 No.) , Collection Vial 2Ml (2000 No.) , Tuberculin Syringe Disposable(2000 No.) , Filter Tips For 0.5-10 Ul Pipette, Sterile, Low Retention Aerosol Barrier Tips, Racked Filter Tip In Box Format, 0.5 Ul - 10 Ul Universal Graduation, Dnaase/ Rnaase Free (10 Packs) , Filter Tips For 20 Ul To 200 Ul Pipette, Sterile, Low Retention Aerosol Barrier Tips, Racked Filter Tip In Box Format, 20 Ul - 200 Ul Universal Graduation, Dnaase/ Rnaase Free (10 Packs) , Filter Tips For 10-100 Ul Pipette, Sterile, Low Retention Aerosol Barrier Tips, Racked Filter Tip In Box Format, 10 Ul - 100 Ul Universal Graduation, Dnaase/ Rnaase Free (10 Packs) , Filter Tips For 100 Ul To 1000 Ul Pipette, Sterile, Low Retention Aerosol Barrier Tips, Racked Filter Tip In Box Format, 100 Ul - 1000 Ul Universal Graduation, Dnaase/ Rnaase Free (10 Packs) , Optical Clear 8-Pcr Tube Strip With Attached Optical Clear Caps, 0.2 Ml, Compatible With Quant Studio 5. (05 Packs) , Optical Clear 8-Pcr Tube Strip With Attached Optical Clear Caps, 0.1 Ml, Compatible With Qiagen Rotor Gen Q. (05 Packs) , Cryogenic Vials, 1.8 Ml, Sterile, Internal Thread (10 Packs) , Cryobox, 100 Places, Polypropylene, For Storage Of Samples At Minus 80 Degree C / Minus 20 Degree C (10 Packs) , Molecular Grade Alcohol (500 Ml) (10 Bottles) , Molecular Grade Water (100 Ml) (05 Bottles) , Powder Free Nitrile Gloves, Large Size,Iso 9001Certified & Fda Approved,Ce Marked- En455 & Aql 1.5, Should Provide High Degree Of Puncture And Chemical Resistance (10 Packs) , Autoclavable Biohazard Bag, Medium Size, Dimension 356 X 483, Autoclavable At 121 Degree C, Should Be In 2 Thickness Of Polypropylene, Printed With Biohazard Warning Symbol, Should Fulfill M.P Pollution Control Board Norms (500) , Autoclavable Biohazard Bag, Large Size, Dimension 483 X 584, Autoclavable At 121 Degree C, Should Be In 2 Thickness Of Polypropylene, Printed With Biohazard Warning Symbol, Should Fulfill M.P Pollution Control Board Norms (500) , Autoclave Tape, 18Mm Width, To Be Used In High Vacuum, High Temperature Steam Autoclaves And Other High Temperature Sterilisation Sysytem, Colour Change From White To Visible Brown/ Black Should Take Place On Complete Sterilisation Through Moist Heat (2 Packs) , Self Adhesive Lables (500) , Parafilm(1 Packs) , Rnase/ Dnase Away Solution, For Complete Removal Of Rnase/ Dnase Contamination From Work Surfaces, Pipettes And Equipments, Should Be Stable At Room Temperature (1 Bottles (500Ml)) , Pipette Stand For Holding Atleast 4 Pipettes (1) , Crp Kits (25 Test Kit Each Box) , Pregnancy Test Hcg Card Test(50 Test) , Vdrl Latex Test/Rpr (25 Test Kit Each Box) , Hbsag Card Test (10 Test Kit Each Box) , Rapid Test Kit For Anti Hcv Ab (25 Test Kit Each Box) , Ra Factor Test(100 Test Each Vial) , Widal Test (100 Test Kit) , Aso Titre Test(500 Test) , Mountx Test ( Itu/Ppd) (100 Test Each Vial (05Ml)) , Dengue Rapid Kit For Ns1 Antigen & Igg /Igm Antibody (25 Test Kit) , Chikungunyarapid Kitigm Antibody (25 Test Kit) , Drinking Water Testing Kit(12 Parameters) (200 Kits) , Leptospira Igm Elisa Kit (1 Kits (96 Test)) , Measles Igm Elisa Kit (1 Kits (96 Test)) , Bacterial Meningitis (Rapid Latex Agglutination Test Kit) (1 Kits (96 Test)) , Hbsag (Antigen)Elisa Kit (1 Kits (96 Test)) , Hbeag (Antigen)Elisa Kit (1 Kits (96 Test)) , Anti Hbeag Abelisa Kit (1 Kits (96 Test)) , Anti Hbc Igm Abelisa Kit (1 Kits (96 Test)) , Anti Hbs Abelisa Kit (1 Kits (96 Test)) , Anti Hbc Ab (Total) Elisa Kit (1 Kits (96 Test)) , Anti Hav (Hepatitis A Virus) Igm Elisa Kit (1 Kits (96 Test)) , Anti Hev (Hepatitis E Virus)Igm Elisa Kit (1 Kits (96 Test)) , Scrub Typhus Rapid Card Test Kit (100 Test Kit) , Hepatitis B Virus Quantitative Pcr Kit(100 Test Each Kit) , Hepatitis C Virus Quantitative Pcr Kit(100 Test Each Kit) , Nucleic Acid Extraction Kit From Blood/Plasma/Serum/Body Fluids(100 Test Each Kit) , Nucleic Acid Extraction Kit From Swabs In Viral Transport Medium(100 Test Each Kit) , Tuberculin Ppd Ip 1Tu/0.1Ml (05 Ml Each Vail) , Mvr Blade (20G) , Needle 30 G 1/2 Inch , Glucose Kit God Pod(125 Ml) , Urea Berthelots Method(R1 + R2 500 Ml) , Creatinine Kit, Jaffes Method(125 Ml) , Total Protein Kit Biuret Method(125 Ml) , Albumin Kit Bcg Method(125 Ml) , S- Total Cholesterol Kit(125 Ml) , S- Triglyceride Kit(125 Ml) , Ammonium Sulphate Crystal(500 Gms) , Liquor Ammonia(500 Gms) , Benzidine Powder(25 Gms) , Sodium Nitroprusside Cystal(100 Gms) , Acetic Acid (Glacial)(2.5 Ltr) , Sulphur Powder(250 Gms) , Hydrogen Per Oxide Soln-(500 Ml) , D- Glucose Powder(500 Gms) , Acetone Soln-(500 Ml) , Bile Salt Powder(500 Gms) , Cupric Sulphate Powder(500 Gms) , Tri-Sodium Citrate Powder(500 Gms) , Sodium Hydrogen Carbonate(500 Gms) , Litmus Paper(Blue & Red)(100 Leavs) , Filter Paper(100 X 01) , Naoh Solution (0.1 N)(500 Ml) , Bromine Water(500 Ml) , Barium Chloride (10%)(500 Ml) , Conc. Nitric Acid(500 Ml) , Ammonium Hydroxide Crystal(500 Gms) , Ammonium Hepta(500 Gms) , Molybdate Tetrahydrate(500 Gms) , Phenopthalein Soln. 0.1%(500 Ml) , Picric Acid Powder(500 Gms) , Sodium Carbonate 20%(500 Gms) , Bendicits Uric Acid(500 Ml) , Ammonium Oxalate Crystal(500 Gms) , Silver Nitrate (500 Gms) , Test Tube (10 X 100 Mm) , Test Tube (8 X 75 Mm) , Beaker (Small ) , Beaker (Big) , Urine Jar(Glass (250 Ml)) , Dropping Bottle(Glass (100 Ml) ) , Reagent Bottle(Glass (200 Ml)) , Glass Rod , Glass Pipette(1 Ml/2Ml/5Ml/10 Ml) , Rubber Bulb(1 Ml/5Ml/10 Ml) , Test Tube Holder , Test Tube Stand(8 X75 & 10 X 100 Mm) , Micro Pipette (Fixed- 10 Micro Litre ) , Micro Pipette (Variable 5-50 Micro Litre) , Micro Pipette (Variable 200-1000 Micro Litre) , Plastic Dropper(5 Ml) , Porcelain Cup , Measuring Cylinder(100 Ml) , Measuring Cylinder(500 Ml) , Measuring Cylinder(1000 Ml) , Conical Flask(200 Ml ) , Cuvette (1 Cm Diameter ) , Urinometer (Calib Temp. 20 ?C) , Pipette Stand(Plastic ) , Spatula (Big ) , Spatula (Small) , Stock Bottle(1 Litre Capacity) , Burner Stand(Metallic) , Tray(Metallic) , Test Tube Brush , Match Box Big Size , Candlebig Size(Big) , Cellulose Acetate Strips 100 Nos. , Tris Na2 200 Ml,Edta 200 Ml,Boric Acid 200 Ml (For Buffer Preparation) , Ponceau S Stain 200 Ml, Trichloroacetic Acid (Tca) 200 Ml, (For Staining) , Whatman Filter Paper No 1 (Sheets) , Amino Acid Mixture (Any 4 Available)/ Or Individual Amino Acid Pack 1 Each Of Any 4 , Butanol 200 Ml , Ninhydrin Dye Spray 200 Ml , Glacial Acetic Acid ( For Destaining ) 1000 Ml , Postmartam Gloves Size (Pair) 10 No , Postmartam Gloves Size (Pair) 9 No , Postmartam Gloves Size (Pair) 8.5 No , Postmartam Gloves Size (Pair) 8 No , Postmartam Gloves Size (Pair) 7.5 No , Postmartam Gloves Size (Pair) 7 No , Postmartam Gloves Size (Pair) 6.5 No , Postmartam Gloves Size (Pair) 6 No , Clonical Flask (100Ml) , Reagent Bottel (150Ml) , Hb Tube , Hb Pipette , Chalk Mitti Per Kg , Ncl Gel , Aerb Cerrtified Lead Apron , Aerb Cerrtified Lead Head Cap , Aerb Certified Thyroid Collar , General Items , Kaali Mitti (1 Haiva 600 Square Feet) , Pili Mitti (1 Haiva 600 Square Feet) , Gobar Khad (1 Haiva 600 Square Feet) , Stationary , Ruled Register 400 Pagesize21cm (Width) X 34Cm (Length) Fair Quality (A Grade Paper) (65-70 Gsm) , Ruledregister 200 Pagesize21cm (Width) X 34Cm (Length) Fair Quality (A Grade Paper) (65-70 Gsm) , Ruledregister 300 Pagesize21cm (Width) X 34Cm (Length) Fair Quality (A Grade Paper) (65-70 Gsm) , Ruledregister 500 Pagesize21cm (Width) X 34Cm (Length) Fair Quality (A Grade Paper) (65-70 Gsm) , Ruledregister 600 Pagesize21cm (Width) X 34Cm (Length) Fair Quality (A Grade Paper) (65-70 Gsm) , Ruledregister 100 Pagesize21cm (Width) X 34Cm (Length) Fair Quality (A Grade Paper) (65-70 Gsm) , Ruledregister 800 Page Size21cm (Width) X 34Cm (Length)Fair Quality (A Grade Paper) (65-70 Gsm) , Attendance Register 200 Page (Student) Fair Quality (A Grade Paper) Size20cm (Width) X 32Cm(Length) (65-70 Gsm) , Attendance Register 200 Page (Staff) Size20cm (Width) X 32Cm(Length) (65-70 Gsm) , Exam Copy Main (24 Page)70 Gsm Fair Quality Paper , Exam Copy Supplementary (12 Page) 70 Gsm Fair Quality Paper , File Cover (Office Tag File) Filemate, Veer, Cobra (400-500 Gsm) Size 14X10 Inch, (Llet On Left Top Corner) , File Cover With Clamp (Cobra File ) Filemate, Veer, Cobra (400-500 Gsm) Size 14X10 Inch, With Spring Patti Clip For Paper Holder , Index File (Liver Arch File) Veer, Ace, Cobra, Neel , File Pad Veer/Jumbu Deep , Button Type Transparent A4 Size File Folder , Dak Book , A4 Size Paper 75 Gsm 500 Pages Rim , A4 Size Mint Color Paper 85 Gsm 500 Pages Rim (Ledger Paper) , A4 Size Florid Pink Color Paper 80 Gsm 500 Pages Rim , A3 Size Paper 75 Gsm 500 Pages Rim , Paper Fs Size/ Legal Size 75 Gsm 500 Pages Rim , Chalk White (Dustless) , Calculator Orpat Ot-400Gt,Citizin-Ct512, , Scissor Big Size , Ink Blue Color Forstamp Pad (25Ml) , Stapler Hp-45(24/6) Big Size Kangaroo Hp-45, , Stepler Pin 24/6 Kores,Kangaro , Paper Pin , Pocker , Carbon Paper (100 Pcs/ Pkt) Kores/Camlin Or Equivalent Brand , Whitener 9Ml Size Infinity,Camlin, Reynolds , Permanent Marker (Black Color) Xl Sizecamlin/ Cello/ Luxar , Paper Weight For Office Desk , Sealing Wax , Lock 7 Lever (Godrej Nav-Tal, Link Hi-Tech) , Punching Machinebig Sizekangaroo Dp-600, , Fevicol (100 Gm Per Pack) , Gum Bottle Small (150 Ml) Camlin/Mohni, , Whiteboard Duster , Stamp Pad (Big Size ) , Basta Cloth 36 X 36 Inch Each , Basta Cloth 44 X 44 Inch, Each , Led Bulb (15 Watt) Surya, Eveready, Syska, Crompton, Orient, Anchor , Led Bulb (12 Watt) Surya, Eveready, Syska, Crompton, Orient,Anchor , Led Tube Light Complete Set Surya, Eveready, Syska, Crompton, Orient,Anchor , Phenyl (05 Ltr Per Pack, White Color) Lizol, Gainda White, Presto, Rinsl , Mug Big Size(1 Liter) , Date Broom( , Coconut Broom , Naphthalene Balls (10No Per Packet) , Soap (125 Gm) 1 Pic Dettol, Lifebuoy, Savlon , Washing Powder (01 Kg Pkt Each) Ghadi, Nirma, Tan-Man Or Equivalent , Dustbin Large (50 Ltr) Cello, Nilkamal, Aristo , Dustbin Small Size (10 Ltr) Cello, Nilkamal, Aristo , Plastic Bucket (20 Ltr) Ello, Nilkamal, Aristo , Toilet Brush , Wiper With Stick(Big Size 40 Cm Blade Width And 3.5 Feet Stick Size) (Big Size 40 Cm Blade Width And 3.5 Feet Stick Size) , Floor Cleaning Clip Mop With Stick(Clip Mop With Size 8-9 Inch Wide And Stick Size Upto 3.5 Feet) (Clip Mop -Size 8-9 Inch Wide) , Garbage Bag For 50/60 Ltr. Dustbin Pack Of 20 Pcs , Garbage Bag For 10 Ltr. Dustbin Pack Of 30 Pcs , Envelopesize 9 Inch X 4Inch (Window Envelope) White Color 100 Gsm Fairquality , Envelopesize 11Inch X 5Inch (Window Envelope) White Color 100 Gsm Fairquality , Envelopebig Size 14 Inch X 10 Inchlaminated Yellow Color 100 Gsm Fairquality , Envelope Big Size 16 Inch X 12 Inchlaminated Yellowcolor 100 Gsm Fair Quality , Pen (Blue Color) Easy Click , Pen (Black Color) Easy Click , Pen (Red Color) Easy Click , Permanent Marker (Black Color) Cello, Camlin , Pencil(10 Pic Per Packet) Natraj/Apsara/Doms , Scale (12 Inch Size) Plastic Trasnparent Natraj/Apsara/Doms , Hand Wash200 Ml Detol/Savlon/Lifeboy , Pin Cusion Plastic With Top Magnet , Rubber (10 Pic Pkt) Natraj/Doms/Apsara , Sharpner (10 Pic Pkt) Natraj/Doms/Apsara , Cover Roll Brown Color (Plastic) , Cello Tape (1 Inch) Transparent , Cello Tape Machine Dispenser(1 Inch) , Thread For Supplementary Sheet , Thumb Pin , Pin Removerkangaroo Sr - 100 , White Board Markerfor Writing Blue Camlin/Cello/Luxor , White Board Markerfor Writing Black Camlin/Cello/Luxor , Manila Envelop (Internal Lamineted) Buff Color, A3 Size , Manila Envelop (Internal Lamineted) Buff Color, A4 Size , Manila Envelop (Internal Lamineted) Buff Color, 11 X 5 Size , Manila Envelop (Internal Lamineted) Buff Color, 9 X 4 Size , Form 2/4, (A4 Size Yellow Color 100 Pages 75 Gsm With Hard Cover And Binding) , Button Type Transparent A4 Size File Folder (Plastic) , Water Sponge Damper , Indent Book (8 X 13, 100 X 3 Copy With Numbering Per Book With Binding) 75Gsm , Indent Voucher Book ( 9 X 11,100 X 3 Copy With Numbering Per Book With Binding) 75Gsm , A4 Size One Side Printing/White Paper 75Gsm , A4 Size Double Side Printing/White Paper 75Gsm , Fs Size One Side Printing/White Paper 75Gsm , Fs Size Double Side Printing/White Paper 75Gsm , Form A3 Printed One Side , Form A3 Printed Both Side , 8 X 13 White Paper Register 300 Pages With Custome Print & Binding 75Gsm , 8 X 13 Ledger Paper Register 300 Pages With Custome Print & Binding 75Gsm , Discharge Ticket -16.5 X 11, 300 Gsm Card Sheet -One Sided Printed , Discharge Ticket -A4 Size, 300 Gsm Card Sheet -Double Sided Printed , 8.5 X 13.5 (Ledger Paper With Printing & Numbering 8 Quire Register) 75Gsm , 8.5 X 13.5 (Ledger Paper With Printing & Numbering 10 Quire Register) 75Gsm , 8.5 X 13.5 (Ledger Paper With Printing & Numbering 300 Pages) 75Gsm , Cancer Registration File (A3 Size 75Gsm 4 Pages Printed Both Side With Center Stapler Binding) , Registration Card 4.75 X 3.5 White Color Card Sheet 300 Gsm , Radio Therapay Ticket 4.75 X 7 Yellow Card Sheet 300 Gsm Both Side Printed , A4 Form Printing In Pink/Yellow Paper75gsm , Sticker Colored Printed 35 X 3.75 75Gsm , Book 9 X 11 (2 Color White + Pink Numbering On Each Page 75Gsm) , 16 X 13 White Rulled Register 200 Pages 75Gsm , 17 X 13.5 Ledger Paper 300 Paper With Printing 75Gsm , 8.5 X 13.5 White Paper 200 Pages 75Gsm , 8 X 13 White Paper 400 Pages Printed 75Gsm , 8.5 X 13.5 White Paper 400 Pages Printed 75Gsm , 16 X 13 White Rulled Register 400 Pages 75Gsm , Cobra File Custome Printed , 10 X 15 Ledger Paper Register 75 Gsm 200 Pages , 10 X 15 Ledger Paper Register 75 Gsm 400 Pages , 10 X 15 White Paper Register 75 Gsm 400 Pages , 10 X 15 White Paper Register 75 Gsm 200 Pages , 8.5 X 13.5 Rulled Regster 75 Gsm 2 Q , 11 X14card Sheet Both Side Printed , A3 Size Printed Both Side Card Sheet White Paper 150-200 Gsm , 9 X 11 Yellow Paper Printed One Side 75 Gsm , A3 Size Printed Both Side4 Color Paper 75 Gsm , A4 Size Printed Both Side4 Color Paper 75 Gsm , Furniture , Classroom Chair (Backrest - Pu Foam With Fabric,Armrest Design - U Shape,Arms-Pvc ,Seat- Pu Foam With Fabric,Frame Material -Cantilever With Stainless Steel 304 Grade Material,Section Size (Diameter/Sides) Of Understructure -25 Mm,Under Structure Wall Thickness (Mm) -2 Mm,Minimum Thickness (In Mm) Of Ms Plate Joining The Understructure With Seat-2 Mm,Seat Size - 510X510,Density Of Pu Used In Seat (Kg Per Cubic Meter ->40<=50,Understructure Finish-Na Due To Stainless Steel 304,Weight-Bearing Capacity- Up To 150 Kg,Writing Pad Material- Hdhmr ,Writing Pad Size- 300X600,Writing Pad Size Mechnism - Open From One Size And Slide Adjacently To Other Side,Warranty -Minimum 1 Year ) , Visitor Chair Mid Back Cantilever (Backrest - Polypropylene Back With Black Mesh Fabric,Armrest Design -Armrest Type Moulded Down Uarmrest Fitted With Seat Bottom,Arms- Polypropylene Arm With Decorative Silver Profile,Seat-High Density Moulded Plywood Of 12 Mm Thickness Upholstered With 50 Mm Thick Foam And Black Crape Fabric, Frame Material -Cantilever With Stainless Steel 304 Grade Material, Section Size (Diameter/Sides) Of Understructure - 25 Mm,Under Structure Wall Thickness (Mm) -2 Mm,Minimum Thickness (In Mm) Of Ms Plate Joining The Understructure With Seat- 2 Mm,Chair Dimensions-62(D)X60(W)X91(H) Cm ,Density Of Pu Used In Seat (Kg Per Cubic Meter - >40<=50,Understructure Finish- Na Due To Stainless Steel 304,Seat Material -Pu Foam, Warranty -Minimum 1 Year) , Visitor Chair 4 Legs (Pvc Upholstered Seat And Back -Pu Foam, Frame Material - Ss 304,Chrome Plated Mild Steel Frame With A Substantial Thickness- 1.1 Mm,Weight-Bearing Capacity Up To 150 Kg, Armest Type- Fixed Polypropylene Armrests For Convenient Arm Support, Dimensions , Width (Cm) 52,Depth (Cm)60,Height (Cm) 87, Warranty -Minimum 1 Year) , Revolving Chair High Back (Tilt Mechanism -Revolving Without Tilting Mechanism, Revolving Mechanism - Designed With 360 Degree-Revolving, Seat Depth Adjustment -Fixed Type ,Seat And Back Stitching –Doble Niddle,Seat Material - Pu Foam ,Seat Upholstery Material - Leather,Backrest Base Frame Material - Hot Pressed Plywood Of 15 Mm,Width Of Backrest (Mm)- 500, Backrest Height From The Seat Level - 550,Backrest Upholstery Material- Leather,Handle-Ms Cusioned Fix/ Adjustable,Pedestal Base Erw With Crome Plated - 26 Inch ,Minimum Thickness (In Mm) Of Ms Plate Joining The Backrest With Seat Of The Chair- 8 Millimeter,Density Of Pu Used In Seat (Kg Per Cubic Meter) - 40,Thickness Of Pu Used In Seat (Mm) - 40,Minimum Seat Height From Floor Surface (Mm) - >550,Width Of Seat (Mm) - 550,Depth Of Seat (Mm)- 550, Backrest Height -720, Warranty -Minimum 1 Year) , Revolving Chair Mid Back (Tilt Mechanism -Revolving Without Tilting Mechanism,Revolving Mechanism - Designed With 360 Degree-Revolving,Seat Depth Adjustment - Fixed Type,Seat And Back Stitching –Doble Niddle,Seat Material - Pu Foam ,Seat Upholstery Material - Leather,Backrest Base Frame Material - Hot Pressed Plywood Of 15 Mm,Width Of Backrest (Mm) - 500,Backrest Height From The Seat Level - 550,Backrest Upholstery Material - Leather ,Handle- Ms Cusioned Fix/ Adjustable ,Pedestal Base Erw With Crome Plated - 26 Inch,Minimum Thickness (In Mm) Of Ms Plate Joining The Backrest With Seat Of The Chair - 8 Millimeter ,Density Of Pu Used In Seat (Kg Per Cubic Meter)-40,Thickness Of Pu Used In Seat (Mm) - 40,Minimum Seat Height From Floor Surface (Mm) - >550,Width Of Seat (Mm) - 550,Depth Of Seat (Mm)- 550, Backrest Height (Mm)- 575, Warranty -Minimum 1 Year) , Revolving Chair Low Back (Tilt Mechanism - Revolving With Tilting Mechanism,Revolving Mechanism- Designed With 360 Degree-Revolving,Seat Depth Adjustment - Fixed Type,Seat And Back Stitching –Double Niddle,Seat Material - Pu Foam With Fabric,Seat Upholstery Material - Fabric,Backrest Base Frame Material - Pvc Supporting With Mesh Fabric,Width Of Backrest (Mm)- 470,Backrest Height From The Seat Level - 470,Backrest Upholstery Material - Mesh Fabric,Handle- ?Polyurethane,Pedestal Base Erw With Crome Plated - Injection Molded Plastic,Minimum Thickness (In Mm) Of Ms Plate Joining The Backrest With Seat Of The Chair - 8 Millimeter ,Density Of Pu Used In Seat (Kg Per Cubic Meter) - 40,Thickness Of Pu Used In Seat (Mm) - 40,Minimum Seat Height From Floor Surface (Mm) - >470,Maximum Height From Floor Surface (Mm) - >880,Width Of Seat (Mm) - 470,Depth Of Seat (Mm)- 470,Backrest Height (Mm)- 470, Warranty -Minimum 1 Year) , Executive Revolving Chair (Chair Type - Seat Upholstery Material,Leatherette With Spacer Fabric , Tilt Mechanism-Any Position Synchronic Tilt Mechanism ,Back Locking Mechanism - 3 Position Locking ,Seat Depth Adjustment - Adjustable ,Revolving Mechanism- Designed With 360 Degree-Revolving Type,Gas Lift- Class 3 ( Chrome Plated),Wheel Size- 60 Mm,Pedestal Base - Stainless Steel,Size Of Base - 650Mm,Minimum Thickness (In Mm) Of Ms Plate Joining The Backrest With Seat Of The Chair - 1 Millimeter ,Seat Material - Mesh ,Density Of Pu Used In Seat (Kg Per Cubic Meter) - >40<=50 ,Thickness Of Pu Used In Seat (Mm) - >40<=50 ,Minimum Seat Height From Floor Surface (Mm) ->400<=500 ,Width Of Seat (Mm) - >450<=500 ,Depth Of Seat (Mm)- >450<=500 ,Backrest Type - Flexi Back ,Backrest- Made Of Mesh In 3 Parts For Flexibility ,Backrest Support Type -Fixed Lumber Support ,Backrest Base Frame Material - Injection Moulded Plastic ,Thickness Of Pu Used In Backrest (Mm)- Na ,Width Of Backrest (Mm) - 500Backrest Height From The Seat Level - 550 Backrest Upholstery Material -Leatherette - , Warranty Period In Number Of Years - 1 Year) , Almirah Steel (Technical Specification Of Almirah Steel Generally Conforming To Bis Specification Is: 3312:2021 (With Latest Amendment) - Yes,Type Of Almirah Steel- Almirah Steel Shelving Cabinets,Number Of Door -2,Number Of Shelves4,Steel Sheet Material Crca Sheets Conforming To Grade Cri Of Is 513(Part-1):2016 (With Latest Amendment) - Yes,Almirah Height(Excluding The Height Of Pedestal) ± 5 Mm - 1980 Mm ,Almirah Width ± 5 Mm - 920 Mm ,Almirah Depth ± 5 Mm - 480 Mm ,Side Sheet Thickness- 0.8 Mm ,Back Sheet Thickness - 0.8 Mm ,Top Sheet Thickness - 0.8 Mm, Bottom Sheet Thickness - 0.8 Mm ,Shelves Sheet Thickness - 0.8 Mm ,Thickness Of Door- 1 Mm ,Shelves Supporting Bracket Thickness - 1.6 Mm ,Hinges Sheet Thickness- 1.6 Mm,Width Of Stiffener - 115 Mm ,Stiffener Sheet Thickness - 0.6 Mm ,Handle Size- 12 Cm,Steel Almirah Lock/Locker Lock - Six Lever Lock ,Material Of Lock Finish Having Brass Levers And Mazak/Zamak Bolt Having Zinc Plated Finish Along With Mazak/Zamak - Yes,Powder Coating Conforming To Is: 13871 -60 Micron Powder Coating With 7 Tank Anti Corrosion Process ,7 Tank Pre-Treatment Process - The 4 Stage Pre-Treatment Process For Proper Zinc Depositon To Prevent Rusting,Powder Caoted - Yes, With 50 Micron Minimum Coating ,Locking Mechanish - 3 Way 6 Lever Lock ,Handle - 12 Cm Nickle-Chrome Plated Cast Iron ,Steel Sheet Material - Crca Sheets Conforming To Grade Cri Of Is 513 ,Width Of Stiffner - 115 Mm ,Cutting - The Cutting Is Done Using Cnc Laser Machine. No Burrs Visible In Cut Sheet ,Bending - Bending Is Done Properly Using A Cnc Bending Machine Or Panel Bender ,Construction - Multibend Construction With Proper Welding ,Finishing - The Almirah Is Given Proper Finishing Before Powder Coating Using Thermal Putty. There Are No Visible Dent On The Surface ,Color - The Powder Coating Is Perfect Without Pinholes. The Paint Finish Is Gloss, Warranty -Minimum 1 Year) , 3 Seater Stainless Steel Bench (Governing Specification- 3 Seater Stainless Steel Benches,Seating Capacity- 3 Seater,Weight Of The Bench In Kg- 36-38 Kg (Approx),Punching / Perforation In Seating Plate And Backrest- Square Shape 1Cm X 1Cm Having Perforation 49-49 [Seat And Back],Material For Bench- Stainless Steel 304 Grade,Thickness Of Stainless Steel Sheet / Plate- 1.5 Mm (16 Gauge),Round Pipe Size- 2 (50Mm With 2 Mm Thick),Square Pipe Size- 50Mm X 50Mm X 2 Mm Thick,Base Plate Thickness- 1.5Mm (16 Gauge),Length Of Bench- 60 (1765Mm),Length Of Backrest- 60 (1765Mm),Height Of Seat From The Floor- 16 (406 Mm),Seat And Backrest Connection- With Profile 1.5Mm Thick (16 Guage),Seat Width- 16 (400Mm),Depth Of Bench- 28 (710),Clear Height Of Bench- 30 (775Mm),Base Pipe Size (To Be Fixed Ground)- 2 X 2 X 19.5 With Suitable Fixing Arrangement,Separation Of Seating Space- With Capsule Pipe Of 33Mm X 15Mm Outer Circumference Of Hand Rest 24,Warranty Period- 5 Year,Confirmatory Test In Respect Of Stainless Steel- Grade 304,Finishing/Polishing Of Product- Uniform Smooth Satin Finish, Warranty -Minimum 1 Year) , Computer Table Type Of Computer Table (Computer Cum Printer Table With Key Board Pullout Tray And Table Top,Construction Of Computer/Printer Table- Gable End And Modesty Panel,Colour Of Top- Teak,Material Of Table Top,Keyboard And Drawer- Mdf Board Of Grade Sbg Ii Of Is 12406/Latest,Gable End And Modesty Panel Material- Flat Single Layer Prelaminated Mdf Board Conforming To Having Designation Plmdf-23 Of Is 14587/Latest,Leg Material- No Legs,Table Top Thickness ±2Mm- 25 Millimeter,Thickness Of Gable End And Modesty Panel ±2Mm- 19,Dimension Of Leg(Mmxmm) ±5Mm- No Legs,Length Of Table In Mm (±15 Mm)- 1220 Millimeter,Depth Of Table In Mm (±10Mm)- 610 Millimeter,Height Of Table In Mm (±10Mm)- 760 Millimeter,Type Of Keyboard Tray- Mdf Board Keyboard Tray,Material Of Footrest- Flat Single Layer Prelaminated Mdf Board Conforming To Having Designation Plmdf-22 Of Is 14587/Latest,Material Thickness Of Footrest ±2Mm- 19Mm, Warranty -Minimum 1 Year) , 5X3 Table With Both Side Storage (,No. Of Storage- 2,No. Of Storage With 3 Drawers- 1,No. Of Storage With Cabinet- 1,Top- 18 Mm Thick Prelaminated Particleboard,Pipe Structure- 25Mmx25mm 1.2 Mm Thick Crca Pipes,Modesty Panel- .8 Mm Thick Cr Sheet,Storage Unit Sheet- .8 Mm Thick,Telescopic Channels- Provided For Smooth Movement Of Drawer,Powder Caoted- 60 Micron Powder Coating With 7 Tank Anti Corrosion Process,Locking Mechanish- 10 Lever Centralized Lock,Steel Sheet Material- Crca Sheets Conforming To Grade Cri Ofis 513,Cutting- The Cutting Is Done Using Cnc Lasermachine. No Burrs Visible In Cut Sheet,Bending- Bending Is Done Properly Using A Cncbending Machine Or Panel Bender,Construction- Multiband Construction With Properwelding,Finishing- The Amirah Is Given Proper Finishing Before Powder Coating Using Thermal Putty. There Are No Visible Dent On The Surface,Color- The Powder Coating Is Perfect Withoutpinholes. The Paint Finish Is Gloss, Warranty -Minimum 1 Year) , 4 X2.5 Table With Single Side Storage (No. Of Storage- ,No. Of Storage With 3 Drawers- 1,No. Of Storage With Cabinet- 1,Top- 18 Mm Thick Prelaminated Particleboard,Pipe Structure- 25Mmx25mm 1.2 Mm Thick Crca Pipes,Modesty Panel- .8 Mm Thick Cr Sheet,Storage Unit Sheet- .8 Mm Thick,Telescopic Channels- Provided For Smooth Movement Of Drawer,Powder Caoted- 60 Micron Powder Coating With 7 Tank Anti Corrosion Process,Locking Mechanish- 10 Lever Centralized Lock,Steel Sheet Material- Crca Sheets Conforming To Grade Cri Ofis 513,Cutting- The Cutting Is Done Using Cnc Lasermachine. No Burrs Visible In Cut Sheet,Bending- Bending Is Done Properly Using A Cncbending Machine Or Panel Bender,Construction- Multiband Construction With Properwelding,Finishing- The Amirah Is Given Proper Finishing Before Powder Coating Using Thermal Putty. There Are No Visible Dent On The Surface,Color- The Powder Coating Is Perfect Withoutpinholes. The Paint Finish Is Gloss, Warranty -Minimum 1 Year) , Single Hostel Bed (Overall Dimensions- 1830Mmlx900mmwx450mmh,Thickness Of Pipes- 1.2 Mm,Storage Space In Bed- Without,Head Panel Material- Metal Steel Square Pipe Of 50X50 Mm,Frame Structure Of Bed- Metal Steel Rectangular Pipe Of 50X25 Mm,Powder Coated- 60 Micron Powder Coating,Color- The Powder Coating Is Perfect Without Pinholes. The Paint Finish Isgloss, Warranty -Minimum 1 Year) , Stool With Backrest (Adjustable Height- Yes,Normal Height (Mm)- 400,Min. Height (Mm)- 350,Max. Height (Mm)- 800,Stool Top Base Thickness (Mm)- 2.2,Cushioning In The Stool Top- With Cushion,No Of Legs In The Under Structure- 4,Foot Rest- Without,Material Of Top- Stainless Steel,Painting- Powder Coating,Type Of Stool- Revolving,Back Rest- With,Material Of Back Rest- Mild Steel,Material Of Cushion- Pu Foam,Cushioning In The Stool Top- With Cushion,Finish- 50 Micron Power Coated ,Design Of Back Rest- Rectangular,Back Rest Support Frame Material- Mild Steel,No Of Legs In The Under Structure- 4,Shape Of Stool Top- Round,Material Of Top- Stainless Steel,Covering Material Of Cushion- Heavy Leatherite,Leg Shoe Material- Pvc/Rubber,Density Of Cushion (Kg/Cub Metre)- 41,Type Of Stool- Revolving,Material Of Under Structure- Mild Steelwarranty -Minimum 1 Year) , Office Equipment , Desktop Computer, Processor Make-Intel Processor Generation 11Thgen Or Higher,Number Of Cores Per Processor 4 Or Higher, Processor Description Intel Core I5 Or Higher,Motherboard ,Chipset Series Intel H/E/B/Q Series/Integrated Chip,Operating System(Factory Pre-Loaded) Windows 11 Professional Or Better,Recovery Image Media Online/Cloud/Cd,Os Certification Windows,Form Factor Tower,Type Of Ram -Ddr4,Ram Size(Gb) 8 Or More,Total Numbers Of Dimm Slots Available 2,Ram Expandability Upto (Using Spare Dimm Slots In Gb) Upto 32 Gb Or More (Using Spare Dimm Slots In Gb),Ssd 512 Gb ,Total Hdd Capacity(Gb) 1000 Gb Or More,Type Of Ethernet Ports 10/100/1000 On Board Integrated Gigabit Port,Wifi Connectivity Inbuilt Wifi Connectivity Should Be Available.,Usb At Least 3 Usb Port With At Least 1 Usb 3.0 Connectivity Should Be Present Along With One Usb C Type Connectivity (Optional).,Hdmi At Least 1 Hdmi Port Should Be Present.,Monitor Led Monitor Should Be Minimum 21.5 Inch Or Above.,Keyboard & Mouse Wired Keyboard & Mouse Should Be Supplied,On Site Oem Warranty- 3 Years ,Certifications Ce/Bis,In Tender Documents (Hp/Acer/Dell/Lenovo/Asus/Ibm/Hcl) , Laptop (I3, 8Gb,512 Ssd With License Windows 10/11)(Hp/Acer/Dell/Lenovo/Asus/Ibm/Hcl) , All In One Printer Printer Functions Print- Scan And Copy, Print Speed 28-32 Ppm ,Duplex Printing- Yes,Product Type Laser- Monochrome,Wireless Capacity- Yes,Paper Size A4, Letter, A5, A5 (Long Edge), A6, Executive, Legal,Memory Capacity-128 Mb,Paper Capacity Up To 250 Sheets Of 80 G/M2 Plain Paper,On Site Oem Warranty(Year) 1 Year Or Higher(Hp/Canon/Brother) , All In One Printer Printer Functions Print- Scan And Copy, Print Speed 33-40 Ppm ,Duplex Printing- Yes,Product Type Laser- Monochrome,Wireless Capacity- Yes,Paper Size A4, Letter, A5, A5 (Long Edge), A6, Executive, Legal,Memory Capacity-128 Mb,Paper Capacity Up To 250 Sheets Of 80 G/M2 Plain Paper,On Site Oem Warranty(Year) 1 Year Or Higher(Hp/Canon/Brother) , Single Function Laser Printer With 18 Ppm Or Higher (Hp/Canon/Brother) , Cat-6 Ethernet Cable Bundle Of 305 Meter Bundel (Digisol/D-Link/Havels/Finolex) (Stranded Bare Copper (7 X 23 Awg). 2. Insulation: Hdpe (Cmi-75E)Nominal Wall Thickness: 0.178Mm. Min. Thickness: 0.153Mm) , Long Range Ip Ptz Camera (Endless 360 Degrees Rotation And Variable Speed,750Mm Or 1000Mm With Auto Focus) , Single Finger Aadhaar Based Biometric Device With Registered Rd Services , Webcam With Mic 1080P , Usb Wifi Dongle , 55 Smartled Tv With Comercial Pannel (Branded) , 32 Smartled Tv With Comercial Pannel (Branded) , 1 Kva Ups Pure Sinewave With In-Built Batteries (Single Phase) , 3 Kva Ups Pure Sinewave With In-Built Batteries (Single Phase) , Inverter 5 Star Air Conditioner 1.5 Ton, Copper Coil, With Standard Installation Warrenty On Complete 1 Year & 5 Years On Compressor (Make- Lg/Samsung/ Voltas/ Llyod/ Daikin/ Mitsubishi/ Og Genral/ Vestar/Whirlpool/ Godrej/ Hitachi/ Carrier/ Blue Star Or Equivalent) , Inverter 5 Star Air Conditioner 2 Ton, Copper Coil, With Standard Installation Warrenty On Complete 1 Year & 5 Years On Compressor (Make- Lg/Samsung/ Voltas/ Llyod/ Daikin/ Mitsubishi/ Og Genral/ Vestar/Whirlpool/ Godrej/ Hitachi/ Carrier/ Blue Star Or Equivalent) , Aadhar Based Biometric Attendance Machine , Speaker System 10 W,100 V With Aplifier (Per Speaker) , Wireless Handheld Mic With Aplifier Per Mic , Water Cooler With Purifier (As Per Tender Documents) , Long Through Projector 4500 Lumens With Minimum 1 Year Warrranty Including 15 Meter Hdmi Cable , Power Cabel And Ceeling Instalation Kit , Brother Dcp L2605 Dw Toner (Tn 2570 Xl) , Brother Dcp L2605 Dw Drum Unit , Xerox Original Toner Versalink B7125 , Hdmi Extendor Tx Cat 6 Full Hd 1080P 3D , 12 V 2 A Dc Power Supply Adapter , 5 V 1 A Dc Power Supply Adapter , Canon Lbp 2900B Paper Picup Roller , Canon Lbp 2900B Power Supply Board , Canon Lbp 2900B Logic Board , Canon Lbp 2900B Pickup Assembly , Brother B7535dw Toner , Brother B7535dw Drum Unit , Hp Mp 203 An Toner (30A) , Hp 154 A Toner (153A) , Hp M104a Toner (104A) , Hdmi Cable 25 Mtr , Power Cable 25 Mtr , 8 Port Gigabyte Switch , 16 Port Gigabyte Switch , 24 Port Gigabyte Switch , 48 Port Gigabyte Switch , Double Antena Router 300 Mtr Range , Reffling & Repairing Of Toner Cartridge Including Podwer And All Parts Required, As And When Required On Site For 12A/925A/88A/110A , Reffling & Repairing Of Toner Cartridge Including Podwer And All Parts Required, As And When Required On Site For Brother Toner Or Equivalent , Office Equipment , Oxygen Sensor Oom202 (Compatible With Cv-200 & Dhaman Iii Ventilators) , Dsposable Flow Sensor (Compatible With Cv-200 & Dhaman Iii Ventilators) , Diagphram (Compatible With Cv-200 & Dhaman Iii Ventilators) , Battery (Compatible With Cv-200 & Dhaman Iii Ventilators)
Contract Date: Jun 06, 2025 Contract Value : Ref. Document
Government Departments No of Bidders 17
Madhya Pradesh View Result →
16.
Health and Family Welfare #7423822 AOC
RE E-TENDER FOR PROCUREMENT OF DENTAL ITEMS USED IN DENTISTRY FOR TWO YEARS FROM THE DATE OF AWARD OF CONTRACT (AOC)-- 1 Adson Forceps, Toothed Specification: 1.5mm × 2.75mm 1×2 Teeth. 46mm Handle. Made of stainless steel 2 Adson’s forceps non toothed Specification: of length 12.5 cm Made of stainless steel 3 Babcock’s forcep Specification: finger ring, ratcheted, non-perforating forceps used to grasp delicate tissue Made of stainless steel 4 Binocular Compound Microscope Specification: Sharp Image Display with Excellent optical function, Small space occupancy with Integral Stand Design, Low Environment requirement with Anti-mould Technology. Comfortable operation with Ergonomic Design Principle Viewing Head: Compensation Free Binocular Head Inclined at 30° Interpupilary Distance 55-75mm Eyepiece: Wide Field Eyepiece WF10x/18mm with Eye Guard, Achromatic Objective 4x, 10x, 40x, 100x, Focussing Range: Co-axial Coarse and fine adjustment Range 13mm fine division 0.2mm with tension control. Nose Piece: Quadruple Nosepiece, Stage: Double Layer Mechanical Stage 140 x 140 mm/ 75 x 50 mm N.A1.25 Abbe Condenser with Iris Diaphragm. Focussing: Coaxial Coarse & Fine Adjustment System Range 24mm, Fine Division 2mm Illumination: LED Light with Brightness Adjustable. ISO 13485 OR EC Certificate/directive 93/42/EEC) 5 Blades for microtome (High profile) Specification: High Profile 818 Disposable Blades made of stainless steel with exceptional durability. Ultra fine yet durable, 80mm long x 14mm high x 0.35 mm thick suitable for use with microtomes and cryostat series as well as for common cryostat and microtome models Inventive blade coating process provides perceptibly improved results in section stretching and in the quality of sectioning ribbons in routine histology Standard packaging/physical verification of sample may be made 6 Bone rongeur side cutting Specification: Scissor-type handle, cutting edges on side and top of beaks 7 Castrovejo needle holder Specification: Castroviejo Microsurgical Needle Holder is a double spring instrument used for holding small, delicate needles in various microsurgical procedures. It also features a locking mechanism.Made of stainless steel, autoclavable 8 Debackey’s forceps Specification: Length 26 cm, tip width 1.5 mm Made of stainless steel 9 Dental drape kit- disposable Specification: Kit containing: a) 1 pc surgeons drape b) 1pc Disposable tray cover, c) 1pc Half gown for patient, 140x75 cm with tying tape 170 cm, round neck 13 cm c) 1pc head cap of adult size,50 gsm Made of SMS fabric EO sterilized, GMP certified 10 Dental Tweezer Specification: with horizontal serrations at tip, diamond knurling on the outside for good grip, Stainless steel alloy 11 Humby’s knife holder Specification: Made of stainless steel 12 Hydroxyapatite Crystals / Powder Specifications : Synthetic nanocrystalline hydroxyapatite bone graft, 100/200/300/400/500/600/700 microns particle size, Each unit packet contains 1 cc. Price being the same to be supplied as per requirement of the user Standard packaging/physical verification of sample may be made 13 Kocher’s forceps 14cm hemostatic forcep. Specification: It is specifically designed to catch the bleeder that are deep within tissue hence it is ideally used on tough structures Made of stainless steel 14 Langenback’s retractor Specification: Made of stainless steel 15 Lower molar Extraction forcep English pattern Specification: made of hard stainless steel with knurnled handle grip, disc /box type of hinge joint Set of one piece right & one piece lower molar forcep 16 Pediatric Extraction upper incisor & canine forcep Specification: made of hard stainless steel with knurnled handle grip,disc type of hinge joint, 4.5 inches of length 17 Pediatric Extraction upper molar forcep right & left Specification: made of hard stainless steel with knurnled handle grip,disc type of hinge joint, 4.5 inches of length 18 Penta Head microscope Specification: Total Magnification: Penta Head 1+4 , 40X – 1000X Viewing Head - Compensation free Trinocular Head inclined at 30° , 360° rotatable-IPD 48 -75mm Objective Lens: Infinite Plan Achromatic objectives 4X, 10X, 40X & 100X (oil) Eyepiece- 10X/22mm Nosepiece- Reversible Inward Quintuple Nosepiece Condenser- Swing out / dual type condenser, N.A.0.9/0.25 centre adjustable Focus- Co-axial coarse & fine focusing system 0.2 mm Stage- Double layer Mechanical Stage 185mm X 142mm, cross travel- 75mm X 55mm Illumination-LED pointer with brightness adjustment 24V/100W Warranty- 2 years 19 Slide storing cabinet Specification: Cabinet for 1050 slides consisting of 6 drawers each for 175 slides, arranged in single rowFramework made of 15mm plywood with top and sides covered with sunmica laminated sheet. 20 Slide warming table Specification: Top surface made of Stainless Steel (SS-304 grade) The surface temperature is controlled from ambient to 70°C Supplied complete with pilot lamp, cord and plug To work on 220/230 Volts A.C. Supply 21 Steel mallet Specification: for use in oral surgical work Made of stainless steel length 7.5”, head diameter 20-22mm 22 Steel slide racks for staining Specification: The 5-Slide Gripper can accommodate 5 microscope slides in one staining procedure.It fits most coplin and round-open staining jars It should be made of a special material which is resistant to all chemicals and solvents which are used in staining It withstands drying temperatures up to 80°C 23 Synthetic Nanocrystalline Beta Tricalcium Phosphate Bone Graft Specifications : 100/200/300/400/500microns particle size. Each unit packet contains 1cc Standard packaging/physical verification of sample may be made 24 Tissue capsules / Tissue embedding cassettes Specification: Made of acetyl polymer;Cassettes should keep specimen safely submerged in liquid, Efficient flow- through slots,Snap-latch and hinge-lock design prevent early separation of base and lid and allows for one hand operation. Large labeling area on two sides of cassette. Anterior writing area is at 35° angle. Pore size: 1mm square pores Outside dimensions: 28.5 x 41 x 6.7mm (1.12 x 1.61 x 0.26) Inside dimensions: 26 x 30 x 5mm (1.02 x 1.18 x 0.2) 25 Tissue floatation water bath Specification:(thermostatically controlled) Inner tank (Single piece) made of black anodized aluminum. Housing made of powder coated aluminum. Front panel consist of temperature regulator knob, mains switch and pilot lamp. Inside black and outer surface finished in powder paint, with wide enough rim for drying the wet slides. Bath size(inner)-225mm*70mm Temperature- controlled by capillary tube thermostat Temperature range- +5 degree c to 70 degree C 26 Upper premolar Extraction forcep English pattern Specification: made of hard stainless steel with knurnled handle grip, disc /box type of hinge joint 27 Important Note:1. All prospective bidders are requested to quote the rate in BOQ AS PER ACCOUNTING UNIT (AU) REPEAT AS PER ACCOUNTING UNIT (AU) & item specifications as mentioned in the Table-1. WRONG QUOTING OF THE RATE in BOQ will be dealt with as per penal provisions of the T&C of the Tender.2. Quality of the product supplied, may be ascertained by testing / physical examination by the experts at any stage of the tender period.3. The equipment should be US FDA/ CE/ BIS/ CDSCO approved (US FDA/ CE requirements will be applicable only when the Indian Standards like BIS/ CDSCO is not available).4. The prospective Bidders of the said Tender are requested to make a declaration in Affidavit under Annexure VI(b)in case of sole manufacturer/importer (i.e. proprietary in nature).5. If the Item(s) under sole manufacturer / importer is (are) Proprietary in nature, quarterly intimation is solicited from the approved Bidders positively regarding the status of their Item(s) Proprietary in nature, otherwise their Item(s) will be blocked in the SMIS.6. In case of Tie Bid, decision will be taken by the TIA as per G.O. No. 2320-F(Y), dated 07.06.2022 issued from Finance Department Audit Branch (Group T).
Contract Date: Jun 02, 2025 Contract Value : 1
Government Departments No of Bidders 11
West Bengal View Result →
17.
Public Administrative Department #3733824 AOC
Tender Rate Contract For Supply Of Pathology Reagents & Kits To Thane Municipal Corporationfor 2023-24 & 2024 - 25 , Absolute Alcohol , Acetic Acid 3% , Acetone , Adamtb ( With Longer Stability ) , Albert Stain Kit ( A+B ) , Amino Acid Disc ( Lysine Hydrochloride, Arginine Hydrochloride, Ornithin Hydrochloride ) , Ammonium Sulphate Powder , Anti A , Anti A1 , Anti Ab , Anti B , Anti D , Anti H , Aso Lattex Kit , Barium Chloride ( 10% Solution ) , Benedicts Solution , Benzidene Powder , Biofixative Spray , Bilirubin Kit ( Colorimetric Method ) , Bilirubin Total ( Compatible For Semi- Automatic Biochemistry Analyser ) , Bilirubindirect ( Compatible For Semi- Automatic Biochemistry Analyser ) , Carbol Fuchsin ( Readymade Stain ) , Chloroform , Chromic Acid , Cleanac 1X5 Litre ( Compatible For Nihon Kodhen Cell Counter ) , Cleanac 3 ( 1X2 Litre ) ( Compatible For Nihon Kodhen Cell Counter ) , Concentrated Hydrochloric Acid , Concentrated Nitric Acid , Coombs Sera , Cpda Blood Bags ( Single 350Ml Needle - 16 Guage, Ultra Thin Walled, Siliconised With 2 Part Protective Cover- Hard & Soft, , Memmorable Tubing With Uniform Wall Thickness, Should Have Clear Thermal Printed Numbering After Every 10Cm. Length-110Cm.350 Ml Capacity Pvc Bag W ) , Cpda Blood Bag Doublebag ( Single 350 / 450 Ml Needle - 16 Guage, Ultra Thin Walled, Siliconised With 2 Part Protective Cover- Hard & Soft, , Memmorable Tubing With Uniform Wall Thickness, Should Have Clear Thermal Printed Numbering After Every 10Cm. Length-110Cm. Mother Bag 350 / 450 ) , Cpda Blood Bag Triplebag ( Single 350450Ml With Sagm Solution Needle - 16 Guage, Ultra Thin Walled, Siliconised With 2 Part Protective Cover- Hard & Soft, Memmorable Tubing With Uniform Wall Thickness, Should Have Clear Thermal Printed Numbering After Every 10Cm. Mother Bag .350 / 4 ) , Cpda Blood Bag Quadriplebag ( Single 350Ml Needle - 16 Guage, Ultra Thin Walled, Siliconised With 2 Part Protective Cover- Hard & Soft, , Memmorable Tubing With Uniform Wall Thickness, Should Have Clear Thermal Printed Numbering After Every 10Cm. Length-110Cm.350 Ml Capacity Pvc Bag. ) , Creatinine Kit One Step Visit ( Colorimetric Method ) , Creatinine Kit ( Compatible For Semi- Automatic Biochemistry Analyser ) , Crp Kit , Crystal Violet , Csf Diluting Fluid , Csf Protein Kit , Dehydratedd Bile Esculine Agar , Dehydrated Bhi Agar , Dehydrated Bhi Broth , Dehydrated Blood Agar Base , Dehydrated Cled Agar , Dehydrated Corn Meal Agar , Dehydrated Glucose Phosphate Broth , Dehydrated Mac Conkeys Agar ( With >15% Salt, Cv & Nacl ) , Dehydrated Moller Decarboxylase Broth Base , Dehydrated Mullar Hinton Agar , Dehydrated Peptone Water , Dehjydrated Potato Dextrose Agar , Dehydrated Rcm Medium , Dehydrated Sabrouts Dextrose Agar , Dehydrated Simmonss Citrate Agar , Dehydrated Tcbs Agar , Dehydrated Trypticase Soya Broth , Dehydrated Tsi Agar , Dehydrated Urea Agar , Deionised Water , Dengue Igm Antibodies Capture Elisa ( Elisa Method ) , Dengue Ns1 Igg, Igm Antibodies Detection Kit ( Rapid Method Paper Immunocromatography Whole Blood ) , Dextrose Powder , Diastix ( For Protien And Glucose Test ) , Dpx Mountant , Edta Solution Di Potassium Pack , Eosine 2 % , Eosinophil Diluting Fluid , Erba Norm For Em 200 ( Compatible For Em 200 Machine ) , Erba Path For Em 200 ( Compatible For Em 200 Machine ) , Erba Xl Wash ( Compatible For Em 200 Machine ) , Esr Control ( Abnormal Control Plasma For Calibration And Quality Control For Use Withvesmatic Esr Analyser ) , Esr Control ( Normal Control Plasma For Calibration And Quality Control For Use Withvesmatic Esr Analyser ) , Extended Anibiotics Disc ( Cifazolin ( 30Mcg ) , Cifotaxime ( 30Mcg ) , Ceftriaxone ( 30Mcg ) , Tetracyclin ( 30Mcg ) , Cotrimaxazole, Norfloxacin, Nitroferentoin, Nalidixic Acid, Levofloxacin, Clindamycin, Oxacillin, Ampicillin Sulbactum, Ampicillin, Cifoparazone Sulbactum, Penicilline G ) , Febrile Antigen Kit ( Slide Method ) , Ferric Chloride 10 % , Field Stain A ( For Malaria Staining ) , Field Stain B ( For Malaria Staining ) , Fouchets Reagent , G6pd Kit , Glacial Acetic Acid , Glucosekit ( God-Pod Method ) , Glyserol , Grams Iodine , H2so4 20% ( 20% ) , Harries Haematoxyline , Hartleys Broth ( Adult ) ( For Adult Patients.With 0.05 %Sps ) , Hartleys Broth ( Pediatric ) ( For Pediatric Patients With 0.05 %Sps ) , Hbsag Test Kitelisa ( Fourth Generation ) , Hbsag Test Kitrapid ( Paper Immunochromatography For Detection ) , Hcv Test Kitelisa ( 4Th Generation ) , Hcv Test Kitrapid ( Flow Through Method ) , Hemolenac 3N 1X500ml ( Comptatible For Nihon Kodhen Cell Counter ) , Hiv Test Kit Elisa Test ( Fourth Generation ) , Hiv Test Kit Rapid Test ( Paper Immunochromatography For Detection Of Hiv I And Hiv Ii Antibodies ( Compatible With Whole Blood / Serum / Plasma ) , Identification Disc Vial ( Bacitracin ( 0.04Mcg & 10Mcg ) , Optochin, Flurozolidone ( 50Mcg & 100Mcg, ) Novobiocin ( 5Mcg ) , Oxidase ) , Immersion Oil For Microscope ( Compatible For Any Binocular Microscope ) , Isopropyl Alcohol , Isotonac 1X18litre ( Compatible For Nihon Kodhen Cell Counter ) , Ketodiasix ( For Ketone And Glucose ) , Kovacs Reagent , Lactophenol Cotton Blue , Leishmans Stain With Buffer Tablet , Leptospira Antibodies Igm Detectionelisa Test ( Elisa Method ) , Leptospira Antibodies Igm Detectionrapid Test ( Rapid Method ) , L-J Medium Slants ( Ready To Use ) , Liquor Ammonia , Litmus Paper Red ( Red ) , Litmus Paper Blue ( Blue ) , Lugols Iodine , Malaria Antigen Test Kit ( For Both Falciparum & Vivax ) , Malaria Antigen Test Kit ( For Detection Of Pan Malaria ( Detection All Species ) , Falciparum ( Hrp2 Based ) & Vivax ( Pldh Specification To Vivax ) ) , Methelene Blue , Methenol , Methyle Red Indicator , Multistix , N / 10 Hydrochloric Acid ( N / 10 Normality ) , Nigrosine Stain , Oxidase Reagent Powder , Pap Stain Kit ( Rapid Pap Method ) , Platelet Diluting Fluid , Potassium Telurite ( 1% Concentrated ) , Ppd Bulb 1T.U ( 1 Tu / 0.1Ml ) , Prothrombin Time Kit ( Uniplastin Isi Value 1.0 ) , Ra Test Kit , Retic Stain , Safranine , Salmonella Igm Anibody Test Rapid ( Immunochromatography ) , Selvinoffs Reagent , Sgotkit Colorimetric , Sgptkit Colorimetric , Sodium Citrate 3.8% , Sodium Fluoride Solution 2% W / V ( 2% W / V ) , Sodium Metabisulphite , Solubility Test For Detection Of Haemoglobulin S ( In Sickle Cell Anaemia ) , Sulphar Powder , Sulphosalicylic Acid 3 % , Sulphosalicylic Acid 30 % , Tpha Test For Syphilis ( Rapid Dipstick Method ) , Troponin I ( Cardiac Marker ) Test ( Should Be Highly Sensitive Sensitivity Should Not Be More Than0.4 Nmg ) , Urea 40% , Urea Bun Kit Colorimetric ( One Step Method ) , Vdrl Test Kit ( Rpr ) , Vdrl Test Kit ( Modified ) , Vtm Medium Kit , Wbc Diluting Fluid , Widal Test Kit ( Antigen O, H, Ah.Bh ) ( For Widal Tubeagglutinatioon Test For Detection Of Salmonella Species Antobodies ) , Xl Multical ( Compatible For System Packs Of All Reagent Of Em200 ) , Xylene ( Should Be In Glass Container ) , ?-Hcg Pregnancy Test Kit ( Strip Method ) , Alluminium Square Basket ( 4X4 In Sizemade With Wire Mesh ) , Aluminium Square Basket ( 8X8 In Size Made With Alluminium ) , Autoclavable Plastic Petryplate ( 120 Mm Size ) , Beaker 250 Ml , Beaker 500 Ml , Blotting Paper ( 18X24 Inch ) , Brush ( 6 Inch ) , Capillary For Btct ( 144-4Mm Size ) , Cell Counter For Dc ( Manual Cell Counter With 5 Keys And Digital Display ) , Centrifuge Machine For 24 Tubes ( With 24Tubes Capacity ) , Centrifuge Tubes ( 15Ml Capacity With Gradation ) , Centrifuge Tubes ( 15Ml Capacity With Gradation Screw Capped Polysterene Tubes ) , Colorimeter Digital ( Digital ) , Conical Flask ( 100Ml Capacity ) , Conical Flask ( 500Ml Capacity ) , Conical Flask ( 1000Ml Capacity ) , Coverslip ( 22X22mm ) , Coverslip For Cytology And Histology ( 22X40mm ) , Coverslip For Neubar Chamber ( 20X25x0.4Mm ) , Cuvettes For Digital Colorimeter 5 Ml ( Compatible For Digital Colorimeter ) , Double Wound Nicrome Wire Loop With Holder. ( 4Mm , 2 Mm & 1.3 Mmdiameter ( Calibreated To 1 ?L Sample ) , Easyflow Tubes For Esr , Electronic Timer , Esr Heparinised Capillaries , Esr Stand For 12 Pipettes ( Steel Spring ) , Eyepiece For Binocular Microscope ( 10X Compatiblefor Labomed Microscope ) , Glass Funnel ( 2 Diametre ) , Glass Marking Pen ( Permenant Marker ) , Glass Marking Pencil ( With Dimond Tip ) , Glass Pipette 1Ml ( With Gradation Of 0.1Ml ) , Glass Pipette 2Ml ( With Gradation Of 0.1Ml ) , Glass Pipette 5Ml ( With Gradation Of 0.1Ml ) , Glass Pipette 10Ml ( With Gradation Of 0.1Ml ) , Haemoglobinometer With Square Tube , Hb Pipette , Hb Square Tube , High Profile Blades 818 ( Compatible For Automated Moterised Leica Microtome Machine Rm 2255 In Use ) , Hot Plate , Koplin Jars ( Plastic ) , Label ( 2 X 1.5 Cm Size ) , Label ( 2 X 1 Cm Size ) , Lancet Needles , Liquid Soap , Low Profile Blades 819 ( Compatible For Leica Cryostat Machine Cm1100 ) , Measuring Glass Cylinder 100Ml ( 100Ml Capacity ) , Measuring Glass Cylinder 500Ml ( 500Ml Capacity ) , Measuring Glass Cylinder 1000Ml , Micropipette 10 Microlitre , Micropipette 20 Microlitre , Micropipette 50 Microlitre , Micropipette 100 Microlitre , Micropipette 200 Microlitre , Micropipette 500 Microlitre , Micropipette 1000 Microlitre , Micropipette Variable 10-100 Microlitre , Micropipette 100 To 1000Microlitre Variable , Micropipette 2-10Ml Variable , Micropipette Tips Blue , Micropipette Tips Yellow , Microscope Bulb ( 6 V- Halogen ) , Microscope Slides ( Size- 75Mm X 25Mm X 1Mm ) , Multiple Sample Needle ( 22 Gx1 ( 0.7 X 25 Mm ) For Vaccutainer. ) , Neubauers Chamber ( Silverline ) , Non Sterile Cotton Swab Sticks , Objective For Labomedbinocular Microscopes ( 40X ) , Objective For Labomed Binocular Microscopes ( 100 X ) , Ordinary Filterpaper ( 11Mm Size ) , Ordinary Filterpaper ( 21Mm Size ) , Paraffin Wax ( Fully Processed Melting Point 56`C ) , Pasture Pipette With Rubber Teat , Petryplate With Lid ( Glass 90 Mm In Diametre ) , Ph Paper Range Ph 6.5 To 9 , Sharp Container ( Leakproof And Puncture Proof Container, 1-2Litre Capacity ) , Slide Box . ( 25 Slide Capacity With Innersidevelvet Coating ) , Slide Box ( 50 Slide Capacity With Innersidevelvet Coating ) , Slide Box ( 100 Slide Capacity With Innersidevelvet Coating ) , Slide Stand For Staining ( Metal ) , Slide Tray ( Vertical ) , Slide Tray ( Horizontal With 20 Slides ) , Spirit Lamps , Sterile Cotton Swab Sticks , Sterile Cotton Swab Sticks In Screw Cap Polypropylen Tube ( Cotton Bud With Polyporpylene Stic Size- 75Mm Packed In 12Mm Diameter Tube Indevisualy Packed ) , Sterile Specimen Collector , Test Tubes ( 10 X 75Mm Size ) , Test Tubes ( 12 X 75 Mm Size ) , Test Tubes ( 12 X 100 Mm Size ) , Test Tubes ( 15 X 120Mm Size ) , Test Tubes ( 15 X 150Mm Size ) , Test Tubes ( 18 X 180 Mm Size ) , Test Tubes Stand ( Wooden 1X12 Tubes ) , Test Tubes Stand ( Metal 4X12 Tubes ) , Test Tubes Stand ( Autoclavable Plastic Stands For 12Mm X75mm / 100Mmtest Tubes With Alfanumeric Marking ) , Thermal Paper Roll ( 60.8Mmx30 Meter Compatible For Sysmax Kx 21 ) , Tissue Paper Roll , Torniquet ( Button Release Torniquets ) , Urinometer ( With Measuring Cylinder ) , Vacutainer Plain 2Ml ( 2Ml Plain Clot Activator ) , Vacutainer Plain 3Ml ( 3 Ml Plain Clot Activator ) , Vacutainer For Coagulation Assay ( 2Ml With 3.2% Buffered Tri- Sodium Citrate For Coagulation Assay ) , Vacutainerfluoride ( 2 Sodium Fluoride ) , Vacutec Tubes K3edta ( 2 Ml K3edta ) , Vaccutec Tube Diesse For Esr ( Compatible For Esr Analyser Ves Matic 20 ) , Vdrlslide Shaker , Vial For Urine Collection ( Plastic Container Of 20Ml Capacity With Cap ) , Whatman Filter Paper ( 11Cms Diameter Discs ) , Wooden Slide Box ( 25 Slide Capacity With Innersidevelvet Coating ) , Wooden Slide Box ( 50 Slide Capacity With Innersidevelvet Coating ) , Wooden Slide Box ( 100 Slide Capacity With Innersidevelvet Coating ) , Afb Stain Kit ( For Detection Of Mycocobactria ) , Alcain Blue ( For Detection Of Acid Mucin / Mucosubstances ) , Ammonium Sulphate Powder , Calibrator For Elite 580 ( Compatible Forelite 580 ) , Calibrator For H 360 ( Compatible Forh 360 ) , Cell Clean ( Compatible For Xn 1000 Analyser ) , Cell Pack Diluent ( Dcl 300A ) ( Compatible For Xn 1000 Analyser ) , Cell Pack ( Dfl 300A ) ( Compatible For Xn 1000 Analyser ) , Control Trilevel ( Compatible For H-360 Machine ) , Control Trilevel ( Compatible For Elite 580 Machine ) , Diluent Elite 580 ( Compatible For Elite 580 Machine ) , Diluent H 360 ( Compatible For H 360 Machine ) , Elite 580 Calibrator ( Compatible For Elite 580 Machine ) , Elite 580 Lyse 1 ( Compatible For Elite 580 Machine ) , Elite 580 Lyse 2 ( Compatible For Elite 580 Machine ) , Elite 580 Lyse 3 ( Compatible For Elite 580 Machine ) , Elite 580 H Clean ( Compatible For Elite 580 Machine ) , Flurocell Ret ( Ret 800A ) ( Compatible For Xn 1000 Analyser ) , Flurocell Wdf ( Wdf 800A ) ( Compatible For Xn 1000 Analyser ) , Flurocell Wnr ( Wnr 800A ) ( Compatible For Xn 1000 Analyser ) , Giemsa Stain ( Mgg ) ( For Staining Blood, Bonemarrow Smear & Cytological Specimens. ) , H Clean ( Compatible For H 360 Machine ) , Lyse ( Compatible For H 360 Machine ) , Lysercell Wdf-210A ( Compatible For Xn 1000 Analyser ) , Lysercell Wnr-240A ( Compatible For Xn 1000 Analyser ) , Pas Stain ( For Demonstration Of Glycogen, Polysaccharides, Glycoproteins, Phospholipids, Fungi. ) , Sta -Neoplastine Cl5 ( Isi-1.8 ) Compatible For Stago Freeze-Dried Rabbit Brain Thromboplastin With Heparin Inhibitor ) , Sta Cephascreen 4 ( Compatible For Stagofully Automated Cagulometer ) , Sta- Fibrinogen 5 ( Freez Dried Human Thrombin ( -80Nih Units / Ml ) With Heparin Inhibitor And Calcium ) , Sta Coag Control N+P ( Compatible For Stagofully Automated Cagulometer ) , Sta Cacl2 0.025 M ( Compatible For Stagofully Automated Cagulometer ) , Sta Satellite Cuvettes ( Compatible For Stagofully Automated Cagulometer ) , Sta Desorb U ( Compatible For Stagofully Automated Cagulometer ) , Sta Cleaner Solution ( Compatible For Stagofully Automated Cagulometer ) , Sta Defficient Viii ( Compatible For Stagofully Automated Cagulometer ) , Sta Unicalibrator ( Compatible For Stagofully Automated Cagulometer ) , Sta System Control N+ P ( Compatible For Stagofully Automated Cagulometer ) , White Stirring Bar ( Compatible For Stagofully Automated Cagulometer ) , Sta Oweron Koller ( Compatible For Stagofully Automated Cagulometer ) , Sulfolyser ( Sls-240 A Compatible For ) , Acrylic Jar ( 10 X 13 X 3.5 Cm ) , Acrylic Jar ( 12.3 X 15.3 X 4.5 Cm ) , Acrylic Jar ( 12.5 X 18.5 X 6.5 Cm ) , Acrylic Jar ( 12.5 X 23.5 X 4.5 Cm ) , Acrylic Jar ( 23.5 X 33.5 X 23.5 Cm ) , Acrylic Jar ( 12.0 X 15.5 X 8.0 Cm ) , Acrylic Jar ( 16.0 X 30.5 X 8.0 Cm ) , Acrylic Jar ( 6.0 X 6.5 X 3.0 Cm ) , Acrylic Jar ( 12.5 X 23.0 X 8.5 Cm ) , Cassette For Holding Tissues ( Regular Size ) , Cassette For Holding Tissues ( Biopsy ) , Enamel Tray ( 6X12 ) , Hot Air Oven ( Medium Size ) , Label ( 25 X 13 Mm Size ) , Micropipette Tips ( Compatible For 2 To 10 Ml ) , Micropipette Tips ( Compatible For 2 To 20 Microlitre Variable ) , Slide Filing Cabinet For More Than 1, 00, 000 Slide Holding Capacity ( Should Be Made Of Crca Sheet With Anti Fungal Growth Proof Treatment, Should Be Powder Coated, After 7 Tank Phospheting Process, Shoul Be Scratch And Rust Resistant, Alpha Numeric Slide Trays Should Be Made Of Anodised Seamless Molded Aluminiumwith Slide Arrangement Separately For 100 To 200 Slides.Doorshould Be With Safety Lock And Key ) . , Thermameter 0 To 100 ( 0 To 100 Degree Celcius. ) , Water Bath ( With Digital Thermameter ) , Antimicrobial Disc Vial ( Peniciline G ( 10Mcg ) , Cifoxeten ( 30Mcg ) , Teicoplanine ( 30Mcg ) , Gentamycin ( 10Mcg ) , Amicasin ( 30Mcg ) , Ciprofloxaxine ( 5Mcg ) , Levofloxacine ( 5Mcg ) , Tetracycline ( 30 Mcg ) , Erythromycine ( 15Mcg ) , Clindamycine ( 2Mcg ) , Cotrimoxazole ( 25Mcg ) , Linezolid ( 30 Mcg ) Ampcilin ( 10Mcg ) , Amoxy / Clav ( 20 / 10Mcg ) , Azythromycin ( 15Mcg ) , Aztreonam ( 30Mcg ) Cefazoline ( 30Mcg ) , Cefotoxine ( 30Mcg ) Cefixime ( 5Mcg ) , Cefotoxime / Clav ( 30 / 10Mcg ) , Ceftazidime ( 30Mcg ) , Ceftazidime / Clav ( 30 / 10Mcg ) , Ceftriaxoma ( 30Mcg ) , Cholistin ( 10Mcg ) , Nalidixic Acid ( 30Mcg ) , Nitroferantoin ( 300Mcg ) , Norfloxacin ( 10Mcg ) , Ofloxacin ( 5Mcg ) , Cefipime ( 30Mcg ) , Chloramphenicol ( 30Mcg ) , Piperaciline / Tazobactum ( 100 / 10Mcg ) , Polymixine B ( 300 U ) , Pefloxacine ( 5Mcg ) , Streptomycin ( 300Mcg ) , Vancomycin ( 30Mcg ) , Metronedazole ( 30 Mcg ) , Ticarciline / Clavulinic Acid ( 75 / 10Mcg ) , Antimicrobial Disc For Fungus ( Amphoterecin B, Itraconazole, Flucanazole, Voricanazole, Nystatin, Ketoconazone ) , Antimicrobial Suseptibility Testing Mic E Strips ( Vancomycin, Linazolid, Ticoplanine, Metronedazol. ) , Anti Hav Antibodies Elisa , Anti Hev Antibodies Elisa , Blood Culture Bottles ( Adult ) ( Compatible With Bactiallert Machine ) , Blood Culture Bottles ( Pediatric ) ( Compatible With Bactiallert Machine ) , Carbohydrate Fermentation Media ( Glucose, Sorbitol, Sucrose, Manitol, Xylose ) , Chloramphenicol Cyclohexamine Vial , Dehydrated Dermatophyte Test Medium Agar Base With Dermat Suppliment , Dehydrated Dixon Medium , Dehydrated Hugh Leifson Oxidative Fermentative Media , Dehydrated Neomycin Erythromycin Agar , Dehydrated Selenite F Broth ( Part A And Part B ) , Dehydrated Tetrathyonate Broth , Dehydrated Xld Agar , Lyophilised Atcc Strain ( Staphylococcus Aureus Atcc 25923: Selfcontianed Device Including Lyophilised Microorganism Pellets, Ampoule Of Hydration Fluid And Inocculating Swab Plus Certificate Of Analysis ) , Lyophilised Atcc Strain ( Pseudomonas Aeruginosaatcc 27853: Selfcontianed Device Including Lyophilised Microorganism Pellets, Ampoule Of Hydration Fluid And Inocculating Swab Plus Certificate Of Analysis ) , Lyophilised Atcc Strain ( Escherichia Coli Atcc 25922: Selfcontianed Device Including Lyophilised Microorganism Pellets, Ampoule Of Hydration Fluid And Inocculating Swab Plus Certificate Of Analysis ) , Lyophilised Atcc Strain ( Candida Albicans Atcc 10231: Selfcontianed Device Including Lyophilised Microorganism Pellets, Ampoule Of Hydration Fluid And Inocculating Swab Plus Certificate Of Analysis ) , Centrifuge Tubes ( 50 Ml Capacity With Gradation Screw Capped Autoclavablepolysterene Tubes ) , Cryovials ( 2 Ml Sutaible For Storage In -80 Degree Celcius And Liquid Nitrogen Rnase And Dnase Free ) , Micropipette 1-20 Microlitre ( 1-20 Microlitre Variable ) , Micropipette 0.2 To 10 Microleter ( 0.2 To 10 Microleter Variable ) , Micropipette Tips ( Compatible For 2 To 20 Microlitre Variable ) , Nitrile Gloves Powder Free For Molecular Testing ( Free Size ) , Optical Adesive Plate Sealer Light Cycler 480 Sealing Foil High Quality Sealing , Pcr Plates ( 96 Well Hard White Shell Clear Well Thin Wall Compateble For Biorad Pcr Machine ) , Pcr Tubes 0.1 Ml 8 Strip ( Compatable With Biorad Pcr Machine ) , Rota Reaction Tubes 0.2 Ml ( Compatible With Rgq ) , Sterile Microcentrifuge Tube Nuclease Free ( 1.5 To 2Ml Capacity ) , Sterile Micropipete Tips 0.2 To 10 Microleter ( Made Og Virgin Polypropelene, Clear Low Retaintion Filtered Rnase And Dnase Free Racked With Aerosol Barrier ) , Sterile Micropipete Tips 0.2 To 20 Microleter , Sterile Micropipete Tips2 To 200 Microleter ( Made Og Virgin Polypropelene, Clear Low Retaintion Filtered Rnase And Dnase Free Racked With Aerosol Barrier ) , Sterile Micropipete Tips100 To 1000 Microleter ( Made Og Virgin Polypropelene, Clear Low Retaintion Filtered Rnase And Dnase Free Racked With Aerosol Barrier ) , Strip Tubes And Cap ( 0.1 Ml ( Roter Gene Pcr ) , Cryoboxes For Storage Of Samples Made Of Polypropylene ( 100 Place Upto 2Ml Of Tubes ) , 0.2Ml 8 Strip Pcr Tubes With Cap ( Single Pcr Strip With Cap Compatible With Himedia Machine ) , Non Skirted Or Semiskirted Transparent Pcr Plate 0.2Ml ( Single Plate Compatible With Himedia Pcr Machine ) , Te Buffer ( 500Ml Bottle ) , Proteinase K ( 1Ml Bottle ) , Parafilm Tape , Rnase Free Water ( 500Ml Bottle ) , Covid-19 Rtpcr Kits , Pcr Kits For Infectious Diseases ( H1n1, Dengue, Leptospira, Malaria, Chikungunya, Salmonella, Hpv, Endemic Typhus, Monkeypox, Hsv, Clostridium Difficile, Brucella, Legionella, Zika ) , 4 Aminoantipyrine 25 Gms , Magnesium Sulphate 500 Gms , Sodium Bisulphite 500Gm , Sodium Pyruvate 100 Gm , Sodium Tungstate 100 Gm , Glass Beaker 50 Ml , Glass Funnel 3 Diameter , Oven , Pipette Pump ( 10 Ml Pipette ) , Ph Paper Range 2-10.5 , Pm Kit For Xl 640 ( Compitable For Xl 640 Machine ) , Test Tubes Stand ( Metal Stand Of 2 X 6 Holes For 15 X 150 Mm Testtube ) , Test Tubes Stand ( Metal Stand Of 4 X 10 Holes For 18 X 150 Mm Testtube ) , Test Tubes Stand ( Metal Stand Of 3 X 10 Holes For 18 X 150 Mm Testtube ) , Bovine Albumin 22% , Microscope ( Binocular ) , Urinorm , Dekaphan Laura , Tetraphan Sg Laura , Control Strips Laura M , Thermal Printer Paper Roll , Erbaprotime L S , Erbaactime , Erba Calcium Chloride , Erba Control N , Cuvettes , Ferritin Kit ( System Pack For Xl 640 Compatible For Xl640 ) , Ferritin Calibrator ( System Pack For Xl 640 Compatible For Xl640 ) , Ferritin Control Low ( System Pack For Xl 640 Compatible For Xl640 ) , Ferritin Control High ( System Pack For Xl 640 Compatible For Xl640 ) , Fe 125 Kit ( System Pack For Xl 640 Compatible For Xl640 ) , Uibc 125 Kit ( System Pack For Xl 640 Compatible For Xl640 ) , Xl Hba1c With Cali Set ( System Pack For Xl 640 Compatible For Xl640 ) , Hba1c Cali Set ( System Pack For Xl 640 Compatible For Xl640 ) , Hbaa1c Con L ( System Pack For Xl 640 Compatible For Xl640 ) , Hbaa1c Con H ( System Pack For Xl 640 Compatible For Xl640 ) , Reference Electrode ( System Pack For Xl 640 Compitibale For Xl653 ) , Na+ Electrode ( System Pack For Xl 640 Compitibale For Xl640 ) , K+ Electrode ( System Pack For Xl 640 Compitibale For Xl640 ) , Cl- Electrode ( System Pack For Xl 640 Compitibale For Xl640 ) , 4 Channel Ise Module Reagent Pack @35Spd ( System Pack For Xl 640 Compitibale For Xl640 ) , Chikungunya Igm Test Kit , Covid-19 Rapid Antigen Test Kit ( Icmr Approved )
Contract Date: May 24, 2024 Contract Value : 5.18 Crore
Local Bodies No of Bidders 14
Maharashtra View Result →
18.
Health and Family Welfare #2288398 AOC
Re E Tender For Procurement Of Dental Items Used In Dentistry For Two Years From The Date Of Award Of Contract ( Aoc ) , Blades For Microtome ( High Profile ) Specification: High Profile 818 Disposable Blades Made Of Stainless Steel With Exceptional Durability. Ultra Fine Yet Durable, 80Mm Long X 14Mm High X 0.35 Mm Thick Suitable For Use With Microtomes And Cryostat Series As Well As For Common Cryostat And Microtome Models Inventive Blade Coating Process Provides Perceptibly Improved Results In Section Stretching And In The Quality Of Sectioning Ribbons In Routine Histology Standard Packaging / Physical Verification Of Sample May Be Made , Bone Plate 1.5 S.S “C”Plate With Screw Specification: 1. 4 Hole With Gap “C” Plate -1 2.1.5X 4Mm Screws 2 3. 1.5 X 6 Mm Screws 2 4. 1.7 X 6 Mm Screws ( Emergency ) -01 , Bone Plate 1.5 S.S “L” Plate With Screw Specification: 1. “L” 4 Hole Plate –Rt Side—1 2.”L” Plate 4 Hole - Lf Side –1 3. 1.5 X 6 Mm Screws 8 4. 1.7 X 6 Mm Screws ( Emergency ) -01 , Bone Plates 1.5 Ss 50 Hole Continous Plate With Screw & Drill Bit Specification: Unit Pack Containing 1. 50 Hole Continous Plate --1 2.1.5X 4Mm Screws 20 3. 1.5 X 6 Mm Screws 20 4. 1.7 X 6 Mm Screws ( Emergency ) -05 5. 1.0 Mm Drill Bit 1 , Bone Plates 2.0 Ss “L” Plate With Screw Specification: 1. “L” 4 Hole Plate –Rt Side—1 2.”L” Plate 4 Hole - Lf Side –1 3. 2.0X 6 Mm Screws 8 4. 2.3 X 6 Mm Screws ( Emergency ) -01 , Bone Plates 2.0 Ss 50 Hole Continuous Plate With Screw Specification: 1. 50 Hole Continous Plate --1 2.2.0 X 6Mm Screws 20 3. 2.0 X 8Mm Screws 20 4. 2.3X 8Mm Screws ( Emergency ) -05 5. 1.5 Mm Drill Bit 1 , Bone Plates 2.5Mm Ss 4 Hole With Gap With Screw Specification: 1. 4 Hole With Gap -1 2. 2.5X 8Mm Screws -4 3. 2.7X8mm Emergency Screw-1 , Bone Plating Screws Specification: ( Compatible With The Mini Plates ) 1. Made Of Titanium. Bone Plating Screws Of Assorted Sizes. The Screw Must Be Compatible With The Plates. A. 1.5Mm Diameter And Length 4Mm, 6Mm & 8Mm. B. 2Mm Diameter And Length 6Mm, 8Mm, 10Mm & 12Mm . C. 2.5Mm Diameter And Length 8Mm, 10Mm & 12Mm . D. 2.7Mm Diameter And Length 6Mm, 8Mm & 10Mm . E. 2.3 Mm Diameter And Length 6Mm, 8Mm & 10Mm. Price Being Same Of All Above Mentioned Sizes ( To Be Supplied As Per The Requirement Of The Users ) . Standard Packaging / Physical Verification Of Sample May Be Made , Dental Drape Kit- Disposable Specification: Kit Containing: A ) 1 Pc Surgeons Drape B ) 1Pc Disposable Tray Cover, C ) 1Pc Half Gown For Patient, 140X75 Cm With Tying Tape 170 Cm, Round Neck 13 Cm C ) 1Pc Head Cap Of Adult Size, 50 Gsm Made Of Sms Fabric Eo Sterilized, Gmp Certified , Disposable Surgeons Full Wrap Around Gown Specification: The Products Should Be Eo Sterilized & Ready To Use , Face Mask Elastics Specification: In Different Sizes A ) 5 / 16”, 3 / 8”, – Capable Of Generating 8 Oz Of Force Each B ) 5 / 16”, 3 / 8”, - Capable Of Generating 14 Oz Force Each. Price Being Same Of All Above Mentioned Sizes ( To Be Supplied As Per The Requirement Of The Users ) . Standard Packaging / Physical Verification Of Sample May Be Made. , Hydroxyapatite Crystals / Powder Specifications : Synthetic Nanocrystalline Hydroxyapatite Bone Graft, 100 / 200 / 300 / 400 / 500 / 600 / 700 Microns Particle Size, Each Unit Packet Contains 1 Cc. Price Being The Same To Be Supplied As Per Requirement Of The User Standard Packaging / Physical Verification Of Sample May Be Made , Ss Reconstruction Plate 2.5Mm Straight 20 Hole With Screw Specification: 1. 20 Hole 2.5 Mm Reconstruction Plate-1 2. 2.5 X 8 Mm Screws – 4 3. 2.5 X10 Mm Screws-2 4. 2.7X10 Mm Emergency Screws-2 , Ss Reconstruction Plate 2.5Mm With Angle Left Side 20 Hole With Screw Specification: 1. 20 Hole 2.5 Mm Reconstruction Plate-1 ( Left Side ) 2. 2.5 X 8 Mm Screws – 4 3. 2.5 X10 Mm Screws-2 4. 2.7X10 Mm Emergency Screws-2 , Ss Reconstruction Plate 2.5Mm With Angle Rt Side 20 Hole With Screw Specification: 1. 20 Hole 2.5 Mm Reconstruction Plate-1 ( Rt Side ) 2. 2.5 X 8 Mm Screws – 4 3. 2.5 X10 Mm Screws-2 4. 2.7X10 Mm Emergency Screws-2 , Synthetic Nanocrystalline Beta Tricalcium Phosphate Bone Graft Specifications : 100 / 200 / 300 / 400 / 500Microns Particle Size. Each Unit Packet Contains 1Cc Standard Packaging / Physical Verification Of Sample May Be Made , Zinc Oxide Eugenol Impression Paste: Specification: Packet Unit Containing Tubes Of Base & Accelerator Paste 1. Base Paste Content Not Less Than 60-150Gms & Accelerator ( Catalyst ) Paste Content Not Less Than 80- 100 Gms Or More. 2. Base Paste - Zinc Oxide & Vegetable Or Mineral Oil. 3. Accelerator Paste- Oil Of Cloves / Eugenol Gum / Polymerized Rosin Filler ( Silica ) And Other Ingredients. 4. Regular Setting Initial Setting 3 - 6 Minutes Final Set 10-15 Minutes. Standard Packaging / Physical Verification Of Sample May Be Made , Zinc Phosphate Cement Type – Ii Specification: Single Packet Unit Containing Powder And Liquid 30 Gm Powder &15Ml Liquid. 1 ) Type Ii Zinc Phosphate Cement. A ) Supplied In The Form Of Powder & Liquid With Components As Per The Iso Specifications. B ) Composition In The Range Of :- Powder: Zno - And Mgo. Liquid - Phosphoric Acid And Other Ingredients. C ) Setting Time Range From 3 To 5.5 Minutes D ) 24Hour Compressive Strength 104 -114 Mpa. , Adson Forceps, Toothed Specification: 1.5Mm × 2.75Mm 1×2 Teeth. 46Mm Handle. Made Of Stainless Steel , Adson’S Forceps Non Toothed Specification: Of Length 12.5 Cm Made Of Stainless Steel , Amalgam Carrier Specification: Made Of Stainless Steel , Amalgam Plugger Specification: Made Of Stainless Steel Double Ended , Anatomical Articulator Specification: 1. Rust Free Construction. 2.Fixed Condylar Guidance With Spring Mounted Elements That Are Attached To Upper Member 3. Incisal Pin. 4. Mid Incisal Pin 5. Orientation Rod, 6. Incisal Guide Table 7. Support Upper & Lower Plaster Cast , Apexo Elevators Specification: Set Of Two Set Of Right & Left Made Of Stainless Steel. , Babcock’S Forcep Specification: Finger Ring, Ratcheted, Non-Perforating Forceps Used To Grasp Delicate Tissue Made Of Stainless Steel , Band Contouring Pliers Specification: For Orthodontic Work. Made Of Hard Tempered Steel , Band Cutting Scissors Specification: For Orthodontic Work. Made Of Hard Tempered Steel , Band Remover Anterior & Posterior Specification: For Orthodontic Work. Made Of Stainless Steel , Band Seater Specification: For Orthodontic Work. Made Of Hard Tempered Steel , Binocular Compound Microscope Specification: Sharp Image Display With Excellent Optical Function, Small Space Occupancy With Integral Stand Design, Low Environment Requirement With Anti-Mould Technology. Comfortable Operation With Ergonomic Design Principle Viewing Head: Compensation Free Binocular Head Inclined At 30O Interpupilary Distance 55-75Mm Eyepiece: Wide Field Eyepiece Wf10x / 18Mm With Eye Guard, Achromatic Objective 4X, 10X, 40X, 100X, Focussing Range: Co-Axial Coarse And Fine Adjustment Range 13Mm Fine Division 0.002Mm With Tension Control. Nose Piece: Quadruple Nosepiece, Stage: Double Layer Mechanical Stage 140 X 140 Mm / 75 X 50 Mm N.A1.25 Abbe Condenser With Iris Diaphragm And Filter. Focussing: Coaxial Coarse & Fine Adjustment System Range 24Mm, Fine Division 2Mm Illumination: Led Light With Brightness Adjustable. Iso 13485 Or Ec Certificate / Directive 93 / 42 / Eec ) , Block Holders Specification: To Be Used To Hold Paraffin Blocks And Not Made Of Plastic , Bone Rongeur Side Cutting Specification: Scissor-Type Handle, Cutting Edges On Side And Top Of Beaks , Bone Shear Specification: Length 6-8Inches.Made Of Stainless Steel , Bracket Debonding Plier Anterior Specification: For Band Removal Orthodontic Work. Tungsten Carbide Tipped , Bracket Holding Tweezer Specification: For Orthodontic Work. Made Of Hard Tempered Steel , Buser Bone Chisel Specification: 6Mm Pointed Tip Made Of Martensitic Stainless Steel Alloy , Castrovejo Needle Holder Specification: Castroviejo Microsurgical Needle Holder Is A Double Spring Instrument Used For Holding Small, Delicate Needles In Various Microsurgical Procedures. It Also Features A Locking Mechanism.Made Of Stainless Steel, Autoclavable , Castroviejo Scissor Specification: Castroviejo Scissor Has Curved Blades. Ultra-Sharp Blades Microscopic Serrations Provide A Smooth Cut. Spring-Loaded Knurled Handles Provide The Control You Need To Make Perfectly Smooth Cuts In Delicate Materials. Stainless Steel, Autoclavable , Chanel Retractor Specification: Length 17.5 Cm, Made Of Stainless Steel , Chisel Curved Specification: Chisel Curved 20Mm Made Of Martensitic Stainless Steel , Circular Saw Specification: For Dental Model Cutting: With Self Illumination Provided With Motor Driven Circular Saw Blade And Cast Holding Platform, Electrically Operated Motor Driven With Push Button Type On Off Switches. , Composite Curing Unit System Specification: For Indirect Composite Work Chamber Provided With Sliding Tray, Provided With Multiple Halogen Or Led Lights Light Intensity Not Less Than 900 Mw / Cm2output Peak Wavelength Range 450 - 490 Nm ( Intensity Maximum At 460 Nm ) Capable Of Curing Indirect Composite Veneers / Inlays . Curing Chamber Dimension : Length 10 Inches Width 7 Inches Height 4 Inches Or More Electrically Operated 220-230 Volts Portable With Timer , Cooley Bulldog Clamp Specification: Straight 8.6Cm Jaw 4.7Cm Made Of Stainless Steel , Cushing Nerve Hook Specification: Used For The Retraction Of Nerves Or Delicate Tissue During Neurosurgery. The Instrument Has A Ball Tip To Avoid Tearing. This #1 Hook Is Angled 90 Degrees With A 4Mm Ball Tip And Overall Length Of 7-1 / 2 Inches , Dandy Type Nerve Hook Specification: Length 16-20Cm Tip 4-5Mm, Deep Working Tip Blunt Ended Made Of Stainless Steel , De La Rosa Wire Contouring Plier Specification: For Orthodontic Work. Made Of Stainless Steel , Deans Scissors: Specification: Scissors With 1 Serrated Angular Blade Used For Trimming Tissue Or Cutting Sutures. , Debackey’S Forceps Specification: Length 26 Cm, Tip Width 1.5 Mm Made Of Stainless Steel , Debackey’S Vascular Forcep 6” Specification: Made Of Stainless Steel, Autoclavable , Debakey Bulldog Clamp 8.5Cm Specification: With Serr.Jaws, Straight Made Of Stainless Steel , Dental Excavator Discoid Type Specification: Made Of Stainless Steel Double Ended Iso 13397-4:1997 , Dental Phantom Head Unit Specification: Manikin Head Fixed With A Table, With Mounted Upper & Lower Jaw Containing Screw Mounted Teeth Having 90° Swiveling Function Of Head Unit, Provided With Control Box For Micromotor, Foot Control & Micromotor With Contra Angle Handpiece, Should Have Mounted Light Unit With Illumination Power Not Less Than 7000 Lux. , Dental Plaster Dispenser Specification: Body Made Of Stainless 304 Grade, Fitted With Digital Electronic Timer, Capacity 5 Kg Or More. Will Dispense Premeasured Dose Of Plaster At Touch Of A Button. , Dental Tweezer Specification: With Horizontal Serrations At Tip, Diamond Knurling On The Outside For Good Grip, Stainless Steel Alloy , Die Cutting Machine Specification: Electrically Operated With Diamond Disc. With Adjustable Model Holder Self Illuminated Chamber , Distal End Bender Specification: For Orthodontic Work. Made Of Stainless Steel ) , Distal End Cutter Specification: Tungsten Carbide Tipped Cutter For All Types Of Wire Up To A Maximum Of .021” X .025” ( .53 Mm X .64 Mm ) , Double Wax Heater Pot Specification: With Thermostat Controlled Temperature Regulator Electrically Operated , Farabeufs Periosteal Elevator Specification: Of Different Sizes- Length 6-8Inch, Width 8-12Mm, Made Of Stainless Steel. , Fergusons Mouthgag Specification: Made Of Stainless Steel , Heavy Duty Lathe With Suction Unit Specification: Electrically Operatedheavy Duty Motor Unit Having Power Not Less Than – 0.5Hp High Speed R.P.M.-3000 Rpm Arrangement To Attach Bur Holding Chuck – Electroplated Spindle On One Side For Polishing Buff Wheel, On The Other Arm Is A Grinding Stone Wheel Of Diameter 2.5 Inch Or More. Provided With Built In High Power Dust Suction Unit For Clean, Unpolluted, Dust Free Work Environment, Attached With Dust Collection Bag – Easily Removable Tray For Debris Collection. Table Mountable Heavy Base Plate For Vibration Free Operation Built – In Lighting For High Visibility , Heavy Wire Cutter Specification: Wire Cutter Tungsten Carbide Tipped , Howarth’S Periosteal Elevator Specification: Double Ended: One End Flat, Broad Sharp Edge, Other End Rugine Ended Made Of Stainless Steel , Humby’S Knife Holder Specification: Made Of Stainless Steel , Hydraulic Press Specification: The Closed Circuit Hydraulic Press Should Work With A Pressure Up To 7000 Kg Of Thrust. It Can Contain Up To Three Flasks At A Time. The Structural Elements In Chromium Plated Steel. Provided With Dial. , Kilner’S Cheek Retractor Specification: Made Of Stainless Steel , Kocher’S Forceps 14Cm Hemostatic Forcep. Specification: It Is Specifically Designed To Catch The Bleeder That Are Deep Within Tissue Hence It Is Ideally Used On Tough Structures Made Of Stainless Steel , Laboratory Micromotor With Brushless Motor Specification: Compact And Portable Size, Continuous Variable Speed Control , R.P.M-1000 -40000, On / Off Foot Switchone- Touch Change Of The Driving Direction For Efficient Operation With Brushless Motor With Handpiece , Laboratory Micromotor With Carbon Brush Motor Specification: Compact And Portable Size, Continuous Variable Speed Control , R.P.M-1000 -40000, On / Off Foot Switchone- Touch Change Of The Driving Direction For Efficient Operation With Carbon Brush Motor With Handpiece , Langenback’S Retractor Specification: Made Of Stainless Steel , Laser Guided Pin Drilling System With Pins Specification: Electrically Operated 110V / 240V, Laser Guided Pinsetter, Pin Drilling For Easy Die Pin Attachment. Laser Light Technology With Carbide Bur Drill With High Speed Motor. To Accurately Drill Parallel Holes Into The Underside Of The Model Die Pins Of Various Sizes ( 1000 Pieces Total ) Made With Non Corrosive Alloys For Use With Pindex System Of Die Pins. , Lingual Arch Plier Specification: For Orthodontic Work. Made Of Stainless Steel , Loop Forming Plier Specification: For Orthodontic Work. Made Of Hard Tempered Steel , Lower Molar Extraction Forcep English Pattern Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc / Box Type Of Hinge Joint Set Of One Piece Right & One Piece Lower Molar Forcep , Lower Premolar Extraction Forcep English Pattern Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc / Box Type Of Hinge Joint , Lower Roots Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip , Lower Universal Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc / Box Type Of Hinge Joint Set Of One Piece Right & One Piece Lower Molar Forcep , Model Trimmer With Carborundum Disc Specification: Motor Rpm 2800 Heavy Duty, Equipped With Two Ball Bearing Single Speed, Rating Continuous With Buffer And 10 Carborundum Disc , With Heavy Base That Can Be Clamped And Installed On Underlying Table, With Water Inlet And Out Flow Water System. , Model Trimmer With Diamond Disc Specification:1 / 2Hp, Rpm-2800, Heavy Duty Equipped With Two Ball Bearings, Single Speed, Rating Continuous With Buffer And One 10 Diamond Disc Rough Or Fine Without Suction.1 Piece Spare Diamond Disc To Be Provided , Paraffin Wax Bath ( Thermostatically Controlled ) Specification: Construction – Double Walled Effectively Insulated.Wax Tank Of 20 Gauge Ss Sheet. Fitted With Laminated Wooden Rim And Anodized Alumininium Cover Mounted On 5 Cm Diameter. Heater- Two 1 Kw Each Special Wax Heater. Heat Control- Thermostat To Control Temperature From 30 Degree C To 110 Degree C Finish- Externally Finished In Oven Baked Accessories-Power Plug, 1 Brush For Wax Application And Aluminium Sheet Mesh For Heater. , Pediatric Extraction Lower Molar Forcep Specification: For Children Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pediatric Extraction Lower Premolar Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pediatric Extraction Universal Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pediatric Extraction Upper Incisor & Canine Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pediatric Extraction Upper Molar Forcep Left Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pediatric Extraction Upper Molar Forcep Right & Left Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pediatric Lower Roots Forcep Specification: Made Of Hard Stainless Steel With -Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pediatric Upper Roots Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc Type Of Hinge Joint, 4.5 Inches Of Length , Pin & Ligature Wire Cutter Specification: Tungsten Carbide Tipped Cuts Soft Wire Pins And Ligature Wire Up To .015” ( .38 Mm ) , Punch Biopsy Forceps Specification: Made Of Stainless Steel , Rib Shear ( Doyan ) Specification: Made Of Stainless Steel , Ribbon Arch Plier Specification: For Orthodontic Work. Made Of Stainless Steel , Semi Adjustable Articulator With Accessories Specification: Wide View Arcon Articulator With Spring¬ Bow, Ear¬Piece, Face Bow, Orbital Indicator, Bite Fork & Other Accessories Standard Packaging / Physical Verification Of Sample May Be Made , Slide Storing Cabinet Specification: Cabinet For 1050 Slides Consisting Of 6 Drawers Each For 175 Slides, Arranged In Single Rowframework Made Of 15Mm Plywood With Top And Sides Covered With Sunmica Laminated Sheet. , Slide Warming Table Specification: Top Surface Made Of Stainless Steel ( Ss-304 Grade ) The Surface Temperature Is Controlled From Ambient To 70°C Supplied Complete With Pilot Lamp, Cord And Plug To Work On 220 / 230 Volts A.C. Supply , Steel Mallet Specification: For Use In Oral Surgical Work Made Of Stainless Steel Length 7.5”, Head Diameter 20-22Mm , Steel Slide Racks For Staining Specification: The 5-Slide Gripper Can Accommodate 5 Microscope Slides In One Staining Procedure.It Fits Most Coplin And Round-Open Staining Jars It Should Be Made Of A Special Material Which Is Resistant To All Chemicals And Solvents Which Are Used In Staining It Withstands Drying Temperatures Up To 80°C , Surgical Elevators- Coopland’S Pattern Specification: Made Of Hard Stainless Steel , Tissue Capsules / Tissue Embedding Cassettes Specification: Made Of Acetyl Polymer;Cassettes Should Keep Specimen Safely Submerged In Liquid, Efficient Flow- Through Slots, Snap-Latch And Hinge-Lock Design Prevent Early Separation Of Base And Lid And Allows For One Hand Operation. Large Labeling Area On Two Sides Of Cassette. Anterior Writing Area Is At 35° Angle. Pore Size: 1Mm Square Pores Outside Dimensions: 28.5 X 41 X 6.7Mm ( 1.12 X 1.61 X 0.26 ) Inside Dimensions: 26 X 30 X 5Mm ( 1.02 X 1.18 X 0.2 ) , Tissue Floatation Water Bath Specification: ( Thermostatically Controlled ) Inner Tank ( Single Piece ) Made Of Black Anodized Aluminum. Housing Made Of Powder Coated Aluminum. Front Panel Consist Of Temperature Regulator Knob, Mains Switch And Pilot Lamp. Inside Black And Outer Surface Finished In Powder Paint, With Wide Enough Rim For Drying The Wet Slides. Bath Size ( Inner ) -225Mm*70Mm Temperature- Controlled By Capillary Tube Thermostat Temperature Range- +5 Degree C To 70 Degree C , Towel Clips ( Clamps ) Backhause Type Specification: To Secure Surgical Drapes And To Secure Plastic And Rubber Tubing To Drapes Features: Sharp Prong Tips 31 Temporary Crowns Made Of Stainless Steel , Upper Premolar Extraction Forcep English Pattern Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip, Disc / Box Type Of Hinge Joint , Upper Roots Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip , Upper Universal Forcep Specification: Made Of Hard Stainless Steel With Knurnled Handle Grip , Vacuum Investment Unit Specification: Capable Of Mixing Unit Amount Of Investment Material Under Vacuum Through A Motor , Vacuum Mixing Machine Specification: 1. Vacuum Mixing Machine For Mixing Investment Material 2. Electrically Operated Motor 1500 Watts Or More 3. Compact 4. Automatic Regulation Of The Vacuum 5. The Mixing Motor Remains Clean And Is Easily Serviced Due To A Supporting Filter And A Fine Filter In Conjunction With The Maintenance-Free Vacuum Pump 6. Direct Connection Between Mixing Bowl And Vacuum Pump – No Disturbing Exterior Hose 7. Mechanical Coupling Tolock The Mixing Bowl In Position 8. A Mixing Bowls ( 500 G ) Iso 13485 Or Ce Certificate , Vibrator Specification: • Electrically Operated - Size 4.5 X 8 X 6.5 Inches Or Moreplatform Shaperectangular, Type Heavy Duty • Constructionenamel Painted Body With Rubber Plate Above Body, Speed: 3-Speed Vibration Controller • Platform Shaperectangular , Westcott Curved Tenotomy Scissors Specification: 19Mm / 21Mm Made Of Stainless Steel , Casting Machine Motor Cast With Gas Blow Torch Specification: Motor Driven Table Top Casting Machine Gas Blow Torch Based Melting Technique, Ceramic Melting Crucibles Casting Of All Dental Alloy ( Except Titanium ) Size : 700D X 550W X 450H Approximate Power Rating : 3000 Watts , Electrically Operated Dermatome Specification: Designed To Have Large, Uniform-Thickness Skin Grafts Using Electric Power. These Dermatomes Are Typically Handheld Instruments That Include An Electric Powered Rapidly Oscillating Cutting Blade That Is Manually Advanced Over The Skin. Dermatome Kits Include: Handpiece Handpiece Cable Power Supply Wall Cord Width Clips, Guard Plate Dermatome Screwdriver Pin Position Guide Dermatome Power Supply 110-230 Volts Unique Depth Regulation System Guard Always Parallel With Blade Edge. Carrying Case , Induction Casting Machine With Vacuum Pump Specification: Power:Ac220v 50Hz-60Hz 2000Watt Or More Centrifugal Mount:620 R / Min, Melting Type: Induction, Casting Sequence 3-5 Minutes , Maximum Melting Temperature 1700 °C, Maximum Weight Ofalloy To Be Melted 60Gms, Built In Vacuum Pump With Vacuum Adjustment By Digital Software, Vacuum Level 0.7 Bar Or Lesser, Maximum Pressure 3.5 Bar Attachment For Argon Gas Supply. Casting Ring Dimensions Minimum 50 X 55Mm & Maximum 100 X 70Mm Motor Power:350W Or More , Milling Machine Specification: Capable Of Unattended 5-Axis Milling With Simple One- Button Operation Precision Milling Of Wax, Zirconia, Nano Composites And Pmma Blocks Using Fully Automated 8 Position Disc Changer Unit Integrated Air Flow System Keeps Work Area Clean Sintering Unit Sintering Unit Capable Of Maintaining High Temperature Of Around 1500 Degree Celsius For Not Less Than 5 Hours Or More With Vacuum Unit 110-240 Volts 50-60Hz With Cad / Cam Unit Capable Of Unattended 5-Axis Scanning Diagnostic Notification System Alerts User Of Machine Status § Cam Software Material Sizes Supported Disc, Pin & Ingot , Penta Head Microscope Specification: Total Magnification: Penta Head 1+4 , 40X – 1000X Viewing Head - Compensation Free Trinocular Head Inclined At 300 , 3600 Rotatable-Ipd 48 -75Mm Objective Lens: Infinite Plan Achromatic Objectives 4X, 10X, 40X & 100X ( Oil ) Eyepiece- 10X / 22Mm Nosepiece- Reversible Inward Quintuple Nosepiece Condenser- Swing Out / Dual Type Condenser, N.A.0.9 / 0.25 Centre Adjustable Focus- Co-Axial Coarse & Fine Focusing System 0.002Mm Stage- Double Layer Mechanical Stage 185Mm X 142Mm, Cross Travel- 75Mm X 55Mm Illumination-Led Pointer With Brightness Adjustment 24V / 100W Warranty- 2 Years , Power Saw Unit For Osteotomy- Set Specification: Of Microdrill Handpiece 1Pc, Motor Control Unit-1, Foot Switch-1Pc, Micro Reciprocating Saw 1Pc, Micro Sagittal Saw 1Pc & Micro Oscillating Saw 1Pc Micro Drill Hand Piece: 1 No High Speed, Pencil Grip Light Weight Titanium Body Drill – Length 4.6-4.9 Inch, Diameter 19-21Mm, Mass - 0 .12-0.14Kg. Speed: Max Rpm Of 50, 000. Accepts J- Notch Or Straight Shank Burs Sterilizable Through Steam, Eto And Flash Autoclavable, Should Be Supplied With Medium Straight Attachment – 1 No & Long Angled Attachment – 1 No, Short “O” Attachment – 1 No Should Be Usfda & Ce Approved Motor Control Unit: 1 No Touch Screen Display Control For Incorporating Multifunction Into System Interactive Icons Represents Systems. Outputs Represent In Digital Figures Supply 220-240V On 50-60Hz. Can Identify Different Hand Pieces With Display Must Be Equipped With Atleast 3 Ports To Connect 3 Hand Pieces, 2 Ports For Connecting 2 Foot Switches & Integrated Irrigation Facility. Should Be Usfda & Ce Approved Footswitch: 1 No Fully Programmable Footswitch As User Need Able To Control Following Function Via Footswitch Motion – Forward, Reverse. Oscillation. Switch Over To High / Low Speed. Increase Or Decrease Speed. Can Operate 2-3 Hand Pieces Sequentially Attached To The Same Motor Control Unit. Micro Reciprocating Saw: 1 No Should Run From The Same Motor Control Unit Meant For The Micro Drill Should Cut In A Perpendicular Line, Should Have Maximum Speed Of 14000 Cpm, Dimension: Length 165-170Mm, Diameter 18-20Mm, Mass 0.19-0.21Kg Excursion 3Mm, Titanium Body Ensuring Light Weight, Should Run From The Same Motor Control Unit Meant For Neuro Drill, & At Times Can Run Sequentially. Should Be Usfda & Ce Approved Micro Sagittal Saw:1 No Should Run From The Same Motor Control Unit Meant For The Micro Drill. Should Cut In Same Horizontal Plane, Should Have Maximum Speed Of 25000 Cpm. Dimension – Length 134-136Mm, Diameter 19-21Mm, Mass 0.14-0.16Kg Maintenance Free D.C Brush-Less Motor, Snap-Lock Assembly And Disassembly Of All Attachments, Titanium Body Ensuring Light Weight, Sterilizable Through Steam, Eto And Flash. Micro Oscillating Saw: Should Cut In Same Horizontal Plane, Should Have Maximum Speed Of 20000 Cpm. Dimension: Length – 162-164Mm, Diameter – 19 – 21Mm, Mass – 0.180- 0.185Kg, Excursion – 7-8 Degree Arc. Maintenance Free D.C Brush-Less Motor, Snap-Lock Assembly And Disassembly Of All Attachments, Titanium Body Ensuring Light Weight, Sterilizable Through Steam, Eto And Flash Compatible Hand Switch: 1 No Should Be Common To Micro Drill & Micro Saws. Length 150-153Mm, Diameter 23-23.3Mm. It Should Have Safety Switch To Control Operation Of The Hand Piece. Connecting Cord – 2 Nos Should Be At Least 10Ft Long, 3 / 8 Diameter Flexible Electrical Connecting Cord. Dot-To-Dot Type Push-Pull Connectors At Both Ends. Cutting Accessories : Qty – 10 Each For 1.Micro Drill, Sagittal Saw, Reciprocating Saw & Oscillating Saw All Products Quoted Should Be From The Same Manufacturer To Offer Compatibility Of System , Programmable Porcelain Furnace With Vacuum Pump Specification: Power Connection 50-60Hz 200-240 V 50-60Hz Acceptable Voltage Fluctuations ±10% Max. Power Consumption 8.5 Aat 200-240V Data For The Vacuum Pump: Max. Power Consumption: 2.1 A Final Vacuum: < 50 Mbar Use Only Tested Pumps Display Graphic Lcd Display With Background Lighting And Touch Screen Display. Dimensions Of Electrical Fuses 110-120 V: Diameter 6.3 X 32 Mm 200-240 V: Diameter 5 X 20 Mm Dimensions Of The Closed Furnace Depth: 430 Mm Width: 305 Mm / 410 Mm ( With Cooling Tray ) Height: 565 Mm Usable Size Of The Firing Chamber Diameter: 80 Mm Height: 48 Mm Max. Firing Temperature 1200 °C / 2192 °F Weight Furnace Base: 12.0 Kg Furnace Head: 7.0 Kg Safety Notes , Reconstruction Surgical Operating Microscope With Microscopic Co Observation Systems Specification: Working Distance & Focusing- 215-500Mm Continuously Variable Through Motorized Multifocal Lens That Can Be Controlled & Focused Through Hand & Foot Control Switch & Manual Adjustment Override. Magnification Upto 18 X Eyepieces: 12.5 X Powerful Led Or Xenon Based Illumination System Controlled Through Hand & Foot Control Switch & Manual. With Built In Automatic Zoom Synchronized Illumination Field Diameter, Manual Override & Iris Controller. Binocular Tube Tiltable Upto 180 Degrees With Variable Diapter Settings. Suspension System With Height , Lateral Movement Adjustable Floor Stand, With Position Locking Facility. Microscope Should Have Automatic Circuit Breaker, Voltage 230V +- 10%, Frequency 50-60 Hz. Ce / Fda Approved. Beam Splitter: Stereoscopic Beam Splitter Have Minimum Of Four Port. Have Stereo Co Observervation Attachment For Assistant 360° Movement Of Binocular With 12 X Or More Eyepiece With Diapter Setting From +5D To -8D. Face To Face Attachment With 0-180° Tiltable Binocular Tube With 12 X Eyepiece With Stereoscope Having Similar View With Main Surgeon Diapter Setting From +5D To -8D. Full Hd Video Camera Display:Hd Display System Attached With Microscope Body. ( No External Monitor / Detachable Monitor Will Be Acceptable ) . Recording System With Integrated Hdd. Recorder Should Have Hdmi Input & Output. Permit Precise Movement Of Camera & Microscope In Vertical & Horizontal Plane.
Contract Date: Oct 20, 2022 Contract Value : 1
Government Departments No of Bidders 7
West Bengal View Result →
19.
Health and Family Welfare #1417343 AOC
Tender For Supply Of Chemical And Reagents For Mdru Dep , Item Name , Mdru Kits And Reagents , Ammonium Chloride 500Gm , Potassium Bi Carbonate 500Gm , Sodium Chloride 500Gm , Tris Hcl 500Gm , Sds 500Gm , Saturated Phenol 500Ml , Chloroform 500Ml , Sodium Acetate 250Gm , Isoamyl Alcohol 500Ml / 1Ltr , Glacial Acetic Acid 500Ml / 1Ltr , Molecular Biology Grade Agarose Powder 250Gm , Bromophenol Blue Dye 2Ml*5=1Pack , Ethidium Bromide 10Ml , Molecular Weight ( Dna Ladder ) 100Bp & 1Kb 1 Vial , Molecular Weight ( Dna Ladder ) 50Bp 1 Vial , Molecular Weight ( Dna Ladder ) 25Bp 1 Vial , Taq Polymerase 500Units / Vial , Amplitaq Gold Dna Polymerase Master Mix 500Units / Vial , Mgcl2 5Ml , Dntp Mix 1Ml , Dnase 1000 Unit , Rnase 1000 Unit , Proteinase K 1000 Unit , Tris-Edta 500 Gm , Edta 250Gm / 500Gm , Boric Acid 250Gm / 500Gm , Teepol5 Liter , Xylene Cynol 10 Gm , Dmso 50 Ml , Tips I. 0.2 - 20 ?L Tips , Superscript Ii Rnase Reverse Transcriptase / Episcript™ Rnase H- Reverse Transcriptase ( Episcript Rt ) 400 / 500 Reaction Pack. , Power Sybrgreen Pcr Master Mix 5 Ml , Power Sybrgreen Rt Pcr Reagent Kit 5 Ml , Oligo ( Dt ) 12-18 Primer25ug ( 0.5Ug / Ul ) , Absolute Ethanol 500Ml , Pcr Plates ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Sealing Foil ( Rt Pcr / Qpcr Grade ) ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Filter Tips Each Pack Contains 1000 Psc. , Mct Variable Tubes Each Pack Contains 1000 Psc. , I. 20 -200?L Tubes , Ii. 200 - 600 ?L Tubes , Iii. 500 - 2000 ?L Tubes , Nitrile Autodextorous Gloves Each Pack Contains 1000 Psc. , Mctstands For Variable Tubes Sizes Each Pack Contains 10 Psc. , I. 20 -200?L Tubes Stand , Ii. 200 - 600 ?L Tubes Stand , Iii. 500 - 2000 ?L Tubes Stand , Filter Tip Boxes Each Pack Contains 10 Psc. , I. 0.2 - 20 ?L Filter Barrier Tip Box , Ii. 20 - 200 ?L Filter Barrier Tip Box , Iii. 200 - 1000 ?L Filter Barrier Tip Box , Rt Pcr Grade Water Pack Size Of 20Ml ( 20 Ml * 5 ) , Tip Discard Box ( 1-2 Liter Capacity ) Each , Graduated Measuring Cylinders 50, 100, 500, 1000 Ml Each , Graduated Beakers 50, 100, 500, 1000 Ml Each , Flat Bottom Tube 5Ml ( With Screw Cap ) Pack Size Of 500 Psc. , Tube Stand ( 15Ml Falcon, 5Ml, 2Ml, 0.5Ml, 0.2Ml Mct ) Pack Size Of 10 Psc. , Graduated Conical Flask 50, 100, 500, 1000Ml Pack Size Of 5 Psc. , Test Tube 5, 10 Ml Each Pack Contains 100 Psc. , Slide+Cover Slips ( 25Mm*75Mm ) Each Pack Contains 100 Psc. , Tissue Paper Roll Pack Size Of 12 Psc. , Fine Tissue Cloth Roll Pack Size Of 12 Psc. , Cotton Pack Size Of 10 Psc. , Wash Bottle / Dropping Bottle, 200Ml, 500Ml, 1Ltr Each , Funnels Variable Range Each , Plastic Bottle, 200, 500, 1000Ml Each , Syringe + Needle 2 Ml, 5 Ml Pack Size Of 100 Psc. Each , Nitrile Gloves; Medium And Large Size Box Pack Size Of 1000 Psc. , Dna Isolation Kit { Blood } Per Kit , Rna Isolation Kit Per Kit , Phenol 500 Ml , Hno3 ( Nitric Acid ) 500 Ml , Propionaldehyde Pure ( 97% ) 500 Ml , Phthalic Anhydride 500 Ml , Glacialacetic Acid Ar 500 Ml , Hydrochloric Acid Ar 500 Ml , Sulfuric Acid Ar 500 Ml , 2-Amino Ethanol 500 Ml , Pyridine Ar 500 Ml , Ammonia Solution Ar 500 Ml , Ammonia Chloride Ar 500 Ml , Acetyl Salicylic Acid 500 Ml , Acetone Ar 500 Ml , Anthranilic Acid Ar 500 Ml , Activated Charcoal 500 Ml , Silica Gel G 500 Ml , Benzoicacid Ar 500 Ml , Sds 500 Gm , Colin ( Cleaning Detergent Solution ) 500 Ml , Sterilium ( Hand Sanitizer ) 100 Ml * 5 , Dettol / Lifeboy Alcohol Based Hand Sanitizer 100 Ml * 5 , Floor Cleaner Phenyl 1 L * 5 , Cleaning Mop Per Psc , Broom Per Psc , Microwave Gloves Per Pair , Brown Paper For Autoclaving Per Roll , Liquid Nitrogen 10 / 25 Ltr. , Phosphate Buffer Saline ( 10X; Ph 7.4; Rnase Free ) 500 Ml , Formalin ( Formaldehyde Aqueous Solution; Lab Grade ) 500 Ml , Paraffin Wax ( 58-600C For Histology ) 500 Gm , Xylene ( Molecular Lab Grade ) 500 Ml , Glycerol500 Ml , Ammonia ( Nh4oh; Extra Pure ) 250 Ml / 500 Ml , Methanol ( Methyl Alcohol, Ch3oh ) 500 Ml , Acrylamide / Bis Ar 500 Ml , 10X Tbe Buffer 500 Ml , Urea ( Ultra Pure; Mol-Bio Grade ) 500 Gm / 1Kg , Ammonium Persulfate 100 Gm , Temed ( Ultra Pure; Mol-Bio Grade ) 100 Ml / 250 Ml , 4’, 6-Diamidino-2-Phenylindole 50 Ml , Diethyl Pyrocarbonate 5 Gm / 25 Gm , Tae Buffer , Sybr Gold 100Ul , Restriction Enzyme – Mnl I250 / 300 / 500 Units , Restriction Enzyme – Bcli1000 / 1500 / 2500 / 3000 Units , Restriction Enzyme – Hpych4v100 / 500 Units , Restriction Enzyme – Hpych4iii200 / 250 / 1000 / 1250 Units , Restriction Enzyme – Sau96i 1000 Units , Restriction Enzyme – Sfci200 / 1000 Units , Restriction Enzyme – Bcci1000 Units , Restriction Enzyme – Scrfi500 / 1000 / 2500 Units , Restriction Enzyme – Afliii250 / 1250 Units , Restriction Enzyme – Scai500 / 1000 / 1250 Units , Restriction Enzyme – Avai1000 / 2000 Units , Restriction Enzyme – Bsmi200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Tspri ( Also Share Cleavage Site Withtscai ) 1000 Units , Restriction Enzyme – Mboii250 / 300 / 1250 / 1500 Units , Restriction Enzyme – Bsh1236i500 / 1000 / 2500 Units , Restriction Enzyme – Banii1000 / 1500 / 2000 Units , Restriction Enzyme – Mph1103i1000 / 5000 Units , Restriction Enzyme – Dde I200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Bsmb I ( Also Share Cleavage Site Withesp3i ) 200 / 400 / 1000 Units , Restriction Enzyme – Afa I ( Also Share Cleavage Site Withrsa I ) 1000 / 5000 Units , Restriction Enzyme – Bal I ( Also Share Cleavage Site Withmlu Ni ) 50 / 100 / 200 / 250 Units , Restriction Enzyme – Fspi ( Also Share Cleavage Site Withnsbi ) 400 / 500 / 1000 / 2500 Units , Restriction Enzyme – Hpa Ii ( Also Share Cleavage Site Withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 Units , Restriction Enzyme-Hinf I , Restriction Enzyme- Hpych4 , Restriction Enzyme-Mboii , Restriction Enzyme-Bstui , Restriction Enzyme- Mvai , Primers , Fmr1 Set 1 –F5-Tcaggcgctcagctccgtttcggtttca-3 R5-5 Aagcgccattggagccccgcacttcc-3 , Mecp2 Exon 1 Set 1- F5-Gttatgtctttagtctttgg–3´ R5-Tgtgtttatcttcaaaatgt–3´ , Exon 2Set 1-F5-Cctgcctctgctcacttgtt–3´ R5- Ggggtcatcatacatgggtc–3´ , Exon 2Set 2- F5-Agcccgtgcagccatcagcc–3´ R5-Gttccccccgaccccaccct–3´ , Exon 3 Set 1 –F5-Tttgtcagagcgttgtcacc–3´ R5- Cttcccaggacttttctcca–3´ , Exon 3 Set 2- F5-Aaccacctaagaagcccaaa–3´ R5-Ctgcacagatcggatagaagac–3´ , Exon 3 Set 3- F5-Ggcaggaagcgaaaagctgag–3´, R5- Tgagtggtggtgatggtggtgg–3´ , Exon 3 Set 4 – F5-5´–Tggtgaagcccctgctggt–3´ R5- Ctccctcccctcggtgtttg–3´ , Exon 3 Set 5-F5ggagaagatgcccagaggag–3´ R5- Cggtaagaaaaacatccccaa–3´ , Exon3 ( L100v ) - F5-Aaccacctaagaagcccaaa-3 R5- Gcttaagcttccgtgtccagccttcaggta-3 , Putative Promoter And Exon 1. - F5-Gggtgcaatgaaacgctta-3 R5- Tttaccacagccctctctcc-3 , Mc4r Rs17782313 - F 5-Aagttctacctaccatgttcttgg-3 R 5-Ttccccctgaagcttttcttgtcattttgat-3 Fto Rs9939609-F 5-Aactggctcttgaatgaaataggattcaga-3 R5-Agagtaacagagactatccaagtgcagtac-3 , Adipoqrs2241766 – F5- Tgtgtgtgtggggtctgtct-3 R-5-Tgtgatgaaagaggccagaa-3 , Rs1501299- F5- Ctacactgatataaactatatggag-3 R5-Ccccaaatcacttcaggttg-3 , Pcsk1 Rs155971 – F5’Tatatgcagccaccaatcca 3’ R5’Aaaatgaagggagaagcacaaa3’ , Pomcrs6232- F5- Ttgtgcccttcatctgaaca-3 R5- Tgtagcaactttggcatgga-3 , Rs155971- F5tatatgcagccaccaatcca-3 R5-Aaaatgaagggagaagcacaaa-3 , Ppar-G ( Pro12ala ) -F5gcc Aat Tcaagc Cca Gtc-3R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctttcc G-3 , Kcnj11 ( Rs5219 ) -F5-Gactctgcagtgaggcccta-3’ R5-Acgttgcagttgcctttctt-3’ , Capn10 ( Rs3792267 ) -F5-Cacgcttgctgtgaagtaatgc-3’R5-Tgattcc Catggtctgtagcac-3’Pik3ca-Set 1-Forward-5’-Ggagtatttcatgaaacaaatgaatgatgcg-3’ Reverse- 5’-Gagctttcattttctcagttatctt-3’ , Bat 25-Set 1- F 5’-Tcgcctccaagaatgtaagt-3’R 5’-Tctgcattttaactatggctc-3’Bat 26-Set 1-F5’-Tgactacttttgacttcagcc-3’R5’-Aaccattcaacatttttaaccc-3’ , D2s123-Set 1- F5’-Aaacaggatgcctgccttta-3’ R5’-Ggactttccacctatgggac-3’ , D5s346-Set 1- F 5’-Actcactctagtgataaatcggg-3’ R5-Agcagataagacagtattactagtt-3 , D17s250 – Set 1- F5’-Ggaagaatcaaatagacaat-3’ R5’-Gctggccatatatatatttaaacc-3’ , Impdh2 Set 1- F5- Gtttctgcggtatcccaatc -3 R5- Cgagcaagtccagcctat-3 Bmp6 - Rs73719353- F5’-Gctcctttgcacttcgctgt-3’ , R5’-Aggctctgctg Agctcctac-3’ , Bmp6- Rs73719341- F 5’Tgaacttcccattcccctct-3’ R5’Ataaaattagcattgatcca-3’ , Bmp6- Rs73719318 F5’Caggtgctgtgcaacttctt-3’ R 5’Agagggcaccatggttgcct-3’ , Bmp6-Rs73381662 F 5’-Ctgagattcaattaggccca-3’ R 5’Taaagaacagcaaaagtctg-3’ , Bmp6-Rs73381650 F 5’Cacataaagattgctgcatt-3’ R 5’Tagtaatcctaaaaatggga-3’ , Anxa2- Rs7170178 F 5’-Ttcacagcagttcaaaatac-3’ R 5’-Ctgggtttccagagatggaa-3’ , Anxa2 - Rs73435133 F 5’-Gagtgcaaggtgctgaggat-3’ R 5’-Gatttcagacagcccttgca-3’ , Anxa2- Rs73418020 F 5’-Tctgagagtgaaaggtgcac-3’ R 5’-Tcccatcccctgaatccctg-3’ , Anxa2- Rs72746635 F 5’-Cctgactcattgtcacatca-3’ R 5’-Aagtggctttccactgccc-3’ , Anxa2- Rs73418025 F 5’- Cttctcatcttactttt-3’ R 5’- Agggaaggatacagaggaga-3’ , Hsp-70 Primer Sequence5-Agcgt Aacac Cacca Ttcc-3 ( Forward ) 5-Tggct Cccac Cctat Ctc-3 ( Reverse ) , The Gapdh Sequence Forward Primer 5-Agc Cac Atc Gct Gag Aca C-3, Reverse Primer 5- Gcc Caa Tac Gaccaa Atcc-3. , Mthfr F:5-Tgtggtctcttcatccctcgc-3;R: 5-Ccttttggtgatgcttgttggc-3. , Dpyd F:5-Actcaatatctttactctttcatcaggac-3. R: 5-Acattcaccaacttatgccaattct-3. , Tyms F:5’-Ggtacaatccgcatccaactatta-3’ R:5’-Ctgataggtcacggacagattt-3’ , Imp3 Forward:5’Atgactcctccctacccg3’ Reverse:5’Gaaagctgcttgatgtgc3’ , Cxcl1forward: 5’Ccagacccgcctgctg-3’And Reverse:5’Cctcctcccttctggtcagtt-3’ , Cox-2 Forward: 5- Cagccatacagcaaatcc -3; Reverse: 5-Tcgcacttatactggtcaa-3 , Hmlh1f-5 Ttt Tga Tgt Aga Tgt Ttt Att Agg Gtt Gt 3R-5 Acc Acc Tcatcataa Cta Ccc Aca 3 , Ppar-G ( Pro12ala ) - , F5gcc Aat Tcaagc Cca Gtc-3 , R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctt Tcc G-3 , Methylated ( Hmlh1 ) - F-5 Acg Tagacg Ttt Tat Tag Ggt Cgc 3 R- 5 Cct Catcgtaac Tac Ccg Cg 3 , Hmsh2 - F-5 Ggt Tgt Tgt Ggt Tgg Atg Ttg Ttt 3 R- 5 Caa Cta Caa Cat Ctc Ctt Caa Cta Cac Ca 3 , Methylated ( Hmsh2 ) - F- 5 Tcg Tgg Tcg Gac Gtc Gtt C 3 R-5 Caa Cgt Ctc Ctt Cga Cta Cac Cg 3 , ?-Actin: Forward: 5’-Ctacgtcgccctggacttcgagc-3’ ß-Actin: Reverse: 5’-Gatggagccgccgatccacacgg-3’ , Kras-Forward: 5-Gactgaatataaacttgtggtagttggacct-3.Reverse: 5-Ctattgttggatcatattcgtcc-3. , Braf- Forward: 5-Tcataatgcttgctgatagga-3. Reverse: 5-Ggccaaaaatttaatcagtgga-3. , Mthfr ( C677t ) ‘‘5-Gcacttgaaggagaaggtgtc-3” And Reverse Primer ‘‘5-Aggacggtgcggtgagagtg-3” , Mthfr ( A1298c ) Forward ‘‘5-Ctt Tgg Gga Gct Gaa Gga Cta Cta C-3” And Reverse ‘‘5-Cac Ttt Gtg Acc Att Ccg Gtt Tg-3” Primers. , Total Rna Isolation Mini Kit ( From Human Skin Tissue ) / Rneasy Fibrous Tissue Mini Kit ( For Rna Extraction From Human Skin Tissue ) ( Qiagen ) Per Kit ( Each Kit Pack Is For 50 Reactions ) , Purospin™ Fibrous Tissue Rna Purification Kit ( Luna Nanotech ) ( For Rna Extraction From Human Skin Tissue ) Per Kit ( Each Kit Pack Is For 250 Reactions ) , Aurum™ Total Rna Fatty And Fibrous Tissue Kit ( Biorad ) / Mp Biomedicals Fastrna Pro Green Kitper Kit ( Each Kit Pack Is For 50 Reactions ) , Human Leptin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adiponectin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adipsin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Resistin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Iron Elisa Kit ( Serum Iron ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Ferritin Elisa Kit ( Serum / Ferritin ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Gdf15 Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Spexin Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Pai-1-Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Thyroid Estimation Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Ice Maker Machine For Laboratory Purpose 1 Unit , Microwave Gloves Each Packet Contains One Pair Of Gloves. , Pcr Mini Cooler / Coolcube Microplate And Pcr Tube Cooler Each , Horizontal Gel Apparatus: 18 – 20 Cm ( Length ) X 25 – 30 ( Breadth ) X 5- 7.5 Cm ( Height ) , 40-60 Samples, Multichannel Pipette Compatible Combs And Gel Caste Each , Mini-Horizontal Gel Apparatus: 9 Cm W X 11 Cm L With Grooves ( 8.7 Cm L X 1.2 Cm H ) On The Side For Gripping The Gel Tray. It Should Have Two Comb Slots On The Same Tray Area. Buffer Capacity Should Be 600 Ml For The Buffer Tanks And Optimum Gel Runs With A Fill Line Indicator For Buffer Levels Along The Unit Side Each , Multi Size Forceps Lab Set Each Packet Containsmulti Size Forceps Lab Set , Liquid Nitrogen Sample Storage Tanks Each , Liquid Nitrogen Sample Handling Gloves Each Packet Contains One Pair Of Gloves. , L-Mold Each , Tissue Cassette Steel Each , Electric Tissue Float Bath ( Thermostate ) Each , Coupling Jar Each Pack Contains 2 Psc. , Staining Rack Each , Whatman Filter Paper Grade 1 & 2 Each Packet Contains 50 Psc.. , Harri’S Hematoxylin Powder 25 / 50 / 100 / 250 / 500 Gm , Yellow Eosin Powder 25 / 50 / 100 / 250 / 500 Gm , Coverslip 18X18 ( Microscopic ) Each Packet Contains 100 Psc.. , Dpx Mount 100 Ml / 250 Ml , Hot Plate Each , Mx35 Premier Microtome Blade ( 34 / 80Mm ) 50 Blades Each Box Contains 50 Psc.. , Diamond Point Marker Pen ( Histopathology Use ) Each , Embedding Mold And Embedding Ring Each , Qiamp Dna Ffpe Tissue Kit ( 50 Rxns ) , Genomic Dna Purification Kit ( Promega ) , Rna Extraction Kit From Tissue , Cdna Synthesis Kit , Superscript Ii Rnase Reverse Transcriptase , Sybr Green Pcr Master Mix , Sodium Bisulphite , Page Loading Dye , Formamide , N’N’-Methylene Bisacrylamide , Ammonium Persulfate , Temed , Polyacrylamide , Wizard Dna Clean Up System ( Promega ) , 2-Mercaptoethanol , Silver Stain , Hydroquinone , Urea , Blotting Paper , Dna Ladder 10 Bp , Pas Stain , Histopathology Plastic Cassettes , Poly – L – Lysine Coated Slides , Deep Well Mortar And Pestle Homogenizers ( Medium Size ) , Deep Well Mortar And Pestle ( Small Size ) , Rneasy Minielute Cleanup Kit , Phase – Lock Gel Heavy5 Prime Phase – Lock Gel Heavy5 Prime , Qiazol Lysis Reagent , Rneasy Minielute Cleanup Kit , Cryo-Vial 1 Pkt Contains 50 Psc. , Deep Well Mortar And Pestle ( Small Size )
Contract Date: Jul 24, 2023 Contract Value : 25.00 Lakh
Government Departments No of Bidders 2
Madhya Pradesh View Result →
20.
Health and Family Welfare #1366117 AOC
Tender For Supply Of Chemical And Reagent For Mdru Department Third Call , Mdru Kits And Reagents , Ammonium Chloride 500Gm , Potassium Bi Carbonate 500Gm , Sodium Chloride 500Gm , Tris Hcl 500Gm , Sds 500Gm , Saturated Phenol 500Ml , Chloroform 500Ml , Sodium Acetate 250Gm , Isoamyl Alcohol 500Ml / 1Ltr , Glacial Acetic Acid 500Ml / 1Ltr , Molecular Biology Grade Agarose Powder 250Gm , Bromophenol Blue Dye 2Ml*5=1Pack , Ethidium Bromide 10Ml , Molecular Weight ( Dna Ladder ) 100Bp & 1Kb 1 Vial , Molecular Weight ( Dna Ladder ) 50Bp 1 Vial , Molecular Weight ( Dna Ladder ) 25Bp 1 Vial , Taq Polymerase 500Units / Vial , Amplitaq Gold Dna Polymerase Master Mix 500Units / Vial , Mgcl2 5Ml , Dntp Mix 1Ml , Dnase 1000 Unit , Rnase 1000 Unit , Proteinase K 1000 Unit , Tris-Edta 500 Gm , Edta 250Gm / 500Gm , Boric Acid 250Gm / 500Gm , Teepol5 Liter , Xylene Cynol 10 Gm , Dmso 50 Ml , Tips I. 0.2 - 20 ?L Tips , Tips Ii. 20 - 200 ?L Tips , Tips Iii. 200 - 1000 ?L Tips , Superscript Ii Rnase Reverse Transcriptase / Episcript™ Rnase H- Reverse Transcriptase ( Episcript Rt ) 400 / 500 Reaction Pack. , Power Sybrgreen Pcr Master Mix 5 Ml , Power Sybrgreen Rt Pcr Reagent Kit 5 Ml , Oligo ( Dt ) 12-18 Primer25ug ( 0.5Ug / Ul ) , Absolute Ethanol 500Ml , Pcr Plates ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Sealing Foil ( Rt Pcr / Qpcr Grade ) ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Filter Tips Each Pack Contains 1000 Psc. , I. 0.2 - 20 ?L Filter Barrier Tips , Ii. 20 - 200 ?L Filter Barrier Tips , Iii. 200 - 1000 ?L Filter Barrier Tips , Mct Variable Tubes Each Pack Contains 1000 Psc. , I. 20 -200?L Tubes , Ii. 200 - 600 ?L Tubes , Iii. 500 - 2000 ?L Tubes , Nitrile Autodextorous Gloves Each Pack Contains 1000 Psc. , Mctstands For Variable Tubes Sizes Each Pack Contains 10 Psc. , I. 20 -200?L Tubes Stand , Ii. 200 - 600 ?L Tubes Stand , Iii. 500 - 2000 ?L Tubes Stand , Filter Tip Boxes Each Pack Contains 10 Psc. , I. 0.2 - 20 ?L Filter Barrier Tip Box , Ii. 20 - 200 ?L Filter Barrier Tip Box , Iii. 200 - 1000 ?L Filter Barrier Tip Box , Rt Pcr Grade Water Pack Size Of 20Ml ( 20 Ml * 5 ) , Tip Discard Box ( 1-2 Liter Capacity ) Each , Graduated Measuring Cylinders 50, 100, 500, 1000 Ml Each , Graduated Beakers 50, 100, 500, 1000 Ml Each , Flat Bottom Tube 5Ml ( With Screw Cap ) Pack Size Of 500 Psc. , Tube Stand ( 15Ml Falcon, 5Ml, 2Ml, 0.5Ml, 0.2Ml Mct ) Pack Size Of 10 Psc. , Graduated Conical Flask 50, 100, 500, 1000Ml Pack Size Of 5 Psc. , Edta Blood Collection Tube 5Ml Each Pack Contains 100 Psc. , Plain Vial ( For Clot Activator ) Each Pack Contains 100 Psc. , Fluoride Vial Each Pack Contains 100 Psc. , Test Tube 5, 10 Ml Each Pack Contains 100 Psc. , Slide+Cover Slips ( 25Mm*75Mm ) Each Pack Contains 100 Psc. , Tissue Paper Roll Pack Size Of 12 Psc. , Fine Tissue Cloth Roll Pack Size Of 12 Psc. , Cotton Pack Size Of 10 Psc. , Wash Bottle / Dropping Bottle, 200Ml, 500Ml, 1Ltr Each , Funnels Variable Range Each , Plastic Bottle, 200, 500, 1000Ml Each , Syringe + Needle 2 Ml, 5 Ml Pack Size Of 100 Psc. Each , Nitrile Gloves; Medium And Large Size Box Pack Size Of 1000 Psc. , Dna Isolation Kit { Blood } Per Kit , Rna Isolation Kit Per Kit , Phenol 500 Ml , Hno3 ( Nitric Acid ) 500 Ml , Propionaldehyde Pure ( 97% ) 500 Ml , Phthalic Anhydride 500 Ml , Glacialacetic Acid Ar 500 Ml , Hydrochloric Acid Ar 500 Ml , Sulfuric Acid Ar 500 Ml , 2-Amino Ethanol 500 Ml , Pyridine Ar 500 Ml , Ammonia Solution Ar 500 Ml , Ammonia Chloride Ar 500 Ml , Acetyl Salicylic Acid 500 Ml , Acetone Ar 500 Ml , Anthranilic Acid Ar 500 Ml , Activated Charcoal 500 Ml , Silica Gel G 500 Ml , Benzoicacid Ar 500 Ml , Sds 500 Gm , Colin ( Cleaning Detergent Solution ) 500 Ml , Sterilium ( Hand Sanitizer ) 100 Ml * 5 , Dettol / Lifeboy Alcohol Based Hand Sanitizer 100 Ml * 5 , Hypo 4% 5 L , Floor Cleaner Phenyl 1 L * 5 , Serum Separator Vial 3.5 Ml ( Vacutainer Tube, 3.5Ml, 13 X 75Mm, Plastic, Additive: Clot Activator / Polymer Gel, Gold Hemogard Closure, Paper Label ) Pack Size Of 100 Psc. Each , Labolene 1 L / 5 L , Cleaning Mop Per Psc , Broom Per Psc , Microwave Gloves Per Pair , Brown Paper For Autoclaving Per Roll , Liquid Nitrogen 10 / 25 Ltr. , Phosphate Buffer Saline ( 10X; Ph 7.4; Rnase Free ) 500 Ml , Formalin ( Formaldehyde Aqueous Solution; Lab Grade ) 500 Ml , Paraffin Wax ( 58-600C For Histology ) 500 Gm , Xylene ( Molecular Lab Grade ) 500 Ml , Glycerol500 Ml , Ammonia ( Nh4oh; Extra Pure ) 250 Ml / 500 Ml , Methanol ( Methyl Alcohol, Ch3oh ) 500 Ml , Acrylamide / Bis Ar 500 Ml , 10X Tbe Buffer 500 Ml , Urea ( Ultra Pure; Mol-Bio Grade ) 500 Gm / 1Kg , Ammonium Persulfate 100 Gm , Temed ( Ultra Pure; Mol-Bio Grade ) 100 Ml / 250 Ml , 4’, 6-Diamidino-2-Phenylindole 50 Ml , Diethyl Pyrocarbonate 5 Gm / 25 Gm , Tae Buffer , Sybr Gold 100Ul , Restriction Enzyme – Mnl I250 / 300 / 500 Units , Restriction Enzyme – Bcli1000 / 1500 / 2500 / 3000 Units , Restriction Enzyme – Hpych4v100 / 500 Units , Restriction Enzyme – Hpych4iii200 / 250 / 1000 / 1250 Units , Restriction Enzyme – Sau96i 1000 Units , Restriction Enzyme – Sfci200 / 1000 Units , Restriction Enzyme – Bcci1000 Units , Restriction Enzyme – Scrfi500 / 1000 / 2500 Units , Restriction Enzyme – Afliii250 / 1250 Units , Restriction Enzyme – Scai500 / 1000 / 1250 Units , Restriction Enzyme – Avai1000 / 2000 Units , Restriction Enzyme – Bsmi200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Tspri ( Also Share Cleavage Site Withtscai ) 1000 Units , Restriction Enzyme – Mboii250 / 300 / 1250 / 1500 Units , Restriction Enzyme – Bsh1236i500 / 1000 / 2500 Units , Restriction Enzyme – Banii1000 / 1500 / 2000 Units , Restriction Enzyme – Mph1103i1000 / 5000 Units , Restriction Enzyme – Dde I200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Bsmb I ( Also Share Cleavage Site Withesp3i ) 200 / 400 / 1000 Units , Restriction Enzyme – Afa I ( Also Share Cleavage Site Withrsa I ) 1000 / 5000 Units , Restriction Enzyme – Bal I ( Also Share Cleavage Site Withmlu Ni ) 50 / 100 / 200 / 250 Units , Restriction Enzyme – Fspi ( Also Share Cleavage Site Withnsbi ) 400 / 500 / 1000 / 2500 Units , Restriction Enzyme – Hpa Ii ( Also Share Cleavage Site Withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 Units , Restriction Enzyme-Hinf I , Restriction Enzyme- Hpych4 , Restriction Enzyme-Mboii , Restriction Enzyme-Bstui , Restriction Enzyme- Mvai , Primers , Fmr1 Set 1 –F5-Tcaggcgctcagctccgtttcggtttca-3 R5-5 Aagcgccattggagccccgcacttcc-3 , Mecp2 Exon 1 Set 1- F5-Gttatgtctttagtctttgg–3´ R5-Tgtgtttatcttcaaaatgt–3´ , Exon 2Set 1-F5-Cctgcctctgctcacttgtt–3´ R5- Ggggtcatcatacatgggtc–3´ , Exon 2Set 2- F5-Agcccgtgcagccatcagcc–3´ R5-Gttccccccgaccccaccct–3´ , Exon 3 Set 1 –F5-Tttgtcagagcgttgtcacc–3´ R5- Cttcccaggacttttctcca–3´ , Exon 3 Set 2- F5-Aaccacctaagaagcccaaa–3´ R5-Ctgcacagatcggatagaagac–3´ , Exon 3 Set 3- F5-Ggcaggaagcgaaaagctgag–3´, R5- Tgagtggtggtgatggtggtgg–3´ , Exon 3 Set 4 – F5-5´–Tggtgaagcccctgctggt–3´ R5- Ctccctcccctcggtgtttg–3´ , Exon 3 Set 5-F5ggagaagatgcccagaggag–3´ R5- Cggtaagaaaaacatccccaa–3´ , Exon3 ( L100v ) - F5-Aaccacctaagaagcccaaa-3 R5- Gcttaagcttccgtgtccagccttcaggta-3 , Putative Promoter And Exon 1. - F5-Gggtgcaatgaaacgctta-3 R5- Tttaccacagccctctctcc-3 , Mc4r Rs17782313 - F 5-Aagttctacctaccatgttcttgg-3 R 5-Ttccccctgaagcttttcttgtcattttgat-3 Fto Rs9939609-F 5-Aactggctcttgaatgaaataggattcaga-3 R5-Agagtaacagagactatccaagtgcagtac-3 , Adipoqrs2241766 – F5- Tgtgtgtgtggggtctgtct-3 R-5-Tgtgatgaaagaggccagaa-3 , Rs1501299- F5- Ctacactgatataaactatatggag-3 R5-Ccccaaatcacttcaggttg-3 , Pcsk1 Rs155971 – F5’Tatatgcagccaccaatcca 3’ R5’Aaaatgaagggagaagcacaaa3’ , Pomcrs6232- F5- Ttgtgcccttcatctgaaca-3 R5- Tgtagcaactttggcatgga-3 , Rs155971- F5tatatgcagccaccaatcca-3 R5-Aaaatgaagggagaagcacaaa-3 , Ppar-G ( Pro12ala ) -F5gcc Aat Tcaagc Cca Gtc-3R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctttcc G-3 , Kcnj11 ( Rs5219 ) -F5-Gactctgcagtgaggcccta-3’ R5-Acgttgcagttgcctttctt-3’ , Capn10 ( Rs3792267 ) -F5-Cacgcttgctgtgaagtaatgc-3’R5-Tgattcc Catggtctgtagcac-3’Pik3ca-Set 1-Forward-5’-Ggagtatttcatgaaacaaatgaatgatgcg-3’ Reverse- 5’-Gagctttcattttctcagttatctt-3’ , Bat 25-Set 1- F 5’-Tcgcctccaagaatgtaagt-3’R 5’-Tctgcattttaactatggctc-3’Bat 26-Set 1-F5’-Tgactacttttgacttcagcc-3’R5’-Aaccattcaacatttttaaccc-3’ , D2s123-Set 1- F5’-Aaacaggatgcctgccttta-3’ R5’-Ggactttccacctatgggac-3’ , D5s346-Set 1- F 5’-Actcactctagtgataaatcggg-3’ R5-Agcagataagacagtattactagtt-3 , D17s250 – Set 1- F5’-Ggaagaatcaaatagacaat-3’ R5’-Gctggccatatatatatttaaacc-3’ , Impdh2 Set 1- F5- Gtttctgcggtatcccaatc -3 R5- Cgagcaagtccagcctat-3 Bmp6 - Rs73719353- F5’-Gctcctttgcacttcgctgt-3’ , R5’-Aggctctgctg Agctcctac-3’ , Bmp6- Rs73719341- F 5’Tgaacttcccattcccctct-3’ R5’Ataaaattagcattgatcca-3’ , Bmp6- Rs73719318 F5’Caggtgctgtgcaacttctt-3’ R 5’Agagggcaccatggttgcct-3’ , Bmp6-Rs73381662 F 5’-Ctgagattcaattaggccca-3’ R 5’Taaagaacagcaaaagtctg-3’ , Bmp6-Rs73381650 F 5’Cacataaagattgctgcatt-3’ R 5’Tagtaatcctaaaaatggga-3’ , Anxa2- Rs7170178 F 5’-Ttcacagcagttcaaaatac-3’ R 5’-Ctgggtttccagagatggaa-3’ , Anxa2 - Rs73435133 F 5’-Gagtgcaaggtgctgaggat-3’ R 5’-Gatttcagacagcccttgca-3’ , Anxa2- Rs73418020 F 5’-Tctgagagtgaaaggtgcac-3’ R 5’-Tcccatcccctgaatccctg-3’ , Anxa2- Rs72746635 F 5’-Cctgactcattgtcacatca-3’ R 5’-Aagtggctttccactgccc-3’ , Anxa2- Rs73418025 F 5’- Cttctcatcttactttt-3’ R 5’- Agggaaggatacagaggaga-3’ , Hsp-70 Primer Sequence5-Agcgt Aacac Cacca Ttcc-3 ( Forward ) 5-Tggct Cccac Cctat Ctc-3 ( Reverse ) , The Gapdh Sequence Forward Primer 5-Agc Cac Atc Gct Gag Aca C-3, Reverse Primer 5- Gcc Caa Tac Gaccaa Atcc-3. , Mthfr F:5-Tgtggtctcttcatccctcgc-3;R: 5-Ccttttggtgatgcttgttggc-3. , Dpyd F:5-Actcaatatctttactctttcatcaggac-3. R: 5-Acattcaccaacttatgccaattct-3. , Tyms F:5’-Ggtacaatccgcatccaactatta-3’ R:5’-Ctgataggtcacggacagattt-3’ , Imp3 Forward:5’Atgactcctccctacccg3’ Reverse:5’Gaaagctgcttgatgtgc3’ , Cxcl1forward: 5’Ccagacccgcctgctg-3’And Reverse:5’Cctcctcccttctggtcagtt-3’ , Cox-2 Forward: 5- Cagccatacagcaaatcc -3; Reverse: 5-Tcgcacttatactggtcaa-3 , Hmlh1f-5 Ttt Tga Tgt Aga Tgt Ttt Att Agg Gtt Gt 3R-5 Acc Acc Tcatcataa Cta Ccc Aca 3 , Ppar-G ( Pro12ala ) - , F5gcc Aat Tcaagc Cca Gtc-3 , R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctt Tcc G-3 , Methylated ( Hmlh1 ) - F-5 Acg Tagacg Ttt Tat Tag Ggt Cgc 3 R- 5 Cct Catcgtaac Tac Ccg Cg 3 , Hmsh2 - F-5 Ggt Tgt Tgt Ggt Tgg Atg Ttg Ttt 3 R- 5 Caa Cta Caa Cat Ctc Ctt Caa Cta Cac Ca 3 , Methylated ( Hmsh2 ) - F- 5 Tcg Tgg Tcg Gac Gtc Gtt C 3 R-5 Caa Cgt Ctc Ctt Cga Cta Cac Cg 3 , ?-Actin: Forward: 5’-Ctacgtcgccctggacttcgagc-3’ ß-Actin: Reverse: 5’-Gatggagccgccgatccacacgg-3’ , Kras-Forward: 5-Gactgaatataaacttgtggtagttggacct-3.Reverse: 5-Ctattgttggatcatattcgtcc-3. , Braf- Forward: 5-Tcataatgcttgctgatagga-3. Reverse: 5-Ggccaaaaatttaatcagtgga-3. , Mthfr ( C677t ) ‘‘5-Gcacttgaaggagaaggtgtc-3” And Reverse Primer ‘‘5-Aggacggtgcggtgagagtg-3” , Mthfr ( A1298c ) Forward ‘‘5-Ctt Tgg Gga Gct Gaa Gga Cta Cta C-3” And Reverse ‘‘5-Cac Ttt Gtg Acc Att Ccg Gtt Tg-3” Primers. , Total Rna Isolation Mini Kit ( From Human Skin Tissue ) / Rneasy Fibrous Tissue Mini Kit ( For Rna Extraction From Human Skin Tissue ) ( Qiagen ) Per Kit ( Each Kit Pack Is For 50 Reactions ) , Purospin™ Fibrous Tissue Rna Purification Kit ( Luna Nanotech ) ( For Rna Extraction From Human Skin Tissue ) Per Kit ( Each Kit Pack Is For 250 Reactions ) , Aurum™ Total Rna Fatty And Fibrous Tissue Kit ( Biorad ) / Mp Biomedicals Fastrna Pro Green Kitper Kit ( Each Kit Pack Is For 50 Reactions ) , Human Leptin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adiponectin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adipsin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Resistin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Iron Elisa Kit ( Serum Iron ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Ferritin Elisa Kit ( Serum / Ferritin ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Gdf15 Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Spexin Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Pai-1-Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Thyroid Estimation Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Ice Maker Machine For Laboratory Purpose 1 Unit , Microwave Gloves Each Packet Contains One Pair Of Gloves. , Pcr Mini Cooler / Coolcube Microplate And Pcr Tube Cooler Each , Pipette 0.5-10Ul, 02-20Ul, 10-100Ul, 20-200Ul And 100-1000Ul. Each , Horizontal Gel Apparatus: 18 – 20 Cm ( Length ) X 25 – 30 ( Breadth ) X 5- 7.5 Cm ( Height ) , 40-60 Samples, Multichannel Pipette Compatible Combs And Gel Caste Each , Mini-Horizontal Gel Apparatus: 9 Cm W X 11 Cm L With Grooves ( 8.7 Cm L X 1.2 Cm H ) On The Side For Gripping The Gel Tray. It Should Have Two Comb Slots On The Same Tray Area. Buffer Capacity Should Be 600 Ml For The Buffer Tanks And Optimum Gel Runs With A Fill Line Indicator For Buffer Levels Along The Unit Side Each , Multi Size Forceps Lab Set Each Packet Containsmulti Size Forceps Lab Set , Liquid Nitrogen Sample Storage Tanks Each , Liquid Nitrogen Sample Handling Gloves Each Packet Contains One Pair Of Gloves. , Slide Tray / Rack Each , L-Mold Each , Tissue Cassette Steel Each , Electric Tissue Float Bath ( Thermostate ) Each , Coupling Jar Each Pack Contains 2 Psc. , Staining Rack Each , Whatman Filter Paper Grade 1 & 2 Each Packet Contains 50 Psc.. , Harri’S Hematoxylin Powder 25 / 50 / 100 / 250 / 500 Gm , Yellow Eosin Powder 25 / 50 / 100 / 250 / 500 Gm , Coverslip 18X18 ( Microscopic ) Each Packet Contains 100 Psc.. , Dpx Mount 100 Ml / 250 Ml , Hot Plate Each , Mx35 Premier Microtome Blade ( 34 / 80Mm ) 50 Blades Each Box Contains 50 Psc.. , Diamond Point Marker Pen ( Histopathology Use ) Each , Embedding Mold And Embedding Ring Each , Qiamp Dna Ffpe Tissue Kit ( 50 Rxns ) , Genomic Dna Purification Kit ( Promega ) , Rna Extraction Kit From Tissue , Cdna Synthesis Kit , Superscript Ii Rnase Reverse Transcriptase , Sybr Green Pcr Master Mix , Sodium Bisulphite , Page Loading Dye , Formamide , N’N’-Methylene Bisacrylamide , Ammonium Persulfate , Temed , Polyacrylamide , Wizard Dna Clean Up System ( Promega ) , 2-Mercaptoethanol , Silver Stain , Hydroquinone , Urea , Blotting Paper , Dna Ladder 10 Bp , Pas Stain , Histopathology Plastic Cassettes , Poly – L – Lysine Coated Slides , Deep Well Mortar And Pestle Homogenizers ( Medium Size ) , Deep Well Mortar And Pestle ( Small Size ) , Rneasy Minielute Cleanup Kit , Phase – Lock Gel Heavy5 Prime Phase – Lock Gel Heavy5 Prime , Qiazol Lysis Reagent , Rneasy Minielute Cleanup Kit , Cryo-Vial 1 Pkt Contains 50 Psc. , Deep Well Mortar And Pestle ( Small Size )
Contract Date: Jul 21, 2023 Contract Value : 25.00 Lakh
Government Departments No of Bidders 2
Madhya Pradesh View Result →
21.
Health and Family Welfare #1103866 AOC
Supply Of Drugs And Medicines And Other Equipment Year 2021-22-2 Desflurane 240 ml in Aluminum Container 3 5-Fluorouracil (5-FU)(250mg),Injection 4 5-Fluorouracil (5-FU)(500mg Inj),Injection 5 Acamprosate(333 mg),Tablet 6 Acarbose(25 mg),Tablet 7 Acarbose Tab 50mg 8 Aceborophylline 100 mg cap 9 Aceclofenac 100Mg+Paracetamol 325Mg + Serratiopeptidase 10Mg Tab(10x10),Tablet 10 Aceclofenac 100mg+Paracetamol 325mg Tab( ),Tablet 11 Acenocoumarol Tab I.P. 2 mg 12 Actinomycin-D(0.5mg Vial),Vial 13 Acyclovir 5% Ointment/Cream(5gm ),Ointment 14 Adenosine Inj 6 mg/ 2ml (2ml amp) 15 Adrenochrome Monosemicarbazone(0.75mg /ml (2 ml amp)),Injection 16 Advanced RFenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 45cm and should be both hand(foot activated with curved tip),Consumable 17 AGGS(Anti Gas Gangrene Serum) - 10,000 IU/ml 18 AGGS(Anti Gas Gangrene Serum)40000 IU/ml 19 Biotene Tablet 20 Agomelatine 25 mg 21 Albendazole 100 mg 22 Alfacalcidiol capsule(0.25 mcg),Capsule 23 Alkaline Citrate with K oral solution each 10 ml contains sodium citric 1 gram Potassium citrate 0.65 gram citric acid 1 gram Syrup 24 Allopurinol 100 mg Tab 25 Aminoacid 10% (Essential)- IVF 26 Aminoacid 5% - IVF (100ml Bottle) 27 Aminoacid (Essential) Infusion(10% 100ml FFS bottle),Bottle 28 Amino Acid Glass Bottle contain Amino Acid 6 gm, Nitrogen 0.929, Essential Amino Acid 51%, Non Essential Amino Acid 49%, BCCA 22.6%, Carbohydrate 5% - Inj 29 Amino Infusions 200ml Bottle 30 Aminophylline Inj. - 25 mg/ml 10 mg Vial(25 mg/ml 10 mg Vial),Injection Solution for 31 Amiodarone Tab 200mg(200mg),Tablet 32 Amisulpride(100 mg),Tablet 33 Amisulpride(200 mg),Tablet 34 Amisulpride(50 mg),Tablet 35 Amitriptyline Tab. IP - 25 mg 36 Amlodipine 5mg+Atenolol 50mg Tab 37 Amoxicillin 100 mg /ml 10 ml with dropper 38 Amoxicillin Cloxacillin and lactic Acid Bacillus capsules 250mg 39 Amoxicillin Dispersible Tab.USP - 125 mg Tablet 40 Amoxycilline and Clavulanic Acid inj 41 Amphotericin B Inj IP(50 mg),Injection 42 Ampicilline + Cloxacilline Injection (250 mg + 250 mg) Vial Injection 5ml Vial( ),Injection 43 Ampicilline + Cloxacilline Injection Tablet((250 mg + 250 mg)),Tablet 44 Antacid Syrup , 170 ml (Dried Alluminium Hydroxide Gel 200 mg, Simethicon 25 mg / 5 ml, ) Syrup 45 Anti Hemophilic Factor IX complex coagulation factor II,VII,IX,X Concentrate(600 IU Vial),Injection 46 Anti Hemophilic Factor VIII Inj. 500IU 47 Antioxident Capsule 48 Anti Rabies Immunoglobulin inj.150 iu per 2 ml vial 49 Aripiprazole(10 mg),Tablet 50 Aripiprazole 15 mg 51 Aripiprazole 20 mg 52 Aripiprazole 30 mg 53 Artesunate Tablets 50 mg + Sulphadoxine 500 mg + Pyrimethamine 25 mg Tablets IP 54 Ascorbic Acid (Vitamin C) Tab I.P. 500mg 55 Atomoxetine 10 mg 56 Atomoxetine 25 mg 57 Atorvastatin(5 mg),Tablet 58 Atracurium 10mg/ml Inj 2.5ml vial 59 Atropine + Dexamethasone + Chloramphenicol 1% + 0.1% + 0.5% 5 ml 60 Azathioprine 50mg Tab 61 Azithromycin 1 gm, Fluconazole 150 mg, Secnidazole 1 gm Tab Tablet 62 Azithromycin inj - 100mg/5ml 63 Aztreonam Inj(500 mg),Injection 64 Azythromycin 1 gm + Fluconazole 150 mg, + Secnidazole 2 g, Tablet C Tablet 65 Baclofen 20 mg 66 Baclofen 30 mg 67 Baclofen 40 mg 68 Basal Insulin Glargin(100IU/ml (10ml vial)),Injection 69 Basal Insulin- Glargine Injection 300IU Disposable Pen 300IU with 4 needles per pen 31G needle( ),Pens 70 Basal Insulin- Glargine Penfill 300IU With Free Permanent Pens One Pen For Each Five Cartridge And 10 Needles Per Pen 71 B-Complex Minerals with zinc - Cap 72 Beclomethasone Dipropionate, Neomycin Sulphate, Miconazole Nitrate(0.025 % + 0.5 % + 2 % (5 gm Tube)),Ointment 73 Benzathine Penicillin 24 Lac IU / vial Vial 74 Benzoic Acid + Salicylic Acid(6% + 3% (15 gm Tube)),Ointment 75 Benzoyl Peroxide 0.025 20 gm 76 Benzyl Benzoate Application I.P. - 25%w/w (100ml Bottle) 77 Benzyl benzoate emulsion( ),Emulsion 78 Betamethasone sodium phosphate(ml contain Betamethasone NA phosphate equal to 4mg of Betame (1ml Amp)),Injection 79 Betamethasone Valerate Cream 0.05 %(0.05%),Eye Drops/ Ointment 80 Betamethasone Valerate Oint 0.1%(15 gm Tube),Ointment 81 Betamethasone Valerate Oint/Cream IP. - 0.12% 82 Bevacizumab(100 IU Inj (4 ml Vial)),Injection 83 Bicalutamide(50mg ),Tablet 84 Bismuth Iodoform Paraffin Paste 200 gm Jar 85 Black Disinfectant Fluid (Phenyl) as per Schedule O Grade - III 86 Bleomycin 15 mg /vial Vial 87 Bleomycin 15 units / Vial 88 Blonanserin 2 mg 89 Blonanserin 4 mg 90 Blood cell counter key(key),Consumable 91 Bortezomib(2mg),Injection 92 Bortezomib(3.5mg Vial),Injection 93 Bromhexine HCL 4 mg+ Guaiphensin 50 mg + Terbutaline Sulphate 1.25 mg/5ml syp(100 ml Bottle),Syrup 94 Bupivacaine hydrochloride Inj - 0.25% (20 ml Vial)(20 ml Vial),Injection 95 Bupivacaine hydrochloride Inj. - 0.25mg (20 ml Vial) 96 Bupropion 150 mg 97 Buspirone 10 mg 98 Buspirone 5 mg 99 Busulphan 2 mg 100 Butorphanol Tartrate 1mg /ml 1 ml 101 Cabergoline 0.5 mg 4 Tablets / Strip 102 Calcitriol 0.25 mcg 103 Calcium Acetate 667 mg 104 Calcium Carbonate 625 mg, Vitamin - D3 125 IU / 5 ml(100 ml Syrup),Syrup 105 Calcium Carbonate + Vitamin D3 + Zinc(200 ml Syrup),Syrup 106 Calcium Chloride Inj.( ),Injection Solution for 107 Calcium Citrate 500mg With Vitamin D3 200mcg Tablet 108 Calcium Gluconate 200ml Syrup 109 Calcium Leucovorin 50 mg/Vial Inj 110 Calcium Phosphate(2 : 1 Ratio (100 ml bottle)),Syrup 111 Calcium Syp 100ML Syrup (240mg/5 ml) 112 Capecitabine 500 mg tab 113 Capreomycin 1000 mg / vial Injection(10 ml),Vial 114 Carbamazepine 100 mg / 5 ml 100 ml Bottle 115 Carbamazepine(200 mg),Tablet 116 Carbamazepine Tab. - 400mg 117 Carbimazole(10 mg),Tablet 118 Carbondioxide gas in Medium Size Cylinder(B Type),Miscellaneous 119 Carbondioxide gas in Small Size Cylinder(A Type),Miscellaneous 120 Carboplatin(150mg 15 ml Vial),Injection 121 Carboplatin(450mg 45ml Multidose Vial),Injection 122 Carboprost Promithamin-250mcg/ml Inj (1ml Amp) 123 Carboprost Trome Thamine inj USP 0.25mg/ml Vial( ),Injection Solution for 124 Carboxymethylcellulose(5 ml),Eye Drop 125 Carboxymethylcellulose Eye Drop IP 1% w/v 10ml Vial 126 Carvedilol(3.125 mg),Tablet 127 Carvedilol 6.25 mg Tab 128 Cefazolin(1gm),Injection 129 Cefazolin inj 500mg Vial 130 Cefepime 1gm and Tazobactam 125 mg Inj(Vial),Injection Solution for 131 Cefepime(250 mg/vial),Injection 132 Cefepime 500mg/vial Inj(500mg/vial),Injection Solution for 133 Cefixime 100 mg / 5 ml 10 ml Bottle 134 Cefixime 50 mg/5ml, 30 ml, drop(30 ml),Drop 135 Cefixime(50 mg DT),Tablet 136 Cefixime + Azithromycin 200 mg + 250 mg 137 Cefixime Syrup 50mg/5ml(30 ml Bottle),Syrup 138 Cefoperazone 1000mg + Sulbactam 1000mg inj(vial),Injection 139 Cefoperazone 1gm /vial vial 140 Ceftazidime(250mg/vial),Injection 141 Ceftazidime inj(500mg/ vial),Injection 142 Ceftriaxone Tab(250 mg),Tablet 143 Ceftriaxone+Tazobactum 250mg+31.25mg Inj(Vial),Injection Solution for 144 Cefuroxime 750mg powder for Solution for Injection(750Mg),Injection Powder for 145 Centchroman IP (30 mg),Tablet 146 Cetirizine Syrup(5mg/5ml 30 ml bottle),Syrup 147 Cetrimide 15% w/v + Chlorhexidine 1.5% w/v (1 liter bottle)( ),Bottle 148 Cetrimide + Chlorhexidine (conc.) (15%+7.5%) (1 liter bottle)(15%+7.5%),Liquid 149 Cetrimide + Choline Salicylate 0.01% + 8% all W/V 10 gm Tube 150 Cetrimide + Choline Salicylate Gel for oral ulcer 15ml Tube 151 Cetrimide Cream BP(0.1% w/w),Tube 152 Charcoal Activated (Powder) 100 gm box/pouch 153 Chlorambucil(2 mg),Tablet 154 Chloramphenicol 0.5%(5ml),Eye Drop 155 Chloramphenicol 1% w/w 50 /pack 156 Chloramphenicol 500 mg capsule 157 Chloramphenicol Eye Ointment 1% 4 gram( ),Tube 158 Chlordiazepoxide 10 mg 159 Chlordiazepoxide 20 mg 160 Chlorhexidine Gluconate Solution 161 Chloroquine Phosphate Inj. - 64.5mg/ml 30ml Vial( ),Injection Solution for 162 Chloroquine phosphate Syrup. 163 Chlorpromazine Hydrochloride 50 mg Tab 164 Chlorpromazine Tab 50 mg 165 Chlorthalidone 50 mg 166 Cholecalciferol 60000 IU 167 Choline Salicylate + Benzalkonium Chloride 9% + 0.02% 10 gm 168 Chymotrypsin and Trypsin 100000 IU Tab 169 Ciprofloxacin Inj 100 mg/50ml (100ml FFS BFS Bottle) 170 Ciprofloxacin + Tinidazole(250 mg + 300 mg),Tablet 171 Cisplatin( 10 mg Vial),Injection 172 Cisplatin 50 mg inj (50 ml Vial) 173 Clindamycin(150mg/ml (2 ml Vial/Amp)),Injection 174 Clobetasol 0.05% + Gentamicin 0.1% Cream 10 gm(10 gm tube),Cream 175 Clofazimine Cap 50 mg Capsule 176 Clomiphene Citrate 25 mg Tab 177 Clonazepam 0.5mg Tab 178 Clonidine 100 mcg Tab 179 Clopidogrel 75mg + Aspirin 75mg Tab 180 Clotrimazole 1% 100 gm 181 Clotrimazole 1% w/v 15 ml 182 Clotrimazole 1%w/v +Lignocaine 2%w/v(10ml),Eye Drop 183 Clotrimazole 1%w/v +Lignocaine 2%w/v Ear drop 10ml vial BFS/FFS squeeze (10ml vial) 184 Clotrimazole 1% w/w 30 gm 185 Clotrimazole Cream - 1%(15 gm Tube ),Cream 186 Clotrimazole Vaginal 500 mg Tab Tablet 187 Clotrimazole Vaginal Tablet I.P. - 100mg (without applicator) 188 Cloxacillin(125 mg / 5 ml 40 ml Bottle),Syrup 189 Cloxacillin 250 mg / vial vial 190 Cloxacillin Cap(250 mg),Capsule 191 Cloxacillin Capsules 500mg 192 Cloxacillin Sodium Inj. - 500mg 193 Clozapine 25 mg 194 Cold Cough Drop , 15 ml(Phenyl Ephrine 5 mg, Chlorphenaramine 0.5 mg, Paracetamol 125 mg/ 5 ml),Consumable 195 Colistinethate Sodium Inj BP(1 Moillion IU),Injection 196 Compound Sodium Lactate Injection IP (Ringers lactate) 0.24 % w/v of Lactic Acid ( eq. to 0.32% w/v of Sodium Lactate), 0.6 % w/v Sodium Chloride, 0.04 % w/v Potassium Chloride and 0.027 % w/v Calcium Chloride (500 ml Bottle)( ),solution 197 Cream Sumag( ),Cream 198 Crystalline Penicillin 5 lakh IU / vial vial 199 Curved Blade having telescoping shaft(10cm-14cm with integrated hand activation control buttons),Consumable 200 Cyclobenzaprine 5 mg 201 Cyclopentolate 1% w/v(5 ml),Eye Drop 202 Cyclophosphamide(1000mg (Vial/Amp)),Injection 203 Cyclophosphamide 50 mg Tab 204 Cyclophosphamide Inj(200 mg/Vial),Injection 205 Cyclophosphamide inj 500mg/vial(Each),Injection Solution for 206 Cycloserine 250 mg 10 Capsules 207 Cyclosporine 25 mg 208 Cyclosporine 50 mg 209 Cyproheptadine HCL + Tricholine Citrate(2mg + 275 mg / 5 ml (200ml Bottle)),Syrup 210 Cytra.Bine 100 mg vial 211 Dacarbazine(200 mg per vial),Injection 212 Dacarbazine Inj. (DTIC)(500 mg Vial),Injection 213 Daunorubicin( 20 mg / Vial),Injection 214 Daunorubicin 50 mg / vial vial 215 Deferasirox Dispersible Tab. 400mg 216 Desferioxamine Inj 0.5g/vial 217 Desferioxamine Injection 500mg 218 Des Venlafaxine 100 mg 219 Des Venlafaxine(50 mg),Tablet 220 Dexamethasone Sodium Inj 4mg/2ml(2ml Vial),Injection 221 Dexmedetomidine Hydrochloride Injection(100mg),Injection 222 Dexmedetomidine Hydrochloride Injection 1ml Amp(1 ml Amp),Ampoule 223 Dextran IV 40%(500ml ),Injection 224 Dextromethorphan Hydrobromide Syrup 13.5 mg/ 5ml (30 ml Bottle) 225 Dextrose 10% 500ml BFS Bottle( ),Injection Solution for 226 Dextrose(10% Inj 500 ml FFS Btl),Injection 227 Dextrose(25% 100 ml FFS Bottle),Injection 228 Dextrose 25%(500ml FFS Bottle),Injection 229 Dextrose 25% Inj 100ml FFS/BFS Bottle 230 Dextrose 25% Inj 500ml FFS/BFS Bottle( ),Injection Solution for 231 Dextrose 50 %, (25 ml) Inj(50 %),Injection 232 Dextrose 50% Inj 100ml FFS/BFS Bottle 233 Dextrose 5%(500ml FFS Bottle),Injection 234 Dextrose with Saline(5% + 0.9% (500ml FFS Bottle)),Injection 235 Diacerein + Glucosamine 50 Mg + 750 Mg 236 Diazepam 10 mg tab. 237 Diclofenac Gel 1% 10gm Tube 238 Diclofenac + Menthol(30gm),Tube 239 Diclofenac+Paracetamol+Chlorzoxazoe(50 mg + 325 mg + 250 mg),Tablet 240 Dicyclomine 20mg+Paracetamol 325mg Tab 241 Dicyclomine Drops 242 Dicyclomine Hydrochloride 20 mg Tab 243 Dicyclomine Syrup 244 Didanosine 250 mg 245 Didanosine 400 mg 246 Diethylcarbamazine 50 mg 247 Digestive Drop ( Digestive Enzyme And Multivitamin with L Lysine )( 15 ml),Drop 248 Diltiazem 5mg/1ml 5 ml 249 Diltiazem Tablet(60 mg),Tablet 250 Dimercaprol 50 mg / ml 2 ml Amp 251 Dinoprostone Gel(0.5%),Gel 252 Diphenhydramine Syrup 12.5mg/ml 253 Diphtheria Antitoxin 10000 IU (10ml Vial) 254 Diproex ER tablet 500mg(500mg),Tablet 255 Disodium Acid Phosphate + Sodium Phosphate 10 gm + 8 gm /100 ml 100 ml 256 Disodium Hydrogen Citrate 1.25gm/5ml 100 ml(100 ml),Syrup 257 Dispersible Zinc Tab 10mg 258 Disulfiram 250 mg 259 Divalproex Sodium 250 mg 260 Dobutamine 12.5 mg / ml 20 ml Vial 261 Dobutamine inj 50 mg / 5 ml 262 Docetaxel(120mg Vial),Injection 263 Docetaxel -20mg Inj 264 Docetaxel 80mg Inj 265 Domperidone(1 mg/ ml 10 ML with dropper),Drop 266 Domperidone +Ranitidine 150mg Tab 267 Domperidone Suspension 5mg/5ml 268 Donepezil 10 mg 269 Donepezil 5 mg 270 Doxophylline 400 mg 271 Doxorubicin Inj 10mg 272 Doxorubicin(Lypholozed) 10 mg / Vial 273 Doxorubicin(Lypholozed) 50 mg / Vial 274 Doxorubicin (Lypholozed)(50mg Vial),Injection 275 Doxycycline Tab. - 100mg( ),Tablet 276 Doxylamine Succinate 10 mg 277 Doxylamine Succinate + Pyridoxine(10mg+10mg),Tablet 278 DPT with VVM 10 Doses 279 Drop Iron 15ml 280 Drotaverine 80 mg(10x10),Tablet 281 Duloxetine(20 mg),Tablet 282 Duloxetine 30 mg 283 Duloxetine(40 mg),Tablet 284 Dydrogesterone 10 mg 285 Each CombiPack Red Colour Blister Pack Contains 3Tab of Artesunate 150MG and 2 tab of Sulphadoxine Pyrimethamine (500mg + 25mg)( Age Group 9 to 14 Years),Tablet 286 Electrolyte M Inj 500ml FFS Bottle 287 Elemental Iron 50 mg /5 ml 150 ml bottle 288 Elemental Iron 50 mg /ml 15 ml with dropper 289 Eltrombopag 25 mg 290 Enalapril maleate Inj. 1.25 mg per ml( ),Injection 291 Enalapril Maleate Tab 2.5mg 292 Ephedrine 30 mg / ml 1 ml Amp 293 Epinephrine hydrochloride Inj. - 1 mg/ml( ),Injection Solution for 294 Epirubicin(10mg Vial),Injection 295 Epirubicin(50mg Vial),Injection 296 Epirubicin inj 100mg/vial Vial(Each),Injection 297 Eplerenone 25 mg 298 Equine Anti Rabies Immunoglobulin Inj. 299 Erythromycin (as estolate)(125mg/5ml, 60ml Blttle),Suspension 300 Erythromycin (as estolate) powder for susp(125 mg/5ml 40ml bottle),Consumable 301 Erythropoietin 10000IU Inj 302 Erythropoietin(4000 IU Inj Vial),Injection 303 Escitalopram + Clonazepam 10 mg + 0.5 mg 304 Esmolol 100 mg /vial vial 305 Estradiol 10 mg /vial vial 306 Estradiol 1 mg /gm 15 gm tube 307 Estradiol Cypionate + Medroxy Progesterone Acetate 5 mg + 25 mg /0.5 ml 0.5 ml 308 Ethacridine Lactate 1 mg / ml 50 ml 309 Ethamsylate 250mg Tablet 310 Ethamsylate inj(250mg (2ml amp)),Injection 311 Ethamsylate Tab 500mg 312 Ethinyl Estradiol 0.01 mg 10 Tablets 313 Ethinyl Estradiol 0.05 mg 10 Tablets 314 Ethinyl Estriadiol+Norethisterone Tab(35 mcg +1mg),Tablet 315 Etophylline + Theophylline Sr Tablet 231mg + 69mg( ),Tablet 316 Etoposide(100mg Vial),Injection 317 Etoposide 50 mg 8 capsule 318 Everolimus Tab 10mg(4x7),Tablet 319 Fentanyl Citrate Inj 50 mcg/ml(2ml Ampoule),Ampoule 320 Filgrastim 300Mcg Inj 321 Filgrastim 300 Mcg(Prefilled Syrings),Vial 322 Fluconazole 100 mg 323 Fluconazole 200 mg 324 Fluconazole 50 mg 325 Fluconazole Eye Drop 3 mg / ml (10 ml Vial)(3 mg),Eye Drop 326 Flumazenil 0.1 mg / ml 5 ml multiple dose Vial 327 Flunarizine 10 mg 328 Fluoxamine(50 mg),Tablet 329 Fluoxetine 40 mg 330 Flupenthixol 20 mg/ml 1 ml 331 Fluphenazine 2.5 mg 332 Fluphenazine 25 mg / ml 1 ml Amp 333 Flurbiprofen Sodium 0.03% 5 ml 334 Formoterol + Budesonide(6 mcg + 100 mcg/puff (120 MDI)),Inhaler 335 Frusemide 20 mg, Spironolactone 50 mg, Tab Tablet 336 Fusidic acid cream/sodium fusidic ointment 2% 5gm tube(5 gm),Tube 337 Gabapentine 100 mg 338 Gefitinib Tab 250mg 339 Gemcitabine(1000mg Vial),Injection 340 Gemcitabine(1.4 gm Vial),Injection 341 Gemcitabine(200mg/Vial),Injection 342 Gentamicin Inj(40 mg/ml 2 ml Amp),Injection 343 Gentamycin 40 mg /ml 10 ml vial(10 ml vial),Injection 344 Gentamycin + Hydrocortisone 0.3% + 1% 5 ml Vial 345 Glibenclamide tab 2.5 mg 346 Glimepiride + Metformin Hydrocloride Sr Tab 1 mg + 500 mg 347 Glycerine + Mag Sulphate Crystal 250 ml Jar 348 Glycerine + Sodium Chloride Enema 15% + 15% 20-30 ml /pack 349 Glycerine Suppository Usp 3 gm Bottle /10 350 Glycopyrrolate inj. - 0.2 mg/ml (1 ml Amp)(1 ml Amp),Injection Solution for 351 Granisetron 1 mg /ml 1 ml amp 352 Griseofulvin Tab. IP - 125 mg 353 Haemoccel, 500 ml Inj (Electrolight Na, K, Ca, Cl) 354 Haemocoagulase 1 IU /ml 10 ml 355 Haemoglobin tube(Tube),Consumable 356 Haemoglobi pippate(pippate),Consumable 357 Haloperidol 1.5 mg 358 HCG (Human Chorionic Gonadotropin) Inj 5000 IU Vial 359 Hemotocyto meter(Meter),Consumable 360 Heparin 25000 IU 5 ml 361 Hepatitis B Immunoglobulin 100 IU/Vial 362 Hepatitis B Immunoglobulin IM Inj 200 IU/Vial 363 Hepatitis B Vaccine ( Hep-B) 10 Doses 364 Human Albumin 20% (50 ml Vial) 365 Human Chorionic Gonadotropin 2000 IU / ml 1 ml Amp 366 Human Chorionic Gonadotropin Inj 5000 IU 1ml Amp 367 Human Insulin Regular/Soluble(100IU/ml (10ml vial)),Injection 368 Human Insulin Regular/Soluble(40IU/ml (10ml vial)),Injection 369 Human Normal immunoglobin(5gm/100ml),Injection 370 Hydrocortisone sodium succinate inj. 200mg vial( ),Injection 371 Hydroethylstarch 6% Solution with Sodium Chloride 0.9% IV infusion (Hydroxy Ethylstarch Solution FFS/BFS)(0.9% IV),Bottle 372 Hydroxyethylstarch 3%(500 ml),Injection 373 Hydroxyethyl starch 6%(Each),Suspension 374 Hydroxyprogesterone Caproate Inj I.P. 250mg/ml 375 Hydroxypropyle Methyle Cellulose Opthalmic Solution 2% 2ml PFS 376 Hydroxypropyl Methylcellulose Eye Drops(2% 5 ml Vial),Eye Drop 377 Hydroxy Urea(500mg),Capsule 378 Hyoscine butylbromide Inj. - 20mg/ml 379 Ibandronic Acid Inj(6mg),Injection 380 Ibuprofen 100mg + Paracetamol 125mg Per 5 ml Syrup(60 ml Bottle),Syrup 381 Ibuprofen 10mg+Paracetamol 125mg Syrup 382 Icthyol Glycerine 1% 30 ml 383 ID wrist band(Identification for mother/child specific colour)(Wrist band/No),Consumable 384 Ifosphamide 1gm Lyophilised each vial + 3Amp of Mesna 100mg/2ml Inj 385 Ifosphamide + Mesna(1gm),Injection 386 Imatinib 100 mg Cap 387 Imatinib Cap/Tab(100 mg),Tablet 388 Imatinib Mesylate 400 mg 389 Imipenem 250mg+Cilastatin 250mg Powder For Solution(1 Each),Injection Powder for 390 Imipramine 25 mg 391 Inj.IV DNS( ),Injection 392 Insulin aspart in Disposable Pen 300IU with minimum 4 needles per pen 31G needle 393 Insulin aspart Penfill 300 IU with free permanent pen (one pen per five cartridges and ten needles per pen) 394 Insulin Biphasic Lispro 25:75 100 IU/ml (3 ml cartridge)(Firm has to supply compatible pen along with cartridges as and when required without any extra cost),Cartridges 395 Insulin Biphasic/Premix 50:50(100 IU/ml (10 ml vial)),Injection 396 Insulin Biphasic/Premix 50:50(40 IU/ml (10 ml vial)),Injection 397 Insulin Human Mixtard inj. - 30:70( ),Injection Solution for 398 Insulin Intermediate inj 399 Insulin Lispro in Disposable Pen 300IU with minimum 4 Needles per Pen 31G needle 300iu(Prefilled Syringe),Pens 400 Insulin soluble Inj. - 40 IU/ml 401 Insulin Syringe(Each),Consumable 402 Intraocular Irrigating Solution sodium chloride 0.49 % w/v, potassium chloride 0.075 % w/v, calcium chloride 0.048 %, magnesium chloride 0.03 % w/v, sodium acetate 0.39 % w/v, sodium citrate 0.17 % w/v. 500 ml FFS 403 Intravenous Fat Emulsion 20% w/v(20% w/v),Bottle 404 Intravenous Immuglobin (IVIG)(Each),Injection 405 Ipratropium Bromide + Levosalbutamol(20mcg+50mcg, 200 MDI),Inhaler 406 Ipratropium Bromide Powder for inhalation 250mcg/ml 407 Irinotecan 100 mg Inj (1 ml amp) 408 Irinotecan(40mg/Vial),Injection 409 Irinotecan Hydrochloride(100 mg),Injection 410 Iron and folic acid entric coated Tab Dessicated IP 67mg Equivalent to 20mg of elmental iron 411 Iron and folic acid sugar coated Tab Dried Ferrous Sulphate IP eq. to 45 mg ferrous iron and 400 mcg folic Acid IP (Pink Colored Tab) - WIFS Junior IFA tablets (Detail specification as per tender)( ),Tablet 412 Iron Dextran 50 mg / ml(2 ml Amp),Injection 413 Iron Ferrous sulphate folic acid 100ml(Each 5ml contains ferrous sulphate I.P Equivalent to elementary iron 100mg folic acid I.P 0.5mg),Syrup 414 Iron Sucrose 20mg(20 mg),Injection 415 Iron Syrup 200 ml (Elemental iron 40 mg, Ammonium Citrate 200 mg, Cyanocobalamin 7.5 mg, Folic Acid 0.5 mg, Zinc Sulphate 7 mg/ 5 ml) 416 Isoflurane(250 ml Amber Color Bottle),Inhalation 417 Isoflurane Solution (Liquid for Inhalation) 100ml (Amber color bottle) 418 Isoprenaline 2 mg /ml 1 ml 419 Isoxsuprine Hydrochloride Inj. - 5mg/ml (2 ml Amp)(2 ml),Injection Solution for 420 Isoxsuprine Tablets I.P. 20 mg Tablet 421 Itraconazole Cap(100 mg),Capsule 422 Ketamine hydrochloride inj(50mg/ml (10 ml vial)),Injection 423 Ketamine hydrochloride inj. 50mg/ml (2 ml Amp) 424 Ketoconazole Tab 200mg( ),Tablet 425 Labetalol 20 mg / 4 ml Inj (4 ml) 426 Lactobacillus 150 million spores 1 Sachet 427 Lactulose solution 3.35gm/5 ml 428 lactulose syrup(10gm/15ml),Syrup 429 Lamotrigine Dt(50 mg),Tablet 430 Lamotrigine Dt Tab(100 mg),Tablet 431 L-Asparaginase 5000 IU Lyophilised(vial),Injection 432 LetroZole(2.5 mg),Tablet 433 Leuprolide Depot Inj(3.75mg),Injection 434 Levamisole 50 mg 435 Levodopa + Carbidopa 200 mg + 50 mg 436 Levodopa +Carbidopa Tab 250mg + 25mg 437 Levofloxacin 500 mg(100 ml FFS Bottle),Injection 438 Levonorgestrel Emergency Contraceptive(0.75mg),Tablet 439 Lidocaine 2% Inj. - 30 ml Vial( ),Injection Solution for 440 Lignocaine Hydrochloride Topical Solution USP 441 Linazolid(300ml),Injection 442 Linezolid 200mg/100ml(100ml FFS Bottle),Injection 443 Linezolid Tab(600 mg),Tablet 444 Lithium Carbonate 300 mg 445 Lomustine 40mg Cap 446 Lorazepam 1 mg 447 L-ornithine +L-Aspartate 5mg inj 448 Losartan tab - 25 mg(10x10),Tablet 449 Magnesium Hdroxide+Aluminium Hydroxide (625mg+312mg/5ml) 450 Magnesium suplhate inj - 50 % w/v (2ml Amp) 451 Magnesium suplhate injection I.P.50 % w/v 10ml Amp 452 Mannitol(20% 100 ml FFS Bottle),Injection 453 Mannitol Inj,10% 100 ml Bottle 454 Mannitol Inj. 20% 350ml FFS Bottle 455 Mebendazole 100 mg Tab 456 Medroxy Progesterone Acetate 10 mg 457 Medroxy Progesterone Acetate(150mg/ml 1 ml Amp),Injection 458 Mefenamic Acid + Dicyclomine Tab(250 mg + 10 mg),Tablet 459 Mefenamic Acid + Drotaverine Hcl 250 mg + 80 mg 460 Mefloquine 250mg Tab 461 Mehylcobalamine 1500 mcg, Alpha Lipoic Acid 100 mg, Folic Acid 1.5 mcg, Thiamine Mononitrate 10 mg, Pyridoxine HCl 3 mg Cap Capsule 462 Memantine(10 mg),Tablet 463 Menadione USP (Vitamin K3)(10 mg/ml (1 ml Amp)),Injection 464 Mephentermine Inj 15mg/ml 10ml Vial 465 Mesalamine (5-Aminosalicylic Acid) Usp 800 mg 466 Metformin 500mg + Gliclazide 80mg tablet(10x10),Tablet 467 Methocarbamol 100 mg /ml 10 ml 468 Methotrexate(10 mg),Tablet 469 Methotrexate 2.5 mg tab 470 Methotrexate 5 mg 471 Methotrexate(7.5 mg),Tablet 472 Methotrexate Inj 15mg/ml (Vial) 473 Methotrexate Inj 500mg Vial 474 Methotrexate Inj 50mg (2ml) 475 Methylcobalamine (Vitamin B12) 500 mcg /ml 3 ml 476 Methyl Prednisolone(500mg),Injection 477 Methyl Prednisolone sodium succinate inj.1000mg Vial 478 Methyl Prednisolone sodium succinate inj. USP - 125mg(10ml),Vial 479 Metoprolol + Amlodipin 25 mg + 2.5 mg 480 Metoprolol + Ramipril 25 mg + 2.5 mg 481 Metronidazole 0.01 15 gm cream 482 Micronised Progesterone(100 Mg),Tablet 483 Micronised Progesterone 400 mg 484 Micronised Progestrone(200 mg),Tablet 485 Micronised Progestrone 50 mg /ml 4 ml amp 486 Micronised Progestron inj. - 200mg/ml 487 Midazolam Inj. - 1mg/ml 5ml Amp 488 Misoprostol 100 mcg 4 Tables / Pack 489 Misoprostol 400 mcg 4 Tablets / Strip 490 Modafinil 100 mg 491 Mometasone 0.10% 15gm 492 Morphine sulphate inj. IP 10mg/ml(1ml Ampoule),Injection Solution for 493 moxifloxacin(100ml),Injection 494 Moxifloxacine Eye drop 0.5%w/v 495 Multivitamin 10ml Amp Inj 496 multivitamine 200ml Syrup 497 Multivitamin Syrup 60 ml (Each 5ml Contains-Vitamin A (Palmitate) IP 1600 IU+Vitamin D3 IP 200 IU(+Vitamin B2 IP 1.00mg+Vitamin B6 IP 0.50mg+Niacinamide IP 15.00mg+D-Panthenol IP 1.00mg),Syrup 498 Multivitamin without iron Syrup(100ml),Syrup 499 Multivitamin with Protein 200 ml(200 ml),Syrup 500 Multivitamin with zinc Drop 15ml(15 ml),Drop 501 N- Acetyl Cysteine Inj 200mg/ml in 1ml Amp 502 Naltrexone(50 mg),Tablet 503 Neomycin+Bacitricin Ointment 5mg+500 IU/g 504 Azothioprine 50 mg 505 Azothioprine 75 mg 506 Azothioprine 100 mg 507 Neostigmine 30mg 508 Neostigmine 60 mg 509 Netilmycin 25 mg /ml 1 ml Vial 510 Nicorandil 5 mg 10 x 10 511 Nilotinib 150mg Tab 512 Nilotinib 200mg Tab 513 Nimesulide 100 mg Tab 514 Nimesulide +Paracetamol 100 + 325 mg,Tablet 515 Nimesulide +Paracetamol+Serratiopetidase 100 + 325 + 10 mg 516 Nitrofruantoin Tablet IP 100mg 517 Noraderanaline Inj. - 2 mg base/2 ml Amp 518 Norethisterone Enanthate 200 mg/ml 1 ml 519 Norethisterone Tablets 5mg 520 Norfloxacin 200 mg 521 Norfloxacin + Metronidazole Suspension 100mg+100mg/5ml(30 ml Bottle),Bottle 522 Norfloxacin + Tinidazole((100 mg + 100 mg) 30ml Syrup),Syrup 523 Norfloxacin + Tinidazole 400mg Tab 524 Norfloxacin +Tinidazole 400mg Tab 525 Normal Saline Injection 0.9% (500ml FFS Bottle) 526 Nortriptyline 10 mg 527 N S 3% hypotonic(100ml),Injection 528 Octreotide Lar 30mg Injection 529 Ofloxacin 200mg +Tinidazole 600mg Tab 530 Ofloxacin + Dexamethasone 10 ml Eye Drop(10 ml),Drop 531 Ofloxacin Inj 2mg/1ml 100ml 532 Ofloxacin+ metronidazole(30ml),Syrup 533 Ofloxacin + Ornidazole (50 mg + 125 mg) / 5ml 30 ml Bottle(30 ml),Suspension 534 Ofloxacin Suspension 535 Ofloxacin Suspension 50mg/5 ml 30 ml Bottle 536 Olanzapine 10 mg/vial Vial 537 Olanzapine 20mg Tab 538 Olanzapine 2.5 mg 539 Olanzapine 7.5 mg 540 Olopatadine hydrochloride ophthalmic solution USP 01% w/v -5ml( ),Eye Drop 541 Omeprazole 10 mg 542 Omeprazole Capsule(40 mg),Capsule 543 Omeprazole + Domperidone 20 mg + 10 mg(Capsule),Capsule 544 Ondansetron 2 mg 545 Ondansetron 8mg Inj 546 Ondansetron(Drops) Syrup(2mg/5ml (10 ml Bottle)),Syrup 547 Ondansetron Syrup 2mg/ml 548 Ornidazole Tab(500 mg),Tablet 549 Oxaliplatin(100mg),Injection 550 Oxaliplatin(50mg Inj 25 ml Vial),Injection 551 Oxcarbazepine 150 mg 552 Oxcarbazepine(300 mg),Tablet 553 Oxcarbazepine(600 mg),Tablet 554 Oxidized Regenerated Cellulose based Topical Absorbable Hemostat, Structured Non-Woven material, with Bactericidal property. Ease-of-use in both open and minimally invasive procedures(Size 4x 4Approved by US FDA),Consumable 555 Oxytocin(5 IU/ml (2ml Amp)),Injection 556 Oxytocin Inj. - 10 IU/ml 557 Paclitaxel -260mg Inj 43.4ml Vial 558 Paclitaxel-260mg Inj( ),Injection 559 Paclitaxel -300mg Inj 560 Paclitaxel -30mg Inj 561 Paclitaxel Inj 100mg 16.7 ml Vial 562 Paclitaxel Nanoparticle/protein bound particles inj.(100mg Vial),Vial 563 Paliperidone 1.5 mg 564 Paliperidone 3 mg 565 Pancuronium 2 mg / ml 2 ml Amp 566 Paracetamol 100 mg/ml, 150 ml Drop(150 ml),Consumable 567 Paracetamol 150 mg/ml(15 ml Bottle with Dropper),Drop 568 Paracetamol + Chlorphenaramine+ Phenylephrine 250 mg + 2.5 mg + 10 mg 569 paracetamol drop 100 mg/ml 570 paracetamol Drop 10mg/ml 571 Paracetamol + Phenylephrine + Chlorpheniramine Maleate (125mg+2.5 mg+1mg) /ml(15 ml Bottle with Dropper),Drop 572 Paroxetine Cr 12.5 mg 573 Paroxetine Cr 25 mg 574 Pemetrexed(100 mg Vial),Injection 575 Pemetrexed(500mg),Injection 576 Penicillin V 125 mg 577 Penicillin V 250 mg 578 Pentoprazole 40mg, Domperidone 10mg Tab Tablet 579 Pentoprozole 40mg +Domperidone 10mg Tab 580 Permethrin cream 5%(30 mg),Cream 581 Petrollium Jelly IP 500 Gm 582 Phenobarbitine 20 mg/ml, 60 ml, Syp Syrup 583 Phenobarbitone(200 mg/ml),Injection 584 Phenobarbitone syp 200mg/5ml( ),Syrup 585 Phenylepherine Hcl & Tropicamide 5% + 1% 5 ml 586 Phenytoin Sodium 250 mg/ 5 ml Inj (5ml Vial) 587 Phenytoin sodium Inj. - 100 mg( ),Vial 588 Pilocarpine Hydrochloride Eye drops BP 2% 589 Pilocarpine Nitrate Inj. IP 0.5 % w/v(1 ml),Injection 590 Piogliatazone Tab. - 15mg 591 Piogliatazone Tab. - 30 mg 592 Piperacillin + Tazobactam 2000 mg + 250 mg 20ml Vial( ),Injection 593 Piracetam 200 mg /15 ml 15 ml 594 Piroxicam Capsules 20 mg 595 Pistol grip Curved Coagulating Shears with ergonomic handle in the following shaft lengths 23 cm. Can seal blood vessels upto and including(5mm in diameter),Consumable 596 Pistol grip Curved Coagulating Shears with ergonomic handle shaft lengths 45 cm. Can seal blood vessels upto and including(5mm in diameter),Consumable 597 Pneumococcal (Polysaccharide) Vaccine 23 valent/0.5ml inj 598 Potassium chloride inj. - 150 mg/ 10ml 599 Potassium chloride Oral solution 100mg/ml 600 Povidone iodine Cream 250 gm 601 Povidone Iodine Ointment 5% 250gm Jar 602 Povidone Iodine Vaginal Pessary - 200 mg 603 Pralidoxime Chloride Injection I.P.(PAM)-1Gm(20 ml Amp),Injection 604 Prazosin Tab 5 mg 605 Prednisolone 10 mg Tab 606 Prednisolone(5mg),Tablet 607 Prednisolone Eye Drops(10 mg/ml (5 ml)),Eye Drop 608 Prednisolone Tab 20 mg 609 Pregabalin + Methylcobalamin 75 Mg + 750 Mcg 610 Premixed Insulin biphasic analogue 25/75 in Penfill 300IU permanent Pen one pen per five cartidges and ten needles per pen 611 Premixed Insulin Biphasic analogue 30/70 in Penfill 300IU permanent pens one pen per five cartridges and ten needles per pen 612 Procaine Penicillin 4 Lac IU / vial vial 613 Procyclidine 5 mg 614 Promethazine Inj 25 mg/ml (10 ml Vail) 615 Promethazine Syrup. - 5 mg/5ml(60 Ml),Syrup 616 Promethazine Tab 25 mg 617 Proparacaine 0.50% 5 ml /vial 618 Propofol 1%(10ml/5ml 20ml),Injection 619 Propofol Sodium(1% w/v 10mg/ml, 10ml Vial),Injection 620 Propranolol Tr 20 mg 621 Prostaglandin E2 Gel 0.5mg ( 3gm tube) 622 Protamine Sulphate inj 10mg/ml 623 Providone Iodine 1% 1% 5 ml 624 Pyrazinamide 750mg tablet(10x10),Tablet 625 Pyridostigmine 60 mg 626 Quetiapine 200 mg 627 Quinine Dihydrochloride 150 mg /ml 2 ml Amp 628 Quinine dihydrochloride(300mg/ml (2ml Amp)),Injection 629 Quinine Sulphate(IP 600mg),Tablet 630 Rabeprazole 10 mg 631 Rabies Vaccine IP Human (Purified chick embryo cell culture)( ),Vaccine 632 Rabies Vaccine IP Inj Human (Chick embryo/Vero Cell Culture) Intra muscular( ),Injection Solution for 633 Ranibizumab inj (10ml/mg),Injection 634 Ranitidine 15 mg /ml 100 ml bottle 635 Recombiant Factor VII 1mg 636 Recombiant Factor VII 2mg 637 Recombinant Anti - Hemophilic Factor VIII(1000 IU inj / Vial),Injection 638 Recombinant Anti - Hemophilic Factor VIII(250 IU inj / Vial),Injection 639 rh-Erythropoetin 2000 I.U PFS 640 Ribavirin 200 mg Cap( ),Capsule 641 Rituximab -100mg Inj 642 Rituximab -500mg Inj 643 Rosuvastatin. 10 mg 644 Roxithromycin 150mg Tablet 645 Roxithromycin 300 mg 646 Roxithromycin 50 mg / 5 ml 30 ml Bottle 647 S-Adenosyl-L-Methionine 400 mg 648 Salbutamol Sulphate(2 mg),Tablet 649 Salicylic Acid 0.02 30 gm 650 Salicylic acid ointment 6% 651 Salmeterol 25 mcg + Fluticasone 125 mcg Inhaler (120MDI) 652 Salmeterol 25 mcg + Fluticasone 250 mcg Inhaler (120MDI)(250 mcg),Inhaler 653 Secnidazole(500 mg Tab),Tablet 654 Sevoflurane USP Inhalation Anesthetic 250 mL(250 mL),Bottle 655 SICS Blade-Sideport(Sideport Entry knife),Consumable 656 Sildenafil 50 mg tab 657 Silver Nitrate 500 ml Each 658 Silver Sulphadiazine Cream USP 1%(500 gm Jar),Cream 659 Sitagliptin(100 mg),Tablet 660 Sitagliptin(50 mg),Tablet 661 Sodium Chloride 0.3% IV 100ml(1 Each),Injection 662 Sodium Chloride 0.45% + Dextrose 5%(500 ml FFS Bottle),Injection 663 Sodium Chloride 1/2 Normal, Hyper Tonic and Dextrose 5% Inj 664 Sodium Chloride Inj IV 0.9% 500ml (Glass Bottle)( ),Injection Solution for 665 Sodium Chloride (Ophthalmic) 5% 10 ml 666 Sodium Citrate 3.8% - 500 ml 667 Sodium Hypochlorite 0.03 5 Ltr 668 Sodium Thiopentone(500mg),Injection Powder for 669 Sodium Thiopentone Inj. - 0.5 gm powder/vial (20ml Vial) 670 Sodium Valproate(200mg),Tablet 671 Sodium Valproate 500 mg 672 Inj Metheline Blue 673 Soluble Insulin 30% Isophane insulin 70% 100 IU inj 674 Sorafenib(200mg),Tablet 675 Stainic Rack(each),Consumable 676 Sulphadoxine 500mg and Pyrimethamine 25mg Tab. 677 Surfactant bovine(135 mg phopholipid per 5 ml) 5ml vial( ),Vial 678 Surfactant Suspension (For Intratrcaheal) Natural surfactant Inj 25 mg/ml 679 Surfactant Suspension (Intratrcaheal) Bovine 4ml Amp - Natural Inj( ),Ampoule 680 Swine flu vaccine 681 Syp. Alkaline Citrate with K Oral Solution 100ml Syrup 682 Syp. Cetirizine 5mg/5ml 30ml Syrup 683 Syp. Ferric Ammonium Citrate 200mg +Folic Acid 0.5mg+Vitamin B 125mcg+Zinc 5ml Syrup 684 Syphalis Card IGG+IGM S/S above 99.5 % Syrup 685 Syrup 100ml bottle. (5ml 100mg elemental Fe iron & folic Acid Syrup(as per the standards provided)( ),Syrup 686 Syrup 50ml bottle (Each 1 ml Contains 20 mg Elemental Iron and 100 mcg Folic Acid Syrup ( as per the standards provided) With Dropper)) 687 syrup cefpodoxime 50 mg 688 Tadalafil 10 mg 689 Tamoxifen(10 mg),Tablet 690 Tamoxifen(20mg),Tablet 691 Tamsulosin(0.4mg),Tablet 692 Tamsulosin 4mg Tab 693 Tamsulosin + Dutasteride 0.4 mg + 0.5 mg 694 Telmisatran 20 mg 695 Temozolomide(100mg),Capsule 696 Temozolomide -250mg cap 697 Terbutaline Suplhate inj 698 Terbutaline Suplhate Tab. - 2.5mg 699 Terlipressine inj. 1mg/10ml vial(1 Each),Injection 700 testcha(23),Ampoule 701 Tetracycline eye oint 1% 702 Tetracycline Eye Ointment 1% 5 gm 703 Thalidomide 100 mg 704 Thiocholchecocide 4 mg 705 Thiocholchecocide 8 mg 706 Thiopentone Injection 1gm 707 Thyroxine Sodium 25 mcg 100 per bottle 708 Thyroxine sodium Tab 50mcg(100 Tab Bottle) 709 Tianeptin 12.5 mg 710 Tinidazole Tab 300 mg 711 Topiramate 100 mg 712 Topiramate 25 mg 713 Topiramate 50 mg 714 Torasemide(10mg),Tablet 715 Torasemide 20 mg / 2 ml Vial 716 Torasemide Inj 100mg/2ml( ),Injection 717 Torasemide Tab 20mg 718 Total Parenteral Nutrition(Including Carbohydrate + Proteins + Fats Solution 2000 ml),Infusion 719 TPN(Total Parenteral Nutrition) Including Carbohydrate + Proteins + Fats Solution (Brand: Oliclinomel N7 2000 ml) 720 Tranexamic Acid Injection BP/IP(100mg/ml (5ml Amp)),Injection 721 Trastuzumab 440mg Inj. 722 Trastuzumav Inj(440mg),Injection 723 Triamcinolone Acetate - 40mg/ml 724 Tricholine Citrate + Sorbitol(550 mg + 7.15 g/10 ml (100 ml bottle) Syrup),Syrup 725 Trifluoperazine 5 mg 726 Trifluoperazine + Trihexyphenidyle 5 mg + 2 mg 727 Tri-Iodothyronine(T3),Consumable 728 Tropicamide Eye drops 1% 5ml vial 729 Trypan blue-Dye(1ml),Consumable 730 TT with VVM 10 Doses 731 Tuberculin Diluted PPD 5 TU/0.1 ml, 5 ml 732 Ultravist 300mg(50 ml/Vial),Injection 733 Urograffin 76% solution for Injection 20ml Vial 734 Urograffin 76% solution for Injection 50ml Vial Bottle 735 Ursodeoxy Cholic Acid 150 mg Tab 736 Ursodeoxy Cholic Acid 300 mg Tab 737 Vancomycin Hydrochloride(1000mg Vial),Injection 738 Vancomycin Hydrochloride(250mg Vial),Injection 739 Vecuronium Bromide inj 2mg/ml (2ml Amp) 740 Vecuronium Bromide inj 4mg/ml Amp 741 Venlafaxine(150 mg),Tablet Capsule 742 Venlafaxine 75 mg(Cap),Capsule 743 Venlafaxine ER/PR(37.5 mg),Tablet Capsule 744 Ventilator Adult -Model new Port e-360 745 Verapamil Sugar Coated tab IP - 40mg 746 Verapamil Tab 80 mg 747 Vildagliptin + Metformin(50mg + 500mg),Tablet 748 Vinblastine -10mg Inj. 749 Vincristine Sulphate(1mg/ml (cytocristin inj) 1 ml Vial),Injection 750 Vitamin A (Soft Gelatin Cap) 50000 I.U 751 Vitamin B1 10mg, B2 10mg, B6 3mg, B12 15mcg, Niacinamide 100mg, Calcium Panthenol 50mg, Folic acid 1.5mg, Vitamin C 150mg, Biotin 100mcg Or more Tab( ),Tablet 752 Vitamin B1 10mg, B2 10mg, B6 3mg, B12 15mcg, Niacinamide 75mg, Calcium Panthenol 50mg(Folic acid 1.5mg, Vitamin C 150mg, Biotin 100mcg Or more),Tablet 753 Vitamin B12 500 mcg /ml 10 ml vial 754 Vitamin B12 Inj 500 mcg/ml (30 ml Amp) 755 Vitamin B1 (Thiamine) 100 mg 756 Vitamin B1 (Thiamine) 75 mg 757 Vitamin B Complex NFI Formula(100ml Bottle),Syrup 758 Vitamin B Complex NFI Formula(200ml Bottle),Syrup 759 Vitamin B complex Syp 200 ml 760 Vitamin C Tab 500 mg Tablet 761 Vitamin D3 Drop 10ml (Cholecalciferol 400 IU)(10 ml),Drop 762 Vitamin D3 Granules(60000 IU Sachet),Powder 763 Vitamin E 200 mg 764 Vitamin K Inj. - 10 mg/ml 765 Vitamin K Inj (Phytonadione Inj)1mg/0.5ml( ),Injection Solution for 766 Voglibose(0.3mg Tab),Tablet 767 Voglibose Dispersible 0.3mg Tab 768 Warfarin Sodium- 5 mg(5 mg),Tablet 769 Zinc Sulphate 10 mg elemental zinc / 5 ml 100 ml bottle 770 Zinc Sulphate 10 mg elemental zinc / 5 ml 200 ml Bottle 771 Zoledronic Acid(4mg Vial),Injection 772 Zolpidem 10 mg 773 Zonisamide 100 mg 774 Zonisamide 50 mg 775 Prostaglandin E2(Dinoprostone Gel) 0.5 mg PFS 776 Alkaline Citrate with Pottsium 777 amlodipine 5 mg 778 Calcium Citrate - 1000mg (Elemental Ca equivalent to 250 mg and Vitamin D3 400 IU) 779 Calcium with Vitamin D tablets Calcium carbonate 650mg eq. to elemental calcium 250mg and Cholecalciferol 125 IU 780 Calcium with vitamin D tablets USP Calcium carbonate 1.25g eq. to elemental calcium 500mg and Cholecalciferol IP 250 IU 781 Ceftazidime 1gm/vial inj(1 gm/vial),Injection Solution for 782 Ceftriaxone Inj 500mg Vial 783 Ceftriaxone+Tazobactum(1gm+125mg,Vial),Injection 784 Dextrose 5% Inj 500ml FFS/BFS Bottle( ),Bottle 785 Dextrose with Saline 5% + 0.9% Inj 500ml FFS/BFS Bottle 786 Diclofenac Sodium + Paracetamol +Serratiopeptidase 50 mg +325 mg + 10 mg 787 Dispersible Zinc(20mg),Tablet 788 Enoxaparin (20mg/0.2ml)(0.2 ml Prefilled Syringe ),Injection 789 Enoxaparin Sodium 40mg (20mg/0.2ml) Prefilled Syringe Inj( ),Syrings 790 Meropenem(1000 mg (Vial)),Injection 791 Nicotine 14 mg 792 Nicotine 2 mg 793 Nicotine 4 mg 794 Nicotine Transdermal Patch 21 mg 795 Nicotine Transdermal Patch 7 mg 796 Norfloxacine 400mg and Tinidazole 600mg Tablet 797 Ofloxacin Tab - 200mg 798 Pantaprazole 40mg Tab 799 Paraffin Liquid (Liquid Paraffin 1.25ml + Milk of Magnesia 3.75ml + Sodium Picosulphate 3.33ml)- Syrup 800 Pentaprazole Inj. - 40mg 10ml Vial( ),Injection Solution for 801 Piperacillin + Tezobactin(4.5 g),Injection 802 Povidone Iodine Solution-5%(500 ml),Bottle 803 Providone Iodine + Metronidazole 5 % + 1 % 15 gm tube 804 Rabies vaccine IP Human cell culture 2.5 IU/dose (Intra Muscular use) 805 Snake venom Anti Serum IP liquid form( ),Injection 806 Sodium Chloride 0.9% Injection IP 100ml Bottle( ),Injection Powder for 807 Syp. Antacid Mint Flavour 170ml Syrup 808 Inj .Paracetamol Amp. 809 Inj. Cefotaxime 1 gram 810 Inj. Cefotaxime 250 m,g 811 Inj. Ceftazidime 1 gram 812 Inj. Diltizam30 mg 813 Inj. Tetanus Toxoid 5ml vial 814 Tab Misoprostrol 200 mcg 815 A V Fistula Sterilized twin Needle(17 G (two needle pack)),Consumable [700786] 816 A.V. Blood Line (Post Haemodialysis Tubing) [700428] 817 Adult - Double Lumen Catheter Set(Size: 11.5 Fr-12 Fr, 13cm to 15cm (Curved)),Consumable [700824] 818 Adult - Double Lumen Catheter Set(Size: 11.5 Fr-12 Fr, 13cm to 15cm (straight)),Consumable [700823] 819 A-V Blood Lines with AV Pressure Transducer(Acceptable for fitting to all standard Dialyzers ) with side tubing-(FOR Heparinization and AV Pressure monitoring) CE and ISO certificate essential with Protector for all machines types and dialysers(Medical grade PVC Like of Fresenius BAIN (DORA), Dialife ,NIPRO, B RAUN Browndone,Biolight or equivalent Post-pump tubing sets options Medical grade clear tubing Guarded access ports for reduced infection risks Parts of superior quality),Consumable [700787] 820 Dialysis Starting Kit Disposable:A)Sterile Tray with Top(disposable),Size not less than 30x30cm B) Sterile drape size not less than 45x45 cm 1No C) Cotton ball 6 No D)(D) Cotton gauze pieces 1,E) Artery forceps-1 No (Disposable) (MFG By Precious Life Care Pvt Ltd)),Consumable [700770] 821 Fistula Sterilized twin Needle(16 G (two needle pack)),Consumable [700785] 822 Hemodialysis Fluid For Bicarb Made(Part A 10 Ltr +Part B 500gm 2/Pkt),Consumable [700254] 823 Hemodialysis Fluid For Bicarb Made(Part A powder to make 10 Ltr + Part B 500gm 2/Pkt),Consumable [700822] 824 Sterilant Cold Disinfectant For Dialysis Containing Peracetic Acid Hydrogen Peroxide Acetic Acid(5 Ltr Can),Consumable [700820] 825 Sterilant Hot Disinfectant For Dialysis Containing 21% (Approx) Citric Acid, Malic Acid, Lactic Acid(5 Ltr Can),Consumable [700821] 826 1.3/1.4 dora dialiser fluid 827 Almirrah Godrej Type 828 Artery Forceps 829 Attendent bed 2*6 830 Attendent stool 831 Autoclave 16*24 electric (S.S.) 832 Autoclove (large) 12*20 833 Autoclove (Medium) 12*15 834 Autoclove Gasket Small 835 Autoclove Gasket Larg 836 Autoclove Gasket Medium 837 Autoclove indicator Roll 838 B.P.apparatus digital 839 B.P.apparatus Stand Model 840 B.P.Cuff Adult 841 B.P.Cuff Infant 842 B.P.Cuff Paediatric/Child 843 Baby Weighing Machine Digital 3 Digit 844 Bacilocid 845 back Out Solution 5 Lit. 846 Balance With Agitator 847 Bed side locker deluxe (steel) top epoxy powder coated 848 Bed side screen 4 Panel 849 Bed Side Screen 3 Fold 850 Bio waste bucket 10 lit. 851 Bio waste bucket 25 lit. 852 Bio waste bucket 50 lit. 853 Benzoin Powder (For Lab Use) 854 1/2 Ccs Cut Needle 48 mm Stainless Steel Length 45 cm Size 4 855 1/2 Ccs Cut Needle 48 mm Stainless Steel Length 45 cm Size 5 856 1/2 Ccs Cut Needle 48 mm Stainless Steel Length 45 cm Size 6 857 1.3/1.4 Adult Dialyzer (Dialyzer - Multiple use- Hollow Fiber Size as Given Polysulphone or Polyethersulfone) 858 1.5/1.6 Adult Dialyzer (Dialyzer - Multiple use- Hollow Fiber Size as Given Polysulphone or Polyethersulfone) 859 1.5/1.6 Dialyzers multiple use made of polysulphone or Polyethersulfone Low/middle flux, hi performance dialyser Performance enhanced technology with hi biocompatibility Housed in medical grade polycarbonate Openable ends for easy cleaning Caps(for dialysate inlet utlet for safer storage openable caps(Red and Blue)Hi quality sterilisation procedure using gamma radiation and should meetings standards of European CE/ISO13485:2003sterlised),Consumable 860 1%W/V AVAILABLE IODINE IN A NON-OXYNOL WITH SOLUBLE IODINE SURACTANT BASE WITH SODIUM IODIDE(< 1% W/V AND SURFACTANT < 5% W/V 500 ML),Consumable 861 5-0 DA Polyglactin 910 Coated With Polyglactin 910 and Calcium State Mono With 1/4 Circle Spatulated Needle (12 Foils/Pkt) 862 5mm Lap Dissecting Hook(32 cm long),Consumable 863 Abdominal Belt(32 inch Each),Consumable 864 Abdominal Belt(34 Inch Each),Consumable 865 Abdominal Belt(36 Inch Each),Consumable 866 Abdominal Belt(38 Inch Each),Consumable 867 Abdominal Drain Set 28 No 868 Abdominal Drain Set 32 No 869 Absolute alcohol (Ethanol)(1x500 ml = 500 ml),Consumable 870 ACD-A Solution 500ml, Model : PB-1AC500J8B(Packing Size : 2 bags/Foil or 12 foils/box),Consumable 871 Acetone Solution(100 ml Bottle),Consumable 872 Adult - Double Lumen Catheter Set 11.5 F-12 Fr, 13cm (curved), Kit 873 Adult - Double Lumen Catheter Set 11.5 F-12 Fr, 13cm (straight), Set 874 Adult - Double Lumen Catheter Set(Size: 11.5 Fr-12 Fr, 13cm (Curved)),Consumable 875 Adult - Double Lumen Catheter Set(Size: 11.5 Fr-12 Fr,14cm (Curved)),Consumable 876 Adult - Double Lumen Catheter Set(Size: 11.5 Fr-12 Fr, 15cm to (straight)),Consumable 877 Advanced RFenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree Articulation and should be both hand(foot activated),Consumable 878 Advanced RFenergy hand instrument of 5mm shaft diameter for laparoscopic procedure with shaft length 35cm with 55degree Articulation and should be both hand(foot activated with curved tip),Consumable 879 Advanced RFenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 14cm and should be both hand and( foot activated),Consumable 880 Advanced RFenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 25cm and should be both hand and(foot activated),Consumable 881 Advanced RFenergy hand instrument of 5mm shaft diameter for open procedure with shaft length 35cm and should be both hand and(foot activated),Consumable 882 Advanced RF energy hand instruments of 12mm shaft diameter for open procedures with shaft lengths(22cm and should be both hand & foot activated),Consumable 883 Advanced RF energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths (35cm and should be both hand & foot activated with curved tip),Consumable 884 Advanced RF energy hand instruments of 5mm shaft diameter for laparoscopic procedures with shaft lengths(45cm and should be both hand & foot activated),Consumable 885 Advanced RF energy hand instruments of 5mm shaft diameter for open procedures with shaft(lengths 14cm and should be both hand & foot activated with Curved Tip),Consumable 886 Advanced RF energy hand instruments of(5mm shaft diameter for open procedures with shaft lengths 25cm and should be both hand & foot activated with curved tip),Consumable 887 Alkaline Phosphate Kit (Autospan) 888 Alkaline Phosphate Kit (Erba) 889 Alphacypermetherin 5% WDP(as per attached specifications in RC (Confirming to IS 15603 standards To be supplied in in 25kg OR 20kg pack . 1 Metric Ton)),Consumable 890 ALT/GPT 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 891 Aluminium potassim sulphate (Each),Consumable 892 AMBU Bag / Adult each -1700ml, with Oxygen connecting tube ,Should be supplied with a carry pouch , Ambu bag should be complete with required autoclavable valves and other accessories,(Should have silicon rubber bellow to withstand autoclave at 134 deg.C),Consumable 893 AMBU Bag / Resuscitator Silicon 200-250 ml Infant Size-each, with Oxygen connecting tube ,Should be supplied with a carry pouch , Ambu bag should be complete with required autoclavable valves and other accessories,(Should have silicon rubber bellow to withstand autoclave at 134 deg.C),Consumable 894 AMBU Bag (Silicon type) Paediatrics each 1400-1700 ml with Oxygen connecting tube ,Should be supplied with a carry pouch , Ambu bag should be complete with required autoclavable valves and other accessories,(Should have silicon rubber bellow to withstand autoclave at 134 deg.C),Consumable 895 Ammonium sulphate (Analar (GR/AR) (1x500 gm = 500gm),Consumable 896 Amunation Boot, Per Pair as per measurment 897 Ankle Boot, Per Pair as per measurment 898 ANTI A1 LECTION SERA5 ML VIAL(Each),Consumable 899 Anti ABD Grouping Serum 3x10ml Consumable 900 Anti AB Sera IgM 5 ml Vial(Each),Consumable 901 Anti A Sera Igm(10 vial),Consumable 902 Anti B Sera Igm(10 vial),Consumable 903 Anti-D (Polyvalent)(1x10 ml),Consumable 904 Anti D Sera Igg+igM 10ML Vial(Each),Consumable 905 Anti H Sera 10 ml Vial(Each),Consumable 906 APIT(2x4 ml),Consumable 907 Apo-a(100 tests),Consumable 908 Apo-b(100 tests),Consumable 909 ASO Kit(25 test/packet), (Span) 910 AST/GOT 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 911 Auto cleanser for CBC machine(4 liter),Consumable 912 Auto dill solution for CBC machine(20 liter),Consumable 913 Auto Lyser solution for CBC machine(500ml),Consumable 914 Babcock- Laparoscopic 10mm a traumatic Babcock, Straight 360 Degree rotating with Insulated shaft, a traumatic jaws with Ratchet Mechanism, plastic grip(36 cms length, Independently moving jaws),Consumable 915 Babcock- Laparoscopic 5mm a traumatic Babcock, Straight 360 Degree rotating with Insulated shaft, a traumatic jaws with Ratchet Mechanism, plastic grip(36 cms length, Independently moving jaws),Consumable 916 Barium Chloride 10% (500 ml Bottle) 917 Barium Chloride 10%(MFG- Precious Life Care Pvt Ltd)(500 ml bottle),Consumable 918 Basic Carbol Fuchsin for AFB Staining(MFG- Precious Life Care Pvt Ltd)(25 gram/packet),Consumable 919 BCG(1 ml Each),Syrings 920 Syrum Bilirubin Total/Direct (Autospan/Erba) 921 Blood culture media fungus- bottles per year, Fungus Can Be tested by all quoted bottles. In the same bottle bacteria and fungus can be tested.; Fungus Can Be tested by all quoted bottles. In the same bottle bacteria and fungus can be tested.(-),Consumable 922 Blood Grouping Anti Sera A Monoclonal : Antisera Should Be Transparent With More Than One Year Shelf Life At 2-6 C , It Should Give +++ Agglutination At 1.256 Dilution In 3-4 Sec With A Positive Cells 10 ml 923 Blood Grouping Anti Sera B Monoclonal : Antisera Should Be Transparent With More Than One Year Shelf Life At 2-6 C , It Should Give +++ Agglutination At 1.256 Dilution In 3-4 Sec With B Positive Cells 10 ml 924 Blood Grouping Anti Sera D Monoclonal :-Antisera Should Be Transparent With More Than One Year Shelf Life At 2-6 C, It Should Give +++ Agglutination At 1.256 Dilution In 3-4 sec With D Antigen Positive Cells. 10ml Vail (Eryclone Anti-D IgM) 925 Blood Urea (Autospan/Erba) 926 Blood Vessel Introducers Needles 16G, Sterilized, Set 927 Bone Wax Sterilised(2 Gm/Packet),Consumable 928 Bovine Albumin (22% w/v)(1x5=5 ml),Consumable 929 Bovine Albumin(Each),Consumable 930 Brain Thromboplastin(5ml Bottle (MFG- Tulip Diagnostics)),Consumable 931 Brain Thromboplastin For Prothrombin Time (PT Reagent) 5ml (Liquiplastin) 932 Calcium Arsenazo 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 933 Cannula Fixer Set Consumable 934 Carelyte 503(Calibrator 1&2),Consumable 935 Carelyte 503(Complete tubing set),Consumable 936 Carelyte 503(Enzyme Cleaning solution),Consumable 937 Carelyte 503(Pottasium electrode),Consumable 938 Carelyte 503(Pump Tubing),Consumable 939 Carelyte 503(Refernce electrode),Consumable 940 Carelyte 503(Sodium electrode),Consumable 941 Carelyte 503(Thermal printer roll),Consumable 942 Chromic Catgut (12 Foils/Pkt)(Size:1/0 length 150 cm),Consumable 943 Chromic Catgut Monofilament With 1/4 Circle Reverse Cutting Needle 6-0 ( 12 / Pkt ) 944 Chromic Catgut No 1.0 Round Dody, 40 mm 12 foils/pkt 945 Chromic Catgut , Round Body Needle No. 1.0 946 Chromic catgut suture (12 Foils/pkt)(3/8 Cir R Cutting Needle 19 mm needle, Suture Length 76 cm Size 4/0),Needle 947 Chromic Catgut Suture(3/8 Cir RCutting Needle 16 mm, Suture Length 76 cm(5/0 12 Foils/pkt)),Sutures 948 Chromic Size - 1, (12 Foils/Pkt)(1/2 Cir RB Needle 40 mm, Length 76 cm),Needle 949 Chromic Size - 1, 12 Foils/Pkt(1/2 Cir RB Needle 45 mm, Length 100 cm),Needle 950 Chromic with 1/2 Cir RB Needle 20 mm length 76 cm, 3-0 USP, Absorbable Surgical Suture Surgical Material 12Foils/Box 951 Chromic with 1/2 Cir RB Needle 30 mm length 76cm, 2-0 USP, Absorbable Surgical Suture Surgical Material 12 Foils/Box 952 Chromic with 1/2 Cir RB Needle 40 mm Length 76 cm (With Needle) ) Absorbable Surgical Sutures USP,(Size 1, 12 foils/pkt),Surgical Material 953 Chromic with 1/2 Cir RB needle SIZE:1/0, 30 mm length 76cm Absorbable Surgical Suture Surgical Material 954 Chromic with CD cutting needle 12 mm length 70cm Size:3/0 955 Chromic with CD RB Needle 30 mm length 76 cm Size:2/0 Absorbable Surgical Suture Surgical USP, 12 Foils/BoxMaterial 956 Chromic with CD.RB Needle Absorbable Surgical Suture (12 Foils/Pkt)(40 mm Length 76 cm Size:1/0),Surgical Material 957 Chromic with ST RB Needle (12 Foils/Pkt)(60 mm length 76 cm Size:2/0),Consumable 958 Citric Acid Analar/GR/AR (1x500 gm = 500gm),Consumable 959 Cleanac-3 4000 Pack Size 5L(Cell Counter (Model No- MEK-6420P-Japan)),Consumable 960 Cleanac 3N-5Litre Solution(Each),Consumable 961 Cleanac-4000 Pack Size 5L(Cell Counter (Model No- MEK-6420P-Japan)),Consumable 962 Cleanac 5 litre Solution(Each),Consumable 963 Close Wound Drainage Device Under Negative Pressure(closed wound suction unit) Size 200 ml(catheter size 16),Consumable 964 Close Wound Drainage Device Under Negative Pressure(closed wound suction unit) Size 200 ml(catheter size 18),Consumable 965 Cloth based surgical adhesive tape Roll(1 inch x 5 mtr / Roll),Consumable 966 Coated Polyster Braided With CD White D Needle 25 mm (curved reverse cutting or curved round body or taper cut) Size:2/0 967 Coated Polyster With CD Green Needle 17 mm (curved reverse cutting or curved round body or taper cut) Size:2/0 Length 90cm 968 Collagen Sheets - 10 x 10 cm sheet 969 Complete Absorbable mesh fixation device with minimum strap length 7mm2point fixation to hold the mesh and device should be of (25 absorbable straps),Consumable 970 Conc HCl (1x500 ml = 500 ml),Consumable 971 Conc Washing Solution 500 ml(Model BA 400 System (Mfg ByBio System)),Consumable 972 Coombs AHG Sera 5ml(Each),Consumable 973 Coombs reagent 5 ml Bottle(Each),Consumable 974 Coombs serum (Anti human Globulin) (Polyvalent)(1x5=5 ml),Consumable 975 Corrugated Drainage Sheet, Sterile, Multichannel, Single Use(2 inch x 6 inch (PVC)-Piece),Consumable 976 Cotton Delivery Belt 977 Cover Slip 18 X 18 mm - 10gm 978 CPK-MB Kit (Kinetic) 25 Test/Kit 979 Creatinine MFG by Ba 400 Biosystems Diagnostics Pvt Ltd(600 ml),Consumable 980 CRP (HS)(100 tests),Consumable 981 CRP test KIT(Latex/Card),kit of 25 tests(MFG- Pathogyme Diagnostics)(25 Test / Kit),Consumable 982 CRP Test Kit (Autospan) 983 Curved Scissors- Laparoscopic 5mm size, 360 Degree rotating with insulated shaft, Non Ratchet , plastic grip(36 cms length, Monopolar pin provision for usage with Electro surgical Unit, Independently moving jaws),Consumable 984 CVP Line Complete Set 985 Cyanemeth solution for Hb(MFG By Beacon Diagnostic)(5 Lit Can),Consumable 986 Cytochrome stain with buffer (500 ml),Consumable 987 D-Dimer(10x3 ml),Consumable 988 Dengue Card Test 100 Test Kit 989 Developer Powder (22.5 Ltr) 990 Developer Single Bath Liquid Concentrated Of Consistent Quality. It Sould Have Favoutable Contrast/Fog Ratio And Good Shelf Life-2 Lit Can( To make 9 Liters working solution) (Bromodex MP Developer Concentrate) 9Ltr Packing 991 Developer Single Bath Liquid Concentrated Of Consistent Quality. It Sould Have Favoutable Contrast/Fog Ratio And Good Shelf Life-3 Lit Can( To make 13.5 Liters working solution) (Bromodex MP Developer Concentrate) 13.5 Ltr Packing 992 Dexamethasone + Gentamycin Eye Drop 0.1%+0.3% 993 Dialysis Starting Kit Disposable:A)Sterile Tray with Top(disposable),Size not less than 30x30cm B) Sterile drape size not less than 45x45 cm 1No C) Cotton ball 6 No D)Cotton gauze pieces 1 994 Dialysis Starting Kit Disposable:A)Sterile Tray with Top(disposable),Size not less than 30x30cm B) Sterile drape size not less than 45x45 cm 1No C) Cotton ball 6 No D)(D) Cotton gauze pieces 1,E) Artery forceps-1 No (Disposable) (MFG By Precious Life Care Pvt Ltd)),Consumable 995 Dionised Water 5 Ltr Cane(Each),Consumable 996 Diphenhydramine inj 50mg/ml 997 Disinfectant Renaclean Cold Sterilant (5 Ltr Can) 998 Disinfectant Renasteril Hot Disinfectant (5 Ltr Can) 999 Disinfectant With Stabilizer By 0.01%W/V Agn03 And H2p04(Each),Consumable 1000 Disposable(24-G Each),Needle 1001 Disposable Appron Consumable 1002 Disposable Cap 1003 Disposable cup for Urine-Sputum 30ml 80 to 90 mm Diameter 100/pkt 1004 Disposable Dust Mask - JL246C Equivalent to N-95 Mask 1005 Disposable Examination Gloves made of natural rubber latex, Pre-powdered, Non-Streile, Conforming to IS 15354:2003 and amendment thereof. Size:- Large 1006 Disposable Examination Gloves made of natural rubber latex, Pre-powdered, Non-Streile medium 1007 Disposable Examination Gloves made of natural rubber latex, Pre-powdered, Non-Streile small 1008 Disposable Needle 20-G-NO-ISI Marked 1009 Disposable Needles 22G Consumable 1010 Disposable Needles 23G 1011 Disposable Needles 26G X 1/2 Consumable 1012 Disposable Needles IS 10654:2002 22G 1013 Disposable Needles IS 10654:2002(23G),Needle 1014 Disposable Needles IS 10654:2002 24G 1015 Disposable Needles IS 10654:2002 26 G 1016 Disposable Needles IS 10654:2002 26G x 1/2 1017 Disposable Pricking Lancet (Pkt of 200 Units) 1018 Disposable Sharp Collection Containers(1.5 L MFG By - Precious life Care),Each 1019 Disposable Sharp Collection Containers(5 L (MFG By - Precious life Care)),Each 1020 Disposable Spinal Needle 18 no 1021 Disposable Spinal Needle 22 no 1022 Disposable Spinal Needle 23 no 1023 Disposable Spinal Needle, Mfg by Alpha Medicare and Devices Pvt. Ltd.(23 no),Needle 1024 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made of hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422, 6.5 inch / pair 1025 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made of hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422, 7.5 inch / pair 1026 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made of hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422, 7 inch / pair 1027 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made of hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422-92, 6 inch / pair 1028 Disposable Sterile Gloves ISI Marked Surgical Rubber Hypoallergenic Latex 100% Powder free 7 1/2 Inc 1029 Disposable Sterile Gloves ISI Marked Surgical Rubber made of Hypoallergenic Latex 100% Powder free 6 1/2 Inches 1030 Disposable Sterile Gloves ISI Marked Surgical Rubber made of Hypoallergenic Latex 100% Powder free 6 Inches 1031 Disposable Sterile Gloves ISI Marked Surgical Rubber made of Hypoallergenic Latex 100% Powder free 7 Inches 1032 Disposable Sterile Gloves ISI Marked Surgical Rubber Made of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422-92, Powder Free 6.5 inch / pair 1033 Disposable Sterile Gloves ISI Marked Surgical Rubber Made of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422-92, Powder Free 6 inch / pair 1034 Disposable Sterile Gloves ISI Marked Surgical Rubber Made of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422-92, Powder Free(7.5 inch / pair),Consumable 1035 Disposable Sterile Gloves ISI Marked Surgical Rubber Made of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / ETO IS No : 13422-92, Powder Free 7 inch / pair 1036 Disposable syringe (FOR VITAMIN K INJ)(1ml with needle 26G),Consumable 1037 Disposable Syringes Is 10258:2002 With Needle Is 10654:2002 10ml 1038 Disposable Syringes IS 10258:2002 With Needle IS 10654:2002 CGS 10CC (In Ribbon Pack) 1039 Disposable Syringes IS 10258:2002 With Needle IS 10654:2002 CGS 2CC (In Ribbon Pack) 1040 Disposable Syringes IS 10258 2002 With Needle IS 10654 2002 CGS 5CC In Ribbon Pack 1041 Disposable Syringes Is 10258:2002 With Needle Is 10654:2002, Mfg by PH Health Care Pvt Ltd(10ml),Consumable 1042 Disposable Syringes With Needle - CGS 10CC Consumable 1043 Disposable Syringes With Needle - CGS 2CC Consumable 1044 Disposable Syringes With Needle - CGS 5CC Consumable 1045 Dissecting Hook having telescoping shaft(10cm-14cm with integrated hand activation control buttons),Consumable 1046 Distilled water 5 litre(Each),Consumable 1047 DJ Stent For Ureter 6 Fr 1048 DJ Stent For Ureter 8 Fr 1049 Double Blood Bag 450 Ml Cpda(Each),Consumable 1050 Double Lumen Hoemodialysis Catheter With PUR Ext Tube 1051 Double Lumen Polyurethane CVP Catheter 4 to 5 Fr(Length 8 to 13 cm),Consumable 1052 Double Lumen Polyurethane CVP Catheter, 5 Fr, G-17 x 20, Length 15cm 1053 Double Lumen Polyurethane CVP Catheter, 5 Fr, G-17 x 20, Length 8cm 1054 Double Lumen Polyurethane CVP Catheter 5 Fr(Length 13 to 15 cm),Consumable 1055 DPX(1 x 250 Lit),Consumable 1056 Drabkin solution for Hb (1x5 lit),Consumable 1057 Drop Paracetamol 100mg/15ml 1058 Dusting Powder, 10 gm ( Neomycin Sulphate 5 mg, Baccitracin 250 Unit, Sulphacetamide Sodium 60 mg) 1059 EA- 50 (Modified) (For cytology)(1x125 ml),Consumable 1060 ECG Paper(Chemical Coated) 50mm x 20mm Roll 1061 ECG Paper(Chemical Coated) 50mm x 30 mtr. Roll 1062 ECG Paper (Chemical Coated)(80mmx 20 mtr Each),Consumable 1063 ECG Paper Computerizesd Triple Channel 20m 1064 ECG Paper Computerizesd 6 Channel 20m 1065 ECG Paper Computerizesd 12 Channel 20m 1066 ECG Roll Three Channel 20m 1067 EDTA Solutions K3(MFG By Himedia)(500 ml Bottle),Consumable 1068 Edta Vaccutainer 3 Ml + Needle(Each),Consumable 1069 EDTA Vial 1070 EGC Roll 66 mm x 15 mm 1071 EGC Roll, Mfg by Life-O-Line Technologist(66 mm x 15 mm roll),Consumable 1072 Ehrilichs Aidehyde Reagen (2x250 ml),Consumable 1073 Electrolyte Solution A 250ml(250ml),Consumable 1074 Electrolyte Solution B 250ml(250ml),Consumable 1075 Endotracheal Tube Internal Dia 2.5 mm to 5 mm 1076 Endotracheal Tube Internal Dia 5.5mm to 9.5mm 1077 Endotracheal Tube Internal with radioopaque line(Dia 2.5 mm to 5 mm),Consumable 1078 Endotracheal Tube,Soft cuff towards the distal end Kink resistant inflation tube Murphy eye at distal end with polished smoothness Standard 15 mm connector Sterile, single use Curved shaped blister pack-suiting the shape of product(Size 3),Tube 1079 Endotracheal Tube, Soft cuff towards the distal end Kink resistant inflation tube Murphy eye at distal end with polished smoothness Standard 15 mm connector Sterile, single use Curved shaped blister pack-suiting the shape of product(Size 4),Tube 1080 Endotracheal Tubes Size 5.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Combi Blister Pack 1081 Endotracheal Tubes Size 5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1082 Endotracheal Tubes Size 6.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1083 Endotracheal Tubes Size 6 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1084 Endotracheal Tubes Size 7.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1085 Endotracheal Tubes Size 7 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1086 Endotracheal Tubes Size 8.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1087 Endotracheal Tubes Size 8 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1088 Endotracheal Tubes Size 9.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue Line 1089 Endotracheal Tubes Size 9.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque line(Size 9.5),Consumable 1090 Endotracheal Tubes Size 9 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue(25 Each),Consumable 1091 Endotreheal Tube Size 3 Cuffed -Piece, Should Have Silicon Tube With Radio Opaque Blue Line 1092 Endotreheal Tube Size 4 Cuffed -Piece, Should Have Silicon Tube With Radio Opaque Blue Line 1093 Enema 100 ml (Sodium acid Phosphate 10 gm, Sodium Phosphate 8 gm / 100 ml) 1094 Eosin 2% solution (1x250 ml),Consumable 1095 Esbachs reagent (125 ml),Consumable 1096 Exchange Transfusion Catheter With Four Way Adaptor Size- 4 cm, L-40 cm 1097 E-Z Cleaner 100ml(Each),solution 1098 Factor IX deficient plasma (<1%)(10x1 ml),Consumable 1099 Factor VII deficient plasma (<1%)(10x30 ml),Consumable 1100 FDP Kit(4 ml),Consumable 1101 Femoral Catheters Double Lumen Kit Curved Double Lumen Catheter Set 12 F (Curved) Adult, Set 1102 Femoral Catheters Single Lumen Set Adult(Size - 6F to 8F, length 13 cm to 15 cm),Consumable 1103 Femoral Catheters Single Lumen Set pediatric(Size - 3F to 4F, length 13 cm to 15 cm or less),Consumable 1104 Femoral Catheters Single Lumen Size Adult (Set of 12 different sizes), Set 1105 Femoral Catheters Single Lumen Size Size Pediatrics (Set of 12 different sizes), Set 1106 Femoral Guide wires : Straight (0.325 mm size) Should Meet the following standards : European CE, ISO13485, Sterile, FDA, Set 1107 Femoral Guide wires : Straight/j Tip((0.325 mm size) Sterile: CE/ISO13485 Marked),Consumable 1108 Ferric Ammonium Citrate 200mg, Folic acid 0.5mg 1109 Fistula 16G, Single Sterilized ETO Single Needle Packing 1110 Fistula 17G, Single Sterilized ETO Single Needle Packing 1111 Fistula and wound management system(size 104-159 mm),Consumable 1112 Fistula and wound management system(size 156-228 mm),Consumable 1113 Fistula and wound management system(size 208-297 mm),Consumable 1114 Fistula Sterilized twin Needle(16 G (two needle pack)),Consumable 1115 Fixer: It shall be powder fixer to produce clean radiographs available in pack size Size:- 13.5 Ltr 1116 Fixer: It shall be powder fixer to produce clean radiographs available in pack size Size:- 9 Ltr 1117 Fixer Powder (Bromex Acid Fixer With Hardner) ( 22.5 Ltr/Pkt) 1118 Flow Regulator (Dial Flow)(Each),Consumable 1119 Foldable IOL sterile lens +18D(Each),Lens 1120 Foldable IOL Sterile lens + 18D (USFDA approved, as per specification)(Each),Consumable 1121 Foldable IOL Sterile lens + 19.5D (USFDA approved, as per specification)(Each),Consumable 1122 Foldable IOL sterile lens +19D(Each),Lens 1123 Foldable IOL Sterile lens + 19D (USFDA approved, as per specification)(Each),Consumable 1124 Foldable IOL Sterile lens + 20.5D (USFDA approved, as per specification)(Each),Consumable 1125 Foldable IOL sterile lens +20D(Each),Lens 1126 Foldable IOL Sterile lens + 20D (USFDA approved, as per specification)(Each),Consumable 1127 Foldable IOL Sterile lens + 21.5D (USFDA approved, as per specification)(Each),Consumable 1128 Foldable IOL sterile lens +21D(Each),Lens 1129 Foldable IOL Sterile lens + 21D (USFDA approved, as per specification)(Each),Consumable 1130 Foldable IOL Sterile lens + 22.5D (USFDA approved, as per specification)(Each),Consumable 1131 Foldable IOL sterile lens +22D(Each),Lens 1132 Foldable IOL Sterile lens + 22D (USFDA approved, as per specification)(Each),Consumable 1133 Foleys Catheter Size 14-2 Way 1134 Foleys Catheter Size 14-3 Way 1135 Foleys Catheter Size 18- 2 Way 1136 Foleys Catheter Size 20-2 Way(12 Each),Consumable 1137 Foleys Catheter Size 22-2 Way(13 Each),Consumable 1138 Foleys Catheter Size 24-2 Way(14 Each),Consumable 1139 Foleys Urinary Catheter 2 way(Size 22 Each),Consumable 1140 Foleys Urinary Catheter 2 Way Size 8 1141 Foleys Urinary Catheter 3 Way Size 12 1142 Foleys Urinary Catheter 3 Way Size 16 1143 Foleys Urinary Catheter 3 Way Size 18 1144 Foleys Urinary Catheter 3 Way Size 20 1145 Foleys Urinary Catheter 3 Way size 22 1146 Foleys Urinary Catheter Pediatrics Size 10 1147 Foleys Urinary Catheter Size 16 2 Way 1148 Formaldehyde 40% (Conc. Formaline)(1 x 30 lit),Consumable 1149 Formaldehyde (Formolene Liquid 450 ml 1150 Formaldehyde (Formolene ) Tab pack 1151 Fouchets Reagent(MFG- Precious Life Care Pvt Ltd)(100 ml bottle),Consumable 1152 G-6PD Kinetic per ml 1153 G6PD (Span) 1154 Gauze Swab/pad 4 layer 20x40 1155 Gauze Swab/Pad 6 Layer 10 × 10 1156 Gauze Swab/Pad 6 Layer 20 × 20 1157 Giemsa stain (Merck / span) (125 ml),Consumable 1158 Glacial Acetic acid (2.5 liter),Consumable 1159 Glass Slide 75mm x 25mm 1.1 mm 1160 Glass Slide 75mm x 25mm 1.35 mm 1161 Glass test tube 5 without Edge 1162 Glucometer Strip (1x100) 1163 Gold Chloride (1x1 gm),Consumable 1164 Gram Iodine (Gram Stain) 125 ml 1165 Grasper- Laparoscopic 5mm Straight 360 Degree rotating with Insulated shaft, Toothed a traumatic Grasper with Ratchet Mechanism, plastic grip(36 cms length, Independently moving jaws),Consumable 1166 Guide Wire 3mm 1167 H2SO4 (Sulphuric Acid)(25% 500 ml Bottle),Consumable 1168 H2SO4 (Sulphuric Acid)(5% 500 ml Bottle),Consumable 1169 Haematoxyline solution (Harris)(1x125 ml),Consumable 1170 Haemocoagulase 1 NIH Unit/ml, 1 Ml Inj 1171 Haemoglobin colour scale with paper 1172 Haemoglobinometer (Square Tube Pattern) 1173 Capillary Tube 1174 Stop Watch 1175 Handpiece(Blue),Consumable 1176 Handpiece(Transducer),Each 1177 HbA 1 C (Glycosylated Hb)(100 tests),Consumable 1178 Hba Ag ELISA 96 KIT 1x96(Each),Consumable 1179 HBA AG RAPID CARD TEST(Each),Consumable 1180 HbsAg Test Kit (SD Biolab) 1181 HCV ELISA(96 TEST KIT),Consumable (SD Biolab) 1182 HDL kit 50 Test 1183 Hematology Cell Counter Reagents Rinse Solution (20 Ltr) 1184 Hemodialysis Fluid For Bicarb Made(Part A 10 Ltr +Part B 500gm 2/Pkt),Consumable 1185 hemolynac 3n-2340 500ml(Each),Consumable 1186 Hemolynac-3N-2340 Pack Size 500 ml(Cell Counter (Model No- MEK-6420P-Japan)),Consumable 1187 Heparin and Benzyl Nicotinate 20mg Oint. 1188 Heparin Sodium Benzyl Nicotinate Oint 1189 HIV 1+2 (Rapid) per Card J Mitra 1190 HIV 1&2 Test Cards 1191 HIV Kit (SD Biolab) 1192 HpMED Solution Consumable (pack size: 16 bottles of 50 ml) , Make- Polti S.P.A. ; Model-Sani system(country of Origin- Italy;),Consumable 1193 Hub Cutter-Non Electric Lockable Safety Portable Box for Disposal of Hypodemic Needles. Cuts the Needle From The Hub Of Machine 1194 Hub Cutter Non Electric Lockable Safety Portable Box for Disposal of Hypodemic Needles. Cuts the Needle From The Hub Of Machine(MFG By - Precious life Care),Each 1195 Hydroethyl starch 6% Solution with sodium chloride 0.9% 500 ml Bottle(Each),Consumable 1196 Hydrogen Peroxide (Conc.) H2O2 (500 ml),Consumable 1197 Hypodermic Needles For Single Use BIS Gauze(23 Length, 25 mm +-1),Needle 1198 Hypodermic Needles For Single Use -Gauze 22 BIS Length, 25 +1/-2 1199 Hypodermic Needles For Single Use -Gauze 23 BIS Length, 25 +1/-2 1200 Hypodermic Syringe For Single Use 10ml BP/BIS (Without Needle) 1201 Hypodermic Syringe For Single Use 1ml, IS : 10258 (10 ml Vial) 1202 Hypodermic Syringe For Single Use 2ml BP/BIS (Without Needle) 1203 Hypodermic Syringe For Single Use 5ml BP/BIS (Without Needle) 1204 Individual Identification Panel for aerobic Gram Positive Organism(GPID),Each 1205 Individual Identification Panel for anaerobic Gram Negative Organism(ANC),Each 1206 Individual Identification Panel for anaerobic Gram Positive Organism(ANC),Each 1207 Individual Identification Panel for fungus(YST),Each 1208 Infant Feeding Tube Size: 5G 1209 Inj. B-Complex 30ml 1210 Inj. Diclofenac 30ml 1211 Inj. Heamocoagulase 1CU 1ml 1212 Inj. L-Ornithine L-Aspartate 10ml 1213 Inj. Meropenam 125mg 1214 Inj. Primacort Hydrocotisone 200 mg 1215 Inj. Sigmacrome (Obrochrome) 10ml 1216 Instrument Sterilant 10 minute Sporicidal Sterilant ALdehyde free containing Sodium Perborate((810 grm packet)),Powder 1217 Instrument Wash 500ml With Spray Pump 1218 Insulin Syringe/ each (graduation upto 100 units) 30 G Needle, 40 units/ml(30 G Needle, 40 units/ml),Syrings 1219 Intra Camral saline (R.L) - Sep- (ETO Sterelied, Specialy(Manufactured for Intra Camral),Consumable 1220 Iron Alum a) Ferric Amino sulphate (1x500 ml = 500 ml),Consumable 1221 Iron & Folic acid entric coated 100mg,of elemental iron (Adult)+FA 1.5mg Tab. 1222 IV Cannula Size With Inj.Valve (Port)(18G ),Consumable 1223 IV Dextrose 40% 1224 Jugular Catheters : Double Lumen kit (curved), Set 1225 K3 Blood Vaccutainer EDTA-100 tubes/pkt 1226 Keratome 3.2 Keratome –Round Stock 3.2mm Full Handle Knives E.T.O. Sterile Angled Bevel Up 45 DEG 1227 Kores Indelible Ink Marker Pen 1228 K Wire Length 375mm Size:1.6mm Roll 1229 K Wire Length 375mm Size:1.8mm Roll 1230 K Wire Size:1mm 1231 Labetalol 5 mg/ ml, 2 ml Inj 1232 Ladies Sleeper, Per Pair as per measurment 1233 L-Alanyl L-Glutamine Solution for Infusion (20%w/v)(Each),Consumable 1234 Laser Fiber for Dental Laser , Make- Faith Inovation ; Model-FD10B ;(country of Origin- India),Consumable 1235 LDH Kit Pack (50 ml Bottle),Consumable 1236 Leishmann Stain Sol with buffer tablet pH (1x5 lit),Consumable 1237 Leishman stain(MFG- Precious Life Care Pvt Ltd)(500 ml bottle),Consumable 1238 Light Weight Composite Mesh : Polypropylene and Polyglycolic Acid Partially Absorbable Composite Mesh With Large Pore size 6 x 11 cm 1239 Liquid Paraffin 50ml(bottle ),Consumable 1240 Liquor Ammonia (500 ml),Consumable 1241 Long Line Silicon Catheter, G-24, Fr-2, L-30cm 1242 Low-Profile Titenium chemo Port with cilicon catheter (9.6 fr, 6.6fr, 3.9fr,) Length -60cm,guide wire, peel-away desilet,Hubsite needle(22G*20mm) 1243 Malaria Antigen, P Vivax, P Falciparum Rapid Diagnostics Bivalentt- Test Card (As Per GIO-NVBDCP Specification) Pack of 10 card test with 10 Dropper, 1 Buffer Solution, 10 Pricking Lancet, and 10 Alcohol Swab 1244 Malaria Antigen, P Vivax, P Falciparum Rapid Diagnostics Bivalentt- Test Card (As Per GIO-NVBDCP Specification) Pack of 10 card test with 10 Dropper, 1 Buffer Solution, 10 Pricking Lancet, and 10 Alcohol Swab (SD Biolab) 1245 Malaria Card (Antigen) Atleast 100 microbes/desi ltr. For both species 1246 Malaria PF/PV Antigen Card 1247 Malaria PF/PV Rapid Test 1248 Maryland Dissector- Laparoscopic 5mm curved Maryland dissector with tapering end, 360 Degree rotating with insulated shaft, Non Ratchet , plastic grip(36 cms length, Monopolar pin provision for usage with Electro surgical Unit, Independently moving),Consumable 1249 Masson Trichrome Staining Kits(100 test),Consumable 1250 Medical X-Ray film-Polyester based imaging film 35.6cm x 35.6cm (14x14) Size:- 50 sheets in one packet 1251 Medical X-Ray film-Polyester based imaging film 35.6 cm x 43.2cm (14x17) Size:- 50 sheets in one packet 1252 Medigard hand scrub 1253 Meropenem Inj 1mg 1254 Methyl Blue for (Z N)(MFG- Precious Life Care Pvt Ltd)(125 ml bottle),Consumable 1255 Methyline Blue(100 ml),solution 1256 Methyline Blue 0.1% Solu. 1257 Miconazole Nitrate 2 % w/w 15 gm, Oint 1258 Microalbumin Urine(100 tests),Consumable 1259 Micro pipet 1000 fix and variable Each 1260 Micropiptte 100-1000 1261 Microtips (2-200 UL) 1x1000(Each),Consumable Pkt 1262 Microtips Yellow (10-200Ul)1x1000(Each),Consumable 1263 Micro and Macro Tips stand 1264 MilkiWhite Gel Based sanitizer 1.Ethinol (cas-64-17-5) 58-62% 2. benzoil coline chloride 0.52% 1 % 3.(Ph neutral contact time 15 se 4. pack size 100 ml & 100 ml with dispensor),Consumable 1265 MilkiWhite Gel Based sanitizer 1.Ethinol (cas-64-17-5) 58-62% 2. benzoil coline chloride 0.52% 1 % 3. Ph neutral contact time 15 sec 4.(pack size l& 500 ml with dispensor),Consumable 1266 Mindray BC 2800, Auto Hematology Analyzer(M 18 CFL Lyes),Consumable 1267 Mindray BC 2800, Auto Hematology Analyzer (M 18 Cleanzer),Consumable 1268 Mindray BC 2800, Auto Hematology Analyzer (M 18 Diluent),Consumable 1269 Mindray BC 2800, Auto Hematology Analyzer(M 18 Probe Cleanzer),Consumable 1270 Mindray BC 2800, Auto Hematology Analyzer(M 18 Rinse),Consumable 1271 Mindray BC 2800, Auto Hematology Analyzer(Paper Roll),Consumable 1272 Mindray BC 2800, Auto Hematology Analyzer(Quality Control),Consumable 1273 Mindray BC 5300, Auto Hematology Analyzer part -5(M- 53 Cleaner),Consumable 1274 Mindray BC 5300, Auto Hematology Analyzer part -5(M- 53 Diluent),Consumable 1275 Mindray BC 5300, Auto Hematology Analyzer part -5(M- 53 Leo (II) Lyes),Consumable 1276 Mindray BC 5300, Auto Hematology Analyzer part -5(M- 53 Leo (I) Lyes),Consumable 1277 Mindray BC 5300, Auto Hematology Analyzer part -5(M- 53 LH Lyes),Consumable 1278 Mindray BC 5300, Auto Hematology Analyzer part -5(M- 53 Probe Cleaner),Consumable 1279 Mindray BC 5300, Auto Hematology Analyzer part -5(Quality Control),Consumable 1280 Montex Test 2TU(1 vial),Consumable 1281 MVA Kit (mannual Vaccum Aspiration Kit) (As per attached specification)(Mfg by Women Care Global),Consumable 1282 N/10 HCL 500ml 1283 NaH2 PO4 (Anhydrous) Analar / GR/AR (1x500 gm = 500gm),Consumable 1284 Needle Hypodermic0Insulin (Metallic Non0Sterile) Needle 1285 Needle Hypodermic Size IS 10654:2002 23G 1286 Needle Hypodermic Size IS 10654:2002 24G 1287 Neomycin and Sulfacetamide Sprinkling Powder 5 gm(Each),Consumable 1288 Neubauers Chamber(each),Consumable 1289 Nimesulide Oint gel 20gm 1290 Non Foldable IOL Sterile Lens AC + 18 1291 Non Foldable IOL Sterile Lens AC + 20 1292 Non Foldable IOL Sterile lens PC+14D ,Lens 1293 Non Foldable IOL Sterile lens PC+16D ,Lens 1294 Non Foldable IOL Sterile lens PC+18D ,Lens 1295 Non Foldable IOL Sterile lens PC+19D ,Lens 1296 Non Foldable IOL Sterile lens PC+19.5D ,Lens 1297 Non Foldable IOL Sterile lens PC+20 D ,Lens 1298 Non Foldable IOL Sterile lens PC+20.5 D ,Lens 1299 Non Foldable IOL Sterile lens PC+21 D ,Lens 1300 Non Foldable IOL Sterile lens PC+21.5 D ,Lens 1301 Non Foldable IOL Sterile lens PC+22 D ,Lens 1302 Non Foldable IOL Sterile lens PC+22.5 D ,Lens 1303 Non Foldable IOL Sterile lens PC+23 D ,Lens 1304 Non Foldable IOL Sterile lens PC+24 D ,Lens 1305 Non Foldable IOL Sterile lens PC+26 D ,Lens 1306 Non Foldable IOL Sterile lens AC+19D ,Lens 1307 Non Foldable IOL Sterile Lens PC + 18.5(Each),Lens 1308 Occult blood test kit (Haem test kit) (1 x 100 strips),Consumable 1309 OG6 (For cytology)(1x125 ml),Consumable 1310 Oint. Gentamycin Sulphate 15gm 1311 Optia Granulocyte Depletion Set, Model : 10300(Packing Size : 6 Kits),Consumable 1312 Oxidized Regenerated Cellulose based Topical Absorbable Hemostat, Structured Non-Woven material, with Bactericidal property. Ease-of-use in both open and minimally invasive procedures(Size 1x 2Approved by US FDA),Consumable 1313 Oxidized Regenerated Cellulose based Topical Absorbable Hemostat, Structured Non-Woven material, with Bactericidal property. Ease-of-use in both open and minimally invasive procedures(Size 2x 4Approved by US FDA),Consumable 1314 Oxygen Mask Adult (Standard Size) 1315 Paediatric - Double Lumen Catheter Set 6.5 F - 8.5 Fr, 13cm (curved), Kit 1316 Paediatric - Double Lumen Catheter Set 6.5 F - 8.5 Fr, 13cm (straight), Set 1317 Paediatric Drip Set(set),Digonstic 1318 Paediatric Epidural Set(19G Needle, Metal Stylet,22g Catheter,0.22Micron Epidural Catheter LOR Syringe) 1319 Adult Epidural Set with catheter 1320 Pandys Reagent CSF (125 ml),Consumable 1321 Papaniculau Stain Kit (125ml Bottle) 1322 Paper Adhesive Microporous Surgical Tape 3 inch x 5 m / Roll (10 Roll/PKT)(3 inch x 5 m / Roll (10 Roll/PKT)),Consumable 1323 Paper Adhesive Plaster 1/2 X 9.0mts 1324 Paper Adhesive Plaster 1 X 9.0mts 1325 Paper Adhesive Plaster Microporous Surgical Tape 1 inch x 9 m / Roll 1326 Paper Adhesive Plaster Microporous Surgical Tape 6 inch x 10 m / Roll 1327 Paracetamol 75 mg/ml, 10 ml Inj 1328 Paracetamol + Chlorpheniramine(100 ml Syrup),Syrup 1329 Paraffin Wax Histology (58-60)(1x1 kg = 1 kg),Consumable 1330 Patch Buprenorphine(10mcg),Consumable 1331 Patch Buprenorphine(20mcg),Consumable 1332 Personal Protection Kit(Kit),Consumable 1333 Phenobarbitone Inj. - 100 mg/ml 1334 Pistol grip curvedcoagulating shears ergonomic handle with ATT shaft lenght 36cm can seal blood vessel upto and inclding (5mm in diameter),Consumable 1335 Pistol grip Curved coagulating shears with ergonomic handle in the(Folloeing shaft lengths 36 cm Can seal blood vessels upto and including 5 mm in diameter),Consumable 1336 Pistol grip Curved coagulating shears with ergonomic handle shaft(langths 36 cm Can seal blood vessels upto and including 5 mm in diameter ATT),Each 1337 Plain Disposable Vial 3ml(Each),Consumable 1338 Plain Vial(12 x 75 with Screw Cap Each),Consumable 1339 Plain vial with screw cap(12 x 75),Consumable 1340 P O P 1 Kg Pkt 1341 Plastic Bottle(300ml),Consumable 1342 Plastic Bottle(500 ml),Consumable 1343 Platelet dilution fluid(MFG- Precious Life Care Pvt Ltd)(100 ml),Consumable 1344 Polybutylate Coated With polyester braided(Green) with 1/2 cir Tap cut V-5 DA needle 17mm, non-abs surg suture USP 2-0 Length 90cm (12 Foils/Pkt) 1345 Polyester Braided Coated With CD White DN 17 mm Curved RB 90cm 2/0 (12 Foils/Pkt) 1346 Polyester Braided Coated With CD White DN 17 mm(Curved Rev Cut) Cut 90 cm 2/0 (12 Foils/Pkt) 1347 Polyester Braided Coated With CD White DN 17 mm Taped Cut 90 cm 2/0 (12 Foils/Pkt) 1348 Polyester Braided Coated With CD white DN 25mm(Curved RB) 2-0 Length 90cm (12 Foils/pkt) 1349 Polyethylene High Pressure Extension Tube, Length - 100cm 1350 Polyethylene High Pressure Extension Tube, Length - 150cm 1351 Polyglecaprone with 1/2 Cir Oval RB Needle 26 mm Length 70 cm (12 Foils/Pkt) 1352 Poly L-Lysine Coated slides (50 lidess x 1),Consumable 1353 Poly L-lysine sol (for immunochisto chemistry) (1x100 ml),Consumable 1354 Polymaide Mono Filament (Nylon) with CD Cut Needle 20 mm Length 70 cm Size 2/0 (12 Foils/Pkt) 1355 Poly Propylene Mesh 15 x 15 cm 1356 Poly propylene Mesh 7.5cmx15cm 1357 Poly Propylene Mono Filament Sterile Precut with 1/2 cir RB D Needle 16mm Length 70 cm Non Absorbable Surgical Sutures USP Size 5/0(12foils/Pkt),Consumable 1358 Poly Propylene Mono Filament Sterile Precut with 1/2 cir RB Heavy Needle 16 mm length 70 cm Non Absorbable Surgical Sutures USP 5/0 (12 foils/Pkt) 1359 Poly Propylene Mono Filament Sterile Precut with 1/2 cir RB Heavy needle 30mm length 70 cm Non Absorbable Surgical sutures USP Size 1 1360 Poly Propylene Mono Filament Sterile Precut with 1/2 cir RB Needle 25 mm length 70 cm Non Absorbable Surgical sutures USP Size 3/0 1361 Poly Propylene Mono Filament Sterile Precut with 1/2 cir RB Needle 30 mm length 70 cm Non Absorbable Surgical sutures USP Size 1/0 1362 Poly Propylene Mono Filament Sterile Precut with 1/2 cir RB Needle 30 mm length 70 cm Non Absorbable Surgical sutures USP Size 2/0(12 foils/Pkt),Surgical Material 1363 Poly Propylene Monofilament Sterile Precut With 1/2 Cir RB Needle 30mm Length 70cm Size : 1/0(12 foils/Pkt),Consumable 1364 Poly Propylene Monofilament Sterile Precut With 1/2 Cir RB Needle 30mm Length 70cm Size:2/0 (12 foils/Pkt) 1365 Poly Propylene Mono Filament Sterile Precut with 1/2 cir RB Needle 40 mm length 70 cm Non Absorbable Surgical sutures USP Size 1/0 1366 Poly Propylene Monofilament Sterile Precut with 1/2 cir RB Needle 40 mm length 70 cm Size 1(12 Foils/Pkt),Needle 1367 Polytaxine powder(1x5 gm),Consumable 1368 Post Operative bag with Window size 100 mm(1 Each),Consumable 1369 Post Operative bag with Window size 70 mm(1 Each),Consumable 1370 Potassium Chloride Oral Solution 500mg/10ml 1371 Povidone Iodine Cream 250gm 1372 Powder Protien +Vitamins +Corbohydrates & Minerals 200gm 1373 Pregnancy Detection Kit CE Marked/ISI Marked 30 Test/ Kit 1374 Prolene 1-0 RB 1/2 circle 30 mm, L 70 cm (12 foils /pkt) 1375 Prolene mesh 7.5 x 15 cm(12 foils /pkt) 1376 Protein (Total)(600 ml),Consumable 1377 Protein (Total) (Autospan) 1378 Protein (Total) (Erba) 1379 Protein (Total) 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 1380 Protien (Total) MFG by Ba 400 Biosystems Diagnostics Pvt Ltd(600 ml),Consumable 1381 Protien (Urine) Ba 400 Biosystems Diagnostics Pvt Ltd(240 ml),Consumable 1382 PTAH Staining kits(100 test),Consumable 1383 PTFE Material, IV Cannula, With Luer-lock, G-18 1384 PTFE Material, I.V. Safety Cannula, With Luer-lock, G-16 1385 PT Kit (time) (IST 1.00 - 1.20)(2x4 ml),Consumable 1386 PTK (Nishchay Kit) 1387 Quick diff staining kits for Pap Smear(100 test),Consumable 1388 Quincke Bevel Pediatric Spinal Needle, G-25, Length 1.2 inch 1389 Quincke Pediatric Spinal Needles G-25, Length 2.0 Inch 1390 RA factor 50 test kit Qualicative 1391 R A Factor Test Kit (Span) 1392 R A Factor Test Kit (Erba) 1393 Reaction Rotor 10 Pc(Model BA 400 System (Mfg ByBio System)),Consumable 1394 HDL Cholesterol(Autospan/Erba) 1395 Reticulocyte Kit (100 tests),Consumable 1396 Reuse Prevention Syringe 10 ml 1397 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe with detachable needles complaint to ISO 7886:4 Type I and B,Flow wrap/ Blister pkg using medical grade breathable paper, ETO Sterilized,Non latex stopper 3ml 1398 Reuse Prevention Syringe-Sterile single use reuse prevention syringewith detachable needles complaint to ISO 7886:4 Type I and Type B, Flow wrap/ Blister package using medical grade breathable paper, ETO Sterilized, Non latex stopper 2ml 1399 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe with Detachable Needles Complaint to ISO 7886:4 Type I,B, Flow rap/Blister pack using medical grade breathable paper, ETO Sterilized, Nonlatex stopper (prefd matr thmoplast ela)5ml 1400 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe with fixed/ detachable needles complaint to ISO 7886:4 Type I and B,Flow wrap/ Blister pkg using medical grade breathable paper, ETO Sterilized.(10 ml),Syrings 1401 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe with Fixed/detachable needles complaint to ISO 7886:4 Type I,B,Flow wrap/ Blister pack using medical grade breathable paper, ETO Sterilized(2ml),Syrings 1402 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe with Fixed/detachable needles complaint to ISO 7886:4 Type I,B,Flow wrap/ Blister pack using medical grade breathable paper, ETO Sterilized(3ml),Syrings 1403 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe with Fixed/detachable needles complaint to ISO 7886:4 Type I,B,Flow wrap/ Blister pack using medical grade breathable paper, ETO Sterilized(5ml),Syrings 1404 Reuse Prevention Syringe-Sterile with detachable needles complaint to ISO 7886:4 TypeI and TypeB 3ml 1405 Reuse Prevention Syringe-Sterile with detachable needles complaint to ISO 7886:4 Type I and Type B, Flow wrap/ Blister package using medical grade breathable paper, ETO Sterilized, Non latex stopper (preferred material thermoplastic elastomer) 5ml 1406 Rhyroid stimulating hormone(TSH),Consumable 1407 Rib Belt large(MFG By - Precious life Care),Each 1408 Rib Belt Medium(MFG By - Precious life Care),Each 1409 Roll Bandage 05 cm x 05 m Tana X Bana (26s x 26s) Reed x Pik (34x 24) 1410 Roll Bandage 10 cm x 05 m Tana X Bana (26s x 26s) Reed x Pik (34x 24) 1411 Roll Bandage 15 cm x 05 m Tana X Bana (26s x 26s) Reed x Pik (34x 24) 1412 Roll Bandage 7.5 cm x 05 m Tana X Bana (26s x 26s) Reed x Pik (34x 24) 1413 Rolled Bandage 10cm × 5m 1414 Rolled Bandage 15cm × 5 m 1415 Rolled Bandage 5cm × 5m 1416 Rolled Bandage 7.5cm × 5m 1417 Safranine (Gram Stain) 500 ml Bottle 1418 Safranine (Gram Stain) (500 ml Bottle (MFG-Sunlabs)),Consumable 1419 S.Albumin(Each),Consumable 1420 Sargramostim (recombinant human granulocyte macrophage colony stimulating factor)(500 mcg/ml),Injection 1421 S. B12(100 tests),Consumable 1422 S.Calcium(Each),Consumable 1423 Scalp Vein Set(Size 24G, Disposable),Consumable 1424 Schirmer Strip For Ophthalmic Use 1425 Scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft(lengths 17 cm Can seal blood vessels upto and including 5 mm in diameter),Each 1426 Scissor grip curved coagulating shears with curved tapered tip for precise dissection and with 240 degree activation triggers that support multiple hand positions in the following shaft(lengths 9cm Can seal blood vessels upto and including 5 mm in diameter),Each 1427 S Direct Billirubin(1000 ml),Consumable 1428 Semen dilution fluid(100 ml Bottle),Consumable 1429 Serum Amylase (MFG By Beacon Diagnostic)(100 ml),Consumable 1430 Serum Electrolite Na+ K+ Kit analizer(50 test per Kit),Consumable 1431 Serum T4 kit, ELISA(96 Test kit each),Consumable 1432 Serum TSH kit, ELISA(96 / Pkt),Consumable 1433 Sevoflurane 20cc(Each),Consumable 1434 S. Ferritin(Each),Consumable 1435 S. Folate(100 tests),Consumable 1436 SGOT(MFG- Pathogyme Diagnostics)(25 ml),Consumable 1437 SGOT(MFG- autospan/Erba 1438 SGPT Kit LYPHOZYME 5x20 Ml 1439 SGPT Test Kit Reagent 1440 SGPT Test Kit Reagent (autospan/Erba) 1441 Shoes Uniform ,Per Pair as per measurment 1442 Short IV Catheter With Straight Guidewire. L-20, Fr-2, G-22 1443 Short IV Catheter With Straight Guidewire. L-4, Fr-2, G-22 1444 Short IV Catheter With Straight/J tip Guidewire(L-4, Fr-2, G-22),Consumable 1445 SICS Blade-cresent(15 degree),Consumable 1446 SICS Blade (Disposable) Cresent Nife 2.8 (Specialy long matel handle, micro sharp edge, ISI/ISO(Manufaturer, ETO stereliged),Consumable 1447 Silk No 1 cutting needle 1x12(1x12),Consumable 1448 Sulpher Powder pkt 1449 S. Iron (Ferrozine)(100 tests),Consumable 1450 S.Lipase(Each),Consumable 1451 Sliver nitrate (1x25 gm = 25 gm),Consumable 1452 Sodium chloride NaCl Analar / Gr / AR (1x500 gm = 500gm),Consumable 1453 Sodium Citrate 3.8%(MFG- Precious Life Care Pvt Ltd)(500 ml bottle),Consumable 1454 Sodium Hydroxide (NaOH) (Analar / GR/AR) (1x500 gm = 500gm),Consumable 1455 Sodium hypo chloride 5 lit jar 1456 Sodium metabisuiphite (Na2S2O3) (Analar (GR/AR) (1x500 gm = 500gm),Consumable 1457 Sodium nitroprusside (100 gm),Consumable 1458 Spectra Optia collection Set, Model : 10110 / 10120(Packing Size : 6 Kits),Consumable 1459 Spectra Optia exchange Set, Model : 10220(Packing Size : 6 Kits),Consumable 1460 Spectra Optia Platelet Kit, Model : 10400(Packing Size : 6 Kits),Consumable 1461 S. Phosphorus (Each),Consumable 1462 Spinal Needle with Metal Stylet, Mfg by Nipro Medical India Pvt. Ltd.(G-23),Needle 1463 (SS) Powder (1x25 gm = 25 gm),Consumable 1464 Sstromatolyser-4DS For 5-Part Hematology Analyser (Model : Sysmex XS-800i (Japan))(Pack Size 126 ml),Consumable 1465 Stago Diagnostica Stago S.G.S, Model - STA satellite Fully Automated Coagulation machine(PT –STA Neoplastin cl + 5),Consumable 1466 Stago Diagnostica Stago S.G.S, Model - STA satellite Fully Automated Coagulation machine(STA-CACL2 ),Consumable 1467 Stago Diagnostica Stago S.G.S, Model - STA satellite Fully Automated Coagulation machine(STA- CLEANER SOLUTION),Consumable 1468 Stago Diagnostica Stago S.G.S, Model - STA satellite Fully Automated Coagulation machine(STA- COAGCONTROL N+P),Consumable 1469 Stago Diagnostica Stago S.G.S, Model - STA satellite Fully Automated Coagulation machine(STA- DESORB-U),Consumable 1470 Stago Diagnostica Stago S.G.S, Model - STA satellite Fully Automated Coagulation machine(STA- SATELLITE CUVETTE),Consumable 1471 Stago Diagnostica Stago S.G.S, Model - STA satellite Fully Automated Coagulation machine(WHITE STIRRER FOR PT TEST),Consumable 1472 Stain (1x25 gm = 25 gm),Consumable 1473 Staining kit reticulin(100 test),Consumable 1474 Staining kits (100 test),Consumable 1475 Stainless Steel Wire 28G 1476 Stainless Steel Wire 30G 1477 Sterigen-C Electrolyte Solution one pack of 10 ltr. for Sterigen 400 DAF , Make- Faith Inovation; Model- Sterigen SG 400 DAF ;(country of Origin- India),Consumable 1478 Sterilant Cold Disinfectant For Dialysis Containing Peracetic Acid Hydrogen Peroxide Acetic Acid(5 Ltr Can),Consumable 1479 Sterilant Hot Disinfectant For Dialysis Containing 21% (Approx) Citric Acid, Malic Acid, Lactic Acid(5 Ltr Can),Consumable 1480 Sterile Hypodermic Syringe with Needle, Mfg by PH Health Care Pvt Ltd(20 ml),Consumable 1481 Sterile Hypodermic Syring With Needle 10 ml 1482 Sterile Hypodermic Syring With Needle 20 ml 1483 Sterile Hypodermic Syring With Needle(5 ml),Syrings 1484 Sterile Hypodermic Syring with Needle, Mfg by PH Health Care Pvt Ltd(10ml),Consumable 1485 Sterlium 500 ml 1486 S. TIBC Kit(100 tests),Consumable 1487 S. Total Protein(Each),Consumable 1488 S. Transferin(100 tests),Consumable 1489 Strip for Albumin Urine and Suger 1490 Strip for malaria antigen, P vivex, P Falciparum (50 tests) 1491 Stromatolyser-4DL for 5-Part Hematology Analyser (Model : Sysmex XS-800i (Japan))(Pack Size 5000 ml),Consumable 1492 Sulfolyser For 5-Part Hematology Analyser (Model : Sysmex XS-800i (Japan))(Pack Size 5000 ml),Consumable 1493 Sulfur powder 1494 Surface Disinfectant - 10 minute Aldehyde free disinfectant containing Potassium Mono Per Sulphate powder(5 kg packet (MFG by Zenith Chemicals Allied Industries)),Consumable 1495 Surface Disinfectant 10 minute Aldehyde free disinfectant containing Potassium Mono Per Sulphate powder((5kg Packet)),Powder 1496 Surgical Blade, Size 15 (100/Pkt) 1497 Surgical Blade, Size 24 (50/Pkt) 1498 Suter(8/0 (01 Box)),Consumable 1499 Sutureless Dural Graft Substitute(1x3),Consumable 1500 Sutureless Dural Graft Substitute(2x2),Consumable 1501 Sutureless Dural Graft Substitute(3x3),Consumable 1502 Sutureless Dural Graft Substitute(4x5),Consumable 1503 Suture Mersilk 8-0 (12 Foil) 1504 S.Vitamin D3(100 tests),Consumable 1505 Tannic Acid With Glycerine (Gum Paint) 80% + 20% 10 ml vial(10 ml),Lotion 1506 MacroPorus Partially Absorbable Mesh made up of approximately equal parts of Polypropylene Monofilament fiber (6-0) and Poliglecaprone 25 Monofilament fiber (5-0) with pore size 2.7 mm having a weight of 39 g/m2 and containing blue orientation stripes of Polypropylene. 15cmx15cm 1507 Thrombin time kit(10x3 ml),Consumable 1508 Thyroxine(T4),Consumable 1509 TMT Graph Paper A4 Size, 100 Piece/Pkt 1510 Tracheostomy Tube (PVC) Sterile Single Use - (Adult)(Size 4 each piece Soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction Non-irritant),Tube 1511 Tracheostomy Tube (PVC) Sterile Single Use - (Adult)(Size 5 each piece Soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction Non-irritant),Tube 1512 Tracheostomy Tube (PVC) Sterile Single Use - (Adult)(Size 7 each piece Soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction Non-irritant),Tube 1513 Tracheostomy Tube (PVC) Sterile Single Use - (Adult)(Size 8 each piece Soft flexible flange at for each fixation 15 mm connector at terminal end which can be rotated in 360 degree direction Non-irritant),Tube 1514 Triple Lumen Jugular Catheter 12 x 16 1515 Triple Lumen Jugular Catheter Kit(Size 12F, 16+/- 1cm),Consumable 1516 Triple Lumen Polyurethane CVP Catheter, 7.5 Fr, G-14x18x18, Length 15cm 1517 Triple Lumen Polyurethane CVP Catheter, 7.5 Fr, G-14x18x18, Length 20cm 1518 Triple Lumen Polyurethane CVP Catheter 7 to 7.5Fr(G-14-16x18x18, Length 16-20 cm),Consumable 1519 Triple Lumen Polyurethane CVP Catheter 7 to 7.5 Fr(G-14-16x18x18x18, Length 15-16cm),Consumable 1520 Trisodium Citrate 3.8%(MFG- Precious Life Care Pvt Ltd)(500 ml bottle),Consumable 1521 Trisodium citrate Analar/Gr/AR (1x500 gm = 500gm),Consumable 1522 Troponin 1 kit(10 test Per Pack),Consumable 1523 Troponin T (cTn - T) Card test(50 test),Consumable 1524 Trucut Biopsy Needle 18 G Length 15 cm 1525 Typhoid Test Card. 1526 Umblical Cotton Tape Length 75cm. 1527 Urea/BUN – UV 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 1528 Urea UV GLOH 5x20ml 1529 Uric Acid 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 1530 Uric Acid Biosystem 1531 Uric Acid(MFG- Pathogyme Diagnostics)(50 ml (2 X 25 ml)),Consumable 1532 Uric Acid(Autospan)(50 ml (2 X 25 ml)),Consumable 1533 Uric Acid(Erba)(50 ml (2 X 25 ml)),Consumable 1534 Urine Albumin & Suger Test Kit 1*100 Pkt 1535 Urine Culture Pot 30 ml. 1536 Urine (Multi Stripe),Consumable 1537 Urine Strip 2 Parameter (SD Biolab) 1538 Urine Strip 2 Parameter (Tulip) 1539 Urine Strip 10 Parameter (SD Biolab) 1540 Urine Strip 10 Parameter (Tulip) 1541 Uri stix 100 test 1542 Urosticks(50/pkt),Consumable 1543 USG Gel(250 ml bottle),Consumable 1544 Vaseline White/Yellow 1/2kg 1545 VDRL kit (Strip) (MFG By Alere)(50 Test/Kit),Consumable 1546 VDRL (RPR) 1x100 SD Strip (SD Biolab) 1547 VDRL Tedt Kit (Liquid) Span 1548 V.P Shunt High Pressure (Venticular Peritonial shunt, (Venticular Catheter 15cm length, 1 distilled catheter 75 l, Struit stylet)(Each),Consumable 1549 V.P.SHUNT(LOW PRESSUR),Consumable 1550 V.P.SHUNT(MEDIUM PRESSUR),Consumable 1551 Whitacre - Pencil Point Spinal Needle 25 G With Introducer 1552 White petrollium Jelly 500 gm 1553 Widal 2x2 Sera Slide KIT 1554 Widal 2x2 tube Test kit 1555 Widal 4x5 Ml 1556 Wound Suction NO 18 1557 XRO Catheter With PTFE Material, I.V. Safety Cannula, With Luer-lock(G-18),Consumable 1558 XRO Catheter With PTFE Material, I.V. Safety Cannula, With Luer-lock(G-20),Consumable 1559 XRO Catheter With PTFE Material, I.V. Safety Cannula, With Luer-lock(G-22),Consumable 1560 Adhesive Tape 7.5cm X10 Mtr/Roll 1561 Alcohol Dispensor 1562 All Out 1563 Blood Bag with ACD/CPD Solution (Disposable Sterilised) with Needle(100 ml),Bag HLL 1564 Blood Bag with ACD/CPD Solution (Disposable Sterilised) with Needle(350 ml),Bag (HLL) Triple 1565 Cleanser M52 1 Lit 1566 Coagulater 1567 Diff Lyse M52 500 ml 1568 Disposable Sterile Gloves Size 6 Inches Consumable 1569 Disposable Sterile Gloves Size 61/2 Inches Consumable 1570 Disposable Sterile Gloves Size 7,1/2 Inches Consumable 1571 Disposable Sterile Gloves Size 7Inches Consumable 1572 Glucometer With Strip 1573 I.V. Cannula With Injection Valve(Size 24 G),Consumable 1574 IV Cannula Size 24G With Inj.Valve (Port) 1575 IV Cannula Size With Inj.Valve (Port)(22G ),Consumable 1576 Latex Based Baloon capacity (30-50ml) Foleys Catheter(Size 16- 2 Way),Consumable 1577 Bleaching Power GR-II (25kg) Bags Consumable 1578 A.V Fistula Needle - 17 G 1579 A.V. Blood Line (Post Haemodialysis Tubing) High Quality 1580 A-V Blood Lines with AV Pressure Transducer(Acceptable for fitting to all standard Dialyzers ) with side tubing-(FOR Heparinization and AV Pressure monitoring) CE and ISO certificate essential with Protector for all machines types and dialysers(Medical grade PVC Like of Fresenius BAIN (DORA), Dialife ,NIPRO, B RAUN Browndone,Biolight or equivalent Post-pump tubing sets options Medical grade clear tubing Guarded access ports for reduced infection risks Parts of superior quality),Consumable 1581 A-V Blood Lines with AV Pressure Transducer Protector For all Machines Types and Dialysers (Acceptable For Fitting to all standard Dialysers), Set 1582 Giemsa Stain 1583 Glass Beaker 200 ml 1584 Glass Conical Flask 100 ml 1585 Glass Conical Flask 200 ml 1586 Glass Tube plain 4” 1587 Glass Tube Plain 6” 1588 Group Confermation card+ Solution matrix Gel System 1589 Prolin No 1 1590 Prolin No 2-0 1591 RUB IN HAND SOLUTION 100ML/500ML 1592 surgical Scalpel Blade With Handle 1593 T3, Reagent (Mini Vidas)/Biomerieux 1594 T4 Reagent (Mini Vidas)Biomerieux 1595 Test Tube Glass 10 ml 1596 TSH Reagent (Mini Vidas)Biomerieux 1597 Wiper Big 1598 wiper Medium 1599 wiper Small 1600 utility gloves for large latex 1601 utility gloves for medium of latex 1602 Baby Vest - The baby vest should be a double breasted upper garment & Single jersey Knit (100% cotton) 150-160 GSM. Size should be:- Length-9”, chest size should be 9”, Sleeve length should be 1¾” & width 6”. Piping is must & the piping made of cotton-cambric. It should have side wise stretching. (specs attached seperately) {for all new born} 1603 B. B. SILK Size 2/0 , 110 cm with 1/2 CR cutting needle 1604 Mackintosh sheet - Rubber Makintosh double colour Rubber sheeting, High Polymer (55% grade A) Water proof Colour (Green, Blue, Red), Thickness-0.4mm, Width-90cm Roll of 30 mtr Compliant to IS 4135 (1974) {for labour table OT & maternity beds} 1605 Synthetic absorbable suture with 1/2 circle round body needle 40 mm length - 90 cm polyglycolic Acid 1606 nylon no .1, 1/2 circle needle 40 mm, 110 cm, nonabsorblr suture 1607 vicryl no.1 2347 D ,40mm 1/2 circle cut,tapper, heavy,double needle, 180 cm, PGA absorble,suture 1608 Inj. Myopyrolate 5ml ampule 1609 Inj. Pheneramine malate 1610 Paracetamol suppository 400 mg 1611 Inj. Voluven 1612 Endotrachial tube 3.5; ( uncuffed) 1613 Endotrachial tube 4; ( uncuffed) 1614 Endotrachial tube 4.5; ( uncuffed) 1615 Endotrachial tube 5; ( uncuffed) 1616 Endotrachial tube 5.5; ( uncuffed) 1617 Endotrachial tube 5.5; 1618 Endotrachial tube 6.5; 1619 Endotrachial tube 7; 1620 Endotrachial tube 7.5; 1621 Endotrachial tube 8; 1622 Endotrachial tube 8.5; 1623 Glycine 1.5% 3 Litre Bottle 1624 Normal Saline 0.45% 3 Litre Bottle 1625 Inj. Carboprost / prostodin 1626 Inj. Methergin 0.24 1627 Inj. Pitocin 1628 Inj.Human chorionic Ganadotraphin 5000u, 2000u 1629 Tab. Cabergoline 1630 Tab. Bromocriptine 50 mg, 25 mg 1631 Tab. Letrozole 2.5 mg 1632 Tab. Pyridoxine 25 mg 1633 Tab. Perinorm 1634 Inj . Methotrexate 1635 Tab. Methotrexate 1636 Acetic Acid 1 % 1637 Lugol’s lodine 1638 Tolmdine Blue 1639 Formalin solution 5 lit. 1640 Sodium Hypochlorite solution or Bleaching power 1641 Inj. Vitamin K 1642 Xylocaine 2 % multidose vial for Labour room 1643 Inj. Tranexa 1644 Inj. Buscopan 1645 Inj. Drotaverine 1646 Inj. Mgso4 1647 Inj. Largactil 1648 Inj. Phenargan 1649 Inj. Duvadilon ( lsoxsuprine) 1650 Inj. Labetolol 1651 Tab. Labetolol 1652 Inj. Hydrallazine 1653 Inj. Phenytoin sodium 1654 Tab. Medroxy progesteione acetrate 10 mg 1655 Ear Buds 1656 Ear Speculum (Set) 1657 flying cacher 1658 Foreign Body spud Ear 1659 Foreign Body spud Nasal/ 1660 Franulum Retractor 1661 Fumigator 1662 Liquid Soap 500ml 1663 oxyagen flow meter (rotometer) 1664 Oxygen Cylender key 1665 Thermometer -40 Digree 1666 Scissor Encleation (Medium) 1667 Scissors Big (Tailor Type) 1668 Shoe Rack Affordable, Stackable 6-tier Storage Shoe Rack Holds up to 24 Shoes, Made From Metal and Plastic - 34w X 11d X 41h 1669 sonography Jelly 500 ml 1670 sonography Jelly 5 Lit. 1671 Steel bowel 10 1672 Steel bowel 4 1673 Steel Bowel 8 1674 Steel Container For General Use 2 Lit with led 1675 Steel Container For General Use 5 Lit with led 1676 Steel Container For General Use 10 Lit with led 1677 Steel Container For General Use 20e Lit with led 1678 Steel/Iron rack Four selves 1679 Strecher trolley deluxe 1680 Three Bucket Trolly For Cleaning/Moping 1681 Vein Spy Equipment 1682 Walker Non Folding 1683 Walker Folding 1684 Walking Stick 3/4 base 1685 Walking Stick Double grig 1686 Walking Stick Single base 1687 Walking Stick Single grip 1688 Ward linen trolly 1689 New Born Sheet 1690 alcoho; Based Hand Rub 70% 1691 Sensorcaine Vial 1692 Vintolin Injection 500 mcg 1693 LOW MOLECULAR WEIGHT HEPARIN 40 MG 1694 LOW MOLECULAR WEIGHT HEPARIN 60 MG 1695 P.T.INR Test Kit (Beccon) 1696 PAP Smear Kit 1697 Stethoscope 1698 FORMALIN SOLUTION Per litres 1699 GLYCERINE Per litre 1700 DISTILLED WATER Per litre 1701 PHENOL Per litre 1702 HISTOLOGY SLIDES FOR HISTOLOGY LAB SET OF 60 SLIDE 1703 Benedict’s reagent Per litres 1704 Acetic acid 10% Per litres 1705 Litmus paper 1706 Ammonium sulphate 1707 Sodium nitroprusside 1708 Liquor ammonia Per litres 1709 Sulphur powder (fine) 1710 WBC diluting fluid Per litres 1711 RBC diluting fluid Per litres 1712 Leishmann stain Per litres 1713 Dextrose powder Per pack 1714 Xylene Per litres 1715 Paraffin wax Per kg 1716 Nitric acid Per litres 1717 Haematoxylin& eosin stain Per litres 1718 DPX mount Pre bottle 1719 Egg albumin Pre bottle 1720 Ethanol (absolute) Per litres 1721 Rapid PAP stain Pre bottle 1722 May Grunwald Giemsa stain (MGG)Per litres 1723 Ziehl-Neelsen stain( ZN stain) Pre bottle 1724 Glass slides (Sunbeam–frosted) 1725 Cover slip (glass) 22 x 40 1726 Cover slip (glass) 22 x 60 1727 Field stain Pre bottle 1728 Filter paper Per pack 1729 Bloating paper Per pack 1730 Distilled water Per litres 1731 Reticulocyte solution (New methylene blue) Pre bottle 1732 Fitefaraco stain Per litres 1733 Grocott’smethamine silver (GMS) stain Pre bottle 1734 India ink Per litres 1735 Sodium metabisulphite Pre bottle 1736 Liquid paraffin Pre bottle 1737 PAS (Periodic acid schiff) stain Pre bottle 1738 EDTA Vacutainer (purple top) Per piece 1739 Sodium citrate Vacutainer (light blue top) 1740 Multistix 10 SG (10 parameter urine analysis strip) 1741 Glucose per pack of 100 test GOD POD 1742 Urea per pack of 100 test GLDH 1743 Creatinine per pack of 100 test Modified Jaffe’s 1744 Billirubin (Total and Direct) per pack of 100 test Diazo 1745 SGPT per pack of 100 test NADH oxidation 1746 SGOT per pack of 100 testNADH oxidation 1747 ALP per pack of 100 test Nitrophenyl phosphate 1748 Total Protein per pack of 100 test Biuret 1749 Albumin per pack of 100 test BCG 1750 Total Cholesterol per pack of 100 test CHOD POD 1751 Triglyceride per pack of 100 test Trinder 1752 HDL per pack of 100 test Direct 1753 LDL per pack of 100 test Direct 1754 Uric Acid per pack of 100 test Uricase POD 1755 Uristix ( strips for qualitative urine ketone bodies and protein detection)1/100 1756 Troponin I qualitative kit 1/100 1757 Troponin T qualitative kit 1/100 1758 CK-MB per pack of 100 testNADP Reduction 1759 T3 per pack of 100 testImmunoturbidimetry (Biomerieux) 1760 T4 per pack of 100 testImmunoturbidimetry (Biomerieux) 1761 TSHImmunoturbidimetry (Biomerieux) 1762 Amylase per pack of 100 test For Semiautomated Biochemistry analyser 1763 Lipase per pack of 100 test For Semiautomated Biochemistry analyser 1764 LDH per pack of 100 test For Semiautomated Biochemistry analyser 1765 Sodium per pack of 100 test For Semiautomated Biochemistry analyser 1766 Potassium per pack of 100 test For Semiautomated Biochemistry analyser 1767 Distilled Water Per litres 1768 Vacutainer (Plain) Red Coloured Cap 1/100 1769 Vacutainer (Fluoride) Grey Coloured Cap 1/100 1770 Sterilium Per litres 1771 Microtips (10-200 µl)1/100 1772 Microtips (100-1000 µl)1/100 1773 Micro And Macro Tips Stand1/100 1774 Micro Pipettes (10-100 µl) Per piece 1775 Micro Pipettes (20-200 µl) Per piece 1776 Micro Pipettes (100-1000 µl)Per piece 1777 Micro Pipettes (0.5-50 µl)Per piece 1778 Micro Pipettes StandPer piece 1779 Glass Tubes small 5ml 1780 Rubber pipette bulb (25 ml)Per piece 1781 Rubber pipette bulb (60 ml size)Per piece 1782 Pipette fillersPer piece 1783 Bottle top dispenserPer piece 1784 Acetone2.5 litre x 1 1785 Acetic acid 2.5 litre x 1 1786 Liquid ammonia500 ml x 1 1787 Ammonium chloride 500 gm x1 1788 100 gm x 1 1789 alpha naphthol 100 gm x 1 1790 Ammonium molybdate 500 gm x1 100 gm x 1 1791 Ammonium oxalate 500 gm x1 1792 Agar powder 500 gm x1 1793 Barium chloride 500 gm x1 1794 Benzoic acid 500 gm x1 1795 Benzidine powder 100 gm x 1 1796 Bovine albumin 5 gm x1 1797 Benedicts reagent 5 litre x 1 1798 Barfoeds reagent 125 ml x 1;500 ml x 1 1799 Bromine water 500 ml x 1 1800 Bile salt 500 gm x1 1801 Boric acid 500 gm x1 1802 Butanol 500 ml x 1 1803 Copper sulphate 500 gm x1 1804 Calcium carbonate 500 gm x1 1805 Calcium chloride 500 gm x1 1806 Citric acid500 gm x1 1807 Chloroform 500 gm x1 1808 Carbolic acid/ phenol 500 gm x1 1809 Cupric acetate 500 gm x1 1810 Disodium hydrogen phosphate 500 gm x1 1811 Dipotassium hydrogen phosohate 500 gm x1 1812 Dextrose 500 gm x1 1813 Dextrin 500 gm x1 1814 Ethanol 500 ml x 1 1815 Esbachs reagent 125 ml x 1 1816 Egg albumin powder 1817 D- fructose250 gm x 1 1818 Formaldehyde solution 500 ml x 1 1819 Formic acid 500 ml x 1 1820 Fehlings solution A 500 ml x 1 1821 Fehlings solution B 500 ml x 1 1822 Ferric chloride 500 gm x1 1823 Ferric ammonium sulphate 500 gm x1 1824 Fouchets reagent 125 ml x 1 1825 Gelatin 500 gm x 1 1826 Hydrochloric acid(HCl) 2.5 litre x 1 1827 Hydrogen peroxide 500 ml x 1 1828 Iodine crystals 100 gm x 1 1829 Lead acetate trihydrate 500 gm x1 1830 Lactose 500 gm x1 1831 Mercuric chloride 100 gm x 1 1832 Mercuric nitrate 100 gm x 1 1833 Methyl red 25 gm x 1 1834 Methylene blue 125 ml x 1; 100 ml x 1 1835 Magnesium sulphate 500 gm x1 1836 Methanol 500 ml x 1 1837 Mercuric sulphate100 gm x 1 1838 Molischs reagent500 ml x 1 1839 Maltose 250 gm x 1 1840 Millons reagent500 ml x 1 100 ml x 1 1841 Ninhydrin 10 gm x 1 1842 Ninhydrin reagent 500 ml x 1 1843 Ortho-toludine 100 gm x 1 1844 Potassium hydroxide 500 gm x1 1845 Potassium dichromate 500 gm x1 1846 Potassium chromate 500 gm x1 1847 Potassium iodide500 gm x1 250 gm x 1 1848 Phenopthaleine indicator 100 ml x 1 1849 Phenol red 100 ml x1 1850 Potassium chloride 500 gm x1 1851 Potassium dihdrogen phosphate 500 gm x1 1852 Potassium ferricyanite 500 gm x1 1853 Phenylhydrazine 250 gm x 1 1854 Peptone 500 gm x1 1855 Picric acid 500 gm x1 1856 Resorcinol 500 gm x1 1857 Sodium hydroxide 500 gm x1 1858 Sucrose 500 gm x1 1859 Sulphosalicylic acid 500 gm x1 1860 Sodium dithionite 500 gm x1 1861 Sodium nitrite 500 gm x1 1862 Sodium nitrate 500 gm x1 1863 Sodium acetate 500 gm x1 1864 Sodium carbonate 500 gm x1 1865 Sodium bicarbonate 500 gm x1 1866 Starch 500 gm x1 1867 Sodium chloride 500 gm x1 1868 Sodium sulphate 500 gm x1 1869 Silver nitrate100 gm x 1 1870 Sodium hydrogen carbonate 500 gm x1 1871 Sulphuric acid 2.5 litre x 1 1872 Seliwanoffs reagent 125 ml x 1 1873 Sodium citrate 500 gm x1 1874 Sodium potassium tartarate 500 gm x1 1875 Sodium nitroprusside 100 gm x 1 1876 Trichloro acetic acid 500 gm x1 1877 Zinc oxide 500 gm x1 1878 Nitric acid 500 ml x 1 1879 Phenylhydrazine Hydrochloride 250 gm x 1 1880 Bromophenol blue 125 ml x 1 1881 1-Amino-2-Naphthol-4-Sulphonic Acid 25 gm x 1 1882 2,4-Dinitrophenyl Hydrazine 100 gm x 1 1883 2-Amino-2-Methyl-1-Propanol 500 ml x 1 1884 4-Amino Antipyrine 100 gm x 1 1885 8-hydroxyquinoline 100 gm x 1 1886 Alpha ketoglutaric acid 25 gm x 1 1887 Bromocresol Green 5 gm x 1 1888 Cholesterol 25 gm x 1 1889 Creatinine 5 gm x 1 1890 Diacetylmonoxime 25 gm x 1 1891 Disodium Phenyl Phosphate 25 gm x 1 1892 Ehrlich’s Aldehyde Reagent 100 ml x 1 1893 Glycine 5 gm x 1 1894 L-Alanine 5 gm x 1 1895 L-Aspartic Acid 5 gm x 1 1896 L-Leucine 10 gm x 1 1897 L-Proline 5 gm x 1 1898 Nessler’s Reagent 100ml x 1 1899 o-Cresolphthalein 25 gm x 1 1900 Oxaloacetate 5 gm x 1 1901 pH Indicator Papers pH range 1-14 1 pack 1902 pH Indicator Papers pH range 3.5-6.0 1 pack 1903 pH Indicator Papers pH range 6.5-9.0 1 pack 1904 Phosphotungstic Acid 100 gm x 1 1905 Potassium Thiocyanate 500 gm x1 1906 Sodium Hypobromite Solution 100 ml x 1 1907 Sodium pyruvate 25 gm x 1 1908 Sodium Tungstate 100 gm x 1 1909 Sulphanilic Acid 100 gm x 1 1910 Tartaric Acid 100 gm x 1 1911 Thiosemicarbazide 25 gm x 1 1912 Unconjugated Bilirubin 1 gm x 1 1913 Urea 500 gm x1 1914 Uric Acid 25 gm x 1 1915 Whatman Paper No. 1 100 nos. x 1 1916 Test tubes 12 × 100 mm (Borosil) 1917 Test tubes12 × 75 mm(Borosil) 1918 Test tubes18 × 150 mm(Borosil) 1919 Sterile, AutoclavablePetriplates,optical clear) (Gamma irradiated)100 mm × 15 mm pack of 20 plates(Borosil) 1920 Glass Slide 75×25×1 mm(Borosil) 1921 Cover slip (microscope cover glass)22X22 mm(Borosil) 1922 Conical Flask (Flat bottam)2000 cc(Borosil) 1923 Conical Flask (Flat bottam)1000 cc(Borosil) 1924 Conical Flask (Flat bottam)500 cc(Borosil) 1925 Conical Flask (Flat bottam)250 cc(Borosil) 1926 Conical Flask (Flat bottam)100 cc(Borosil) 1927 Conical Flask (Flat bottam)50 cc(Borosil) 1928 Glass rod 1929 Measuring jar500 ml(Borosil) 1930 Measuring jar100 ml(Borosil) 1931 Glass volumetric pipette1 ml(Borosil) 1932 Glass volumetric pipette5 ml(Borosil) 1933 Petri Plates (Glass) (Pack of 10 plates)100 x 15 mm(Borosil) 1934 Tuberculin syringe 1/100 pack 1935 Sterile cotton swab in screw capped plastic tubes Himedia75mm packed in 12 mm tube per piece 1936 Sterile cotton swab sticks Himedia pack 1937 Urine container 1/100(30 ml) 1938 Stool container 1/100(50 ml) 1939 Micropipette tips (nucleases autoclavable polystyrene free (500 µl-1000 µl) 1 / 1000 tips 1940 Micropipette tips (nucleases autoclavable polystyrene free) (1µl-500 µl)1/1000 1941 Dropping bottle (plastic) Per p 1942 Filter paper (46×57 cm) 1/50Big sheet 1943 Forcep (pointed) 1944 Teasing needle 1945 Metal Loop holder (w/o loop) any size of nichrome wire can be inserted 1×24pack 1946 Antibiotic zonescale Per pSize 370 mm×65 mm 1947 Cleaning brush for test tubes Nylon material 1948 Spatula128 1949 Concavity slide (1 cavity) 1950 Spirit lamp 1951 Filter paper (Watsmen no 6) pack 1952 Cotton bundle Roll 1953 Plastic tray 24X18X6 1954 Test tube racks for 12 × 100 mm tubes 1955 Test tube racks for 12 × 75 mm tubes 1956 Test tube racks for 18 × 150 mm tubes 1957 Steam IndicatorTape 1 No 1958 Serum Vials 1 pack of 500 vials 2ml 1959 Screw capped plastic tubes 1 pack of 500 vials 1960 Serum vial stand (for 2 ml vials) 1961 Durham’s Tube 1 pack of 500 1962 Multichannel pipette (50 ul-300 ul) 1963 Micropipette tip stand(1µl-500 µl 1964 Micropipette tips stand (500 µl-1000 µl) 1965 ACETONE 500 ml 1966 ALBERTS Metachromatic stain kit (STAIN A &B) 500 ml 1967 BARIUM CHLORIDE 500 gm 1968 CARBOL FUCHSIN 25gm 1969 PHENOL (CRYSTAL) 500 gm 1970 CEDAR WOOD OIL - 30ML. 30ml 1971 DISTILLED WATER 5 ltr 1972 ETHANOL ABSOLUTE , 500 ML 5lit 1973 CRYSTAL VIOLET 125 ml 1974 METHYLENE BLUE SOLUTION 25 gm 1975 PH- PAPER RANGE - 2 - 10.5 1976 SAFFRANIN 125 mL 1977 SPIRIT 500 ml 1978 SULPHURIC ACID Conc. 5 ltr 1979 Gram stain kit 1980 Liquid paraffin 500ml 1981 TISSUE PAPER / LABORATORY PAPER 50 role 1982 XYLENE 500 ml 1983 Hydrogen peroxide 3% 1 Lit 1984 Lactophenol Cotton Blue Stain 100 ml 1985 Hydrochloric Acid Conc. 500 ml 1986 India Ink Stain 100 ml 1987 Potassium Hydroxide pellets 500 gm 1988 Sodium Hydroxide 500 gm 1989 Nichrome wire loop 2mm 1990 Nichrome wire loop 4mm 1991 Aluminium Foil Roll 500 gm 1992 Kovacs reagent (for Indole test) 100 ml 1993 Grams Iodine 125 ml 1994 Blood culture bottle (Adult) (Hi-media) 70 ml 1995 Blood culture bottle (Pediatric) (Himedia) 20 ml 1996 Sodium hypochlorite solution 5 lit 1997 HAEM Test Kit ( Stool for Occult blood test) 1 pack of 200 test 1998 RAPID AFB STAIN KIT (BA1523, 2X100ML (Biolab) 100 ML 1999 Lugol’s Iodine 125 ml/ Bottle 2000 Golves (7.5 no) 50 PAIRS/ PACK 2001 Liquid Soap 500 ml 2002 Hand Sanitizer 2003 Vaccutainers (Plain) red coloured cap 100 /PACK 2004 Triple sugar iron agar 500 gm MO21- 500g, Hi-media 2005 Peptone 500 gm RM667- 500g, Hi-media 2006 Agar agar Powder 500 gm RM026-500 G, Hi-media 2007 Bile Esculin Agar (MV972) 100 gm M340-100 G, Hi-media 2008 Cooked Meat Medium 500 gm M149-500G, Hi-media 2009 Fluid Thioglycolate medium 500 gm MM009-500G, Hi Media 2010 Deoxycholate Citrate Agar 500 gm M065-500 G,Hi-media 2011 Mac-Conkey Agar 500 gm M081-500G, Hi-media 2012 Mannitol Salt Agar Base 100gm M118-100 G,Hi-media 2013 SabouroudCyclohexamide Agar 500 gm M063-500 G, Hi-media 2014 Simmons Citrate Agar 500 gm M0009-500 G, Hi-media 2015 TCBS Agar 500 gm M189- 500 G, Hi-media 2016 Urea 40% FD048 10 ml Hi-media 2017 Urea Agar base 500 gm M112-500G, Hi Media 2018 Ready Water Testing Kit K015 Hi-media 2019 Tuberculin P.P.D 1 TU Hi-media 2020 Nutrient Agar 500 gm M877-500G, Hi Media 2021 Meuller Hinton Agar 500 gm M1084-500 Gm 2022 Brain Heart Infusion Broth 500gm 10210-500G 2023 Spore strips 25 strips/pack DD032-1pk 2024 Glucose broth 500 gm pack HIMEDIA M-860 2025 L J Media 10 Bottles/ Box HIMEDIA SL-001-10SL 2026 Field stain kit 1 HIMEDIAK-011L 2027 Ferric Chloride 500 gm HIMEDIA RM1379 2028 MR-VP broth 100 gm HIMEDIA-M070 2029 Methyl red indcator 125 ml bottle HIMEDIA -1007 2030 Glucose 500 gm Himedia 2031 Lactose 500 gm 2032 Sucrose 500 gm Himedia 2033 Mannitol Disk 1 vial DD006-1VL 2034 Corn meal Agar 100 gm HIMEDIA M146-100G 2035 Moeller decarboxylase broth lysine 100 gm M687-100G 2036 MOeller decarboxylase broth Ornithine 100 gm M688-100G 2037 MOeller decarboxylase broth Arginine 100 gm M689-100G 2038 Phenol red broth base 500 gm M054-500G 2039 Sodium chloride 500 gm RM853-500G 2040 Beef extract powder 500 gm RM669-500G 2041 Glucose - phosphate broth 100 gm M070-100G 2042 Barritt reagent A 100 ml R029-100 ml 2043 Barritt reagent A 100 ml R030-100 ML 2044 MacConkey Double strength broth 500 gm Hi Media 2045 Amikacin Antibiotic Disc 30mcg SD035-5vl HiMedia 2046 Amoxyclav Antibiotic 20+10mcg SD063-5vl HiMedia 2047 Ampicillin Antibiotic 10mcg SD002-5CT HiMedia 2048 Aztreonam Antibiotic Disc 30mcg SD212- 5CT HiMedia 2049 Ampicillin + sulbactum Antibiotic Disc (10+10)mcg SD112-5CT HiMedia 2050 Bacitracin 0.04 unit DD015-1vl HiMedia 2051 Cefotaxime Antibiotic Disc 30mcg SD040 - HiMedia 2052 Cefoxitin Antibiotic Disc 30mcg SD041 - HiMedia 2053 Clindamicin Antibiotic Disc 2mcg SD051-5CT HiMedia 2054 Cefotaxime + clavulanic acid Antibiotic Disc (30+10)mcg SD724-5CT HiMedia 2055 Ceftazidime + clavulanic acid Antibiotic Disc (30+10)mcg SD207-5CT HiMedia 2056 Cefalexin 30 mcg SD048–5CT HiMedia 2057 Ceftriaxone Antibiotic Disc 30mcg SD065 – 5CT HiMedia 2058 Cefazoline Antibiotic Disc 30mcg SD047-5CT HiMedia 2059 Cefepime Antibiotic Disc 30mcg SD219- 5vl HiMedia 2060 Cefuroxime Antibiotic Disc 30mcg SD061-5CT HiMedia 2061 Chloromphenicol Antibiotic Disc 30mcg SD006- 5vl HiMedia 2062 Ciprofloxacin Antibiotic Disc 5mcg SD060- 5vl HiMedia 2063 Cefixime 30mcg SD211- 5CT HiMedia 2064 Colistin E-Strip (0.5) 10mcg EM020-30ST HiMedia 2065 Ceftazidime 30mcg SD062- 5vl HiMedia 2066 Co-trimaxazole (1.25+23.75)mcg SD010-5vl HiMedia 2067 Cefoperazone sulbactum 75/10mcg SD254-5CT Hi Media 2068 Doxycycline 30mcg SD012-5vl HiMedia 2069 Imipenam Antibiotic Disc 10mcg SD073-5vl HiMedia 2070 Imipenam + EDTA Antibiotic Disc (10+750)mcg HiMedia 2071 Ertapenem Antibiotic Disc 10mcg SD280-5vl HiMedia 2072 Levofloxacin Antibiotic Disc 5mcg SD216 – 5vl HiMedia 2073 Linezolid Antibiotic Disc 30mcg SD215-5CT HiMedia 2074 Meropenam Antibiotic Disc 10mcg SD727- 5vl HiMedia 2075 Moxifloxacin 5mcg SD217- 5CT HiMedia 2076 H.S Gentamicin 120mcg SD195-1vl HiMedia 2077 Netilmicin Antibiotic Disc30mcg SD085-5CT HiMedia 2078 Nitrofurantoin Antibiotic Disc 300mcg SD023-5vl HiMedia 2079 Norfloxacin Antibiotic Disc 10mcg SD057-5vl HiMedia 2080 Nalidixic acid Antibiotic disc 30mcg SD021-1vl HiMedia 2081 Ofloxacin Antibiotic Disc 5mcg SD087-5CT HiMedia 2082 Optochin Antibiotic Disc 5mcg DD009-1vl HiMedia 2083 Oxidase disc Antibiotic Disc DD018-1vl HiMedia 2084 Penicillin G Antibiotic Disc 10 units SD028- 5CT HiMedia 2085 Piperacillin Antibiotic Disc 100mcg SD066-5CT HiMedia 2086 Piperacillin/Tazobactum Antibiotic Disc (100+10)mcg SD210-5vl HiMedia 2087 Polymyxin B E- strip Part A 240-.01mcg Part B32-.001mcg/ml EM043-30STHiMedia 2088 Polymyxin B 50mcg HiMedia 2089 Tigecycline Antibiotic Disc 15mcg SD278-5CT HiMedia 2090 Novobiocin 5mcg HiMedia 2091 Gentamicin 10mcg SD016-5vl HiMedia 2092 Teicoplanin Antibiotic Disc 30mcg SD213-5CT HiMedia 2093 Tetracycline Antibiotic Disc 30mcg SD037-5vl HiMedia 2094 Tobramycin Antibiotic Disc 10mcg SD044-5vl HiMedia 2095 Vancomycin Antibiotic Disc 30mcg SD045-5CT HiMedia 2096 Vancomycin E- Strip 256-.015mcg/ml EM060-30ST HiMedia 2097 Fosfomycin 200mcg SD179- 5vl HiMedia 2098 Azithromycin 15mcg SD204- HiMedia 2099 Erythromycin 15mcg SD013-5CT HiMedia 2100 HBsAg TEST KIT 10 tests/ Kit 2101 HCV TEST KIT 10 tests/ Kit 2102 RPR TEST KIT 25 TESTS (5 ml reagent)/ KIT 2103 MALARIA Ag (Pv/Pf) TEST KIT 10 tests/ Kit 2104 WIDAL SLIDE AGGLUTINATION TEST KIT 25 TESTS (5 ml reagent)/ KIT 2105 DENGUE NS1 ANTIGEN ELISA 96 tests/ Kits 2106 RA FACTOR TEST KIT 25 TESTS (5 ml reagent)/ KIT 2107 ASO TITRE TEST 25 TESTS (5 ml reagent)/ KIT 2108 CRP TEST 25 TESTS (5 ml reagent)/ KIT 2109 WIDAL TUBE AGGLUTINATION TEST 25 TESTS (5 ml reagent)/ KIT 2110 TORCH ELISA 1/96 test 2111 HBeAg STRIP rapid card test 10 tests/ Kit 2112 Hepatitis A rapid card test 10 tests/ Kit 2113 Weil Felix Tube agglutionation test 25 TESTS (5 ml reagent)/ KIT 2114 ATCC strain-Enterococcus fecalis 29212 Pack of 2 swabs HiMedia – 0366-P 2115 ATCC strain - E.coli 25922 Pack of 2 swabs HiMedia -0335-P 2116 ATCC strain - E.coli 35218 Pack of 2 swabs HiMedia – 0495-P 2117 ATCC strain Pseudomonas aeruginosa 27853 Pack of 2 swabs HiMedia -0353-P 2118 ATCC strain Staphylococcus aureus 25923 Pack of 2 swabs HiMedia -0360-P 2119 ATCC strain Staphylococcus aureus 29213 Pack of 2 swabs HiMedia – 0365-P 2120 ATCC Klebsiella Pack of 2 swabs HiMedia – 01005 P 2121 Pneumoniae BAA - 1705 2122 ATCC Klebsiella Pack of 2 swabs HiMedia- 0784-P 2123 Pneumoniae 700603 2124 ATCC Candida albicans 10231Pack of 2 swabs HiMedia- 0443-P 2125 ATCC Candida tropicalis 750 Pack of 2 swabs HiMedia- 0767-P 2126 Antisera - Salmonella 1 set 2127 Antisera – Shigella dysenteriae 2128 Antisera – Shigella flexnari 2129 Antisera – Shigella sonnie 2130 Antisera - Vibrio cholerae 1 set 2131 Methylene Blue Stain 100ml 2132 Carbol Fuschin(Strong) 100ml 2133 Sulfuric Acid(Conc.) Per Liter 2134 ECG electrode (disposal) Other 2135 Electric Setlizier 10*5 Other 2136 Electric setlizier 14*5 Other 2137 Electric setlizier 16*5 Other 2138 Electric setlizier 18*5 Other 2139 Electric setlizier 20*5 Other 2140 Reusable Preformed Supraglotic airway device with sizes 1,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2141 Reusable Preformed Supraglotic airway device with sizes 1.5,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2142 Reusable Preformed Supraglotic airway device with sizes 2,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2143 Reusable Preformed Supraglotic airway device with sizes 2.5,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2144 Reusable Preformed Supraglotic airway device with sizes 3,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2145 Reusable Preformed Supraglotic airway device with sizes 4,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2146 Reusable Preformed Supraglotic airway device with sizes 5,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2147 Reusable Preformed Supraglotic airway device with sizes 6,-should have silicon cuff , Reinforced tip, Pilot balloon withtactile indication, Autoclavable ,US FDA ,CE & ISO Certified. 2148 Supraglotic airway device with integrated gastric access and intubation :- 2149 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 1 USFDA CE & ISO certified 2150 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 1.5 USFDA CE & ISO certified 2151 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 2 USFDA CE & ISO certified 2152 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 2.5 USFDA CE & ISO certified 2153 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 3 USFDA CE & ISO certified 2154 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 4 USFDA CE & ISO certified 2155 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 5 USFDA CE & ISO certified 2156 Reinforced tip with gastric drainage port and intubating laryngeal. Pilot balloon withtactile indication, MRI safe and Phthalate free material. Integrated bite absorption area. Soft & thin cuff & Available with sizes 6 USFDA CE & ISO certified 2157 Manual Resuscitators with Built in pressure limitation – adult withface mask of size 3/4 & 5,O2 Tidal volume 1300 ml, reservoir volume 1500 ml; 100% latex free & double layered. Built-in- pressure limitation, single shutter valve, integrated hand strap, autoclavable, provision to attach peep valve. USFDA ,CE & ISO certified 2158 Manual Resuscitators with built in pressure limitation – Paediatric/neonatewith face mask of size 0 & 2 max. Tidal volume - 300 ml; Volume of O2 reservoir - 1500 ml/volume 100% latex free outer cover & double layered. single shutter valve, integrated hand strap, autoclavable ,pressure-limiting valve ,provision to attach pressure manometer, USFDA ,CE & ISO Certified 2159 ECG Electrodes with Offset connector. Highly conductive wet gel , Combination of instant and long-term adhesives ,Breathable micro porous material ,Special soft spongeOffset connector concept, High Quality Ag/ AgCl sensor 2160 Fibreless video scope, available with three optional sizes of inner diameter 1.2mm, 2.2mm & 2.8 mm, should have suction port & oxygen delivery port, should be USFDAShould be compatible with a-view monitor of size 8.5 inches with 8 GB memory. 2161 Airway visualization system (Adult):-Display Monitor with Video output capability. Work on AAA consumable batteries & runs continuously upto 90 mints. can work on reusable batteries too if required, Anti Fog Lens with White LED light source, supplied with 3pcs of size 3 channelled and 1 pc of size 3 non-channelled blades, 510 K , ISO & CE Certified 2162 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 18, 2163 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 20, 2164 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 22, 2165 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 24, 2166 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 26, 2167 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 28, 2168 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 30, 2169 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 32, 2170 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 34, 2171 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 36, 2172 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 38, 2173 Reusable Armored tube made of 100% Siliconized, radio opaque, mounted connector, pilot balloon with universal port. size- 40, 2174 Broad spectrum Antimicrobial/ Antibacterial/ Double Lumen Polyurethane CVC Catheter kit, catheter and Extension Line along with Hub should be Impregnated. Kit should contain- Fr-7, G-14X18, L-16cm.with J Guide wire, Rollerson, Syringe, Dilator, Scalpel. Needle free cannula transduction probe, Catheter stabilization device. 2175 Broad spectrum Antimicrobial/Antibacterial Triple Lumen Polyurethane CVC Catheter, catheter and Extension Line along with Hub should be Impregnated. Kit should contain- Fr-7, G-16x18X18, L-16cm. with J Guide wire, Rollerson, Syringe, Hub stopper impregnated with 70% Isopropyl Alcohol swab Dilator, Scalpel. Needle free cannula, transduction probe, Catheter stabilization device 2176 Broad spectrum Antimicrobial/Antibacterial Double Lumen Polyurethane HD Catheter, catheter Lumen and Extension Line along with Hub should be Impregnated. Kit should contain- Fr-12, L-13cm. with J Guide wire, Rollerson Syringe with Dilator, Scalpel. Needle free cannula, transduction probe, Catheter stabilization device. 2177 Broad spectrum Antibacterial /Antifungal Triple Lumen Polyurethane HD Catheter, Catheter and Extension Line along with Hub should be Impregnated. Kit should contain- Fr-12, L-16cm. with J Guide wire, Rollerson Syringe, Dilator, Scalpel. Needle free cannula, transduction probe,Catheter stabilization device. 2178 Hydrocolloid Scar free Nasal Pads to prevent CPCP, BIPAP, and OXY MASK, to avoid pressure ulcers or bruises on the nose. Sizes S/L. CE certified. 2179 Hemostatic dressing in Sponge/ Pad from made of 100% Natural Biopolymer with a Net Positive charge, Gama Sterilized and moisture proof. USFDA Approved. Sizes- 5*5, 2180 Hemostatic dressing in Sponge/ Pad from made of 100% Natural Biopolymer with a Net Positive charge, Gama Sterilized and moisture proof. USFDA Approved. Sizes- 8*8 2181 Urethral Catheter made up of soft color less,clear, breathable, Odorless, 2182 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. Sizes- 8, Should be US FDA Approved. 2183 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. Sizes- 12, Should be US FDA Approved. 2184 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. Sizes- 14, Should be US FDA Approved. 2185 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. Sizes- 16, Should be US FDA Approved. 2186 100% silicon having white opaque line and white cyclindercal balloon tip 5 to 10 ml balloon capacity. Sizes- 18, Should be US FDA Approved. 2187 Non-absorbable Polymer Locking Clips provide cool secure ligation; clip locks onto the vessel. Clip sizes Medium, Medium-Large, Large and Extra-Large. The Non-Absorbable polymer clip is inert, nonconductive, radiolucent, and does not interfere with CT or X-ray diagnostics. FDA Approved 2188 Multifunctional Mask with the multiple Integrated attachment of Nebulizer Mask, venture mask, oxygen mask, With 7” Double Oxygen Tube. Should have Oxygen outlet Diverter and Fenestration opening slits on both sides. FDA Approved 2189 Polymer Ligation device with locking mechanism, sterile, radiolucent property, USFDA approved. cartridges should have self-adhesive backing.Sizes- A- Medium Large polymer Ligation device. 2190 Polymer Ligation device with locking mechanism, sterile, radiolucent property, USFDA approved. cartridges should have self-adhesive backing. Sizes- B- Medium Large polymer Ligation device. 2191 Polymer Ligation device with locking mechanism, sterile, radiolucent property, USFDA approved. cartridges should have self-adhesive backing.Sizes- C- Medium Large polymer Ligation device. 2192 Sizes- A- 8 inch in size with Curved for ML/ L/ XL. 2193 B- 11 inch in size with right angle 70° 2194 Endo Applicator- Matt finishing stainless steel applier, with US FDA approvedSizes- A- 32.5cm for ML/ L/ XL 2195 Endo Applicator- Matt finishing stainless steel applier, with US FDA approvedSizes- B- 45cm for ML/ L/ XL 2196 Micro Titanium Ligation device with locking mechanism, sterile, USFDA approved. Cartridges should have self-adhesive backing. 2197 Sizes- 6” and 8” 2198 Postpartum Hemorrhage Balloon Silicon Catheter for control of obstetrical bleeding OR management of PPH. Size- 24Fr, Length- 54cm,Balloon capacity-500ml, FDA Approved 2199 Cervical ripering Balloon for mechanical dilation L-40cm. Fr.-18, Balloon Capacity 80ml. 2200 PUR Catheter Non Shrinkable IV Line with prefilled 70% Isopropyl Alcohol cap for Peripheral Veins. XRO, and with non- return Valve 2201 Short IV Catheter for Neonates with Straight Guide Wire. G-22, L-10, 12cm 2202 Arterial Catheter with Floswitch and straight Guide wire, G-18, L-6/13cm 2203 Short PTFE material Emergency Catheter with Floswitch and stabilising device. G-14, L- 13 16mm. 2204 Reinforced Epidural wired Polyurethane catheter kit with stainless steel needle. Size- catheter-19G, Needle-17G. 2205 Suture free Securement hydrocolloid device S 2206 Suture free Securement hydrocolloid device M 2207 Suture free Securement hydrocolloid device L 2208 Medicated Catheter stabilization device with medical grade PVC clamp should have ID tag S 2209 Medicated Catheter stabilization device with medical grade PVC clamp should have ID tag M 2210 Medicated Catheter stabilization device with medical grade PVC clamp should have ID tag L 2211 Vascular haemostatic pad to stop external bleeding and Catheterization site bleeding , should be 100% Chitosin material, size-2”X2” single pack. Sterilized. 2212 Paracain eye Drop 0.5% 2213 Trypan blue-Dye 0.4% 2214 Plastering in C.M 1:5-12 mm thick with including cost and conveyance of all materials and including all labour charges etc complete 2215 Spectacles fornSchool childremnA. Frame- Material- Ployflex unbreakable frame with all different sizes suitable for children(from 8-20 yrs).nB. Lenses- CR hardcoated lenses (fiber) of prescribed numbers.nC. Case-Plastic case printed as followos-nName of the district.......nNPCB & VI, nMadhya PradeshnNot for salenD. Accessiores-nI. Dori, nII. Cleaning Cloth(Slevet),nIII. Prescription Card,n 2216 Screening and free spectacles for near work to Old PersonnA. Frame- Material- Ployflex unbreakable frame with all different sizes suitable for Old PersonnB. Lenses- CR hardcoated lenses (fiber) of prescribed numbers.nC. Case-Plastic case printed as followos-nName of the district.......nNPCB & VI, nMadhya PradeshnNot for salenD. Accessiores-ni. Dori, nii. Cleaning Cloth(Slevet),niii. Prescription Card,n 2217 Spectacles after cataract surgery (where bifocal lens will be needed) nA. Frame- Material- Ployflex unbreakable frame with all different sizes suitable for Cataract Patient.nB.Lenses- CR hardcoated lenses (fiber) of prescribed numbers.nC. Case-Plastic case printed as followos-nName of the district.......nNPCB & VI, nMadhya PradeshnNot for salenD.Accessiores-ni. Dori, nii. Cleaning Cloth(Slevet),niii. Prescription Card,n 2218 Gastro Intestinal Anastomotic Stapler 60 mm with dual firing knob and inbuilt knife in every cartridge,GIA6038S,GIA6048S,GIA6025S 2219 Gastro Intestinal Anastomotic Stapler 80 mm with dual firing knob and inbuilt knife in every cartridge,GIA8038S,GIA8048S 2220 Gastro Intestinal Anastomotic Stapler 100 mm with dual firing knob and inbuilt knife in every cartridge,GIA10038S,GIA10048S 2221 Gastro Intestinal Anastomotic 60 mm cartridge with fresh knife-White/Blue/Green,GIA6025L,GIA6038L,GIA6048L 2222 Gastro Intestinal Anastomotic 80 mm cartridge with fresh knife-White/Blue/Green,GIA8038L,GIA8048L 2223 Gastro Intestinal Anastomotic 100 mm cartridge with fresh knife-White/Blue/Green,GIA10038L,GIA10048L 2224 Reusable Gastro Intestinal Anastomotic stapler 60 mm with dual firing knob and inbuilt knife in every cartridge,GIA60RS 2225 Reusable Gastro Intestinal Anastomotic stapler 80 mm with dual firing knob and inbuilt knife in every cartridge,GIA80RS 2226 Gastro Intestinal Anastomotic 60 mm cartridge with fresh knife-White/Blue/Green for reusable stapler,GIA6025RL,GIA38RL,GIA6048RL 2227 Gastro Intestinal Anastomotic 80 mm cartridge with fresh knife-White/Blue/Green for reusable stapler,GIA8038RL,GIA8048RL 2228 Curved End to End Anastomotic Stapler 25 mm with Tilt-Top Anvil 2229 Curved End to End Anastomotic Stapler 28 mm with Tilt-Top Anvil 2230 Curved End to End Anastomotic Stapler 31 mm with Tilt-Top Anvil,EEA31 Circular stapler 2231 Curved End to End Anastomotic Stapler 33 mm with Tilt-Top Anvil,EEA33 Circular stapler 2232 Endo Gastro Intestinal Anastomotic Universal Stapler can accommodate all sizes of cartridges also both straight and roticulator cartridges 2233 BLADELESS TROCAR -5mm/11mm/-12mm,NONB12STS,NONB5STF 2234 OPTICAL BLADELESS TROCARS-5 mm / 11mm/12mm/15mm,ONB12STS,ONB5STF 2235 Hemorrhoid Stapler 33 mm diametre with detachable anvil and staple height 3.5 mm,HEM3335 2236 Hemorrhoid Stapler 33 mm diametre with detachable anvil and staple height 4.8 mm,HEM3348 2237 Appose ULC Skin Stapler With 35 WIDE Staples 2238 Premium single use Skin Stapler remover 2239 MED WOUND PROTECTOR 5 - 9CM,WPSMD509 2240 SML WOUND PROTECTOR 2.5 - 6CM,WPSM256 2241 PREMIUM SURGICLIP III 9.0 2242 3X6 ENDOBAG SPECIMEN RETRIEVAL 2243 5 X 8 ENDOBAG SPECIMEN RETRIEV 2244 ENDO CLIP* II MED/LRG APPLIER 2245 PREMIUM SURGICLIP* II M-9.75 2246 PREMIUM SURGICLIP* II M-11.5 2247 Fred anti fog Kit 2248 Monofilament Glycomer 631* 3-0 75CM , UNDYED 24MM 3/8 Circle Reverse Cutting 2249 Monofilament Glycomer 631* 0 75CM , UNDYED 37MM 1/2 Circle Reverse Cutting 2250 Monofilament Glycomer 631* 2-0 75CM , UNDYED 37MM 1/2 Circle Reverse Cutting 2251 Monofilament Glycomer 631* 0 ,150CM LOOP , VIOLET 40MM 1/2 Circle Taper Point 2252 Monofilament Glycomer 631* 1 ,90CM , VIOLET 40MM 1/2 Circle Taper Point 2253 Monofilament Glycomer 631* 2-0 75CM , VIOLET 26MM 1/2 Circle Taper Point 2254 Monofilament Polyglyconate* 3-0 75CM , GREEN 20MM 1/2 Circle Taper Point 2255 Monofilament Polyglyconate* 1, 150CM LOOP, GREEN 40MM 1/2 Circle Taper Point 2256 Monofilament Polyglyconate* 1 90CM , GREEN 48MM 1/2 Circle Taper Point 2257 Monofilament polyamide * 1 150CM , LOOP , BLACK 48MM 1/2 Circle Taper Point 2258 Coated,Braided Lactomer 91* 3-0 75CM , UNDYED 24MM 3/8 Circle Reverse Cutting 2259 Coated,Braided Lactomer 91* 3-0 75CM , VIOLET 22MM 1/2 Circle Taper Point 2260 Coated,Braided Lactomer 91* 0 90CM , VIOLET 37MM 1/2 Circle Reverse Cutting 2261 Coated,Braided Lactomer 91* 2-0 90CM , VIOLET 37MM 1/2 Circle Reverse Cutting 2262 Coated,Braided Lactomer 91* 0 90CM , VIOLET 40MM 1/2 Circle Reverse Cutting 2263 Coated,Braided Lactomer 91* 1 90CM , VIOLET 40MM 1/2 Circle Reverse Cutting 2264 180 Absorbable Polyglyconate Knotless wound closure device with unidirectional & Dual Angled cut Barbs Geometry * 0 45CM , GREEN 37MM 1/2 Circle Taper Point 2265 180 Absorbable Polyglyconate Knotless wound closure device with unidirectional & Dual Angled cut Barbs Geometry * 2-0 30CM , GREEN 37MM 1/2 Circle Taper Point 2266 90 Glycomer 631 Knotless wound closure device with unidirectional & Dual Angled cut Barbs Geometry 3-0 58CM , UNDYED 24MM 3/8 Circle Reverse Cutting 2267 90 Glycomer 631 Knotless wound closure device with unidirectional & Dual Angled cut Barbs Geometry 3-0 45CM , UNDYED 24MM 3/8 Circle Reverse Cutting 2268 Polybutester with Polytribolate coating Knotless wound closure device with unidirectional & Dual Angled cut Barbs Geometry 1 45CM , BLUE 37MM 1/2 Circle Taper Point 2269 Polyester SELF GRIPPING MESH FOR Open Inguinal Hernia Repair, Size 14x9cm L&R 2270 Polyester SELF GRIPPING MESH FOR Open Incisional Hernia Repair, Size 20x15cm 2271 Polyester SELF GRIPPING MESH FOR Open Incisional Hernia Repair, Size 15x15cm 2272 MacroPorus Partially Absorbable Mesh made up of approximately equal parts of Polypropylene Monofilament fiber (6-0) and Poliglecaprone 25 Monofilament fiber (5-0) with pore size 2.7 mm having a weight of 39 g/m2 and containing blue orientation stripes of Polypropylene. 15cmx15cm 2273 Purified lyophilized Rabies antigen derived from Rabies virus ( L.Pasteur 2061/Vero Strain propagated in Vero Cells ) Inactivated.2.5 I.U 2274 Aceclofenac 100mg+Paracetamol 325mg+Chlorzoxazone 250mg Tab(250mg),Tablet 2275 Aceclofenac 10 x 10 Mg Tab(10 x 10 ),Tablet 2276 Aceclofenac 100mg+Paracetamol 500mg Tab 2277 Aceclofenac(100mg),Tablet 2278 Aceclofenac + Paracetamol + Chlorzoxazone 100 mg + 500 mg + 500 mg tab 2279 Acetazolamide Tab(250mg),Tablet 2280 Aciclovir Cream 5% (5g Tube) 2281 Acyclovir(800mg),Tablet 2282 Acyclovir Inj 250 mg/Vial 2283 Acyclovir Inj 500mg/Vial 2284 Acyclovir intervenous infusion i.p 500mg/Vial 2285 Acyclovir suspension 400mg/5ml(100 ml Bottle),Suspension 2286 Acyclovir Tab 400 mg(400 mg),Tablet 2287 Acyclovir tab. IP - 200mg 2288 Adrenaline(1 mg / ml (1 ml Amp)),Injection 2289 AGGS(Anti Gas Gangrene Serum)l/30000 OU/ml Inj. 2290 Albendazole Suspension - 200mg/5ml(10 ml Bottle),Syrup 2291 Albendazole Tab(200 mg),Tablet 2292 Albendazole Tablets IP - 400mg 2293 Alpha-Beta Arteether(150mg/2ml),Injection 2294 Alpha-Beta Arteether Inj 75 mg / 2 ml 2295 Alpha-Beta Arteether Inj 75 mg /ml 1ml 1ml Amp( ),Injection 2296 Alprazolam(0.5mg),Tablet 2297 Alprazolam Tab. - 0.25mg Tab 2298 Altracurium (10mg/ml,2.5ml vial),Injection 2299 inj amphotericin B 500mg for injection 2300 cap amphotericin B 10mg 2301 Amikacin(100mg / 2ml vial),Injection 2302 Amikacin(250mg/2ml),Injection 2303 Amikacin(500mg/2ml (2ml Vial)),Injection 2304 Amiodarone inj. - 50mg/ml (3ml vial) 2305 Amiodarone Tab 100mg 2306 Amitriptyline(10 mg),Tablet 2307 Amitriptyline Sugar Coated Tab. IP - 25 mg 2308 Amitryptiline 75 mg tab 2309 Amitryptiline Tab(50 mg),Tablet 2310 Amlodipine(10mg),Tablet 2311 Amlodipine(2.5mg),Tablet 2312 Amlodipin Tab(5mg),Tablet 2313 Amoxicillin(125 ml/5ml (30 ml Bottle)),Suspension 2314 Amoxicillin 250mg + Clavulanic Acid 50mg Inj Vial 2315 Amoxicillin 250 mg / vial Vial 2316 Amoxicillin Cap. - 250 mg. 2317 Amoxicillin + Clavulanic Acid (125 mg + 25 mg) / vial Vial 2318 Amoxicillin + Clavulanic Acid(200 mg + 28.5 mg),Tablet 2319 Amoxicillin Trihydrate Dispersible 125 mg Tab(125 mg),Tablet 2320 Amoxycillin and Clavulanic Acid I.P.(200+28.5mg (30 ml Bottle)),Suspension 2321 Amoxycillin and Clavulanic Acid I.P.(500mg + 125mg),Tablet 2322 Amoxycillin and Potassium Clavulanate I.P.(1 gm + 0.2 gm /10 ml vial),Injection 2323 Amoxycillin +Clavulanic acid Inj (Amoxycillin 500 + Clavulanic acid 100 mg)/vial 2324 Amoxycillin Dispersible Tablets IP-Amoxicillin Trihydrate IP equivalent to Amoxicillin(250mg),Tablet 2325 Amoxycilline(500mg),Capsule 2326 Ampicillin(1 gm Vial),Injection 2327 Ampicillin 250 mg Cap 2328 Ampicilline 125mg/30ml Syrup 2329 Ampicillin Inj. - 250 mg/vial 2330 Ampicillin Syrup (125 mg / 5 ml 30 ml Bottle),Syrup 2331 Antacid Chewable Tablet containing Aluminum hydroxide equivalent to dried gel 250mg+ Magnesium hydroxide 250mg+ Simethicone 50mg USP 2332 Anticold (Paracetamol 300mg+Cetirizine HCL 5mg Tablet 2333 Anti D Immunoglobulin for IV/IM Use (Monoclonal) Inj. 150mcg (1ml Vial) 2334 Anti Hemophilic Factor VIII(250IU Vial),Injection 2335 Anti Rabies Immunoglobulin Inj - 300 IU per 2ml (2ml Vial)(300 IU per 2ml),Injection Solution for 2336 Anti Snake Venom Polyvalent Inj 10ml (Lyophilized)(10 ml Vial),Injection 2337 Aripiprazole 5 mg tab 2338 Artemether Inj 80mg/ml (1 ml Amp) 2339 Artemether+Lumefantrine 20mg+120mg tab 2340 Artesunate inj 60 mg /vial 2341 Artesunate + Sulphadoxine + Pyrimethamine (Age group between 1-4 year)(50 mg (3 Tab) + 500 mg (1 Tab) + 25 mg (1 Tab)),Combi Blister Pack 2342 Artesunate + Sulphadoxine + Pyrimethamine IP (Age Group 15 or above)(200 mg (3Tab) + 750 mg (2Tab) + 37.5 mg (1Tab)),Combi Blister Pack 2343 Artesunate + Sulphadoxine + Pyrimethamine IP Age Group Between 5 to 8 Years(100 mg(3Tab) + 750mg + 37.5mg (1tab)),Combi Blister Pack 2344 Artesunate Tablets 150mg(3Tab) + Sulphadoxine (500mg+500mg)-Pyrimethamine 25mg +25mg Tab IP (2Tab) (Age Group 9 to 14 Years) 2345 Artesunate Tablets 25mg(3Tab) + Sulphadoxine 125mg-Pyrimethamine 6.25mg Tablets IP(1tab) (Age group of less than 1year) 2346 Ascorbic Acid (Vitamin C) Tab. 500 mg. 2347 Aspirin Low Dose 75mg tab 2348 Aspirin low dose tab - 150mg 2349 Atenolol(25 mg),Tablet 2350 Atenolol Tab. - 100mg - 10 X 14 Tab 2351 Atenolol Tab 50mg. 2352 Atorvastatin(10 mg),Tablet 2353 Atorvastatin(20mg),Tablet 2354 Atracurium Besylate(10mg/ml Inj Amp),Injection 2355 Atropine Sulphate 0.6 mg/ml SC/IM/IV(2ml Amp),Injection 2356 Atropine Sulphate Eye drops - 1% (5 ml Vial)(5 ml Vial),Eye Drops/ Ointment 2357 Atropine Sulphate Eye Ointment 1% (3 gm tube) 2358 Azithromycin(100mg/5ml (15 ml Bottle)),Suspension 2359 Azithromycin 1gm Tab + Cefixime 400mg Tab 2360 Azithromycin(200mg/5ml (15 ml Bottle)),Suspension 2361 Azithromycin(250mg),Tablet 2362 Azithromycin(500 mg/5ml Inj ),Vial 2363 Azithromycin 500mg Tab 2364 Balance salt solution for irrigation-500 ml FFS bottle(500ml bottle),Eye Applicap 2365 Beclomethasone Dipropionate, clotrimazole, Neomycine sulphate, chlorocresol(0.025% + 1% + 0.5% + 0.1% w/w (5gm Tube)),Ointment or Cream 2366 Beclomethasone Inhalation I.P 200 mcg per dose(200 metered dose container),Inhaler 2367 Benzathine Penicilline 12 Lac IU / vial Vial 2368 Benzathine Penicillin Powder for Inj IP 6 lakh IU/vial 2369 Benzyl Benzoate lotion(25%),Bottle 2370 Benzyl Penicillin 10lac/vial(Penicillin G),Injection 2371 Betahistine(16 mg),Tablet 2372 Betahistine 8 mg Tab 2373 Betamethasone Dipropionate Ointment 0.05% (15gm) tube 2374 Betamethasone Tab 0.5 mg 2375 Biphasic Isophane Insulin(30/70 40IU/ml (10 ml Vial)),Injection( mixtured ) 2376 insuline regular/ soulable (40iu/ml10mlvail) 2377 Bisacodyl(5 mg),Suppository 2378 Bisacodyl Tab 5mg 2379 Botropase injection (Haemocoagulase 1cu) 1ml 2380 Bromhexine hydrochloride 4mg/5ml Syrup (50ml Bottle) 2381 Budesonide Nebulising Suspension Containing Budesonide 0.25mg/ml - 2ml Amp 2382 Budesonide Respules 0.25mg/2ml Inhalation(2ml Amp/Respule),Inhaler 2383 Bupivacaine Hcl For Spinal Anaesthesia 0.5%(Heavy)amp 4 ml Amp 2384 Bupivacaine hydrochloride Inj. - 0.5% (20 ml Vial) 2385 Bupivacaine Hydrochloride Inj. 0.5% - 20ml Vial (Not For Spinal use) 2386 Bupivacaine Hydrochloride Inj. 4ml Amp (Not For Spinal use)(0.5%),Vial 2387 Buppivacaine 5 mg, Dextrose80 mg / ml, 4 ml Inj Injection 2388 Caffeine Citrate Inj. 20mg/ml (3 ml Vial)(20mg/ml 3 ml Vial),Injection 2389 Calamine Lotion IP (contains per 1000 ml:- calamine 150 gm,Zinc oxide 50 gm, Bentonite 30 gm, Sodium Citrate 5gm, liquified phenol 5ml, glycerin 50 ml purified waterfreshly boiled and cooled to produced 1000ml) 50 ml Bottle 2390 Calcium Carbonate 500 mg Tab 2391 Calcium Carbonate derived from Oyester shell equivalent to elemental Calcium 500mg and Vitamin D3 250 IU( ),Tablet 2392 Calcium gluconate Injection I.P. - 10%w/v (10ml Amp) 2393 Carbamazepine (SR) 100 mg tab 2394 Carboprost Tromethamine Injection I.P.(15-methyl PGF2a)inj 250mcg/1ml 2395 Carboxymethylcellulose Sodium Eye Drop 0.5%(10ml),Eye Drop 2396 Cefadroxil 250 mg tab 2397 Cefadroxil 500 mg tab 2398 Cefadroxil Syrup(125 mg / 5 ml 30 ml Bottle),Syrup 2399 Cefixime 200 mg Tab 2400 Cefixime 50 mg DT Tab( ),Tablet 2401 Cefixime Oral Suspension(100 mg / 5 ml (30 ml Bottle)),Suspension 2402 Cefixime Tab IP 100mg tab 2403 Cefoperazone 500mg + Sulbactam 500mg(vial),Injection 2404 Cefotaxime + Sulbactam 1000 mg + 500 mg vial 2405 Cefpodoxime 100 mg( ),Tablet 2406 Cefpodoxime 200 mg Tab 2407 Cefpodoxime(50 mg),Tablet 2408 Ceftriaxone 1000mg + Sulbactam 500mg(Vial),Injection 2409 Ceftriaxone inj 250mg Vial 2410 Ceftriaxone+Tazobactum(500mg+62.5mg Vial),Injection 2411 Cefuroxime 250 mg,Tablet 2412 Cefuroxime 500 mg,Tablet 2413 Cephalexin 100 mg/ml 10 ml with dropper 2414 Cephalexin Dispersible Tablet 125 mg 2415 Cephalexine Cap. - 250mg Capsule 2416 Cephalexine Cap. - 500mg 2417 Cephalexine(Each 5ml Contains 125mg (30ml Bottle)),Syrup 2418 Cerumenolytic(For Ear Wax)Each 10 ml contains Paradichlorobenzene 2%Benzocaine 2.7%Chlorbutol 5%Turpentine Oil 15% 10 ml Vial [110341] 2419 Cetirizine Syp 5mg/5ml 60 ml bottle Syrup 2420 Cetirizine Tab. - 10 mg 2421 Chloramphenicol(1% (5 ml Vial)),Eye Drop 2422 Chloramphenicol Ear drop 5% (5 ml Vial) 2423 Chloramphenicol Eye Applicaps-1% 100 applicaps per Bottle 2424 Chloraxozone + Paracetamol 250 mg + 500 mg tab 2425 Chlordiazepoxide 10 mg tab 2426 Chlordiazepoxide 20 mg tab 2427 Chlordiazepoxide(25 mg),Tablet 2428 Chlorhexidine 0.2% Mouth Gargle 100 ml 2429 Chlorhexidine gluconate mouthwash 0.2% W/V Solution(50ml bottle ),solution 2430 Chlorhexidine Gluconate Solution 4% I.P. (Antiseptic) 500 ml Bottle 2431 Chlorine based compound (Sodium Dicholoroiso cyanurate)NADCC Tablets 75 mg With Available Chloroine 45 mg BIS(45 mg),Tablet 2432 Chloroquine Phosphate Inj 40mg/ml (5 ml Amp) 2433 Chloroquine Phosphate Suspension Equivalent to Chloroquine(50mg/5ml (60 ml Bottle)),Suspension 2434 Chloroquine phosphate Tab. - 250mg 2435 Chlorpheniramine Maleate 10mg/ml Inj 10 ml Vial 2436 Chlorpheniramine Maleate Tab. - 4mg 2437 Chlorpromazine Hydrochloride 100 mg Sugar Coated Tab 2438 Chlorpromazine Hydrochloride(25 mg),Tablet 2439 Chlorpromazine Inj IP 25mg/ml (2ml amp) 2440 Chlorpromazine Tab 100 mg 2441 Cholecalciferol Concentrate (Powder Form) Ph.Eur. 60000IU/gm 2442 Cinnarizine(25 mg),Tablet 2443 Ciprofloxacin 0.3% + Dexamethosone Eye Drop 0.1% 2444 Ciprofloxacin 125 mg / 5 ml 60 ml Bottle 2445 Ciprofloxacin Eye Ointment 0.3% ( 3gm Tube) 2446 Ciprofloxacin Inj 2 mg/ml Inj 100ml Glass Bottle( ),Injection Solution for 2447 Ciprofloxacin Tab - 250mg 2448 Ciprofloxacin Tab - 500mg 2449 Clindamycin(1% w/w 10 gm),Gel 2450 Clindamycin 300 mg/ml Inj(1 Each),Injection 2451 Clobazam(10 mg),Tablet 2452 Clobazam 5 mg tab 2453 Clobetasol Propionate 0.05% 15 gm tube 2454 Clomiphene Citrate 100 mg Tab 2455 Clomiphene Citrate 50 mg Tab 2456 Clomipramine 25 mg Tab 2457 Clomipramine 50 mg Tab 2458 Clomipramine 75 mg Tab 2459 Clonazepam 0.25 mg Tab 2460 Clonazepam(1 mg),Tablet 2461 Clonazepam 2mg Tab 2462 Clonidine 100 mcg tab Tablet 2463 Clonidine Injection, 10ml vial (1mg) 2464 Clopidogrel + Aspirin 150mg Cap 2465 Clopidogrel + Aspirin(75 mg + 150 mg),Capsule 2466 Clopidogrel Tab. - 75 mg 2467 Clotrimazole I.P.- 2%w/w(15gm Tube),Cream 2468 Clotrimazole + Lignocaine Ear Drop 1%(5ml Vial),Drop 2469 Clotrimazole suspension I.P 50mg/5ml 2470 Clotrimazole Vaginal Pessary Tab 100mg 14 x 10 Tab 2471 Tab clotrimazole 100mg 2472 Clozapine 100 mg Tab 2473 Clozapine(50 mg),Tablet 2474 Colistin Sulphate(12.5 mg / 5 ml 30 ml Bottle),Suspension 2475 Compound Benzoic Acid Ointment 2476 Compound Tincture Benzoin IP 2477 Co Trimoxazole Oral Suspension IP(5 ml each Trimethoprim 40 mg Sulphamethoxazole 200 mg),Bottle 2478 Deferasirox Dispersible(250mg),Tablet 2479 Deferasirox Dispersible(500mg),Tablet 2480 Deferasirox Dispersible Tab. 100mg 2481 Dexamethasone(4 mg),Tablet 2482 Dexamethasone Sodium 0.5 mg, Tab Tablet 2483 Dexamethasone Sodium Phosphate Inj 8mg/2ml (2ml Vial) 2484 Dexamethasone Tab(0.5mg),Tablet 2485 Dextran 70 Injectable sol Inj 500ml (Solution) 2486 Dextromethorphan 10mg/5ml Syrup(60ml Bottle) 2487 Dextrose 10% Inj 500ml FFS/BFS Bottle( ),Injection Solution for 2488 Dextrose 25% Inj 500ml BFS Bottle( ),Injection Solution for 2489 Dextrose 5% 500ml BFS Bottle( ),Injection 2490 Dextrose, D-25 0.25 25 ml(25 ml),Injection 2491 Dextrose, D-50 0.5 25 ml(25 ml),Injection 2492 Dextrose with Saline 5% + 0.9% Inj 500ml BFS Bottle 2493 Diazepam Inj. - 5 mg/ml (2 ml amp) 2494 Diazepam Tab 5 mg 2495 Diclofenac 50mg +Paracetamol 325mg+Chlorzoxazone 500mg Tab 2496 Diclofenac 50mg +Seratopeptidase 10mg Tab(10mg),Tablet 2497 Diclofenac Gel 1% 30gm Tube 2498 Dicyclomine(10mg/ml (2 ml Amp)),Injection 2499 Dicyclomine 20mg Tab 2500 Dicyclomine Hydrochloride Oral Solution 10 mg / ml 30 ml Bottle(10 mg),solution 2501 Dicyclomine + Paracetamol Tab 20 mg + 500 mg 2502 Dicyclomine Tab. - 10mg 2503 Diethylcarbamazine Tab(100mg),Tablet 2504 Digoxin Inj. - 250mcg/ml 2505 Digoxin Tab 0.25mg(25x10),Tablet 2506 Dilitiazem Tab 60mg 2507 Dilitiazem Tablets I.P. 30 mg 2508 Diphenhydramine SG Cap 25mg Capsule 2509 Diphenhydramine Syrup(12.5mg/5ml (100 ml Bottle)),Syrup 2510 Divalproex Sodium 500 mg tab 2511 Divalproex Sodium 750 mg tab 2512 Dobutamine HCL 50 mg / ml Inj (5ml Amp) 2513 Domperidone(10mg),Tablet 2514 Domperidone Suspension 1mg/ml (30ml Bottle) 2515 Dopamine HCL 40 mg/ml Inj (5 ml Amp) 2516 Doxycycline Cap 100 mg 2517 Drotaverine(40 mg),Tablet 2518 Drotaverine inj. - 40ml/2ml (2ml Amp)(40ml/2ml 2ml Amp),Injection Solution for 2519 Electrolyte E(Multiple Electrolytes and Dextrose Inj Type V IP)I/V fluid[Each 100ml contains Inj Dextrose 5g, Sod.acetate 0.64g, Sod.chloride 0.50g,Sodium citrate 0.075g,KCL 0.075g,CCl 0.035g,Magnesium chloride 0.031g](500ml FFS Bottle) 2520 Electrolyte G(Multi-Electrolyte with 5% Dextrose IV Injection Type IV IP)Intravenous Fluid[Each 100ml Contains: Anhydrous Dextrose 5 gm,Sod.chloride 0.37g,Potassium chloride 0.13g,Ammonium chloride 0.37g](500ml FFS Bottle)(500 ml),Bottle 2521 Electrolyte M Inj 500ml BFS Bottle( ),Injection Solution for 2522 Electrolyte P Inj 500ml FFS/BFS Bottle( ),Injection Solution for 2523 Tab Econazole 150 mg 2524 Econazole nitrate 1% crem 15 gm 2525 Enalapril Maleate Tab 5mg 2526 Erythomycin Stearate(250mg),Tablet 2527 Erythromycin Stearate(500 mg),Tablet 2528 Escitalopram 10 mg tab 2529 Escitalopram(20 mg),Tablet 2530 Escitalopram(5 mg),Tablet 2531 Etiophylline (77 mg) + theophylline (23 mg) Tab 2532 Etiophylline and theophylline(220 mg/2ml),Injection 2533 Etiophylline and Theophylline Paediatric Syrup. 2534 Etiophylline theophylline SR Tab. - 300mg( ),Tablet 2535 Etiophylline +Theophylline Syrup (46.5+14)mg / 5ml (100 ml Bottle)( ),Bottle 2536 Favipiravir Tab 200mg 2537 Favipiravir Tab 400 mg 2538 Favipiravir Tab 800mg 2539 Ferrous Ascorbate 100mg (Elemental iron)+Folic Acid 1.5mg Tablet 2540 Fluconazole 0.3%(5 ml),Eye Drop 2541 Fluconazole(150 mg),Tablet 2542 Fluconazole Gel USP 0.5% 15 grm Tube 2543 Fluconazole IV(2mg/ml (100ml Bottle)),Injection 2544 Flunarizine 5 mg tab 2545 Fluoxamine(100 mg),Tablet 2546 Fluoxetine Cap 10 mg 2547 Fluoxetine Cap. BP - 20 mg 2548 Folic Acid Tab(400 mcg),Tablet 2549 Folic acid Tab IP - 5 mg 2550 Framycetin sulphate 1% Cream(30 gm tube),Cream 2551 Frusemide Inj. - 10 mg/ml (2 ml Amp) 2552 Frusemide Tab. - 40mg 2553 Furazolidone(25mg/5ml (60 ml Bottle)),Suspension 2554 Furazolidone Tab 100mg. 2555 Fusidic Acid 0.02 15 gm Cream 2556 Gamma Benzene Hexachloride solution 1% (100 ml Bottle)(100 ml Bottle),Fluid 2557 Gatifloxacin Eye Drop 0.3% 5ml 2558 Gentamicin + Betamethasone 0.3% w/v + 0.1% w/v 5 ml inj 2559 Gentamicin Inj. - 40 Mg/Ml, 2ml AMP 2560 Gentamicin Inj(80 mg/ml (2 ml Amp)),Injection 2561 Gentamycin 0.3% Eye/Ear Drops(5ml FFS Squeeze Vial),Eye Drop 2562 Glibenclamide tab 5 mg 2563 Gliclazide Tab. - 80 mg 2564 Glimepiride 1 mg Tab 2565 Glimepiride 2 mg Tab 2566 Gluteraldehyde Solution 2%(5 litre Can),solution 2567 Glycerine IP Solution (100ml Bottle) 2568 Glyceryl Trinitrate 0.5mg (sublingual) Tab 2569 Glyceryl Trinitrate 5mg/ml Inj 10ml vial (Nitroglycerine)(5mg/ml),Injection Solution 2570 Glycopyrolate 0.5% 5ml and Neostigmin 2.5 mg/5 ml Injection(Each),Injection 2571 Haloperidol(5mg),Tablet 2572 Haloperidol Inj 5mg/ml (1 ml amp) 2573 Haloperidol Tab 10mg 2574 Halothane BP 250ml solution 2575 Heparin(1000IU/ml 5ml Vial),Injection 2576 Heparin Inj(5000IU/ml 5ml Vial),Injection 2577 Homatropine 2% 1 ml vial inj 2578 Human Albumin Solution I.P. 20%w/v (100 ml Vial),Injection 2579 Hyaluronidase 1500 IU/ 2 ml(2 ml Amp/Vial),Injection 2580 Hydralazine Hydrochloride 20mg/ml Injection (1 ml Amp/Vial) 2581 Hydrochlorothiazide tab 25 mg 2582 Hydrochlorthiazide(12.5 mg),Tablet 2583 Hydrocortisone Sodium Succinate(100 mg/vial),Injection 2584 Hydrogen Peroxide Sol 6%v 400 ml Bottle 2585 Hyoscine butylbromide Tab 10mg. 2586 Hyoscine Butyl Bromind 1 ml mg(Amp),Injection 2587 Ibuprofen 200 mg,Tablet 2588 Ibuprofen 400mg+ Paracetamol 325mg Tablet( ),Tablet 2589 Ibuprofen(400mg),Tablet 2590 Ibuprofen Syrup 100mg/5ml (60 ml Bottle)(60 ml Bottle),Syrup 2591 Imipramine 75 mg tab 2592 Inj. Pantaprazole (40mg) 2593 Ipratropium Bromide inhaler 20mcg per puff 200Dose 2594 Iron and Folic acid enteric coated Tab dried Ferrous Sulphate Equ. to Ferrous Iron 100 mg and Folic Acid 0.5 mg (Blue Tablet) 2595 Iron and folic acid enteric coated Tab Dried Ferrous Sulphate IP eq. to 45 mg Elemental iron and 400 mcg folic Acid IP (Pink Color) - WIFS Junior 2596 Iron and Folic Acid Enteric Coated Tab. Dried Ferrous Sulphate IP equ. to Ferrous Iron 100 mg and Folic Acid IP 0.5 mg Granules (Red Tablet)( ),Tablet 2597 Iron Folic Acid Syrup, Each mL containing 20mg elemental Iron&100mcgFolic acid with suitable anti-oxidant, antimicrobial agent and food grade flavouring agent.The bottle should have 6 fragmented markings at equal intervals(If an artificial sweetening is used it should be highlighted on the label. Warning should be put on label Medication should be kept out of reach of children. (As per attached specification) (50mL bottle with auto dispenser)),Syrup 2598 Iron Sucrose inj USP 100 mg/5 ml (5 ml Amp) 2599 Isosorbide-5-Mononitrate(Tab.20 mg),Tablet 2600 Isosorbide Dinitrate tab IP - 5 mg 2601 Isosorbide Mononitrate Tab. - 20mg 2602 Isoxsuprine(10mg),Tablet 2603 Isoxsuprine Hydrochloride Inj. - 5mg/ml (2 ml Amp)(2 ml),Injection 2604 Ivermectin Tab USP 6mg 2605 Ivermectin Tab USP 12mg 2606 Isavuconazonium sulphate injection 372mg 2607 Isavuconazole100 cap 2608 IV Human Immunoglobin 5mg/100ml(1 Each),Injection 2609 Ketamine hydrochloride Inj. 10mg/ml (10ml vial) 2610 Ketoconazole ointment 2% 15gm Tube(15 gm),Ointment 2611 Labetalol 100 mg Tab 2612 Lactobacillus tab (Lactobacillus 60 million spores) . 2613 Levetiracetam 250 mg tab 2614 Levetiracetam 500 mg tab 2615 Levocetirizine + Monteleukast((2.5 mg + 4 mg) / 5 ml, 30 ml Bottle),Suspension 2616 Levocetirizine + Monteleukast 5 mg + 10 mg tab 2617 Levocetirizine Tab 5mg 2618 Levofloxacin(250mg),Tablet 2619 Levofloxacin 500mg Inj 100ml FFS/BFS Bottle( ),Injection Solution 2620 Levofloxacin 500mg Tablet 2621 Lignocaine 2 %(21.3 mg / ml (30 ml Vial)),Injection 2622 Lignocaine 2% + adrenaline 5 mcg/ml(30 ml ),Vial inj 2623 Lignocaine Hydrochloride Eye Drops - 4% (5 ml Vial) 2624 Lignocaine Hydrochloride For Spinal Anaesthesia(Heavy) 0.05 2 ml Amp 2625 Lignocaine Hydrochloride Gel 2% w/v (30 gm Tube) 2626 Liquid Paraffin IP - 500 ml solution 2627 Lithium Carbonate 400 mg tab 2628 LMWH low molecular weight Heparin inj 4000IU/ml.( ),Injection Solution 2629 LMWH low molecular weight Heparin inj. - 6000nIU/ml( ),Injectn Solution 2630 Lorazepam 1 mg tab 2631 Lorazepam 2 mg / ml 2 ml Vial 2632 Lorazepam 2 mg tab 2633 Losartan Potassium, Hydrochlorthiazide(50 mg + 12.5 mg),Tablet 2634 Losartan tab - 50 mg 2635 Lysol IP (Cresol with Soap Solution) ( 5Ltr jar) 2636 Magnesium Hydroxide + Aluminium Hydroxide Simethecon 250 mg + 250 mg + 50 mg/ 5 ml 170 ml Bottle(Syrup),Syrup 2637 Magnesium suplhate injection I.P.50 % w/v (1 ml Amp)(1 ml Amp),Ampoule 2638 Mannitol Inj. 10% 350ml Bottle( ),Injection Solution for 2639 Mannitol Injection I.P. 20% 100ml Bottle( ),Injection Solution for 2640 Mephentermine Inj 30mg/ml(10 ml Vial),Injection 2641 Meropenem Inj 125mg/Vial(Each),Injection 2642 Mesalamine (5-Aminosalicylic Acid 400 mg) Tab 2643 Metformine 500mg + Glibenclamide 5mg(Tab),Tablet 2644 Metformin + Glimepiride 500 mg + 2 mg tab 2645 Methylcobalamin + Alpha Lipoic Acid(1500 mcg + 100 mg ),Capsule 2646 Methylcobalamin Inj(500 mcg/ml (10 ml Vial)),Injection 2647 Methylcobalamin/mecobalamin(500 mcg),Tablet 2648 Methyldopa Tab. - 250mg 2649 Methyl Ergometrine inj Meleate - 0.2 mg /ml (1ml Amp) 2650 Methyl Ergometrine Maleate Tab. - 0.125mg 2651 Methyl Phenidate 10 mg tab 2652 Methyl Phenidate 20 mg tab 2653 Methyl Prednisolone sodium succinate inj. USP - 40mg Vial 2654 Methyl Prednisolone sodium succinate inj. USP - 500mg 2655 Methyl Prednisolone sodium succinate Tablet - 8 mg 2656 Methyl Prednisolone Tab - 16 mg 2657 Methyl Prednisolone Tab - 4mg 2658 Metoclopramide Inj. - 5mg/ml (2 ml Amp) 2659 Metoclopramide Syrup(5mg/5ml (30 ml Bottle)),Syrup 2660 Metoclopramide Tab. - 10mg 2661 Metoprolol(50mg),Tablet 2662 Metoprolol inj 1 mg/ml(5ml Vial),Injection Solution 2663 Metronidazole 100mg/5ml Syrup (30ml) 2664 Metronidazole Benzoate oral Suspension(100mg of base/5 ml (60ml Bottle)),Suspension 2665 Metronidazole Inj. 500mg/100ml (100 ml FFS BFS Bottle) 2666 Metronidazole Tab 200 mg 2667 Metronidazole Tab(400mg),Tablet 2668 Miconazole Cream I.P. 2% w/w(15 gm Tube),Consumable 2669 Midazolam Inj. - 1mg/ml 10ml Vial 2670 Mifepristone 200mg Tab 2671 Milk of Magnesia 11.25 ml, Liquid Paraffin 3.75ml Phenolphthalein 50mg/15ml (cremaffin Pink Formula) 170ml Syrup 2672 Mirtazapine 15 mg tab 2673 Mirtazapine 30 mg tab 2674 Mirtazapine 7.5 mg tab 2675 Misoprostol(200mcg),Tablet 2676 Morphine sulphate inj. IP 15mg/ml 2677 Moxifloxacin 0.5% w/v(5 ml),Eye Drop 2678 Moxifloxacine + Dexamethasone 0.5% + 0.1% w/v drop 2679 Moxifloxacin + Prednisolone 5 mg + 3 mg /5 ml drop 2680 Multivitamin drops (Approx 22 drops)( ),Drop 2681 Multivitamine 100ml Syrup(100 ml),Syrup 2682 Multivitamin Sugar coated tablet 2683 Mupirocin(2% w/w (5 gm Tube)),Ointment 2684 N- Acetyl Cysteine Inj 200mg/ml in 10ml Amp 2685 Naloxone Inj. - 0.4 mg/ml(1ml Ampoule),Injection Solution 2686 Neostigmine(0.5mg/ml (1ml amp)),Injection 2687 Nifedipine Capsule - 5mg Cap 2688 Nifedipine (Sublingual) 10 mg tab 2689 Nifedipine Tablets - 10mg Tab 2690 Nitrazepam 5 mg tab 2691 Nitrofruantoin(100mg),Tablet Capsule 2692 Nitroglycerine inj. USP - 25 mg/5ml (5ml Amp) 2693 Non-ionic contrast media(350 mg , 100ml),Consumable 2694 Noraderanaline Bitartrate Inj 2 Mg Base/2ml (2ml Amp)(2 Mg Base/2ml),Injection 2695 Norfloxacine 400mg and Tinidazole 600mg Tab 2696 Norfloxacin +Metronidazole 30ml Syrup 2697 Norfloxacin Tab. - 400mg 2698 Ofloxacin 0.3% w/v of Ofloxacin Ph.Eur.(5 ml Vial),Eye Drop 2699 Ofloxacin + Dexamethosone(0.3%+ 0.1% (10 ml)),Eye Drop 2700 Ofloxacin Infusion (2mg/1ml (100ml FFS Bottle)),Bottle 2701 Ofloxacin Tab - 400 mg 2702 Olanzapine 10mg Tab 2703 Olanzapine( 5 mg),Tablet 2704 Olopotadine Antiallergic(0.1% w/v (5 ml Vial)),Eye Drop 2705 Omeprazole 40mg(Vial),Injection 2706 Omeprazole Cap. - 20mg( ),Capsule 2707 Ondansetron(2mg/5ml 30ml Bottle),Syrup 2708 Ondansetron 8mg Tab 2709 Ondansetron Inj. - 2 mg/ ml (2 ml Amp) 2710 Ondansetron Inj - 2 mg/ ml (4 ml Amp)(4 ml Amp),Injection Solution for 2711 Ondansetron Tab 4 mg 2712 ORS Packet WHO Formula Sodium Chloride 2.5g, Potessium Chloride 1.5g, Sodium Citrete 2.09g Dextrose 13.6g, 20.5gm Pouch( ),Powder 2713 ORS WHO Powder Glucose Anhydrous 13.5g/l, Sodium chloride 2.6g/l, Potassium chloride 1.5g/l, Trisodium Citrate 2.9g/l 2714 Oseltamivir 12 mg/ml Syrup 75ml Bottle 2715 Oseltamivir cap 30 mg 2716 Oseltamivir cap 45 mg 2717 Oseltamivir cap 75 mg 2718 Oxytocin Inj(5 IU/ml (1ml Amp)),Injection 2719 Pantoprazole 40 mg, Domperidone 10 mg(Tab),Tablet 2720 Pantoprazole tab 40 mg 2721 Paracetamol 1000mg I V Infusion 100 ml FFS bottle 2722 Paracetamol Inj 150mg/ml 2ml Amp(2ml Amp),Injection 2723 Paracetamol Oral Drops(100 mg/ml (15 ml Bottle with Dropper)),Drop 2724 Paracetamol Syrup/Suspension 125 mg/5ml (60ml Bottle) 2725 Paracetamol Tab. - 500mg 2726 Paracetamol Tab 650 mg(650 mg),Tablet 2727 Pentazocin lactate Inj. - 30mg/ml (1 ml Amp) 2728 Permethrin Lotion 5% w/v 60 ml Bottle 2729 Pheniramine maleate(22.75 mg/ml (2 ml Amp)),Injection 2730 Phenobarbitone Tab. - 30 mg 2731 Phenobarbitone Tab. - 60 mg( ),Tablet 2732 Phenytoin sodium(50 mg/ml (2ml amp)),Injection 2733 Phenytoin Sodium Oral Suspension - 25 mg/ml(100 ml Bottle),Suspension 2734 Phenytoin Sodium Tab 100mg 2735 Pilocarpine Eye drops 4% 2736 Piperacillin + Tazobactam 1000 mg + 125 mg vial 10 ml Vial( ),Injection 2737 Posaconazole Oral suspension 200mg/5ml 105 ml 2738 Posaconazole 300mg/16.7 ml Injection 2739 Tab Posaconazole Delayed -ReleaseTab 100mg 2740 Potassium chloride Inj. 150mg/ml 2741 Potassium Chloride Syrup 200ml(Each),Syrup 2742 Povidone Iodine ointment 5% 15gm Tube 2743 Povidone iodine Solution 5%(100 ml Bottle),solution 2744 Povidone iodine surgical scrub Solution. - 7.5%(500 ml bottle),solution 2745 Pralidoxime (PAM) Inj. - 25 mg/ml(20 ml Amp/Vial),Injection 2746 Primaquin 15mg Tab 2747 Primaquin(2.5mg),Tablet 2748 Primaquin(7.5mg),Tablet 2749 Promethazine(50 mg),Tablet 2750 Promethazine Inj 25 mg/ml (2 ml Amp)(2 ml Amp),Injection 2751 Propofol Sodium Inj 1%w/v 10mg/ml 20ml Vial(10mg/ml),Vial 2752 Propranolol 40 mg Tab 2753 Propranolol Tab(10 Mg),Tablet 2754 Pyridoxine Tab 10mg 2755 Quetiapine(100 mg),Tablet 2756 Quetiapine(50 mg),Tablet 2757 Quinine Sulphate 150mg/5ml Syrup 60 ml 2758 Quinine Sulphate(300mg),Tablet 2759 Quinine Sulphate Inj. - 300mg/ml . 2760 Rabeprazole(20 mg),Tablet 2761 Rabies Immunoglobulin Inj-300 IU (2ml vial PFS)( ),Vial 2762 Rabies vaccine inj (Vero Cell Culture) Inj. Intra Dermal( ),Vial 2763 Ramipril Tab 2.5 mg 2764 Ramipril Tab 5 mg 2765 Ranitidine(150mg),Tablet 2766 Ranitidine(50mg/2ml , 2ml Amp),Injection 2767 Recombinant Anti - Hemophilic Factor VIII(500 IU inj / Vial),Injection 2768 Rectified Spirit (90%) Solution 2769 Rifampicin Cap(300 mg),Capsule 2770 Rifampicin Cap(450 mg),Capsule 2771 Rifampicin Cap(600 mg),Capsule 2772 Ringer Lactate IP I/V 0.24 % w/v of Lactic Acid ( eq. to 0.32% w/v of Sodium Lactate), 0.6 % w/v Sodium Chloride, 0.04 % w/v Potassium Chloride and 0.027 % w/v Calcium Chloride(500ml FFS Bottle),Injection Solution 2773 Risperidone 1mg Tab 2774 Risperidone 2 mg tab 2775 Risperidone 4 mg tab 2776 Risperidone + Trihexiphenidyle(2 mg + 2 mg),Tablet 2777 Risperidone + Trihexiphenidyle(3 mg + 2 mg),Tablet 2778 Risperidone + Trihexiphenidyle 4 mg + 2 mg tab 2779 Salbutamol 2.5 mg /3 ml 3 ml inj 2780 Salbutamol(2mg / 5ml (100ml bottle)),Syrup 2781 Salbutamol Inhalation IP 100mcg/dose(200 Metered dose container),Inhaler 2782 Salbutamol Nebuliser Solution BP-Sabutamol Sulphate eq. to Salbutamol 1mg per ml 2.5 ml Amp 2783 Salbutamol Sulphate Syrup 2mg/5ml 60ml( ),Bottle 2784 Salbutamol Sulphate Tab IP 4mg(4mg),Tablet 2785 Serratiopeptidase 10 mg tab 2786 Sertraline(100 mg),Tablet 2787 Sertraline 50 mg tab 2788 Silver Sulphadiazine cream USP 1% w/w 25gm 2789 Sodium bicarbonate Inj. - 7.5% w/v(10ml),Ampoule 2790 Sodium Chloride Inj IV 500ml BFS Bottle( ),Injection Solution 2791 Sodium Chloride N/2 Injection IP (0.45%)(500ml FFS Bottle),Injection 2792 Sodium Chloride N/2 Injection IP 500ml BFS Bottle( ),Bottle 2793 Sodium Chloride Normal Saline(100ml FFS Bottle),solution 2794 Sodium Hyaluronate (Intraocular) 10 mg /ml 2ml inj 2795 Sodium Hypochlorite 5% Solution 5ltr 2796 Sodium Hypochlorite Solution 100 ml bottle 2797 Sodium Valporate 300 mg tab 2798 Sodium Valproate 100 mg/ml 5 ml inj 2799 Sodium Valproate 200 mg / 5 ml 100 ml Bottle 2800 Spironolactone Tab 100mg(10x10),Tablet 2801 Streptomycin inj 0.75g 2802 Succinyl Choline Inj. - 50mg/ml (10 ml Vial)(10 ml Vial),Injection Solution 2803 Sulfacetamide Eye drops - 20% 2804 Sulfamethoxazole 200mg and Trimethoprim 40mg per 5ml Suspension 50ml Bottle 2805 Sulfamethoxazole and Trimethoprim(100 mg and 20mg),Tablet 2806 Sulfamethoxazole and Trimethoprim(400mg + 80mg),Tablet 2807 Sulfamethoxazole and Trimethoprim(800mg + 160mg),Tablet 2808 Sulfamethoxazole +Trimethoprim Tab(200 mg + 40 mg),Tablet 2809 Surgical Spirit BP - 500 ml( ),Bottle 2810 Syp. Cefodroxil 125mg/30ml Syrup 2811 Tab Amitryptyline(25 mg),Tablet 2812 Tab citalopram(20 mg),Tablet 2813 Tablet Domeperidone (10mg),Tablet 2814 Terbinafine hydrochloride 250mg 2815 Terbinafine hydrochloride1%cream 10grm 2816 Teicoplanin 200 mg /vial Vial 2817 Telmisartan, Hydrochlorthiazide(40 mg + 12.5 mg),Tablet 2818 Telmisatran 40 mg Tab 2819 Temozolomide 20mg Cap 2820 Tetanus immunoglobulin(USP/IP 250 IU/vial),Injection 2821 Tetanus immunoglobulin USP/IP(500 IU/vial),Vial 2822 Tetanus Toxide inj 5ml( ),Injection Solution 2823 Thyroxine Sodium 75 mcg 100 per bottle 2824 Thyroxine Sodium Tab 100 mcg (100 tab Bottle)(100 tab),Tablet 2825 Tianeptin 12.5 mg tab 2826 Timolol Maleate Eye drop I.P. 0.5 %w/v (5 ml Vial)(5 ml),solution 2827 Tinidazole 150 mg / 5 ml 60 ml Bottle 2828 Tinidazole Tab 500mg 2829 Tobramycin(0.3% 5ml),Eye Drop 2830 Tobramycin + Dexamethasone(0.3%w/v + 0.1%w/v (5ml vial)),Eye Drop 2831 Tramadol(100mg/ml (2 ml Amp)),Injection 2832 Tramadol Cap 50mg 2833 Tramadol Inj. - 50mg/ml. (2ml Amp) 2834 Tramadol Tab. - 100mg 2835 Tranexamic Acid 500 mg Tab Tablet 2836 Tranexamic acid inj. - 125mg/ml Amp 2837 Trifluoperazine + Trihexyphenidyle 5 mg + 2 mg tab 2838 Trihexyphenidyl 2mg tab 2839 Urokinase 5 Lac IU/Vial Inj 2840 Valethamate Bromide inj. - 8mg/ml 2841 Vancomycin Hydrochloride(500mg),Injection 2842 Verapamil Tab 40 Mg IP( ),Tablet 2843 Vildagliptin Tab(50 mg),Tablet 2844 Vitamin A cap USP Soft Gelatin Capsule(1 Lakh IU),Capsule 2845 Vitamin A cap USP Soft Gelatin Capsule( 2 Lakh IU),Capsule 2846 Vitamin A Syrup(100000 IU/ML with market spoon for 1ml and 2 ml (100 ml bottle)),Syrup 2847 Vitamin B Complex Injection NFI Formula 30ml/vial(30ml/vial),Injection 2848 Vitamin. B Complex Tab. NFI (PROPHYLACTIC) 2849 Vitamin D3 (Cholecalciferol)(400 IU /ml (100 ml Bottle)),Syrup 2850 Vitamin E 50 IU /ml 10 ml bottle with dropper 2851 Vitamin-E Capsule USP (400 MG) 2852 Vitamin K1 Inj 1mg/0.5ml (0.5 ml Amp) 2853 Water For Injection 5 ml Amp 2854 Water for injection Inj 10 ml Amp 2855 Water For Injection IP(2 ml Amp) 2856 Xylometazoline Nasal(0.1%w/v (10 ml Vial)),Drop 2857 zinc tab 20mg dispersible 2858 zinc tab 10mg dispersible 2859 Zinc Sulphate Syrup - 20mg/5ml(50 ml Bottle),Syrup 2860 Anti D Immunoglobin 300 mcg inj 2861 Cefotaxime sodium Inj 250 mg Vial 2862 Cefotaxime Sodium Inj(500 mg/Vial),Injection 2863 Cefotaxime sodium Inj. - 1 gm Vial 2864 Ciprofloxacin 0.3%(5ml Vial),Eye Drop 2865 Ciprofloxacin 500mg + Tinidazole 600mg Tab 2866 Cough Syrup (Each 5ml Contains Ammonium Chloride 138mg, Diphenhydramine HCL 14.08mg, Sodium Citrate 57.03mg, Menthol 2.5mg) 2867 Dextromethorphan 10mg/5ml Syrup(100 ml Bottle),Syrup 2868 Diclofenac sodium 25 mg/ml(3ml Amp),Injection 2869 Diclofenac Sodium 50mg + Paracetamol 325mg tab 2870 Diclofenac Sodium Tab 50 mg 2871 Enoxaparin(40mg equivalent to- 4000 IU Vial/PFS),Injection 2872 Enoxaparin(60mg equivalant to- 6000 IU vial/PFS),Injection 2873 Formaldehyde (Formalin) 37% Acq Dilute 34 ml Formaledehyde Solution With Water To Produce 100ml (450 ml Bottle) 2874 Human Anti D. Immunoglobulin (Monoclonal)(300mcg/Vial),Injection 2875 Inj. Ceftriaxone (1G) 2876 Meropenam 500mg Inj 2877 Meropenem 250 mg / Vial(250mg/vial),Injection 2878 Metformin(500 mg),Tablet 2879 Streptokinase inj 15 lac iu 2880 Ampicillin(500 mg/vial),Injection 2881 Ampicillin Trihydrate(500mg),Capsule 2882 Human Anti D. Immunoglobulin(Polyclonal) BP/ EP/ USP/ IP(300mcg/Vial (Vial/PFS)),Injection 2883 Ceftrixone 250 gram inj 2884 Albumin 100 ml Bottle(Each) 2885 Albumin 600 ml(Model BA 400 System (Mfg ByBio System)) 2886 Albumin(MFG- Pathogyme Diagnostics)(200 ml (4 X 50 ml)) 2887 Chlorquine Phosphate 64.5 mg/ ml, 5 ml Inj 2888 Dextrose 25 %, 25 ml Inj 2889 Diclofenac Sodium Injection,3ml 2890 Halothane 200ml 2891 Hydrocortisone sodium succinate Inj. 200 mg/vial 2892 AD Syringe 0.1 ml 2893 AD Syringe 0.5 ml 2894 Barium chloride powder(powder),Consumable 200gm 2895 Benedicts Solution (Qualitative) 100ml 2896 Black Disinfectant Fluid (Phenyl)Strength : Specification as per Schedule O Grade - I per lit 2897 Blood culture media aerobic for adult(BacT/Alert FA Plus),Each 2898 Bloting paper(paper),Consumable 100 per pack 2899 EDTA powder(250 gm),Consumable 2900 EDTA Vial with Safty Cap (2ml.) Capsule 2901 Gentian Violet Crys Sol 1% 2902 x-ray developer powder (13.5 liter),Consumable 2903 Absorbable Gelatine Sponge IP 80MM X 50MM X 10MM 2904 Absorbent cotton Roll 100 gm Each Consumable 2905 Absorbent Cotton Wool IP 500 grms(Each),Consumable 2906 Acetic Acid - Solution(3% 100 ml Bottle),Consumable 2907 Acetone Detection Kit(100 gm),Powder 2908 Adhesive Plasters USP 7.5 cm x 5 mts/roll 2909 Adhesive Roll 1 inch x 5 m / Roll 2910 Alkaline Phosphatase (ALP) DEA 300 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2911 Alkaline Phosphatase kit (Kinetic) 10x2.2ml 44 Test/Kit Consumable 2912 Alkaline Phosphate(100 ml (5 x 20)),Consumable 2913 Ambu Bag Adult (Silicon)(Each),Consumable 2914 Ambu Bag Child (Silicon)(Each),Consumable 2915 Auto Pippets Fixed Volume 1000 Micro Liters Each 2916 Auto Pippets Fixed Volume 10 Micro Liters Each 2917 Auto Pippets Fixed Volume 20 Micro Liters Each 2918 Baby Diapers Small (10 Diaper Per Pkt) 2919 Baby Oxygen Mask Set of all sizes 2920 Balanced Salt Solution 500 ml Bottle(Each),Consumable 2921 Basic Carbol Fuchsin for AFB Staining 25 gm/pkt 2922 B.B. SILK 6 reels X 25 mts length 25 mts.Black Braided Silk without Needle in Reels Non Absorbable Surgical sutures USP-, 2-0(6 reels is per box rate should be quoted for 6 reels ),Surgical Material 2923 B.B. SILK 6 reels X 25 mts length 25 mts. Black Braided Silk without Needle in Reels Non Absorbable Surgical sutures USP 3-0(6 reels is per box rate should be quoted for 6 reels),Consumable 2924 B.B. SILK 6 reels X 25 mts Size:1/0(6 reels is per box rate should be quoted for 6 reels),Surgical Material 2925 B.B. SILK 6 reels X 25 mts Size:3/0 length 25 mts 2926 B.B Silk Size-3/0 (12 Foils/pkt)(3/8Cir RCut Needle 26mm Length 76 cm),Needle 2927 B.B Silk with 1/2 Cir RB Needle 20 mm Length 75 cm Non Absorbable Surgical Suture USP Size 3-0,(12Foils/Pkt),Needle 2928 B.B Silk with 1/2 Cir RB Needle Size:2/0 30 mm length 75 cm Surgical Material 2929 B.B Silk with 1/2 Cir RB Needle Size:3/0 20 mm length 75 cm 2930 B.B Silk with 1/2 Cir RB Needle Size:4/0 20 mm length 75 cm, 12 foils per packet 2931 Benedicts Qualitative reagent(1x5 lit),Consumable 2932 Serum Bilirubin Total/Direct (Autospan/Erba) kit each 2933 Bilirubin (Direct) AS 300 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2934 Bilirubin Kit (Colorimeter Semi Auto) 4X60 ml 480 Test/Kit Consumable 2935 Bilirubin standard 1x5 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2936 Bilirubin (Total) 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2937 Biochemistry calibrator 5x5 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2938 Biochemistry Control Serum L1(5x5 ml),Consumable 2939 Biochemistry Control Serum L1 5x5 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2940 Biochemistry Control Serum L2(5x5 ml),Consumable 2941 Biochemistry Control Serum L2 5x5 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2942 Black-Braided Silk with 1/2 Cir CD Cutting Needle 16 mm Length 75 cm 3/0 (14 Foils/Pkt) 2943 Black-braided Silk with 1/2 Cir Length 75 cm size 3/0(12 foils/Pkt),Consumable 2944 Black-braided Silk with 1/2 Cir RB Needle 20 mm Length 75 cm 1/0 13 Foils/Pkt 2945 Black-braided Silk with 1/2 Cir RB Needle 30 mm Length 75 cm 2/0 12 Foils/Pkt 2946 Blood culture media aerobic for pediatric(BacT/Alert PF Plus),Each 2947 Blood culture media anaerobic for adult(BacT/Alert FA Plus),Each 2948 Blood culture media anaerobic for pediatric(BacT/Alert PF Plus),Each 2949 Blood culture media mycobacterium spp(BacT/Alert MP (Plastic)),Each 2950 Blood Gluose (GOD/POD)(1000 ml),Consumable 2951 Blood Urea (BUN) UV(1000 ml),Consumable 2952 Cannula Fixer Set(piece),Each 2953 Capillary Tube 100 Pieces Consumable 2954 Carbol Fuchsin for ZN Stain (500ml Bottle) 2955 Cassette 10 x 12 2956 Cassette 12 x 15 2957 Catgut Chromic Size:2/0 length 150 cm 2958 Catgut Chromic with 1/2 cir cutting needle 12mm, length 70cm no.3-0, 12 foils per pakt 2959 Catgut Chromic with 1/2 Cir RB needle 30 mm length 70cm no. 1 -0, 12 foils per packet 2960 Catgut Chromic with 1/2 Cir RB needle 40 mm length 75cm no. 1 Consumable 2961 Catgut Chromic with 1/2 Cir RB needle 40 mm length 75cm no. 2 Consumable(Each),Consumable 2962 Cell Clean For 5-Part Hematology Analyser (Model : Sysmex XS-800i (Japan))(Pack Size 50 ml),Consumable 2963 Cell Pack For 5-Part Hematology Analyser (Model : Sysmex XS-800i (Japan))(Pack Size 20000 ml),Consumable 2964 Cell Pack, Reagent Pack for Cell Counter((Erma and Mindrug) Complete Set),Consumable 2965 Mindray Diluent M52 For CBC Model No. Mindray BC 5150 20 Lit. 2966 Mindray LH Lyse M52 100 ml For CBC Model No. BC 5150 2967 Mindray Diff Lyse M52 500 ml For CBC Model No. BC 5150 2968 Mindray Cleanser M52 1 Lit For CBC Model No. BC 5150 2969 MindrayAuto Hematology Analyzer(Paper Roll),Consumable Model No. BC5150 2970 Central Venous Catheter Kit - Single Lumen 2971 Central Venous Catheter Kit Single Lumen 18 G 2972 Cervical Collar/Each-Soft, Medium sized 2973 Chikungunya Card test 1 gG + 1 gM (25 Test/Kit) 2974 Chlorhexidine 0.5 % Propanol 70 %, 100 ml Hand Rub 2975 Chlorhexidine Acetate 0.5 %, Medicated Gauze 2976 Cholesterol 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2977 Cholesterol HDL Direct 160 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2978 Cholesterol Kit End Point Enzymatic Kit 50 Test/Kit 2979 Cholesterol Kit End Point Enzymatic Kit 5x20ml 200 Test/Kit 2980 Chromic (12 Foils/Pkt)(3/8 RB Needle 30 mm, Length 76 cm, Size - 2/0),Needle 2981 Con. (HNO3) Nitric Acid (2.5 liter),Consumable 2982 Cotton Crape Bandage 10cm x 4m (Box of 10 bandages) 2983 Cotton Crape Bandage 15cm x 4m (Box of 10 bandages) 2984 Cover Slip(50 per pkt) 18 X 18 mm, thickness 0.17 mm 2985 CPK MB Kit (Reckon) 25 test/kit 2986 Creatine calorimeter for semi Auto Kinetica 4x60ml 480 Test Kit 2987 Creatinine 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 2988 Creatinine Calorimeter for Semi Auto Kinetic 4x60ml 480Test/Kit 2989 Creatinin Kit consumable each 2990 Cresent Knife(1 Each),Consumable 2991 CRP Kit 1x100 Biolab QUALITATIVE) 2992 CRP Latex Slide per test 2993 CRP Test Kit (Latex/Card) (25 Test/Kit) 2994 Delivery Set 2995 Dengu Card- antigen(25 Card/Pkt),Consumable 2996 Dengue Duo Serum Plasma 10 test/kit(SD) 2997 Dental X-Ray Film Size 31 x 41 mm (150 Films / Pkt) 2998 Developer Single Bath Liquid Concentrated Of Consistent Quality. It Sould Have Favoutable Contrast/Fog Ratio And Good Shelf Life - (5 ltr Can To make 22.5 Liters working solution) 2999 Diagnostic Strips for Urine Sugar/Albmin Packing: Amber colored, 100 Strips/Pkt(MFG By - Anmol Laboratories Pvt Ltd),Consumable 3000 Digital X Ray Film -10x12 (150 Films/Pkt) 3001 Digital X Ray Film -11x14 (150 Films/Pkt) 3002 Digital X Ray Film -8x10 (150 Films/Pkt) 3003 Digital X-Ray film size 14 x 17((100 Sheet Per Packet)),Film 3004 Disposable Paper Gloves Size 7,1/2 Inches Consumable 3005 Disposable Paper Gloves Size 7 Inches Consumable 3006 Disposable Plastic Appron (Full Size) 3007 Disposable Pricking Lancet 100 Units Consumable 3008 Disposable Scalp Vein Set Size 20 no 3009 Disposable Scalp Vein Set Size 22 no 3010 Disposable Sharp Collection Containers 1.5 L 3011 Disposable Sharp Collection Containers 5 Ltr 3012 Disposable Spinal (L.P.) Needle(25G),Surgical Material 3013 Disposable Spinal Needle, Mfg by Alpha Medicare & Devices Pvt. Ltd.(18 no),Needle 3014 Disposable Spinal Needle, Mfg by Alpha Medicare & Devices Pvt. Ltd.(22 no),Needle 3015 Disposable Sterile Gloves BIS Specification Gloves, Surgical Rubber, Hypoallergic Latex, 100%, 7 Inc 3016 Disposable Sterile Gloves BIS Specification Gloves, Surgical Rubber, Made of Hypoallergic Latex, 100%, 6 1/2 Inches 3017 Disposable Sterile Gloves BIS Specification Gloves, Surgical Rubber, Made of Hypoallergic Latex, 100%, 6 Inches 3018 Disposable Sterile Gloves BIS Specification Gloves, Surgical Rubber, Made of Hypoallergic Latex, 100%, 7 1/2 Inches 3019 Disposable Sterile Hypodermic Syringe 10ml(Each),Consumable 3020 Disposable Suction Catheter Assorted Covering All Sizes 10,12,14,16,18 Consumable 3021 Disposable Suction Catheter Size 12 3022 Disposable Suction Catheter Size 14 3023 Disposable Surgeon Cap(Box of 100 caps) 3024 Disposable Syringe 50 ml 3025 Disposable Syringes IS 10258:2002 With Needle IS 10654:2002 20ml 3026 Disposable Syringe with Needle 20ml Each 3027 Disposable Syringe With Needle(2ml Each),Syrings 3028 Disposable Syringe With Needle(3ml Each),Syrings 3029 Disposable Syringe with Needle 5ml Each 3030 Disposable syringe with needle CGS 1cc with mark 0-1ml Consumable 3031 Disposable Three Layer Surgical Mask(Box of 100 mask) 3032 ECG Jelly 250 gms 3033 ECG Roll 112 MM 3034 ECG Roll 108 MM 3035 Serum Cholesterol kit (Autospan/Erba) 3036 ESR Tube (Western Green) 3037 ESR Tube Stand(Western Green) 3038 EDTA K3 Vial Each 3039 EDTA Solutions K3 (500 ml) 3040 Fauchets reagents (125 ml),Consumable 3041 Feeding Tube (Catheter) 10G 3042 Field Stain A 500ml 3043 Field stain A(MFG- Precious Life Care Pvt Ltd)(500 ml bottle),Consumable 3044 Field Stain B 500ml 3045 Field stain B(MFG- Precious Life Care Pvt Ltd)(500 ml bottle),Consumable 3046 Filter paper sheet((Whatmann no 01) sheets),Consumable 3047 Foldable IOL Sterile lens + 18.5 D (USFDA approved, as per specification)(Each),Consumable 3048 Foldable IOL Sterile Lens PC+14D(Lens-2),PC+16D(Lens-3),PC+18D(Lens-5),PC+19D(Lens-5),PC+19.5D(Lens-5), PC+20D(Lens-15),PC+20.5(Lens-15),PC+21D(Lens-13),PC+21.5D(Lens-11),PC+22D(Lens-11),PC+22.5D(Lens-5),PC+23D(Lens-5),PC+24D(Lens-3),PC+26D(Lens-2)(100 Lens per Box),Lens 3049 Foleys Catheter Size 12-2 Way(10 Each),Consumable 3050 Formaldehyde (Formolene ) Tab 3051 Fouchets Reagent (100 ml Bottle) 3052 G6PD Deficiency test kit - 10 Test 3053 Gauze Sponge/Each(Size 3 x 3),Consumable 3054 Gentian Violet (Gram Stain) 100ml Bottle 3055 Glass Slide 75mm x 25 mm(50 slide/pkt)- Thickness-1.35mm,detail specifications-I-with smooth edges, without any scrathtches. II-Glazed glass.III-no visual or chromatic abbretions 3056 Glass Test Tube 12 x 100 (Medium Size) Heavy Quality 100/Pkt 3057 Glass Test Tube 12 x 75(Small Size) Heavy Quality 100/Pkt 3058 Gloves Latex Autoclavable 8 no (pair) Made of Natural Latex Micro Rough Finish For Better Grip 3059 Glucometer Strips 1*50 ,Consumable 3060 Glucose Kit (GOD/POD) 500ml 3061 blood Glucose Kit (Autospan/Erba) 3062 Glucose Pouch(100 gram Pack(MFG - Bhandari Products)),Consumable 3063 Glutaraldehyde Solution 2% in 5 litre can (2 strips/Vials per each can)(5 litre can),Consumable 3064 Gram Iodine (Gram Stain) 100ml 3065 Haemoglobinometer Tube (Square Pattern) 3066 HbsAg 25 Test per Kit (SD Biolab) 3067 HCV kit Card Test(25 Test / Kit),Digonstic 3068 HDL kit PPT(2x50ml 200 Test/Kit),Consumable 3069 HDL/LDL standard(1x1 ml),Consumable 3070 Heamoglobin Colour Scale Book with Special Strip Complete(1 X 200),Consumable 3071 Hematology cell counter Reagents as per Requirement of cell counter Cleaning solution 100 ml 3072 Hematology Cell Counter Reagents Dilutent (20 Ltr) 3073 Hematology cell counter reagents lysis solution 500ml(Each),solution 3074 Hemodialysis Powder For Bicarb Made(Part A powder to make 10 Ltr + Part B 500gm 2/Pkt),Consumable 3075 Hemoglobin Color Scale (Starter KIT) Components (1) Color Scale 01/kit (2) Test Strip 1000/kit (3) Printed Literature for method of use/kit (4)Lancet -1000/kit 3076 HIV ELISA KIT (HIV MICRO ELISA Ag+AB 4tH GENERATION )(96 TEST KIT),Consumable 3077 HIV Kit Card (25 Test / Kit) 3078 Hub Cutter- Non Electric lockable Safety Portable Box for disposal of Hypodemic needles. Consumable 3079 ICD Bag 1000 ml 3080 ICD Bag, Mfg by Life-O-Line Technologist(1000 ml),Bag 3081 Indicator sol, for pH (Litmus sol) (1x500 ml = 500 ml),Consumable 3082 Individual AST Panel for fungus(AST YS07),Each 3083 Individual AST Panel for Gram Negative Organism(GN N280),Each 3084 Individual AST Panel for Gram Positive Organism(GP P628),Each 3085 Individual Identification Panel for aerobic Gram Negative Organism(GNID),Each 3086 Infant Feeding Tube(10 G each Piece),Consumable 3087 Infant Feeding Tube(7G each Piece),Consumable 3088 Infant Feeding Tube (Catheter) Size: 3G 3089 Infant Feeding Tube (Catheter) Size: 4G 3090 Infant Feeding Tube (Catheter) Size: 5G 3091 Infant Feeding Tube (Catheter) Size: 8G 3092 Infant Feeding Tube Size: 6G 3093 Infant Mucus Extractor Sterile PVC(Each),Surgical Material 3094 Insulin Syringe 40 units/ml ISO 8537:2007 3095 Intracath Cannula for Single Use (Intravascular Catheters) BIS(Gauze 22, length 25),Consumable 3096 Intravenous Set (Children) with Airway and Needle 3097 Isopropyl Alcohol (Propanol)(1 x 2.5 Lit),Consumable 3098 Kellys Pad Disposable 3099 Kellys Pad Rubber/each 3100 Kit for Total Protein (Including Albumin and Total Protein) 100ml Bottle 3101 Latex Based Baloon capacity (30-50ml) Foleys Catheter(Size 14- 2 Way),Consumable 3102 Latex Based Baloon capacity (30-50ml) Foleys Catheter(Size 14-3 Way),Consumable 3103 Latex Based Baloon capacity (30-50ml) Foleys Catheter(Size 18- 2 Way),Consumable 3104 latex based baloon (capacity 30-50 ml) Foleys Urinary Catheter(3 Way Size 20),Consumable 3105 latex based baloon capacity (3 ml) Foleys Catheter(3 way, size - 12),Consumable 3106 Latex Based Baloon capacity (3ml) Foleys Urinary Catheter Peadiatrics(2 Way Size 8),Consumable 3107 Latex Based Baloon capacity (3ml) Foleys Urinary Catheter Peadiatrics(Size 10),Consumable 3108 Latex Examination Gloves(Large),Consumable 3109 Latex Examination Gloves(Medium),Consumable 3110 Latex Examination Gloves(Small),Consumable 3111 Lead Letter 0-9 Sets (100 Clips/Pkt) 3112 Lead Letter A To Z Set 100 clips per pack 3113 Leishman Stain 500 ml 3114 Lenstip(1 Each),Consumable 3115 Liquid Hand Wash Solution With Dispenser Consumable(500 ml),Consumable 3116 Mackintosh Double Colour Water Proof Rubber Marked ISI Hospital Rubber Sheeting IS:4135-1974 Packing and Making : as per Clause No 4.1 and 4.3 / Mtr 3117 Malaria Antigen Card PF/PV card (as per NVBDCP guidelines)( 10 card, 10 dropper, 1 buffer solution) 3118 Measure Volume(Drip Set),Each 3119 Mercuric oxide (25 gm),Consumable 3120 Methanol (Acetone free) for leishman staining (1x2.5 lit ),Consumable 3121 Methyl Blue for (Z N) 125 ml Bottle 3122 Plain Plastic Tube (Small) 3123 Plain Plastic Tube (Medium) 3124 Plain Plastic Tube (Large) 3125 Adhesive bandage Strip (Band aid Type) 3126 Micro Volume Drip Set 3127 MVA Kit (mannual Vaccum Aspiration Kit) 3128 N-95 Mask 3129 Nasal Prong(Each),Consumable 3130 Nebulization Mask-Kit (Adult) 3131 Nebulization Mask - Kit, Mfg by Life-O-Line Technologist(Pediatrics),Consumable 3132 Nebulization Mask - Kit (Pediatrics) 3133 NS-1 Elisa Dengue Kit with 96 wells 3134 Nylon suture,macrofilment spatulated, micropoint double armed size 10-0(12 foils/pkt),Sutures 3135 Nylon suture spatulated micropoint reverse cutting needle, double armed suture Size 9-0(12 foils/pkt),Sutures 3136 N.R.B.M mask 3137 oxygen mask adult 3138 Oxygen Mask Paediatric (Standard Size) 3139 Oxygen Nasal cannula neonatal 3140 Oxygen Nasal Canula (Neonatal) 7 White Colour Tubing and threaded nut 25 pcs/pkt 3141 Paper Adhesive Plaster Microporous Surgical Tape 2 inch x 5m /Roll 3142 Paper Adhesive Plaster Microporous Surgical Tape 4 inch x 9 m / Roll 3143 Paper Adhesive Plaster Microporous Surgical Tape 6 inch x 5m /Roll 3144 Platelet Dilution Fluid (100 ml Bottle) 3145 Polyamide Size - 1/0, 12 Foils/Pkt(3/8 R Cutting Needle 45 mm, Length 70 cm),Needle 3146 Polyamide Size - 2/0, 12 Foils/Pkt(3/8 R Cutting Needle 45 mm, Length 70 cm),Needle 3147 Polyamide Size - 8/0, 12 Foils/Pkt(3/8 Cir Micro point spatulated 6 mm, Length 38 cm),Consumable 3148 Polyamide with CD R cut Extra Penetrating Needle (12 Foils/Pkt)(Size 4/0),Consumable 3149 Polyethylene High Pressure Extension Tube, Length - 200cm 3150 Polyglactin 30 mm 1/2 Circle Round Body 90 cm Size 1/0(12 Foils/ Pkt),Consumable 3151 Polyglactin 40 mm 1/2 Circle Round Body 90 cm Size 1 ( 12 Foils/ Pkt) 3152 Polyglycolic acid Absorbable Surgical Suture (12 Foils/Pkt)(1/2 Cir RB Needle 20 mm, Length 70 cm Size -3/0),Needle 3153 Polyglycolic acid Absorbable Surgical Suture (12 Foils/Pkt)(1/2 Cir RB Needle 40 mm, Length 90 cm Size -2/0),Needle 3154 Polypropylene Size - 1, (12 Foils/Pkt)(1/2 Cir RB Needle 45 mm, Length 90 cm ),Needle 3155 Polypropylene size-2/0 (12 Foils/pkt)(1/2 Cir RB Needle 25mm, length 45 cm),Needle 3156 Poly Propylene with 1/2 cir RB Needle 16 mm length 70 cm Size:4/0(12 Foils/Pkt),Consumable 3157 Powder developer suitable for processing medical X-Ray films. One developer box shall contain Part A and Part B which are mixed at the time of preparation of solution of specific capacity Size:- 13.5 Ltr 3158 Powder developer suitable for processing medical X-Ray films. One developer box shall contain Part A and Part B which are mixed at the time of preparation of solution of specific capacity Size:- 9.0 Ltr 3159 Pregnancy Test Card(10 Card Pack(MFG- Oscar Medicare Pvt Ltd)),Consumable 3160 Pyrethrum Extract 2% Conforming to No. IS 1051-1980 3161 Quadraple Blood Bag 450 Ml Sagm(Each),Consumable 3162 RA factor rapid kit 1)Should be based on latex agglutination slide test 2)Qualitative and semi quantative testing facility possible 3)Test speed must be < 2 minutes(25 Test/Kit (MFG By Beacon Diagnostic)),Consumable 3163 RBC Dialuation fluid(MFG- Precious Life Care Pvt Ltd)(500 ml bottle),Consumable 3164 Reagent For HDL Cholestrol Test(100 ml (4 x 25)),Consumable 3165 Rib Belt Small(MFG By - Precious life Care),Each 3166 RPR Rapid Card Test Kit (50 test/pkt) 3167 Ryles Tube (PVC) Size : Adult: 16 3168 Ryles Tube (PVC) Size : Adult(18),Tube 3169 Ryles Tube (PVC) Size : Children: 10 3170 Ryles Tube (PVC) Size : Children : 12 3171 Ryles Tube(Size 14 each Piece),Consumable 3172 Salt Testing Kit each 3173 Seman Diluting Fluid 100 ml. 3174 Serum Creatinine(MFG- Pathogyme Diagnostics)(100 ml (2 X 50 ml)),Consumable 3175 Serum T3 kit, ELISA(96 Test kit each),Consumable 3176 SGOT Kit (Kinetic) 5x20ml 200 Test/Kit 3177 SGPT(100 ml (4 x 25)),Consumable 3178 Silver Sulphadiazine Cream 500gm 3179 Single Lumen Cathater 3180 Sulphur Powder 500gm pkt 3181 Single Umbilical Catheter With Luer Lock Stopcock Fr-2, L-40 cm 3182 Single Umbilical Catheter With Luer Lock Stopcock Fr-3, L-40 cm 3183 Single Umbilical Catheter With Luer Lock Stopcock Fr-4, L-40 cm 3184 Single Umbilical Catheter With Luer Lock Stopcock Fr-5, L-40 cm 3185 Size of Cassette(10 inch X 12 inch),Consumable 3186 Size of Cassette(14 inch X 17 inch),Consumable 3187 Size of Cassette(8 inch X 10 inch),Consumable 3188 Size of film 10 inch X 12 inch Digital X Ray Film(DIHL(Pack of 150)),Film 3189 Size of film 10 inch X 12 inch(DIHL),Consumable 3190 Size of film 14 inch X 17 inch Digital X Ray Film(DIHL (Pack of 100)),Film 3191 Size of film 14 inch X 17 inch(DIHL),Consumable 3192 Size of film 8 inch X 10 inch Digital X Ray Film(DIHL(Pack of 150)),Film 3193 Size of film 8 inch X 10 inch(DIHL),Consumable 3194 Skin closure Stapler (35 Pins High Quality Medical Grade Plastic, Cartridge With SS Rectangular Design pins With Wire Diameter 0.60 mm And Size After Closure 7.2 x 4.3 mm) 3195 Sickel Cell Test Kit (Tulip) 3196 Spinal (L.P.) Needle Disposable 24G Consumable 3197 Spinal (L.P.) Needle Disposable 26G Consumable 3198 Spinal Needle 24 G Each 3199 Spinal Needle 26 G(each),Needle 3200 Spinal Needle G-22 L-120 mm*0.71/piece 3201 Spinal Needle(G-22 L-120 mm),Consumable 3202 Spinal Needle G-23 with Metal Stylet. 3203 Spinal Needle G-27 L-120 mm*0.40/piece 3204 Suction Catheter Assorted 10 no/each 3205 Suction Catheter Assorted 9 no/each 3206 Suction Catheter, Sterile(Size Fg 20 (Disposable, Sterile each)),Consumable 3207 Suction Catheter, Sterile(Size Fg 22 (Disposable, Sterile each)),Consumable 3208 Suction Catheter, Sterile(Size Fg 6 (Disposable, Sterile each)),Consumable 3209 Sugar Albumin Strip 50 per pack 3210 Sulfur powder 500gm 3211 Surface and Fogging disinfectant Stabilised H202,10-11%w/v with diluted silver nitrate sol. 0.01%w/v(5 litre Can),Each 3212 Surgical Blade, Size 11 3213 Surgical Blade, Size 22 (50/Pkt) 3214 Surgical Blade, Size 23 (100/Pkt) 3215 Suture Needles Curved 1/2 Circle Round BodyAssorted Size 11-15 3216 Suture Needles Curved 1/2 Circle Round BodyAssorted Size 1-5 3217 Suture Needles Curved 1/2 Circle Round BodyAssorted Size 16-20 3218 Swab Stick with tube-Sterile(70-80 mm Length 10- 15 mm Diameter), unit 1(100/Pkt (MFG- Laboratories Pvt Ltd)),Consumable 3219 Synethetic Absorbable suture 1/0 with 1/2 cir RB needle size: 1/0 length 90cm 3220 Synthetic Absorbable Suture 1 With 1/2 Circle Taper Cut Needle (H) Size :1 40mm Length 90cm Polyglycolic Acid (PGA) (12 Foils Per Pkt) 3221 Synthetic Absorbable Suture 2/0 With 1/2 cir RB needle Size:2/0 30mm length 90cm-Polyglycolic acid (PGA) 12 foils / pkt 3222 Synthetic Absorbable Suture 2/0 With 1/2 cir RB needle Size:2/0 40mm length 90cm-Polyglycolic acid (PGA) 3223 Synthetic Absorbable Suture 3/0 With 1/2 cir Cutting Needle Size:3/0 36mm length 70cm -polyglycolic acid(PGA) 3224 Synthetic Absorbable Suture 3/0 With 1/2 cir Cutting Needle Size:3/0 36mm length 70cm -polyglycolic acid(PGA) 12 foils / pkt 3225 Synthetic Absorbable Suture 3/0 With 1/2 cir RB needle Size:3/0 20mm length 70cm-Polyglycolic acid (PGA) 3226 Synthetic Absorbable Suture 3/0 With 1/2 cir RB needle Size:3/0,40mm length 90cm-Polyglycolic acid (PGA) 3227 Synthetic Absorbable Suture 3/0 With CD Cutting Needle Size : 3/0 22mm Length 45cm - Polyglycolic Acid (PGA) (12 Foils Per pkt) 3228 Synthetic Absorbable Suture 4/0 With 1/2 cir RB needle Size:4/0 20mm length 70cm -poly glycolic acid (PGA) 3229 Synthetic Absorbable Suture 4/0 With 1/2 cir RB needle Size:4/0 20mm length 70cm -poly glycolic acid (PGA)(12 foils/pkt) 3230 Synthetic Absorbable Suture 4/0 With 3/8 cir Cutting needle Size:4/0 16mm length 45 cm -Polyglycolic acid (PGA) 3231 Synthetic Absorbable Triclosan Coated Polyglactin 910,Size 1, Needle 40mm, 1/2 Circle Round Body , 90cm Length 3232 Synthetic Absorbable Triclosan Coated Polyglactin 910, Size 1-0,Needle 40mm,1/2 Circle Round Body , 90cm Length 3233 Synthetic Absorbable Triclosan Coated Polyglactin 910,Size 1, 40mm,1/2 Circle Reverse Cutting OS Needle , 90cm Length 3234 Synthetic Absorbable Triclosan Coated Polydioxanone,Size 1, Needle 36.4 mm, 1/2 Circle Taper point CT-1 90cm 3235 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 1-0, Needle 36.4 mm, 1/2 Circle Taper point 90cm 3236 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 2-0, Needle 26mm, 1/2 Circle Taper point 70cm 3237 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 3-0, Needle 17mm, 1/2 Circle Taper point 70cm 3238 Synthetic Absorbable Triclosan Coated Poliglecaprone 25, Size 2-0, 26 mm, 1/2 Circle Round Body, Visiblack JB Needle 70cm 3239 Synthetic Absorbable Triclosan Coated Poliglecaprone 25, Size 3-0, 26 mm, 3/8 Circle Reverse cutting,70cm 3240 Test Tube 12 x 100 (Medicm Size) 100/Pkt 3241 Test Tube 12 x 75 (Small Size) 100/Pkt(12 x 75 (Small Size) 100/Pkt),Tube 3242 Test Tube 15x125/1*100/Pkt 3243 Test tube Medium (12x100) 100Eack/Pkt(Each),Consumable 3244 Three layer Surgical Mask 100 per pack 3245 Three Way Stop Cock consumable 3246 Tips For Auto Pipettes 200 to 1000 Micro Litres 500/pkt(200 to 1000 Micro Litres 500/pkt),Each 3247 Tips For Auto Pipettes 2 to 100 Micro Litres 1000/pkt(2 to 100 Micro Litres 1000/pkt),Each 3248 Tips for Auto Pippetes 10 to 100 Micro Litres 1*100/pkt 3249 Tissue Paper Roll(Each),Consumable 3250 Total Protein 100 ml Bottle 3251 Total Protein Lysozyme 1x50 ml 3252 Total Protein (MFG By Beacon Diagnostic)(100 ml),Consumable 3253 Tourniquet with Belt (good quality pairs), Pairs 3254 Transfer Bag(Each),Consumable 3255 Triglyceride 600 ml(Model BA 400 System (Mfg ByBio System)),Consumable 3256 Triglyceride Kit Enzymet 5x20ml 200Test/Kit 3257 Serum Trigyceride (Autospan/Erba) 3258 Trisodium Citrate 3.8% (500 ml Bottle) 3259 Triway Cannula (3 Way Stop Cock) 3260 Typhoid Card Test Kit (For IgG and IgM Antibody Detection) (25 Test Kit) 3261 Umbical Cord Clamps - Plastic Material(Box Of 100 Clamps),Consumable 3262 Urea(Brethelot)3x100ml LYPHOZYME 2x10ml 3263 Urea Kit Berthelot 50 Test/Kit 3264 Urinary Drainage Bag 2 litre Cap With Non Return Valve (EO Sterile) 3265 Urinary Drainage Bag (Paediatric)(100 ml / pc),Consumable 3266 Urine Container 5ml Disposable (50 per pkt) 3267 USG Thermal Paper each 3268 Variable Auto Pippets 10 to 100 Micro Litres 3269 Variable Auto Pippets 20 to 200 Micro Litres 3270 Variable Auto Pippets 100 to 1000 Micro Litres 3271 Variable Auto Pippets 0.5 to 50 Micro Litres 3272 VDRL Kit (Strip)(50 Test/Kit),Consumable 3273 VTM - Hi - Media With 2 Swab : (For Swine Flu) VTM Standard Kit(3ml Vial with 2 Regular Swabs) 3274 WBC Diluting Fluid 500ml 3275 Widal Test Kit Rapid 3276 X-ray cassets(6.5x8.5),Consumable 3277 X-ray cassets(8x10),Consumable 3278 X-Ray Film 10 x 12 50 Sheets/Pack 3279 X-Ray Film 12 x 12 50 Sheets/Pack 3280 X-Ray Film 12 x 15 50 Sheets/Pack 3281 X-Ray Film 14 x 14 50 Sheets/Pack 3282 X-Ray Film 14 x 17 50 Sheets/Pack 3283 X-Ray Film 6.5 x 8.5 50 Sheets/Pack 3284 X-Ray Film 8 x 10 50 Sheets/Pack 3285 X-Ray Film Fixer(Powder to make 13.5 Liters-Pkt),Consumable 3286 X-Ray Film Fixer(Powder to make 9 Liters-Pkt),Consumable 3287 X-ray Hangers(10x12),Consumable 3288 X-ray Hangers(12x15),Consumable 3289 X-ray Hangers(6.5x8.5),Consumable 3290 X-ray Hangers(8x10),Consumable 3291 Xylene (Sulphur free)(1 x 2.5 Lit),Consumable 3292 Absorable Surgical Suture RB needle size No 1-0,30 mm Length -70 cm , 12 foils per packet , Polyglycolic acid (PGA) 3293 Ambu bag (250 ml) 3294 B.B Silk (12 Foils/Pkt)(3/8 RCut Needle 45 mm length 76 cm, Size 2/0)),Consumable 3295 B.B Silk with 1/2 Cir RB Needle Size:1/0 20 mm length 75 cm Non Absorbable Surgical Sutures USP Surgical Material 3296 B.B Silk with 1/2 Cir RB/cutting Needle 30 mm Length 75 cm Non Absorbable(Size 2-0, 12 Foils/Pkt),Consumable 3297 Biomedical waste collection Plastic bag(yellow)(as per attached detail specifications)(450X450 mm 55 micron 100/pkt),Consumable 3298 Biomedical waste collection Plstic bag(Black 750 x 900 mm 55 micron 100/Pkt),Bag 3299 Biomedical waste collection Plastic bag(Black 900 x 900 mm 55 micron 100/Pkt),Bag 3300 Biomedical waste collection Plstic bag(Blue 750 x 900 mm 55 micron 100/Pkt),Bag 3301 Biomedical waste collection Plstic bag(Blue 900 x 900 mm 55 micron 100/Pkt),Bag 3302 Biomedical waste collection Plstic bag(Red 750 x 900 mm 55 micron 100/Pkt),Bag 3303 Biomedical waste collection Plstic bag(Red 900 x 900 mm 55 micron 100/Pkt),Bag 3304 Biomedical waste collection Plstic bag(Yellow 750 x 900 mm 55 micron 100/Pkt),Bag 3305 Biomedical waste collection Plstic bag(Yellow 900 x 900 mm 55 micron 100/Pkt),Bag 3306 BLEACHING POWDER GR-II IS 1065/1989 WITH UPTO DATE AMENDMENT PACKED IN 25 KG HDPE BAGS ISI MARKED STABLE Consumable 3307 Blood Administrations Set 3308 Blood Bag with ACD/CPD Solution (Disposable Sterilised) with Needle(350 ml),Bag (HLL) Single 3309 Blood Bag with ACD/CPD Solution (Disposable Sterilised) with Needle(350 ml),Bag (HLL) Double 3310 Blood Grouping Anti Sera A Monoclonal(10 ml Vial (MFG- Tulip Diagnostics)),Consumable 3311 Blood Grouping Anti Sera B Monoclonal(10 ml Vial (MFG- Tulip Diagnostics)),Consumable 3312 Blood Grouping Anti Sera D Monoclonal(10 ml Vial (MFG- Tulip Diagnostics)),Consumable 3313 Blood Sugar Kit 500ml 3314 C B C Paper Roll 56’’ 3315 C.P.D.A.Blood Bag 350 ml Consumable 3316 Chromic Size - 1/0 (12 Foils/Pkt)(3/8 Cir RB Needle 40 mm, Suture Length 76 cm),Needle 3317 Cotton Thread 10 No. each 3318 Diagnostic Strips for Urine Sugar/Albmin Packing: 100 Strip/Pkt 3319 Disposable Needles 23 No 3320 Disposable Syringe 5 ml 3321 ECG Jelly 250 gms 3322 HBs Antigeng kit Card(Pack of 10 card test with 10 Dropper, 1 Buffer Solution, 10 Pricking Lancet and 10 Alcohol Swab),Digonstic 3323 I V Cannula With Inj.Valve (Port)(Size 26G Each),Consumable 3324 I.V Cannula With Injection Valve Size : 18G 3325 I.V. Cannula With Injection Valve 20G 3326 Intravenous Set with Airway and Needle((Adult)),Surgical Material 3327 IV Cannula (two Way) Size 20 3328 IV Cannula (two Way) Size 22 3329 IV Cannula (two Way) Size 24 3330 IV Cannula size 26G 3331 Phenyl - as Per Schedule O (grade 1) 10 lt Jar(ISI Marked),Consumable 3332 POP Bandage(4 inch),Consumable 3333 POP Bandage(6 inch),Consumable 3334 A.V Fistula Needle - 16 no 3335 Plaster Of Paris Bandage 10 cm x 2.7 mtr / Roll 3336 Plaster Of Paris Bandage 15cm x 2.7mtr / Roll 3337 Plaster Of Paris Bandage BP 10 cm x 2.7 mtr / Roll 3338 100% SILICONE 2-WAY FOLEY BALLOON CATHETERSize 8 FR & 10 FRPoly BagCartoon 3339 100% SILICONE 2-WAY FOLEY BALLOON CATHETERSize 12 FR To 24 FRPoly BagCartoon 3340 2-WAY FEMALE FOLEY BALLOON CATHETER(PAPER PACK)Size 12 FR To 24 FRPoly BagCartoon 3341 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Pediatric Size 6 FRInner BoxCartoon 3342 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Pediatric Size 6 FRPoly BagCartoon 3343 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Pediatric Size:8 FR To 10 FRPoly BagCartoon 3344 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Pediatric Size:8 FR To 10FRInner BoxCartoon 3345 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Size: 12 FR To 18 FR.Poly BagCartoon 3346 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Size: 12 FR To 18 FRInner BoxCartoon 3347 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Size: 20 FR To 24 FR.Poly BagCartoon 3348 2-WAY FOLEY BALLOON CATHETER (PAPER PACK)Size: 20 FR To 24 FRInner BoxCartoon 3349 3 BALL SPIROMETER 3350 3- WAY STOP COCK(Paper Pack)Poly BagBora Pack 3351 3-WAY FOLEY BALLOON CATHETER (PAPER PACK)Size 12 FR To 22 FRInner BoxCartoon 3352 3-WAY FOLEY BALLOON CATHETER (PAPER PACK)Size 12 FR To 22 FRPoly BagCartoon 3353 ABDOMINAL BELT (BOX PACK)Size – 2XL, 3XL 3354 ABDOMINAL BELT (BOX PACK)Size – S,M,L,XL 3355 ABDOMINAL CORSET-ELASTIC(BOX PACK)Size – S,M,L,XL 3356 ABDOMINAL DARINAGE KITSize –FG- 28, 30, 32, 34,36,Packed in Paper Pouch 3357 ABDOMINAL DARINAGE KITSize –FG- 12,14,16, 18,20, 22, 24,26Packed in Paper Pouch 3358 ABSORBENT COTTON WOOL I.P100 Gms 3359 ABSORBENT COTTON WOOL I.P20 Gms 3360 ABSORBENT COTTON WOOL I.P200 Gms 3361 ABSORBENT COTTON WOOL I.P400 Gms 3362 ABSORBENT COTTON WOOL I.P50 Gms 3363 ABSORBENT COTTON WOOL I.P500 Gms 3364 ADHESIVE TAPESize –10cm x 5mts 3365 ADHESIVE TAPESize –2.5cm x 5mts 3366 ADHESIVE TAPESize –5cm x 5mts 3367 ADHESIVE TAPESize –7.5cm x 5mts 3368 AIR CUSHION MASKSize: 2 3369 AIR CUSHION MASKSize: 3 3370 AIR CUSHION MASKSize: 4 3371 AIR CUSHION MASKSize: 5 3372 AIR CUSHION MASKSize: 6 3373 AIR CUSHION MASKSize: 7 3374 ALCOHOL SWABDisposable 3375 AMBU BAG ADULT (SILICON RESUSCITATOR) 3376 AMBU BAG CHILD (SILICON RESUSCITATOR) 3377 AMBU BAG NEONATAL (SILICON RESUSCITATOR) 3378 ANKLE BINDER (BOX PACK)Size – Universal 3379 ANKLE BRACESize – L 3380 ANKLE BRACESize – M 3381 ANKLE BRACESize – S 3382 ANKLE BRACESize – XL 3383 ANKLE SUPPORT(ANKLET) PAIR Size – L 3384 ANKLE SUPPORT(ANKLET) PAIR Size – M 3385 ANKLE SUPPORT(ANKLET) PAIR Size – S 3386 ANKLE SUPPORT(ANKLET) PAIR Size – XL 3387 ANKLE TRACTION (BOX PACK)Size – L 3388 ANKLE TRACTION (BOX PACK)Size – M 3389 ANKLE TRACTION (BOX PACK)Size – S 3390 ANKLE TRACTION (BOX PACK)Size – XL 3391 ARM ‘O’ ELBOW DRAPE 3392 ARM ‘U’ SHOULDER(‘U’ DRAPE) 3393 BAINS CIRCUIT CHILD (Poly Pack) 3394 BAINS CIRCUIT WITH HEINDBRINK VALVE(Poly Pack) ADULT 3395 BED PAN (POLY PACK)Male /FemaleCartoon 3396 BIPAP MASK(CPAP Mask/ Full Face Mask)Poly carbonate MaterialVented or Non VentedSize: medium 3397 BIPAP MASK(CPAP Mask/ Full Face Mask)Poly carbonate MaterialVented or Non VentedSize: small 3398 BIPAP MASK(CPAP Mask/ Full Face Mask)Poly carbonate MaterialVented or Non VentedSize:large 3399 BLOOD ADMINISTRATION SET15 mm single chamber, 18’’G Vein Needle, tube dia.:2.70 mm, 50 mm Latex tube 3400 BLOOD ADMINISTRATION SET15 mm single chamber, 18’’G Vein Needle, tube dia.:2.80 mm, 42 mm bulb Latex 3401 BLOOD ADMINISTRATION SET15 mm single chamber, 18’’G Vein Needle, tube dia.:2.90 mm, 45 mm bulb Latex 3402 BLOOD ADMINISTRATION SET17 mm double chamber with Blood filter, 18’’G Vein Needle, tube dia.:3.20mm, 3403 BLOOD LANCETDisposable 3404 BREATHING FILTER 3405 BVF HME FILTER 3406 CANULA FIXER(Paper Pack) Size- Medium 3407 CAST SHOESSize – L 3408 CAST SHOESSize – M 3409 CAST SHOESSize – S 3410 CAST SHOESSize – XL 3411 CAST SHOESSize –XXL 3412 CATHETER MOUNT EXPANDABLE(Paper Pack) 3413 CATHETER MOUNT STANDARD(Paper Pack) 3414 CERVICAL COLLAR SOFT (BOX PACK)Size – L 3415 CERVICAL COLLAR SOFT (BOX PACK)Size – M 3416 CERVICAL COLLAR SOFT (BOX PACK)Size – S 3417 CERVICAL COLLAR SOFT WITH BUTTON (BOX PACK)Size – L 3418 CERVICAL COLLAR SOFT WITH BUTTON (BOX PACK)Size – M 3419 CERVICAL COLLAR SOFT WITH BUTTON (BOX PACK)Size – S 3420 CERVICAL PILLOWSize - Universal 3421 CESERIAN DRAPE 3422 CHEST BELT(STERNAL SUPPORT)Size – 2XL 3423 CHEST BELT(STERNAL SUPPORT)Size – 3XL 3424 CHEST BELT(STERNAL SUPPORT)Size – L 3425 CHEST BELT(STERNAL SUPPORT)Size – M 3426 CHEST BELT(STERNAL SUPPORT)Size – S 3427 CHEST BELT(STERNAL SUPPORT)Size – XL 3428 CHEST DRAINAGE CATHETERSize FG- 10 3429 CHEST DRAINAGE CATHETERSize FG- 12 3430 CHEST DRAINAGE CATHETERSize FG- 14 3431 CHEST DRAINAGE CATHETERSize FG- 16 3432 CHEST DRAINAGE CATHETERSize FG- 18 3433 CHEST DRAINAGE CATHETERSize FG- 20 3434 CHEST DRAINAGE CATHETERSize FG- 22 3435 CHEST DRAINAGE CATHETERSize FG- 24 3436 CHEST DRAINAGE CATHETERSize FG- 26 3437 CHEST DRAINAGE CATHETERSize FG- 28 3438 CHEST DRAINAGE CATHETERSize FG- 30 3439 CHEST DRAINAGE CATHETERSize FG- 32 3440 CHEST DRAINAGE CATHETERSize FG- 34 3441 CHEST DRAINAGE CATHETERSize FG- 36 3442 CITRATE TUBE PET TUBE 3443 CITRATE TUBE PET TUBESAFETY CAP 3444 CLAVICLE BRACE (BOX PACK)Size – L 3445 CLAVICLE BRACE (BOX PACK)Size – M 3446 CLAVICLE BRACE (BOX PACK)Size – S 3447 CLAVICLE BRACE (BOX PACK)Size – XL 3448 CLOSE WOUND SUCTION UNIT Adult 400 mlSize:FG 10 3449 CLOSE WOUND SUCTION UNIT Adult 400 mlSize:FG 12 3450 CLOSE WOUND SUCTION UNIT Adult 400 mlSize:FG 14 3451 CLOSE WOUND SUCTION UNIT Adult 400 mlSize:FG 16 3452 CLOSE WOUND SUCTION UNIT Adult 400 mlSize:FG 18 3453 CLOSE WOUND SUCTION UNIT Adult 400 mlSize:FG 20 3454 CLOSE WOUND SUCTION UNIT Adult 800 mlSize:FG 10 3455 CLOSE WOUND SUCTION UNIT Adult 800 mlSize:FG 12 3456 CLOSE WOUND SUCTION UNIT Adult 800 mlSize:FG 14 3457 CLOSE WOUND SUCTION UNIT Adult 800 mlSize:FG 16 3458 CLOSE WOUND SUCTION UNIT Adult 800 mlSize:FG 18 3459 CLOSE WOUND SUCTION UNIT Adult 800 mlSize:FG 20 3460 CLOSE WOUND SUCTION UNIT Child 80 mlSize: FG 6 3461 CLOSE WOUND SUCTION UNIT Child 80 mlSize: FG 8 3462 CLOT ACTIVATOR 1 ML TUBE PEDIATRICS TUBERUBBER STOPPER 3463 CLOT ACTIVATOR 4 ML TUBERUBBER STOPPER 3464 CLOT ACTIVATOR 4 ML TUBESAFETY CAP 3465 CLOT ACTIVATOR 4ML TUBE 3466 COMBINE DRESSING – STRILESize – 10cm*10cm 3467 COMBINE DRESSING – STRILESize –10cm*20cm 3468 CONTOURED LUMBAR SACRAL BELT – TWILL ELASTICSize – L 3469 CONTOURED LUMBAR SACRAL BELT – TWILL ELASTICSize – M 3470 CONTOURED LUMBAR SACRAL BELT – TWILL ELASTICSize – S 3471 CONTOURED LUMBAR SACRAL BELT – TWILL ELASTICSize – XL 3472 CONTOURED LUMBAR SACRAL BELT(POLY PACK)Size – 2XL 3473 CONTOURED LUMBAR SACRAL BELT(POLY PACK)Size – 3XL 3474 CONTOURED LUMBAR SACRAL BELT(POLY PACK)Size – L 3475 CONTOURED LUMBAR SACRAL BELT(POLY PACK)Size – M 3476 CONTOURED LUMBAR SACRAL BELT(POLY PACK)Size – S 3477 CONTOURED LUMBAR SACRAL BELT(POLY PACK)Size – XL 3478 CORD CLAMP(Blister Pack) 3479 CORD CLAMP(Paper Pack and 100 Pcs Box) 3480 CORD CLAMP(Paper Pack) 3481 CORD CLAMP(Poly Pack) 3482 CORRUGATED DRAINAGE SHEET 3483 COTTON CREPE BANDAGE (DELUX)Size –10cm x 4mtsPacked in PVC Container 3484 COTTON CREPE BANDAGE (DELUX)Size –15cm x 4mtsPacked in PVC Container 3485 COTTON CREPE BANDAGE (DELUX)Size –6cm x 4mtsPacked in PVC Container 3486 COTTON CREPE BANDAGE (DELUX)Size –8cm x 4mtsPacked in PVC Container 3487 COTTON CREPE BANDAGE (PREMIUM)Size –10cm x 4mtsPacked in PVC Container 3488 COTTON CREPE BANDAGE (PREMIUM)Size –15cm x 4mtsPacked in PVC Container 3489 COTTON CREPE BANDAGE (PREMIUM)Size –6cm x 4mtsPacked in PVC Container 3490 COTTON CREPE BANDAGE (PREMIUM)Size –8cm x 4mtsPacked in PVC Container 3491 DEHP - FREE INFUSION SET- VENTED MOLDED IN-BUILT AIRVENT(Ribbon Pack)VENTED Drip Chamber 16 MM : 21’’G Needle Kink resistant Tube Dia.:3.00mm Length 1500mm. Y-injection port and Luer Lock 3492 DEHP - FREE INFUSION SET-NON-VENTED (Ribbon Pack)Molded Drip Chamber 16 MM : 21’’G Needle Kink resistant Tube Dia.:3.00mm Length 1500mm. Y-injection port and Luer Lock 3493 DISPOSABLE APRONLD 3494 DISPOSABLE APRONPlastic 3495 DISPOSABLE BAD SHEET LD- BLUE120X210 3496 DISPOSABLE BAD SHEET LD- BLUESize: 100X120 3497 DISPOSABLE BOUFFANT CAP Size: 16” 3498 DISPOSABLE BOUFFANT CAP Size: 18” 3499 DISPOSABLE BOUFFANT CAP Size: 21” 3500 DISPOSABLE HELMET HOODFor Joint replacement OrthoPacked in paper pouch 3501 DISPOSABLE MASK3- PLY ( Elastic ) 3502 DISPOSABLE MASK3- PLY TIE ON 3503 DISPOSABLE SURGEON CAP 3504 DORSOLUMBAR BRACE SHORT/ LONG(POLY PACK)Size – SPL ( 44” ) 3505 DORSOLUMBAR BRACE SHORT/ LONG(POLY PACK)Size – SPL ( 52” ) 3506 DORSOLUMBAR BRACE SHORT/ LONG(POLY PACK)Size – Universal ( 28” ) 3507 DORSOLUMBAR BRACE SHORT/ LONG(POLY PACK)Size – Universal ( 44” ) 3508 DOUBLE WATER TRAP VENTILATOR(Poly Pack) Adult 3509 DOUBLE WATER TRAP VENTILATOR(Poly Pack) Child 3510 DYNAMIC COCK-UP SPLINT(POLY PACK)Size – L 3511 DYNAMIC COCK-UP SPLINT(POLY PACK)Size – M 3512 DYNAMIC COCK-UP SPLINT(POLY PACK)Size – S 3513 DYNAMIC COCK-UP SPLINT(POLY PACK)Size – XL 3514 ELASTIC ADHESIVE BANDAGESize – 10cm x 4/6mtsPacked in PVC Tin 3515 ELASTIC ADHESIVE BANDAGESize – 15 cm x 4/6 mtsPacked in PVC Tin 3516 ELASTIC ADHESIVE BANDAGESize – 6cm x 4/6 mtsPacked in PVC Tin 3517 ELASTIC ADHESIVE BANDAGESize – 7.5 cm x 4.5 /6 mtsPacked in PVC Tin 3518 ELASTIC ADHESIVE BANDAGESize – 8cm x 4/6mtsPacked in PVC Tin 3519 ELASTIC KNEE SUPPORTSize – 3XL 3520 ELASTIC KNEE SUPPORTSize – L 3521 ELASTIC KNEE SUPPORTSize – M 3522 ELASTIC KNEE SUPPORTSize – S 3523 ELASTIC KNEE SUPPORTSize – XL 3524 ELASTIC KNEE SUPPORTSize –2XL 3525 ELASTICS SHOULDER IMMOBILIZER (BOX PACK)Size – L 3526 ELASTICS SHOULDER IMMOBILIZER (BOX PACK)Size – M 3527 ELASTICS SHOULDER IMMOBILIZER (BOX PACK)Size – S 3528 ELASTICS SHOULDER IMMOBILIZER (BOX PACK)Size – XL 3529 ELBOW SUPPORTSize – L 3530 ELBOW SUPPORTSize – M 3531 ELBOW SUPPORTSize – S 3532 ELBOW SUPPORTSize – XL 3533 ENDOTRACHEAL TUBE[CUFFED]Size – 2.5, 3, 3.5, 4Sterile / Disposable 3534 ENDOTRACHEAL TUBE[CUFFED]Size – 4.5 to 9Sterile / Disposable 3535 ENDOTRACHEAL TUBE[PLAIN]Size – 2, 2.5, 3, 3.5, 4.Sterile / Disposable 3536 ENDOTRACHEAL TUBE[PLAIN]Size – 4.5 to 9.Sterile / Disposable 3537 ESR TUBE PET TUBE 3538 ESR TUBE PET TUBESAFETY CAP 3539 Ethyl Vinyl Acetate gloves Malaysian Imported/100 pcs Box,Size: Ex-Large. 3540 Ethyl Vinyl Acetate gloves Malaysian Imported/100 pcs Box,Size: Large 3541 Ethyl Vinyl Acetate gloves Malaysian Imported/100 pcs Box,Size: Small 3542 Ethyl Vinyl Acetate gloves Malaysian Imported/100 pcs Box,Size:Medium 3543 EXAMINATION GLOVES LATEXMalaysian Imported /5 gms /100 pcs BoxSize- ex-large. 3544 EXAMINATION GLOVES LATEXMalaysian Imported /5 gms /100 pcs BoxSize- large 3545 EXAMINATION GLOVES LATEXMalaysian Imported /5 gms /100 pcs BoxSize- medium 3546 EXAMINATION GLOVES LATEXMalaysian Imported /5 gms /100 pcs BoxSize-small 3547 EXAMINATION GLOVES NITRILEMalaysian Imported / 100 pcs Box,Size- ex-large. 3548 EXAMINATION GLOVES NITRILEMalaysian Imported / 100 pcs Box,Size- large 3549 EXAMINATION GLOVES NITRILEMalaysian Imported / 100 pcs Box,Size- medium 3550 EXAMINATION GLOVES NITRILEMalaysian Imported / 100 pcs Box,Size-small 3551 EXAMINATION GLOVES PLASTICPlastic gloves disposable(Orange) 32”, 100GSM 3552 EXAMINATION GLOVES PLASTICPlastic gloves disposable12”, 35GSM 3553 EXAMINATION GLOVES PLASTICPlastic gloves disposable12”, 45GSM 3554 EXAMINATION GLOVES PLASTICPlastic gloves disposable14”, 50GSM 3555 EXTENSION LINE WITH3 WAY STOPSize: 10 cms.Packed in Paper Pouch PackPoly BagCartoon 3556 EXTENSION LINE WITH3 WAY STOPSize: 100 cms.Packed in Paper Pouch PackPoly BagCartoon 3557 EXTENSION LINE WITH3 WAY STOPSize: 150 cms.Packed in Paper Pouch PackPoly BagCartoon 3558 EXTENSION LINE WITH3 WAY STOPSize: 200 cms.Packed in Paper Pouch PackPoly BagCartoon 3559 EXTENSION LINE WITH3 WAY STOPSize: 25 cms.Packed in Paper Pouch PackPoly BagCartoon 3560 EXTENSION LINE WITH3 WAY STOPSize: 250 cms.Packed in Paper Pouch PackPoly BagCartoon 3561 EXTENSION LINE WITH3 WAY STOPSize: 50 cms.Packed in Paper Pouch PackPoly BagCartoon 3562 EYE DRAPEWith attached drain pouch and eyelid holders 3563 EYE PATCH 3564 FINGER COTSize – L 3565 FINGER COTSize – M 3566 FINGER COTSize – S 3567 FLUORIDE 2 ML TUBERUBBER STOPPER 3568 FLUORIDE 2 ML TUBESAFETY CAP 3569 FLUORIDE 2ML TUBE MICRO SPRAY COATING 3570 FOOT DROP SPLINT(POLY PACK) ( Left/Right )Size – L 3571 FOOT DROP SPLINT(POLY PACK) ( Left/Right )Size – M 3572 FOOT DROP SPLINT(POLY PACK) ( Left/Right )Size – S 3573 FROG SPLINTSize – L 3574 FROG SPLINTSize – M 3575 FROG SPLINTSize – S 3576 FULLY GYNEC DRAPE 3577 GAMJEE ROLLSize – 10cm*3 meters 3578 GAMJEE ROLLSize – 15cm*3 meters 3579 GIBBON’S CATHETERSize –10 3580 GIBBON’S CATHETERSize –12 3581 GIBBON’S CATHETERSize –14 3582 GIBBON’S CATHETERSize –16 3583 GIBBON’S CATHETERSize –18 3584 GIBBON’S CATHETERSize –20 3585 GIBBON’S CATHETERSize –22 3586 GUEDEL AIRWAY(Paper Pack)Size -0 3587 GUEDEL AIRWAY(Paper Pack)Size -00 3588 GUEDEL AIRWAY(Paper Pack)Size -000 3589 GUEDEL AIRWAY(Paper Pack)Size -1 3590 GUEDEL AIRWAY(Paper Pack)Size -2 3591 GUEDEL AIRWAY(Paper Pack)Size -3 3592 GUEDEL AIRWAY(Paper Pack)Size -4 3593 GUEDEL AIRWAY(Paper Pack)Size -5 3594 HARD CERVICAL COLLAR (POLY PACK)Size – L 3595 HARD CERVICAL COLLAR (POLY PACK)Size – M 3596 HARD CERVICAL COLLAR (POLY PACK)Size – S 3597 HERNIA BELTSize – L 3598 HERNIA BELTSize – M 3599 HERNIA BELTSize – S 3600 HERNIA BELTSize – XL 3601 HERNIA BELTSize –XXL 3602 HIGH CONCENTRATION MASK [RESERVIOR BAG WITH OXYGEN MASK]Size- Adult 3603 HIGH CONCENTRATION MASK [RESERVIOR BAG WITH OXYGEN MASK]Size- Pediatric 3604 HIGH PRESSURE MONITORING LINESize: 10 cms.Packed in Paper Pouch PackPoly BagCartoon 3605 HIGH PRESSURE MONITORING LINESize: 100cms.Packed in Paper Pouch PackPoly BagCartoon 3606 HIGH PRESSURE MONITORING LINESize: 150 cms.Packed in Paper Pouch PackPoly BagCartoon 3607 HIGH PRESSURE MONITORING LINESize: 200 cms.Packed in Paper Pouch PackPoly BagCartoon 3608 HIGH PRESSURE MONITORING LINESize: 25 cms.Packed in Paper Pouch PackPoly BagCartoon 3609 HIGH PRESSURE MONITORING LINESize: 250 cms.Packed in Paper Pouch PackPoly BagCartoon 3610 HIGH PRESSURE MONITORING LINESize: 50 cms.Packed in Paper Pouch PackPoly BagCartoon 3611 HIP ‘U’ DRAPE 3612 HIV PROTECTION KIT (premium)Gown, Mask, Cap, Shoe Cover, Gloves, Goggles, Apron, Waste Carry Bag, Bed sheet 3613 HIV PROTECTION KITGown, Mask, Cap, Shoe Cover, Gloves, Goggles. 3614 HME FILTER(Paper Pack)Size – Adult 3615 HME FILTER(Paper Pack)Size – Pediatric 3616 HOOD CAP 3617 I.V.FLOW REGULATOR SET 3618 INFANT FEEDING TUBE(Paper Pack)Disposable Sterile Size -10 3619 INFANT FEEDING TUBE(Paper Pack)Disposable Sterile Size -5 3620 INFANT FEEDING TUBE(Paper Pack)Disposable Sterile Size -6 3621 INFANT FEEDING TUBE(Paper Pack)Disposable Sterile Size -7 3622 INFANT FEEDING TUBE(Paper Pack)Disposable Sterile Size -8 3623 INFANT FEEDING TUBE(Paper Pack)Disposable Sterile Size -9 3624 INFANT MUCUS EXTRACTER(Paper Pack) 3625 INFANT MUCUS EXTRACTER(Poly Pack) 3626 INFUSION SET- REGULARMolded Drip Chamber 13.5 MM: 21’’G Needle Kink resistant Tube Dia.:2.70 mm Length 1500 mm. 42mm Tube latex. 3627 INFUSION SET- VENTED MOLDED IN-BUILT AIRVENT(Paper Pack)VENTED Drip Chamber 15mm : Kink resistant Tube Dia.: 2.90 mm Length 1500 mm, “Y” connector with luer lock 3628 INFUSION SET- VENTED MOLDED IN-BUILT AIRVENT(Ribbon Pack)VENTED Drip Chamber 16 MM : 21’’G Needle Kink resistant Tube Dia.:3.00mm Length 1500mm, Y-injection port and Luer Lock 3629 INFUSION SET- VENTED MOLDED IN-BUILT AIRVENT(Ribbon Pack)VENTED Drip Chamber 16 MM : 21’’G Needle Kink resistant Tube Dia.:3.00mm Length 1500mm. 48 mm bulb 3630 INFUSION SET- VENTED MOLDED IN-BUILT AIRVENTVENTED Drip Chamber 15mm : Kink resistant Tube Dia.: 2.90 mm Length 1500 mm, “Y” connector with luer lock 3631 INFUSION SET(Paper Pack)Molded Drip Chamber 14 MM : 21’’G Needle Kink resistant Tube Dia.:2.70 mm Length 1500 mm. 50 mm latex tube 3632 INFUSION SET(Paper Pack)Molded Drip Chamber 14 MM : 21’’G Needle Kink resistant Tube Dia.:2.80 mm Length 1500 mm. 42 mm bulb Latex 3633 INFUSION SET(Paper Pack)VENTED Drip Chamber 15 MM : 21’’G Needle Kink resistant Tube Dia.: 2.90 mm Length 1500 mm. 45 mm bulb 3634 INFUSION SETMolded Drip Chamber 14 MM : 21’’G Needle Kink resistant Tube Dia.:2.70 mm Length 1500 mm. 46 mm latex tube 3635 INFUSION SETMolded Drip Chamber 15 MM : 21’’G Needle Kink resistant Tube Dia.:2.80 mm Length 1500 mm. 42 mm Bulb Latex 3636 INFUSION SET-NON-VENTED (Ribbon Pack)Molded Drip Chamber 16 MM : 21’’G Needle Kink resistant Tube Dia.:3.00 mm Length 1500 mm. 47 mm bulb 3637 INFUSION SETSafety Type Chamber(Paper Pack)Molded Drip Chamber 14.6 MM : 21’’G Needle Kink resistant Tube Dia.:2.80 mm Length 1500 mm. 42 mm bulb Latex 3638 INFUSION SETSafety Type ChamberMolded Drip Chamber 14.6 MM : 21’’G Needle Kink resistant Tube Dia.:2.80 mm Length 1500 mm. 42 mm Bulb Latex 3639 INFUSION SETVENTED Drip Chamber 15 MM : 21’’G Needle Kink resistant Tube Dia.: 2.90 mm Length 1500 mm. 43 mm bulb 3640 INTRAVENOUS CANNULASize – 14,26Packed in Blister pack 3641 INTRAVENOUS CANNULASize –16,24Packed in Blister pack 3642 INTRAVENOUS CANNULASize –18,20,22Packed in Blister pack 3643 JACKSON REES CIRCUIT 3644 K2 EDTA 2 ML TUBE MICRO SPRAY COATINGRUBBER STOPPER 3645 K2 EDTA 2 ML TUBE MICRO SPRAY COATINGSAFETY CAP 3646 K2 EDTA 2ML TUBE MICRO SPRAY COATING 3647 K3 EDTA 1 ML TUBE PEDIATRICS TUBERUBBER STOPPER 3648 K3 EDTA 2 ML TUBE MICRO SPRAY COATINGRUBBER STOPPER 3649 K3 EDTA 2 ML TUBE MICRO SPRAY COATINGSAFETY CAP 3650 K3 EDTA 2ML / 3ML TUBE MICRO SPRAY COATING 3651 K3 EDTA 3 ML TUBE MICRO SPRAY COATINGRUBBER STOPPER 3652 K3 EDTA 3 ML TUBE MICRO SPRAY COATINGSAFETY CAP 3653 KARMAN TYPE CANNULASize – 10mm 3654 KARMAN TYPE CANNULASize – 12mm 3655 KARMAN TYPE CANNULASize – 4mm 3656 KARMAN TYPE CANNULASize – 6mm 3657 KARMAN TYPE CANNULASize – 8mm 3658 KNEE ‘O’ DRAPE 3659 KNEE BRACE REGULARSize -L 3660 KNEE BRACE REGULARSize -M 3661 KNEE BRACE REGULARSize -S 3662 KNEE BRACE REGULARSize -XL 3663 KNEE BRACE REGULARSize –XXL 3664 KNEE CAP WITH OPEN PATELLA SINGLE PCSSize – L 3665 KNEE CAP WITH OPEN PATELLA SINGLE PCSSize – M 3666 KNEE CAP WITH OPEN PATELLA SINGLE PCSSize – S 3667 KNEE CAP WITH OPEN PATELLA SINGLE PCSSize – XL 3668 KNEE CAP WITH OPEN PATELLA SINGLE PCSSize –XXL 3669 KNEE CAP WITH RIGID HINGE Size – L 3670 KNEE CAP WITH RIGID HINGE Size – M 3671 KNEE CAP WITH RIGID HINGE Size – S 3672 KNEE CAP WITH RIGID HINGE Size – Size –XXL 3673 KNEE CAP WITH RIGID HINGE Size – XL 3674 KNEE CAP ( PAIR ) (BOX PACK)Size – L 3675 KNEE CAP ( PAIR ) (BOX PACK)Size – M 3676 KNEE CAP ( PAIR ) (BOX PACK)Size – S 3677 KNEE CAP ( PAIR ) (BOX PACK)Size – XL 3678 KNEE CAP ( PAIR ) (BOX PACK)Size – XXL 3679 KNEE IMMOBILIZER EXTRA LARGE - 22”Size – L 3680 KNEE IMMOBILIZER EXTRA LARGE - 22”Size – M 3681 KNEE IMMOBILIZER EXTRA LARGE - 22”Size – S 3682 KNEE IMMOBILIZER EXTRA LARGE - 22”Size – XL 3683 KNEE IMMOBILIZER EXTRA LARGE - 22”Size –XXL 3684 KNEE IMMOBILIZER LONG -19”Size – L 3685 KNEE IMMOBILIZER LONG -19”Size – M 3686 KNEE IMMOBILIZER LONG -19”Size – S 3687 KNEE IMMOBILIZER LONG -19”Size – XL 3688 KNEE IMMOBILIZER LONG -19”Size –XXL 3689 KNEE IMMOBILIZER SHORT - 14”Size – L 3690 KNEE IMMOBILIZER SHORT - 14”Size – M 3691 KNEE IMMOBILIZER SHORT - 14”Size – S 3692 KNEE IMMOBILIZER SHORT - 14”Size – XL 3693 KNEE IMMOBILIZER SHORT - 14”Size –XXL 3694 KNEE WRAP HINGED (NEOPRENE)Size – L 3695 KNEE WRAP HINGED (NEOPRENE)Size – M 3696 KNEE WRAP HINGED (NEOPRENE)Size – S 3697 KNEE WRAP HINGED (NEOPRENE)Size – XL 3698 KNEE WRAP HINGED (NEOPRENE)Size –2XL 3699 KNEE WRAP HINGED (NEOPRENE)Size –3XL 3700 L.S.BELT – PRESSURE PLATESize – 2XL 3701 L.S.BELT – PRESSURE PLATESize – 3XL 3702 L.S.BELT – PRESSURE PLATESize – L 3703 L.S.BELT – PRESSURE PLATESize – M 3704 L.S.BELT – PRESSURE PLATESize – S 3705 L.S.BELT – PRESSURE PLATESize – XL 3706 LARYNGEAL MASK AIRWAYSize: 1 3707 LARYNGEAL MASK AIRWAYSize: 1.5 3708 LARYNGEAL MASK AIRWAYSize: 2.5 3709 LARYNGEAL MASK AIRWAYSize: 3 3710 LARYNGEAL MASK AIRWAYSize: 4 3711 LEG TRACTION BRACESize – L 3712 LEG TRACTION BRACESize – M 3713 LEG TRACTION BRACESize – S 3714 LEG TRACTION BRACESize – XL 3715 LEVIN’S TUBE(Paper Pack)Size –10 3716 LEVIN’S TUBE(Paper Pack)Size –12 3717 LEVIN’S TUBE(Paper Pack)Size –14 3718 LEVIN’S TUBE(Paper Pack)Size –16 3719 LEVIN’S TUBE(Paper Pack)Size –18 3720 LEVIN’S TUBE(Paper Pack)Size –20 3721 LEVIN’S TUBE(Paper Pack)Size –22 3722 LEVIN’S TUBE(Paper Pack)Size –8 3723 LITHIUM HEPARIN 2 MLRUBBER STOPPER 3724 LITHIUM HEPARIN 2 MLSAFETY CAP 3725 LITHIUM HEPARINE 2ML MICRO SPRAY COATING 3726 LUMBO SACRAL BELT (BOX PACK)Size – 2XL 3727 LUMBO SACRAL BELT (BOX PACK)Size – 3XL 3728 LUMBO SACRAL BELT (BOX PACK)Size – L 3729 LUMBO SACRAL BELT (BOX PACK)Size – M 3730 LUMBO SACRAL BELT (BOX PACK)Size – S 3731 LUMBO SACRAL BELT (BOX PACK)Size – XL 3732 MALE EXTERNAL CATHETERSize - Ex-Large 3733 MALE EXTERNAL CATHETERSize - Large 3734 MALE EXTERNAL CATHETERSize - Medium 3735 MALE EXTERNAL CATHETERSize Small 3736 MALLET FINGER SPLINT(BOX PACK)Size – L 3737 MALLET FINGER SPLINT(BOX PACK)Size – S 3738 MATERNITY BELTSize - Universal 3739 MEASURED VOLUME SETcylindrical measured volume chamber of 110 ml. 42 mm Bulb Latex tubePacked in Paper Pack 3740 MEASURED VOLUME SETcylindrical measured volume chamber of 110 ml. 42 mm Bulb Latex tubePacked in Paper Pack 3741 MEASURED VOLUME SETCylindrical measured volume chamber of 110 ml. 50 mm Latex tube Packed in Paper Pack 3742 MEASURED VOLUME SETcylindrical measured volume chamber of 150 ml. 45 mm Bulb Latex tubePacked in Paper Pack 3743 MEASURED VOLUME SETcylindrical measured volume chamber of 150 ml. 45 mm Bulb Latex tubePacked in Paper Pack 3744 MICRO DRIP INFUSION SETMicro Drip Chamber 15 mm : 23’’G, Kink free Tube Dia.:2.80 mmMicro Drip Chamber 15 mm : 23’’G, Kink free Tube Dia.:2.80 mmLength 1500 mm 42 mm bulb 3745 MICRO DRIP WITH AIRVENT INFUSION SETVENTED Micro Drip Chamber 15 mm : 23’’G Needle, Kink free Tube Dia.:3.00 mm Length 1500 mm 45 mm bulb 3746 MICROPOROUS SURGICAL PAPER TAPESize – 2.50 cm x 9.1 mtr 3747 MICROPOROUS SURGICAL PAPER TAPESize – 5.00 cm x 9.1 mtr 3748 MICROPOROUS SURGICAL PAPER TAPESize – 7.50 cm x 9.1 mtr 3749 MICROPOROUS SURGICAL PAPER TAPESize –1.25 cm x 9.1 mtr 3750 MICROSCOPE SLIDE (PKT. OF 50 SLIDES ) 3751 MOUNT PCS(NEBULISER)Component 3752 N-95 FACE MASKWith valve 3753 N-95 FACE MASKWithout Valve 3754 NASAL CANULA[NASAL PRONG] (Poly Pack)Adult, Pediatric, neonatal 3755 NASAL CANULA[NASAL PRONG] (Poly Pack)Size- 10 Mtr Adult, Pediatric, neonatal 3756 NASAL CANULA[NASAL PRONG] (Poly Pack)Size- 2 Mtr Adult, Pediatric, neonatal 3757 NASAL CANULA[NASAL PRONG] (Poly Pack)Size- 22 Mtr Adult, Pediatric, neonatal 3758 NASAL CANULA[NASAL PRONG] (Poly Pack)Size- 5 Mtr Adult, Pediatric, neonatal 3759 NASOPHARYNGEAL AIRWAYSize: 6 3760 NASOPHARYNGEAL AIRWAYSize: 7 3761 NASOPHARYNGEAL AIRWAYSize: 8 3762 NEBULIZER KITAdult & Pediatric 3763 NEBULIZER WITH T PCS 3764 NELTON CATHETERSize: 8 FG To 24 FGPacked in Paper Pouch PackInner BoxCartoon 3765 NELTON CATHETERSize: 8 FG To 24 FGPacked in Paper Pouch PackPoly BagCartoon 3766 ORTHOPEDIC BANDAGESize – 10cm*3 meters 3767 ORTHOPEDIC BANDAGESize –15cm*3meters 3768 OXYZEN MASKAdult & Pediatric 3769 PEDIA URINE BAGCapacity - 100mlPoly BagBora Pack 3770 PELVIC BINDER(POLY PACK)Size – L 3771 PELVIC BINDER(POLY PACK)Size – M 3772 PELVIC BINDER(POLY PACK)Size – S 3773 PELVIC BINDER(POLY PACK)Size – XL 3774 PHILADELPHIA COLLAR( CERVICAL ORTHOSIS )Size – L 3775 PHILADELPHIA COLLAR( CERVICAL ORTHOSIS )Size – M 3776 PHILADELPHIA COLLAR( CERVICAL ORTHOSIS )Size – S 3777 PLAIN VENTILATOR CIRCUIT [PLAIN BREATHING SYSTEM](Poly Pack)Size- Adult & Pediatric 3778 PLASTER OFPARIS BANDAGE(POP)Size – 10cm*2.7 meters 3779 PLASTER OFPARIS BANDAGE(POP)Size –15cm*2.7meters 3780 REBREATHING BAG (RESERVIOR BAG)Size (ltr) –0.5 3781 REBREATHING BAG (RESERVIOR BAG)Size (ltr) –1.0 3782 REBREATHING BAG (RESERVIOR BAG)Size (ltr) –1.5 3783 REBREATHING BAG (RESERVIOR BAG)Size (ltr) –2 3784 RECTAL CATHETERSize – 10 3785 RECTAL CATHETERSize – 12 3786 RECTAL CATHETERSize – 14 3787 RECTAL CATHETERSize – 16 3788 RECTAL CATHETERSize – 18 3789 RECTAL CATHETERSize – 20 3790 RECTAL CATHETERSize – 22 3791 RECTAL CATHETERSize – 24 3792 RECTAL CATHETERSize – 26 3793 RECTAL CATHETERSize – 28 3794 RECTAL CATHETERSize – 30 3795 RECTAL CATHETERSize – 6 3796 RECTAL CATHETERSize – 8 3797 RIB BELT- REGULAR (BOX PACK)Size – Universal 3798 RIB BELT WITH PAD (BOX PACK)Size – 2XL 3799 RIB BELT WITH PAD (BOX PACK)Size – 3XL 3800 RIB BELT WITH PAD (BOX PACK)Size – L 3801 RIB BELT WITH PAD (BOX PACK)Size – M 3802 RIB BELT WITH PAD (BOX PACK)Size – S 3803 RIB BELT WITH PAD (BOX PACK)Size – XL 3804 ROLLER BANDAGESize –10cm x 3mtr10 Roll PacketPer Roll 3805 ROLLER BANDAGESize –10cm x 8 mtr10 Roll PacketPer Roll 3806 ROLLER BANDAGESize –15cm x 3mtr10 Roll PacketPer Roll 3807 ROLLER BANDAGESize –15cm x 8mtr10 Roll PacketPer Roll 3808 ROLLER BANDAGESize –5cm x 3mtr10 Roll PacketPer Roll 3809 ROLLER BANDAGESize –5cm x 8 mtr10 Roll PacketPer Roll 3810 ROLLER BANDAGESize –7.5cm x 3mtr10 Roll PacketPer Roll 3811 ROLLER BANDAGESize –7.5cm x 8 mtr10 Roll PacketPer Roll 3812 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 10 3813 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 12 3814 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 14 3815 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 16 3816 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 18 3817 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 20 3818 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 22 3819 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 24 3820 RYLE’S TUBE (Paper Pack)SizeSterile / Disposable – Size 8 3821 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 10 3822 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 12 3823 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 14 3824 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 16 3825 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 18 3826 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 20 3827 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 22 3828 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 24 3829 RYLE’S TUBE WITH CLOUSER (Paper Pack)Sterile / DisposableSize – 8 3830 SCALP VEIN SETSiliconized and thin walled high quality needle for a traumatic insertion.Packed in Poly Pouch 3831 SCALP VEIN SETSiliconized and thin walled high quality needle insertion for atraumatic.Packed in Blister pack 3832 SERUM 4 ML TUBERUBBER STOPPER 3833 SERUM 4 ML TUBESAFETY CAP 3834 SERUM 4ML TUBE 3835 SHOE COVERLD- Blue (Pair) 3836 SHOE COVERNon Woven (Pair) 3837 SHORT KNEE BRACESize – L 3838 SHORT KNEE BRACESize – M 3839 SHORT KNEE BRACESize – S 3840 SHORT KNEE BRACESize – XL 3841 SHOULDER IMMOBILIZER (BOX PACK)Size – L 3842 SHOULDER IMMOBILIZER (BOX PACK)Size – M 3843 SHOULDER IMMOBILIZER (BOX PACK)Size – S 3844 SHOULDER IMMOBILIZER (BOX PACK)Size – XL 3845 SINGLE BALL SPIROMETER 3846 SINGLE DIAL VENTURI MASKSize - Adult & Child 3847 SINGLE WATER TRAP VENTILATOR(Poly Pack) Adult 3848 SINGLE WATER TRAP VENTILATOR(Poly Pack) Child 3849 SKIN BLADE / RAZORStainless Steel Blade with platinum edge & TEFLON coated 3850 SKIN TRACTION KIT(POLY PACK) 3851 STOMACH TUBE(Paper Pack)Size –20 3852 STOMACH TUBE(Paper Pack)Size –22 3853 STOMACH TUBE(Paper Pack)Size –24 3854 STOMACH TUBE(Paper Pack)Size –26 3855 STOMACH TUBE(Paper Pack)Size –28 3856 STOMACH TUBE(Paper Pack)Size –30 3857 STOMACH TUBE(Paper Pack)Size –32 3858 STOOL CONTAINER50 ml 3859 STOOL CONTAINERSize- 30ml 3860 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-10 3861 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-12 3862 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-14 3863 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-16 3864 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-18 3865 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-20 3866 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-6 3867 SUCTION CATHETER WITH THUMB CONTROL(Paper Pack)Size FG-8 3868 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 10 3869 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 12 3870 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 14 3871 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 16 3872 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 18 3873 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 20 3874 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 22 3875 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 6 3876 SUCTION CATHETER(Paper Pack)Sterile / Disposable Size FG- 8 3877 SURGEONS GOWN (Nonwoven)40GSMPacked in Paper Pouch 3878 SURGICAL GLOVES LATEX: STERILE: 6 3879 SURGICAL GLOVES LATEX: STERILE: 6.5 3880 SURGICAL GLOVES LATEX: STERILE: 7 3881 SURGICAL GLOVES LATEX: STERILE: 7.5 3882 SURGICAL GLOVES LATEX: STERILE: 8 3883 SURGICAL GLOVES : LATEX: STERILE: POWDER FREE 3884 SURGICAL GOWN (Nonwoven)25GSMPacked in Paper Pouch 3885 SURGICAL GOWN (Nonwoven)45GSMPacked in Paper Pouch 3886 SURGICAL WRAPPED GOWNSize: XL 3887 T- OXYGENATOR WITH TUBING(Poly Pack) 3888 T PCS(NEBULISER)Component 3889 TENNIS ELBOW SUPPORTSize – L 3890 TENNIS ELBOW SUPPORTSize – M 3891 TENNIS ELBOW SUPPORTSize – S 3892 TENNIS ELBOW SUPPORTSize – XL 3893 THUMB SPICA SPLINTSize –Universal 3894 TOTAL HIP REPLACEMENT KITSKIN BLADE / RAZORStainless Steel Blade with platinum edge & TEFLON coated 3895 TOTAL KNEE REPLACEMENT KIT5 gowns, 5 helmet hood, 2 bed sheet,1 estimated drape, 1 bad sheet 48”*83” 3896 UMBILICAL CATHETERSize – 4 3897 UMBILICAL CATHETERSize – 5 3898 UMBILICAL CATHETERSize – 6 3899 UMBILICAL CATHETERSize – 7 3900 UMBILICAL CATHETERSize – 8 3901 UNIVERSAL SHOULDER IMMOBILIZER (BOX PACK)Size – Universal 3902 URETHRAL CATHETERSize 10K (91K) To 14K (90K)Packed in Paper Pouch Pack 3903 URETHRAL RED RUBBER CATHETERSize 12 FR To 24 FRPoly BagCartoon 3904 URINARY LEG BAG Capacity – 700 ml12 mic. Tube length – 10” PVC Non return Valve, outlet, Poly BagBora Pack 3905 URINE BAG WITH HANGERCapacity – 2000 ml15 mic. Tube length – 40” PVC Non return Valve, Top outlet, Plastic hangerPoly BagBora Pack 3906 URINE BAG WITH HANGERCapacity – 2000 ml17 mic. Tube length – 40” PVC Non return Valve, Top outlet, Plastic hangerPoly BagBora Pack 3907 URINE BAG WITH HANGERCapacity – 2000 ml12 mic. Tube length – 36” PVC Non return Valve, Top outlet, Plastic hangerPoly BagBora Pack 3908 URINE BAGCapacity – 1500 ml8 mic. Tube length – 28” PVC Non return Valve, Top outlet, Cotton threadPoly BagBora Pack 3909 URINE BAGCapacity – 2000 ml10 mic. Tube length – 32” PVC Non return Valve, Top outletPoly BagBora Pack 3910 URINE BAGCapacity – 2000 ml12 mic. Tube length – 36” PVC Non return Valve, Top outletPoly BagBora Pack 3911 URINE BAGCapacity – 2000 ml15 mic. Tube length – 40” PVC Non return Valve, Top outletPoly BagBora Pack 3912 URINE BAGCapacity – 2000 ml8 mic. Tube length – 28” PVC Non return Valve, Top outlet Plastic threadPoly BagBora Pack 3913 URINE CULTURE BOTTELE50 ml 3914 URINE CULTURE BOTTELESize- 30ml 3915 URINE POT(POLY PACK)Male /Female(Two in One)Cartoon 3916 UROMETERWith 250 ml measured volume meter por Measurement of urine output Capacity – 2000 mlPacked in Ribbon Bag PackPoly BagCartoon 3917 VENTURI MASK WITH 7 DUILTERS ADJUSTABLESize - Adult 3918 VENTURI MASK WITH 7 DUILTERS ADJUSTABLESize - Child 3919 VERICOSE VEIN STOCKINGSize – 2XL 3920 VERICOSE VEIN STOCKINGSize – 3XL 3921 VERICOSE VEIN STOCKINGSize – L 3922 VERICOSE VEIN STOCKINGSize – M 3923 VERICOSE VEIN STOCKINGSize – S 3924 VERICOSE VEIN STOCKINGSize – XL 3925 WALKING STICKSize – L 3926 WALKING STICKSize – M 3927 WALKING STICKSize – S 3928 WRIST & FORE ARM SPLINTSize –Universal 3929 WRIST SUPPORT WITH THUMBSize – Universal 3930 WRIST SUPPORTSize – L 3931 WRIST SUPPORTSize – M 3932 WRIST SUPPORTSize – S 3933 YANKEUR SUCTION SET CROWN TIP (RIBBON POLY PACK) 3934 YANKEUR SUCTION SET PLAIN TIP (RIBBON POLY PACK) 3935 ZIGZAG ABSORBENT COTTON WOOL I.P400 Gms 3936 ZIGZAG ABSORBENT COTTON WOOL I.P500 Gms 3937 ACETONE DETECTION KIT 3938 ACID PHOSPHATASE (Kinetic) 3939 ALBUMIN (BCG Method) (Liquistat) 3940 ALKALINE PHOSPHATASE (Liquistat) (pNPP)nKinetic 3941 ALKALINE PHOSPHATASE (Liquistat) (pNPP)nKinetic 3942 ALKALINE PHOSPHATASE (Liquistat) (pNPP)nKinetic 3943 ALKALINE PHOSPHATASE (Kinetic Auto)n405 nM with extended Stability 3944 ALKALINE PHOSPHATASE (Kinetic Auto)n405 nM with extended Stability 3945 ALKALINE PHOSPHATASE (Kinetic Auto)n405 nM with extended Stability 3946 AMMONIA ( UV Kinetic) (Liquistat) 3947 AMYLASE (CNPG3) (Liquistat) 3948 22% BOVINE SERUM ALBUMIN 3949 ANTI HUMAN GLOBULIN (Coombs) 3950 ANTI A1 LECTIN 3951 ASO TURBILATEX (Quantitative) 3952 BARIUM CHLORIDE 10% w/v 3953 BENEDICTS REAGENT (Qualitative) 3954 BENEDICTS REAGENT (Qualitative) 3955 BILIRUBIN (Liquistat) (DMSO Total & Direct Auto & Manual) 3956 BILIRUBINn(DMSO Total & Direct Auto & Manual) 3957 BIOCHEMISTRY CALIBRATOR (Liquistat) (with multi parameter assigned value) 3958 Neutral Detergent for Lab ware 3959 Neutral Detergent for Lab ware 3960 Microanatomy Spray Fixative 3961 Detergent, Deodorant 3962 Blood Grouping Regent Anti - A 3963 Blood Grouping Regent Anti - B 3964 Blood Grouping Regent Anti - D 3965 Blood Grouping Reagent COMBO (A + B + D) 3966 CALCIUM (o-CPC Auto & Manual)n(Liquistat) 3967 CALCIUM (o-CPC Auto & Manual)n(Liquistat) 3968 CALCIUM (ARSENEZO III) (Liquistat) 3969 CALCIUM (ARSENEZO III) (Liquistat) 3970 CANADA BALSAM (Cytology Mountant) 3971 CARBOL FUCHSIN (ZN Strong) 3972 CARBOL FUCHSIN (ZN Strong) 3973 URINE STRIP - G (Glucose) 3974 URINE STRIP - G (Glucose) 3975 URINE STRIP - AG (Albumin & Glucose) 3976 URINE STRIP - AG (Albumin & Glucose) 3977 URINE STRIP - AGpH (Alb, Glucose, pH) 3978 URINE STRIP - AGpH (Alb, Glucose, pH) 3979 URINE STRIP - KG (Ketone & Glucose) 3980 URINE STRIP - KG (Ketone & Glucose) 3981 URINE STRIP - 5P BLn(Alb, Glucose, pH , Ketone & Blood) 3982 URINE STRIP - 5P BLn(Alb, Glucose, pH , Ketone & Blood) 3983 URINE STRIP - 5P SG (Alb,nGlucose, pH , Ketone & SG) 3984 URINE STRIP - 5P SG (Alb,nGlucose, pH , Ketone & SG) 3985 CHLORIDE (Thiocynate) 3986 CHLORIDE (Thiocynate) 3987 CHOLESTEROL (CE-CO-PAP) (Liquistat) 3988 CHOLESTEROL (CE-CO-PAP) (Liquistat) 3989 CHOLESTEROL (CE-CO-PAP) (Liquistat) 3990 CHOLESTEROL (CE-CO-PAP) (Liquistat) 3991 CHOLESTEROL Totaln(Wybenga Manual with HDL ppt Reagent) 3992 CHOLINESTRASE (Kinetic) 3993 Pregnancy Card Test 3994 Pregnancy Strip Test 3995 CKMB (IFCC Kinetic) 3996 CKMB (IFCC Kinetic) 3997 CK NAC (IFCC) 3998 CK NAC (IFCC) 3999 CREATININE FK (Kinetic) (Liquistat) 4000 CREATININE FK (Kinetic) (Liquistat) 4001 CREATININE EP (Liquistat) (Manual End Point Jaffs) 4002 CRYSTAL VIOLET (Gention Violet) 4003 CRYSTAL VIOLET (Gention Violet) 4004 CRP TURBILATEX (Quantitative) 4005 CSF DILUTING FLUID 4006 CSF Protein (Liquistat)n(Auto & Manual - for Urine micro proteins) 4007 CYTOCHROM KIT With Buffer 2X (Modified Leishmans Stain) 4008 CYTOLOGY COLLECTION KIT 4009 DE COLOURISER FOR HEMATOXYLENE (1% HCL IN A.A.) 4010 DEMINERALISED WATER (Reagent Grade) 4011 DISTILLED WATER (Biochemistry Grade) 4012 DISTILLED WATER (Biochemistry Grade) 4013 DISTILLED WATER (Double) (Flame Photometry) 4014 DISTILLED WATER (Double) (Flame Photometry) 4015 Direct HDL (Liquistat) 4016 Direct LDL (Liquistat) 4017 DOUBLE OXALATE SOLUTION 4018 DPX MOUNTANT (Cytology Mountant) 4019 DRABKINS SOLUTION with Standard (For Hb) 4020 DRABKINS SOLUTION with Standard (For Hb) 4021 EASYFIX SPRAY (Blood Smear Fixative) 4022 EDTA 5% w/v 4023 EDTA 5% w/v 4024 EDTA K3 CONCENTRATEn(Dropping Bottle) 4025 EDTA K3 CONCENTRATEn(Dropping Bottle) 4026 Electrolyte (Na+,K+,Cl+) New (Liquistat) (Auto Colorimetric) 4027 EOSIN 2% (For Hematoxylin Stain) 4028 EOSIN 2% (For Hematoxylin Stain) 4029 EOSINOPHIL DILUTING FLUID 4030 FIELD STAIN - A 4031 FIELD STAIN - A 4032 FIELD STAIN - A 4033 FIELD STAIN - B 4034 FIELD STAIN - B 4035 FIELD STAIN - B 4036 FIELD STAIN A & Bn(Combined kit with EasyFix spray fixative) 4037 FLOW CELL CLEANER (Ready to use) 4038 FLUORIDE CONCENTRATEn(Dropping Bottle) 4039 FLUORIDE CONCENTRATEn(Dropping Bottle) 4040 FORMAL SALINE (FORnHISTOLOGY SAMPLE PRESERVATION) 4041 FLOURIDE SOLUTION (Pot.nOxalate 5%, Flouride 1%) 4042 FLOURIDE SOLUTION (Pot.nOxalate 5%, Flouride 1%) 4043 FOUCHET’S REAGENT 4044 Gamma GT (IFCC Kinetic) (Liquistat) 4045 GEIMSA STAIN KIT (WithnBuffer 10X & Easyfix Spray) 4046 GRAMS IODINE 4047 GRAMS IODINE 4048 GLUCOSE (GOD-POD) 4049 GLUCOSE (GOD-POD) 4050 GLUCOSE (GOD-POD) (Liquistat) 4051 GLUCOSE (GOD-POD) (Liquistat) 4052 GLYCERIN PURIFIED 4053 GOT (AST) Kinetic (Liquistat) 4054 GOT (AST) Kinetic (Liquistat) 4055 GOT (AST) Kinetic (Liquistat) 4056 GPT (ALT) Kinetic (Liquistat) 4057 GPT (ALT) Kinetic (Liquistat) 4058 GPT (ALT) Kinetic (Liquistat) 4059 GRAM’S STAIN KIT (Ready to Use) 4060 G-6PDh (Screening) 4061 G-6PDh (Quantitative, UV) Kinetic 4062 HAEMOGLOBIN STD (Cynmeth) 4063 HEAMOGLOBIN WITH STD. (Liquistat)(Fe-Cyan)n(Ready to use Drabkin’s Reagent with HB Std) 4064 HEAMOGLOBIN WITH STD. (Liquistat)(Fe-Cyan)n(Ready to use Drabkin’s Reagent with HB Std) 4065 HEAMTEST (For Occult Blood with Positive & Negative control) 4066 SUGARSTRIPS (Occult Blood Strips) 4067 HEMATOXYLENE (HARRIS) 4068 HEMATOXYLENE (HARRIS) 4069 HYDROCHLORIC ACID N/10 4070 HYDROCHLORIC ALCOHOL (For AAFB) 4071 IMMERSION OIL (Microscopy Grade) Dropping Bottle 4072 IMMERSION OIL (Microscopy Grade) Dropping Bottle 4073 IRON TIBC (FERROZIN) 4074 LDH (UV Kinetic) (Liquistat) 4075 LIPASE (Liquistat) 4076 LIPASE (Liquistat) 4077 LIQUID PARAFFIN 4078 LUGOL’S IODINE 4079 MAGNESIUM (Calmagite)(Liqui) 4080 METHYLENE BLUE 4081 METHYLENE BLUE 4082 MICRO PROTEIN (Pyrogallol Red) 4083 MICRO PROTEIN (Turbidometry) 4084 OPTICARE - Microscope Lens Cleaner 4085 PAPANICOLAOU EA -36 4086 PAPANICOLAOU EA -36 4087 PAPANICOLAOU EA- 65 4088 PAPANICOLAOU EA- 65 4089 PAPANICOLAOU OG - 6 4090 PAPANICOLAOU OG - 6 4091 PARAFFIN WAX 58°-60°C with cerecin 4092 PHOSPHORUS (End Point) New (Liquistat) 4093 PLATELET DILUTING FLUID 4094 POTASSIUM (STPB) (Liquistat) 4095 POT. OXALATE FLUORIDE (Concentrate) 4096 POT. OXALATE FLUORIDE (Concentrate) 4097 PROTEIN (BIURET) (Liquistat) 4098 RAPID AFB STAIN KIT (Cold Method)) 4099 RAPID BILE PIGMENT REAGENT 4100 RAPID DENGUE (Card) NS1 4101 RAPID DENGUE(IgG/IgM and NS1 (Card) Combo 4102 RAPID FRUCTOSE KIT (WithnPositive Control) 4103 RAPID H & E STAIN KIT (ONLYn03 minute H & E staining Kit) 4104 RAPID HBsAg (CARD) 4105 Rapid HIV 1 & 2 (CARD) 4106 Rapid HCV (CARD) 4107 Rapid HCV (CARD) 4108 RAPID SICKLE CELL HbS New (Solubility Test) (Liquistat) with Accessories 4109 RAPID THALASSEMIA (Nestroff Reagent) 4110 RAPID MALARIA PF / PV (Card Test) 4111 RAPID MALARIA STAIN KIT (JSB I & II) (Onenminute stain for blood Parasite) 4112 RAPID MP STAIN KITn(One minute stain for blood Parasite) 4113 RAPID-PAP STAIN KITn(A3 Minute PAP Staining Kit) 4114 RAPID-PAP Cytoplasm Stain - A 4115 RAPID-PAP Cytoplasm Stain - B 4116 RAPID-PAP DEHYDRANT 4117 RAPID-PAP Nuclear Stain 4118 RAPID ASO (Latex Slide Test) 4119 RAPID ASO (Latex Slide Test) 4120 RAPID ASO (Latex Slide Test) 4121 RAPID CRP (Latex Slide Test) 4122 RAPID CRP (Latex Slide Test) 4123 RAPID CRP (Latex Slide Test) 4124 RAPID RA (Latex Slide Test) 4125 RAPID RA (Latex Slide Test) 4126 RAPID RA (Latex Slide Test) 4127 RAPID WIDAL (O, H, AH, BH) Slide Test 4128 RAPID WIDAL (O, & H) Slide Test 4129 RBC DILUTING FLUID 4130 RETICULOCYTE COUNTING REAGENT 4131 RETICVIEW (With Counter Stain & Buffer) 4132 RF TURBILATEX (Rheumtoid Factor) Quantitative 4133 R.P.R. (VDRL Test) (Ready to use slide Test) 4134 R.P.R. (VDRL Test) (Ready to use slide Test) 4135 R.P.R. (VDRL Test) (Ready to use slide Test) 4136 SAFRANINE 0.5% w/v (Grams) 4137 SAFRANINE 0.5% w/v (Grams) 4138 SANEAT LIQUID SOAPn(Phosphate Free) (Extra Powder & Fragnance) with Dispenser 4139 SANEAT LIQUID SOAPn(Phosphate Free) (Extra Powder & Fragnance) with Dispenser 4140 SANEAT LIQUID SOAPn(Phosphate Free) (Extra Powder & Fragnance) with Dispenser 4141 SCOTT’S TAP WATER SUBSTITUTE 4142 SEMEN DILUTING FLUID 4143 SODIUM (Phosphonazo III) New (Liquistat) 4144 SODIUM CITRATE 3.2% w/v 4145 SODIUM CITRATE 3.8% w/v 4146 SODIUM HYPOCHLORITEn(4% available chlorine) 4147 SODIUM HYPOCHLORITEn(4% available chlorine) 4148 SODIUM POTTASSIUM STD 120/2n(For Flame Photometer 140/4n(Ready to use) 160/6 4149 SODIUM POTTASSIUM STD 120/2n(For Flame Photometer 140/4n(Ready to use) 160/6 4150 SODIUM POTTASSIUM STD 120/2n(For Flame Photometer 140/4n(Ready to use) 160/6 4151 SOD / POT / CHLO (Liquistat) (U. Acetate, STPB, Thiocynate) 4152 SGOT (Manual DNPH) 4153 SGPT (Manual DNPH) 4154 SULPHURIC ACID 20% 4155 SULPHOSALICYLIC ACID 3% w/v 4156 SULPHOSALICYLIC ACID 30 % w/v 4157 SULPHOSALICYLIC ACID 30 % w/v 4158 SYPHILIS (Strip) 4159 SYPHILIS (Card) 4160 TOTAL PROTEIN & ALBUMIN (Biuret &nBCG ) (Liquistat) 4161 TRIGLYCERIDES (Enz. End Point) (Liquistat) 4162 TRIGLYCERIDES (Enz. End Point) (Liquistat) 4163 TRIGLYCERIDES (Enz. End Point) (Liquistat) 4164 TRIGLYCERIDES (Enz. End Point) (Liquistat) 4165 URIC ACID (End Point) (Liquistat) 4166 URIC ACID (End Point) (Liquistat) 4167 URIC ACID (End Point) (Liquistat) 4168 URIC ACID (End Point) (Liquistat) 4169 UREA DAM (with extended linearity) 4170 UREA (GLDH) (Liquistat) 4171 UREA (GLDH) (Liquistat) 4172 UREA (GLDH) (Liquistat) 4173 UREA H. P. (Berthelot) 4174 UREA H. P. (Berthelot) 4175 UREA (NED) (Liquistat) 4176 URINE BILE PIGMENT KIT New 4177 UNIVERSAL CLEANERn(Compatible with All 3 Parts 18-23 Parameter Hematology counter) 4178 UNIVERSAL DILUENT (Compatible with All 3 Parts 18-23 Parameter Hematologyncounter) 4179 UNIVERSAL WASHn(Compatible with All 3 Parts 18-23 Parameter Hematology counter) 4180 WBC DILUTING FLUID 4181 WRIGHT’S STAIN WITH BUFFER (GoldnStandard) 4182 TRUSTEEL 4X45CM (MULTISTRAND) BOX OF 48 SUTURES, Size 4, 45CM, 1/2 CIRCLE CONVENTIONAL CUTTING 48mm 4183 TRUSTEEL 4X45CM (MULTISTRAND) BOX OF 48 SUTURES, Size 5, 45CM, 1/2 CIRCLE CONVENTIONAL CUTTING 48mm 4184 TRUSTEEL 2X45CM (MULTISTRAND) BOX OF 24 SUTURES, Size 6, 45CM, 1/2 CIRCLE CONVENTIONAL CUTTING 48mm 4185 BLACK BRAIDED SILK 2-0, 6 REELS X 25 MTRS 4186 BLACK BRAIDED SILK 3-0, 6 REELS X 25 MTRS 4187 BLACK BRAIDED SILK 0, 6 REELS X 25 MTRS 4188 BLACK BRAIDED SILK 3-0, 6 REELS X 25 MTRS 4189 BLACK BRAIDED SILK 3-0, 76Cms, 3/8 CIRCLE RC 26mm 4190 BLACK BRAIDED SILK 3-0, 76Cms, 1/2 CIRCLE RB 20mm 4191 BLACK BRAIDED SILK 2-0, 76Cms, 1/2 CIRCLE RB 30mm 4192 BLACK BRAIDED SILK 3-0, 76Cms, 1/2 CIRCLE RB 20mm 4193 BLACK BRAIDED SILK 4-0, 76Cms, 1/2 CIRCLE RB 20mm 4194 CATGUT CHROMIC 2-0, 152Cms 4195 CATGUT CHROMIC 0, 76Cms, 1/2 CIRCLE RB 30mm 4196 CATGUT CHROMIC 1, 76Cms, 1/2 CIRCLE RB, HEAVY 40mm 4197 CATGUT CHROMIC 2-0, 76Cms, 3/8 CIRCLE RB 30mm 4198 CATGUT CHROMIC 0, 152Cms 4199 CATGUT CHROMIC 0, 76Cms, 1/2 CIRCLE RB 40mm 4200 CATGUT CHROMIC 0, 76Cms, 1/2 CIRCLE RB 45mm 4201 CATGUT CHROMIC 5-0, 76Cms, 3/8 CIRCLE RC 12mm 4202 CATGUT CHROMIC 1, 76Cms, 1/2 CIRCLE RB, HEAVY 40mm 4203 CATGUT CHROMIC 1, 100Cms, 1/2 CIRCLE RB 45mm,MAYO 4204 CATGUT CHROMIC 3-0, 76Cms, 1/2 CIRCLE RB 20mm 4205 CATGUT CHROMIC 2-0, 76Cms, 1/2 CIRCLE RB 30mm 4206 CATGUT CHROMIC 1, 76Cms, 1/2 CIRCLE RB, HEAVY 40mm 4207 CATGUT CHROMIC 0, 76Cms, 1/2 CIRCLE RB 30mm 4208 CATGUT CHROMIC 2-0, 76Cms, 1/2 CIRCLE RB 30mm 4209 CATGUT CHROMIC 0, 76Cms, 1/2 CIRCLE RB 40mm 4210 CATGUT CHROMIC 2-0, 76Cms, STRAIGHT RB 60mm 4211 TRULON BLACK 0, 70Cms, 3/8 CIRCLE RC 45mm 4212 TRULON BLACK 2-0, 70Cms, 3/8 CIRCLE RC 45mm 4213 TRULON BLACK 4-0, 70Cms, 3/8 CIRCLE RC 16mm 4214 POLYESTER,GREEN 2-0, 90Cms, 1/2 CIRCLE TC DA 17mm 4215 POLYESTER WHITE 2-0, 90Cms, 1/2 CIRCLE TC DA 17mm 4216 TRUSYNTH VIOLET 0, 90Cms, 1/2 CIRCLE RB 30mm 4217 TRUSYNTH 1, 90Cms, 1/2 CIRCLE RB 40mm HEAVY 4218 MONOGLYDE UNDYED 3-0, 70Cms, 1/2 CIRCLE RB 26mm 4219 TRUGLYDE VIOLET 3-0, 70Cms, 1/2 CIRCLE RB 20mm 4220 TRUGLYDE VIOLET 2-0, 90Cms, 1/2 CIRCLE RB 40mm 4221 HARNIA MESH SIZE 15CM X 15CM 4222 HARNIA MESH SIZE 7.6CM X 15CM 4223 Polypropylene 1/2 Circle RB D Needle 16mm, Size 5-0, 70cms 4224 POLY PROPYLENE CD ROUND BODY NEEDLE 16MM SIZE 5-0,70CM 4225 TRULENE BLUE 1, 70Cms, 1/2 CIRCLE RB ,HEAVY 30mm 4226 TRULENE BLUE 3-0, 70Cms, 1/2 CIRCLE RB 25mm 4227 TRULENE BLUE 0, 70Cms, 1/2 CIRCLE RB 30mm 4228 TRULENE BLUE 2-0, 70Cms, 1/2 CIRCLE RB 30mm 4229 TRULENE BLUE 0, 70Cms, 1/2 CIRCLE RB 30mm 4230 TRULENE BLUE 2-0, 70Cms, 1/2 CIRCLE RB 30mm 4231 TRULENE BLUE 0, 70Cms, 1/2 CIRCLE HEAVY RB 40mm 4232 TRULENE BLUE 1, 70Cms, 1/2 CIRCLE RB,HEAVY 40mm 4233 TRULENE BLUE SIZE 1, LENGTH 90Cms, 1/2 CIRCLE RB HEAVY NEEDLE 45mm 4234 TRULENE BLUE 4-0, 70Cms, 1/2 CIRCLE RB 16mm 4235 TRULENE BLUE 0, 70Cms, 1/2 CIRCLE RB 30mm 4236 HARNIA MESH SIZE 7.6CM X 15CM 4237 Acyclovir Lyphollized 250mg 4238 Ampicillin & Sulbactam 1.5GM 4239 Artesunate 60mg 4240 Artesunate 120mg 4241 Artemether 80mg 4242 Atacurium 25mg/2.5ml 4243 Atacurium 50mg/5ml 4244 Aztreonam 250mg 4245 Aztreonam 500mg 4246 Aztreonam 1gm 4247 Aztreonam 2gm 4248 Amrinone 100mg/20ml 4249 Aprotinin 10000 KIU 4250 Aprotinin 50000 KIU 4251 Azithromycin 500mg 4252 Azithromycin 1 gm 4253 B-Complex Vial 10 ML 4254 Ceftriaxone 2000mg 4255 Ceftriaxone & Sulbactam 375 mg 4256 Ceftriaxone & Sulbactam 750 mg 4257 Ceftriaxone & Sulbactam 1.5gm 4258 Ceftriaxone 125mg + Tazobactum 15.6 mg 4259 Ceftriaxone 250mg + Tazobactum 31.25mg 4260 Ceftriaxone 500mg+ Tazobactum 62.5mg 4261 Ceftriaxone 1000mg+ Tazobactum 125mg 4262 Cefipime 500mg 4263 Cefipime 1gm 4264 Cefepime + Sulbactum 375mg 4265 Cefepime + Sulbactum 750mg 4266 Cefepime + Sulbactum 1.5gm 4267 Cefepime 125mg + Tazobactum 15.6 mg 4268 Cefepime 250mg + Tazobactum 31.25mg 4269 Cefepime 500mg+ Tazobactum 62.5mg 4270 Cefepime1000mg+ Tazobactum 125mg 4271 Cefipirome 1gm 4272 Cefoperazone 250mg 4273 Cefoperazone 500mg 4274 Cefoperazone 1gm 4275 Cefoperazone 2gm 4276 Cefoperazone 3gm 4277 Cefoperazone & Sulbactam 500mg 4278 Cefoperazone & Sulbactam 1.5gm 4279 Cefoperazone & Sulbactam 1gm 4280 Cefoperazone & Sulbactam 2gm 4281 Cefoperazone & Sulbactam 3gm 4282 Cefoperazone 250 & tazobactum15.6 mg 4283 Cefoperazone 500 & tazobactum62.5 mg 4284 Cefoperazone 1000 & tazobactum125 mg 4285 Cefotaxime-250mg 4286 Cefotaxime-500 Mg 4287 Cefotaxime 1gm 4288 Cefotaxime & Sulbactam 375 mg 4289 Cefotaxime & Sulbactam 750 mg 4290 Cefotaxime & Sulbactam 1.5gm 4291 Ceftazidime 250mg 4292 Ceftazidime 500 mg 4293 Ceftazidime 1000mg 4294 Ceftazidime 2gm 4295 Ceftazidime + Sulbactum 375mg 4296 Ceftazidime + Sulbactum 750mg 4297 Ceftazidime + Sulbactum 1.5gm 4298 Ceftazidime125mg +Tazobactum 15.6mg 4299 Ceftazidime 250mg +Tazobactum 31.25mg 4300 Ceftazidime 500mg +Tazobactum 62.5mg 4301 Ceftazidime 1000mg +Tazobactum 125mg 4302 Ceftizoxime 250mg 4303 Ceftizoxime 1gm 4304 Cefuroxime Sodium 750 mg 4305 Cefuroxime Sodium 500mg 4306 Cefuroxime 1.5gm 4307 Caspofungin Acetate 50mg 4308 Caspofungin Acetate 70mg 4309 Carboprost 125mcg 4310 Carboprost 250mcg 4311 Clindamycin 600mg 4312 Clindamycin 300mg 4313 colistimethate 1 MIU 4314 colistimethate 2 MIU 4315 colistimethate 3 MIU 4316 colistimethate 4.5 MIU 4317 colistimethate 5 MIU 4318 Chloramphenicol Succinate 1g. 4319 Chloroquin Phosphate 5ml 4320 Chloroquin Phosphate 30ml 4321 Cyclopentolate 5ml inj 4322 Citicholine 250mg/ml- 2ml 4323 Citicholine 250mg/ml-4ml 4324 clarithromycin 500 mg 4325 Dexamethasone 4mg/ml- 2ml 4326 Dexamethasone 10ml 4327 Dexamethasone 20ml 4328 Dexamethasone 30ml 4329 Diclofenac 25mg/ml- 3ml (Blister) 4330 Diclofenac 75mg/1ml Aqueos base 4331 Dopamine Inj 200mg/5ml 4332 Drotaverine 40mg/2ml 4333 Dobutamine Hydrochloride 250mg lyophlized 4334 Dobutamine Hydrochloride 250mg/5ml liquid 4335 Doripenem 250 mg 4336 Doripenem 500 mg 4337 Doripenem 1 gm 4338 Esmolol 100mg/10ml 4339 Esomeprazole 40mg 4340 Ethamsylate 250mg/2ml 4341 Ertapenem 500mg Lypholized 4342 Ertapenem 1gm Lypholized 4343 Frusemide 20mg/ml 4344 FSH 75IU 4345 FSH 150IU 4346 Fluphenazine Decanoate 25mg 4347 Glycopyrolate 0.2ml /1ml 4348 Gentamycin 10ml 4349 Gentamycin 20 ml 4350 Gentamycin 30ml 4351 Gentamycin 80mg/2ml 4352 Heparin 25000IU 4353 Heparin 5000IU 4354 Heparin 10IU 2ml 4355 Human Chorinic Gonodropin 2000 4356 Human Chorinic Gonodropin 5000 4357 Human Chorinic Gonodropin 10000 4358 HMG 75IU 4359 HMG 150IU 4360 Hydroxy Progesterone -250 Combipack 4361 Hydroxy Progesterone -500 Combipack 4362 Hydrochortisone 100mg 4363 Imipenum 250mg + Cilastatin 250mg 4364 Imipenum 500mg + Cilastatin 500mg 4365 Imipenum 1 gm + Cilastatin 1 gm 4366 Indomethacin 1mg/ml 4367 Iron Sucrose Inj 50mg/2.5ml ( with tray) 4368 Iron Sucrose Inj 100mg/5ml (with tray) 4369 Iron Sorbitol 75mg/1.5ml 4370 Isoxusprine 2ml 4371 Ketorolac 30mg 4372 Levrtiracetam 100 mg/ml-5ml 4373 Lignocane 21.3mg + Adrine 0.0005mg- 30ml 4374 Lignocaine 2% 2ml 4375 Lignocane 2% 30ml 4376 Lincomycin 1ml (300mg) 4377 Lincomycin 2ml (600mg) 4378 Labetalol 5mg/20mg 4379 Labetalol 100mg /20ml 4380 L-ornithine L-aspartate 5mg/10ml 4381 M.V.I. 10ml 4382 B1+B6+B12/ (Neurorubine 3mlvial ) 4383 B1+B6+B12/ (Neurorubine 10ml Vial) 4384 Multivitamin inj 4385 Medroxyprogesterone 150mg/1ml 4386 Meropenem 125mg 4387 Meropenem 250mg 4388 Meropenam 500 mg 4389 Meropenam 1gm 4390 Meropenam 2gm 4391 Meropenem+sulbactum 1.5gm 4392 Milirinone acetate 10ml 4393 Metachloropropramide 5mg/ml-10ml 4394 Metochroparamide 5mg/ ml-2ml 4395 Methyl Predinisolone Sccinate 125mg 4396 Methyl Predinisolone Succinate 500mg 4397 Methyl Predinisolone Succinate 40mg 4398 Methyl Predinisolen Succinate 1gm 4399 Methyl Predinisole Accetate 40mg/ml 4400 Methyl Predinisole Accetate 80mg/2ml 4401 Methylcobalamin 500mcg 4402 Methylcobalamin 1000mcg 4403 Methylcobalamin 1500mcg 4404 Methylcobalamin 2500mcg 4405 Neostagmine 0.5mg/ 1ml 4406 Neostagmine 2.5 mg /ml 4407 Neostagmine 25mg/ 5ml 4408 Noradernaline 4mg/2ml 4409 Natural Progesterone 50mg 4410 Natural Progesterone 100mg 4411 Natural Progesterone 200mg 4412 Nandrolone Deconate 25mg 4413 Nandrolone Deconate 50mg 4414 Nedrone Deconate 100mg 4415 Netilmycin SULPHATE 100mg/ml 4416 Netilmycin SULPHATE 200mg/2ml 4417 Netilmycin SULPHATE 300mg/3ml 4418 N-Acetyl Cysteine 200mg/ml 4419 N-Acetyl Cysteine 200mg/ml 4420 Nimodipine 30mg/50ml 4421 Nimodipine 0.2mg/50ml 4422 Nitroglycerine 5mg/ml- 5ml 4423 Nitroglycerine 5mg/ml-10ml 4424 Omeprazole 40mg 4425 Oxytocin 5iu inj 4426 Oxytocin 10iu inj 4427 Ondansetron 2mg/ml 4428 Ondansetron 2mg/ml 4429 Protamine Sulphate 50mg/5ml amp 4430 Pantoprazole 40mg 4431 Paracetamol 150mg/ml 4432 Paracetamol 150mg/ml 4433 Piperacillin & Tazobactum 1.125gm 4434 Piperacillin & Tazobactum 2.25gm 4435 Piperacillin & Tazobactum 4.5gm 4436 Piroxicam 20mg /2ml 4437 Promethazine 25mg/ml 4438 Piracetam 200mg/ml-15ml vial 4439 Piracetam 200mg/ml-15ml amp 4440 Piracetam 200mg/ml -60ml Vial 4441 Pilocarpine Nitrate I.P.0.5% (without preservatives ) Inj 1 ml 4442 Pancuronium Bromide 2mg/ml 4443 Potassium Chloride 0.1% 4444 Polymixin B Sulphate 5lac IU 4445 Rabeprazole 20mg Sodium(Lyhpholized)cake 4446 Ranitidine Inj 25mg/ml 4447 Somatostatin 3mg 4448 Streptokinase 7.5lacs IU 4449 Streptokinase 15lacsIU 4450 Somatrophin 4iu 4451 Somatrophin 10iu 4452 Somatrophin 12iu 4453 Somatrophin 16iu 4454 Somatrophin 36iu 4455 Succinyl Choline Chloride 100mg/2ml vial 4456 Succinyl Choline Chloride 500mg/10ml vial 4457 Succinyl Choline Chloride 50mg/2ml vial 4458 Ticarcillin 3 gm +clav 100 mg (3.1 gm) 4459 Terlipressin 1mg/10ml 4460 Teicoplanin 200mg 4461 Teicoplanin 400mg 4462 Tigecycline 50mg 4463 Testosterne Enanthate 250mg 4464 Testosterne Propionate 100mg 4465 Thiopentone 500mg 4466 Thiopentone 1gm 4467 Tobramycin 20mg 4468 Tobramycin 40mg 4469 Tobramycin 60mg 4470 Tobramycin 80mg 4471 Tramadol (50 mg ) 1 ml 4472 Tramadol (50 mg ) 2 ml 4473 Tranexamic Acid 100mg/ml 4474 Triamcinolone 10mg 4475 Triamcinolone 40mg 4476 Urokinase 500000IU 4477 Urokinase 750000IU 4478 Urokinase 100000IU 4479 Valethamat Bromide 8mg/ml (Epidosin) 4480 Vecuronium Bromide 4mg 4481 Vecuronium Bromide 10mg 4482 Vancomycin 500mg 4483 Vancomycin 1gm 4484 Verapamil 2.5mg/ml 4485 Vitamin B.complex 4ml vial 4486 Vitamin C 250mg/ml 4487 Voriconazole 200mg 4488 Benzathine Pencillien 1.2MIU 4489 Ceftriaxone 1gm+ Vancomycin 500mg inj 4490 Amikacin +vancomycin inj 4491 Ampicillin 1gm & Sulbactam 500mg 4492 Vitamin K Phytomenadione 1mg inj 4493 Vitamin K Phytomenadione 10mg inj 4494 DAPTOMYCIN 350 MG 4495 DAPTOMYCIN 500 MG 4496 MICAFUNGIN 50 MG. 4497 MICAFUNGIN 50 MG. 4498 ANIDULAFUNGIN 100 MG 4499 Amifostine 500mg 4500 Bleomycin 15 units 4501 Bevacuzimab 25mg/ 16ml 4502 Bevacuzimab 25mg/4ml 4503 Cyclosporin 1ml 4504 Cyclosporin 5ml 4505 Carboplatin 150 mg 4506 Carboplatin 450 mg 4507 Carboplatin 600 mg 4508 Cisplatin 10 mg 4509 Cisplatin 50 mg 4510 Cyclophosphamide 200mg Inj 4511 Cyclophosphamide 500mg Inj 4512 Cyclophosphamide 1000mg Inj 4513 Cytarabine 100mg 4514 Cytarabine 500mg 4515 Cytarabine 1000mg 4516 Dacarbazine 100mg 4517 Dacarbazine 200mg 4518 Dacarbazine 500mg 4519 Dacarbazine 1000mg 4520 Doxorubicin 10 mg Liquid 4521 Doxorubicin 50 mg Liquid 4522 Doxorubicin 10 mg Lyoph 4523 Doxorubicin 50 mg Lyoph 4524 Docetaxel 20 mg 4525 Docetaxel 80 mg 4526 Docetaxel 120 mg 4527 Dactinomycin 500mcg 4528 Daunorubicin 20mg 4529 Epirubicin 10 mg Lyoph 4530 Epirubicin 50 mg Lyoph 4531 Epirubicin 100 mg Lyoph 4532 Etoposide 100mg/ 5 ml 4533 Filgrastim 75mg 4534 Filgrastim 150mcg 4535 Filgrastim 300mcg 4536 Fludarabine 50mg 4537 5-Flouracil 250mg/5ml 4538 5-Flouracil 500mg/10ml 4539 Granisetron 1ml 4540 Granisetron 3ml 4541 Gemcitabine 200mg Lyoph 4542 Gemcitabine 1gm Lyoph 4543 Irinotecan 40mg/2ml 4544 Irinotecan 100mg/5ml 4545 Ifosfamide 1000mg + Mesna 200mg 4546 Ifosfamide 2000mg +Mesna 400mg 4547 Leucovorin Calcium 3mg/ml 4548 Leucovorin Calcium 15mg/2ml 4549 Leucovorin Calcium 50mg/5ml 4550 L-asparaginase 5000i.u 4551 L-asparaginase 10000 i.u 4552 Leuprolide 2.25mg 4553 Leuprolide1mg 4554 Leuprolide 4mg 4555 Leuprolide depot 3.75mg 4556 Leuprolide depot 11.25mg 4557 Methotrexate 15MG/3ML 4558 Methotrexate 50mg 4559 Methotrexate 100mg 4560 Methotrexate 250MG/10ML 4561 Methotrexate 500MG/20ML 4562 Methotrexate 1 GM 4563 Mesna 200 mg 4564 Mesna 400 mg 4565 Mitomycin 2mg 4566 Mitomycin 10mg 4567 Mitomycin 40mg 4568 Octreotide Inj. 50mg 4569 Octreotide Inj. 100mg 4570 Octreotide Inj. 200mg 4571 Oxaliplatin 50 mg Lyophlized 4572 Oxaliplatin 100 mg Lyophlized 4573 Oxaliplatin 50mg Liquid 4574 Oxaliplatin 100mg Liquid 4575 Paclitaxel 30 mg 4576 Paclitaxel 100 mg 4577 Paclitaxel 260 mg 4578 Paclitaxel 300 mg 4579 Pamidronate 30mg 4580 Pamidronate 60mg 4581 Pamidronate 90mg 4582 Pemetrexate 100mg 4583 Pemetrexate 500mg inj 4584 Rituximab 10mg/10ml 4585 Rituximab 10mg/50ml 4586 Topotecan 2.5mg/2.5ml 4587 Topotecan 4mg/4ml 4588 Vincristine 1 mg 4589 Vincristine 2mg 4590 Vinorelbine 10mg/1ml 4591 Vinorelbine 20mg 4592 Vinorelbine 50mg/5ml 4593 Vinblastine 10mg/10ml 4594 Zoledronic Acid 4 mg Vial 4595 Enoxaparine Sodium 20mg 4596 Enoxaparine Sodium 40mg 4597 Enoxaparine Sodium 60mg 4598 Enoxaparine Sodium 80mg 4599 Erithopoeitin 2000 4600 Erithopoeitin 4000 4601 Erithopoeitin 10000 4602 Erithopoeitin 20000 4603 Erithopoeitin 40000 4604 Deltaparin 2500IU 4605 Deltaparin 5000IU 4606 Vasopressin 20IU 4607 Sodium hyaluronate 15mg/1ml (Arthritis Application) 4608 Sodium hyaluronate15mg/2ml (Arthritis Application) 4609 Sodium hyaluronate10mg/ 0.4ml PFS 4610 Sodium hyaluronate 0.55ml 4611 Sodium hyaluronate 20mg/2ml PFS 4612 Testostrone gel 1% 4613 Amphoetricin -B 50mg 4614 Amphoetricin -B 100mg 4615 Posaconazole 40 mg ml 4616 Voriconazole 200mg 4617 Immune Globulin IV (Humen)-ifas 10% 4618 Posaconazole 100 mg Tablet 4619 Isavuconazole 200 mg inj 4620 Caspofungin Acetate Inj 50 mg
Contract Date: Jan 01, 2022 Contract Value : 1
Statutory Bodies & Commissions/Committees No of Bidders 11
Madhya Pradesh View Result →
22.
Health and Family Welfare #891826 AOC
Supply Of Medicine , Material And Miscellaneous-2 Esflurane 240 Ml In Aluminum Container 3 5-Fluorouracil ( 5-Fu ) ( 250Mg ) , Injection 4 5-Fluorouracil ( 5-Fu ) ( 500Mg Inj ) , Injection 5 Acamprosate ( 333 Mg ) , Tablet 6 Acarbose ( 25 Mg ) , Tablet 7 Acarbose Tab 50Mg 8 Aceborophylline 100 Mg Cap 9 Aceclofenac 100Mg+Paracetamol 325Mg+Chlorzoxazone 250Mg Tab ( 250Mg ) , Tablet 10 Aceclofenac 10 X 10 Mg Tab ( 10 X 10 ) , Tablet 11 Aceclofenac 100Mg+Paracetamol 325Mg Tab ( ) , Tablet 12 Aceclofenac 100Mg+Paracetamol 500Mg Tab 13 Aceclofenac ( 100Mg ) , Tablet 14 Aceclofenac + Paracetamol + Chlorzoxazone 100 Mg + 500 Mg + 500 Mg Tab 15 Acenocoumarol Tab I.P. 2 Mg 16 Acetazolamide Tab ( 250Mg ) , Tablet 17 Aciclovir Cream 5% ( 5G Tube ) 18 Aciclovir Ointment 3% ( 5Gm Tube ) 19 Actinomycin-D ( 0.5Mg Vial ) , Vial 20 Acyclovir ( 800Mg ) , Tablet 21 Acyclovir Inj 250 Mg / Vial 22 Acyclovir Inj 500Mg / Vial 23 Acyclovir Intervenous Infusion I.P 500Mg / Vial 24 Acyclovir Suspension 400Mg / 5Ml ( 100 Ml Bottle ) , Suspension 25 Acyclovir Tab 400 Mg ( 400 Mg ) , Tablet 26 Acyclovir Tab. Ip - 200Mg 27 Adenosine Inj 6 Mg / 2Ml ( 2Ml Amp ) 28 Adrenaline ( 1 Mg / Ml ( 1 Ml Amp ) ) , Injection 29 Adrenochrome Monosemicarbazone ( 0.75Mg / Ml ( 2 Ml Amp ) ) , Injection 30 Aggs ( Anti Gas Gangrene Serum ) - 10, 000 Iu / Ml 31 Aggs ( Anti Gas Gangrene Serum ) 40000 Iu / Ml 32 Aggs ( Anti Gas Gangrene Serum ) L / 30000 Ou / Ml Inj. 33 Biotene Tablet 100Mg 34 Agomelatine 25 Mg Tab 35 Albendazole 100 Mg Tab 36 Albendazole Suspension - 200Mg / 5Ml ( 10 Ml Bottle ) , Syrup 37 Albendazole Tab ( 200 Mg ) , Tablet 38 Albendazole Tablets Ip - 400Mg 39 Alfacalcidiol Capsule ( 0.25 Mcg ) , Capsule 40 Alkaline Citrate With K Oral Solution Each 10 Ml Contains Sodium Citric 1 Gram Potassium Citrate 0.65 Gram Citric Acid 1 Gram Syrup 41 Allopurinol 100 Mg Tab 42 Alpha-Beta Arteether ( 150Mg / 2Ml ) , Injection 43 Alpha-Beta Arteether Inj 75 Mg / 2 Ml 44 Alpha-Beta Arteether Inj 75 Mg / Ml 1Ml 1Ml Amp ( ) , Injection 45 Alprazolam ( 0.5Mg ) , Tablet 46 Alprazolam Tab. - 0.25Mg Tab 47 Altracurium ( 10Mg / Ml, 2.5Ml Vial ) , Injection 48 Amikacin ( 100Mg / 2Ml Vial ) , Injection 49 Amikacin ( 250Mg / 2Ml ) , Injection 50 Amikacin ( 500Mg / 2Ml ( 2Ml Vial ) ) , Injection 51 Aminoacid 10% ( Essential ) - Ivf 52 Aminoacid 5% - Ivf ( 100Ml Bottle ) 53 Aminoacid ( Essential ) Infusion ( 10 X 10 0Ml Ffs Bottle ) , Bottle 54 Amino Acid Glass Bottle Contain Amino Acid 6 Gm, Nitrogen 0.929, Essential Amino Acid 51%, Non Essential Amino Acid 49%, Bcca 22.6%, Carbohydrate 5% - Inj 55 Amino Infusions 200Ml Bottle 56 Aminophylline Inj. - 25 Mg / Ml 10 X 10 Mg Vial ) , Injection Solution For 57 Amiodarone Inj. - 50Mg / Ml ( 3Ml Vial ) 58 Amiodarone Tab 100Mg 59 Amiodarone Tab 200Mg ( 200Mg ) , Tablet 60 Amisulpride ( 100 Mg ) , Tablet 61 Amisulpride ( 200 Mg ) , Tablet 62 Amisulpride ( 50 Mg ) , Tablet 63 Amitriptyline ( 10 Mg ) , Tablet 64 Amitriptyline Sugar Coated Tab. Ip - 25 Mg 65 Amitriptyline Tab. Ip - 25 Mg 66 Amitryptiline 75 Mg Tab 67 Amitryptiline Tab ( 50 Mg ) , Tablet 68 Amlodipine ( 10Mg ) , Tablet 69 Amlodipine ( 2.5Mg ) , Tablet 70 Amlodipine 5Mg+Atenolol 50Mg Tab 71 Amlodipin Tab ( 5Mg ) , Tablet 72 Amoxicillin 10 X 10 Ml With Dropper 73 Amoxicillin ( 125 Ml / 5Ml ( 30 Ml Bottle ) ) , Suspension 74 Amoxicillin 250Mg + Clavulanic Acid 50Mg Inj Vial 75 Amoxicillin 250 Mg / Vial Vial 76 Amoxicillin Cap. - 250 Mg. 77 Amoxicillin + Clavulanic Acid ( 125 Mg + 25 Mg ) / Vial Vial 78 Amoxicillin + Clavulanic Acid ( 200 Mg + 28.5 Mg ) , Tablet 79 Amoxicillin Cloxacillin And Lactic Acid Bacillus Capsules 250Mg 80 Amoxicillin Dispersible Tab.Usp - 125 Mg Tablet 81 Amoxicillin Trihydrate Dispersible 125 Mg Tab ( 125 Mg ) , Tablet 82 Amoxycillin And Clavulanic Acid I.P. ( 200+28.5Mg ( 30 Ml Bottle ) ) , Suspension 83 Amoxycillin And Clavulanic Acid I.P. ( 500Mg + 125Mg ) , Tablet 84 Amoxycillin And Potassium Clavulanate I.P. ( 1 Gm + 0.2 Gm / 10 Ml Vial ) , Injection 85 Amoxycillin +Clavulanic Acid Inj ( Amoxycillin 500 + Clavulanic Acid 100 Mg ) / Vial 86 Amoxycillin Dispersible Tablets Ip-Amoxicillin Trihydrate Ip Equivalent To Amoxicillin ( 250Mg ) , Tablet 87 Amoxycilline ( 500Mg ) , Capsule 88 Amoxycilline And Clavulanic Acid Inj 89 Amphotericin B Inj Ip ( 50 Mg ) , Injection 90 Ampicillin ( 1 Gm Vial ) , Injection 91 Ampicillin 250 Mg Cap 92 Ampicilline 125Mg / 30Ml Syrup 93 Ampicilline + Cloxacilline Injection ( 250 Mg + 250 Mg ) Vial Injection 5Ml Vial ( ) , Injection 94 Ampicilline + Cloxacilline Injection Tablet ( ( 250 Mg + 250 Mg ) ) , Tablet 95 Ampicillin Inj. - 250 Mg / Vial 96 Ampicillin Syrup ( 125 Mg / 5 Ml 30 Ml Bottle ) , Syrup 97 Antacid Chewable Tablet Containing Aluminum Hydroxide Equivalent To Dried Gel 250Mg+ Magnesium Hydroxide 250Mg+ Simethicone 50Mg Usp 98 Antacid Syrup , 170 Ml ( Dried Alluminium Hydroxide Gel 200 Mg, Simethicon 25 Mg / 5 Ml, ) Syrup 99 Anticold ( Paracetamol 300Mg+Cetirizine Hcl 5Mg Tablet 100 Anti D Immunoglobulin For Iv / Im Use ( Monoclonal ) Inj. 150Mcg ( 1Ml Vial ) 101 Anti Hemophilic Factor Ix Complex Coagulation Factor Ii, Vii, Ix, X Concentrate ( 600 Iu Vial ) , Injection 102 Anti Hemophilic Factor Viii ( 250Iu Vial ) , Injection 103 Anti Hemophilic Factor Viii Inj. 500Iu 104 Anti Rabies Immunoglobulin Inj.150 Iu Per 2 Ml Vial 105 Anti Rabies Immunoglobulin Inj - 300 Iu Per 2Ml ( 2Ml Vial ) ( 300 Iu Per 2Ml ) , Injection Solution For 106 Anti Snake Venom Polyvalent Inj 10Ml ( Lyophilized ) ( 10 Ml Vial ) , Injection 107 Aripiprazole ( 10 Mg ) , Tablet 108 Aripiprazole 15 Mg Tab 109 Aripiprazole 20 Mg Tab 110 Aripiprazole 30 Mg Tab 111 Aripiprazole 5 Mg Tab 112 Artemether Inj 80Mg / Ml ( 1 Ml Amp ) 113 Artemether+Lumefantrine 20Mg+120Mg Tab 114 Artesunate Inj 60 Mg / Vial 115 Artesunate + Sulphadoxine + Pyrimethamine ( Age Group Between 1-4 Year ) ( 50 Mg ( 3 Tab ) + 500 Mg ( 1 Tab ) + 25 Mg ( 1 Tab ) ) , Combi Blister Pack 116 Artesunate + Sulphadoxine + Pyrimethamine Ip ( Age Group 15 Or Above ) ( 200 Mg ( 3Tab ) + 750 Mg ( 2Tab ) + 37.5 Mg ( 1Tab ) ) , Combi Blister Pack 117 Artesunate + Sulphadoxine + Pyrimethamine Ip Age Group Between 5 To 8 Years ( 100 Mg ( 3Tab ) + 750Mg + 37.5Mg ( 1Tab ) ) , Combi Blister Pack 118 Artesunate Tablets 150Mg ( 3Tab ) + Sulphadoxine ( 500Mg+500Mg ) -Pyrimethamine 25Mg +25Mg Tab Ip ( 2Tab ) ( Age Group 9 To 14 Years ) 119 Artesunate Tablets 25Mg ( 3Tab ) + Sulphadoxine 125Mg-Pyrimethamine 6.25Mg Tablets Ip ( 1Tab ) ( Age Group Of Less Than 1Year ) 120 Artesunate Tablets 50 Mg + Sulphadoxine 500 Mg + Pyrimethamine 25 Mg Tablets Ip 121 Ascorbic Acid ( Vitamin C ) Tab. 500 Mg. 122 Aspirin Low Dose 75Mg Tab 123 Aspirin Low Dose Tab - 150Mg 124 Atenolol ( 25 Mg ) , Tablet 125 Atenolol Tab. - 100Mg - 10 X 14 Tab 126 Atenolol Tab 50Mg. 127 Atomoxetine 10 Mg Tab 128 Atomoxetine 25 Mg Tab 129 Atorvastatin ( 10 Mg ) , Tablet 130 Atorvastatin ( 20Mg ) , Tablet 131 Atorvastatin ( 5 Mg ) , Tablet 132 Atracurium 10Mg / Ml Inj 2.5Ml Vial 133 Atracurium Besylate ( 10Mg / Ml Inj Amp ) , Injection 134 Atropine + Dexamethasone + Chloramphenicol 1% + 0.1% + 0.5% 5 Ml Eye Drop 135 Atropine Sulphate 0.6 Mg / Ml Sc / Im / Iv ( 2Ml Amp ) , Injection 136 Atropine Sulphate Eye Drops - 1% ( 5 Ml Vial ) ( 5 Ml Vial ) , Eye Drops / Ointment 137 Atropine Sulphate Eye Ointment 1% ( 3 Gm Tube ) 138 Azathioprine 50Mg Tab 139 Azithromycin ( 100Mg / 5Ml ( 15 Ml Bottle ) ) , Suspension 140 Azithromycin 1 Gm, Fluconazole 150 Mg, Secnidazole 1 Gm Tab Tablet 141 Azithromycin 1Gm Tab + Cefixime 400Mg Tab 142 Azithromycin ( 200Mg / 5Ml ( 15 Ml Bottle ) ) , Suspension 143 Azithromycin ( 250Mg ) , Tablet 144 Azithromycin ( 500 Mg / 5Ml Inj ) , Vial 145 Azithromycin 500Mg Tab 146 Azithromycin Inj - 100Mg / 5Ml 147 Aztreonam Inj ( 500 Mg ) , Injection 148 Azythromycin 1 Gm + Fluconazole 150 Mg, + Secnidazole 2 G, Tablet 149 Baclofen 20 Mg Tab 150 Baclofen 30 Mg Tab 151 Baclofen 40 Mg Tab 152 Balance Salt Solution For Irrigation-500 Ml Ffs Bottle ( 500Ml Bottle ) , Eye Applicap 153 Basal Insulin Glargin ( 100Iu / Ml ( 10Ml Vial ) ) , Injection 154 Basal Insulin- Glargine Injection 300Iu Disposable Pen 300Iu With 4 Needles Per Pen 31G Needle ( ) , Pens 155 Basal Insulin- Glargine Penfill 300Iu With Free Permanent Pens One Pen For Each Five Cartridge And 10 Needles Per Pen 156 B-Complex Minerals With Zinc - Cap 157 Beclomethasone Dipropionate, Clotrimazole, Neomycine Sulphate, Chlorocresol ( 0.025% + 1% + 0.5% + 0.1% W / W ( 5Gm Tube ) ) , Ointment Or Cream 158 Beclomethasone Dipropionate, Neomycin Sulphate, Miconazole Nitrate ( 0.025 % + 0.5 % + 2 % ( 5 Gm Tube ) ) , Ointment 159 Beclomethasone Inhalation I.P 200 Mcg Per Dose ( 200 Metered Dose Container ) , Inhaler 160 Benzathine Penicillin 24 Lac Iu / Vial Vial 161 Benzathine Penicilline 12 Lac Iu / Vial Vial 162 Benzathine Penicillin Powder For Inj Ip 6 Lakh Iu / Vial 163 Benzoic Acid + Salicylic Acid ( 6% + 3% ( 15 Gm Tube ) ) , Ointment 164 Benzoyl Peroxide 0.025% 20 Gm Cream 165 Benzyl Benzoate Application I.P. - 25%W / W ( 100Ml Bottle ) 166 Benzyl Benzoate Emulsion ( ) , Emulsion 167 Benzyl Benzoate Lotion ( 25% ) , Bottle 168 Benzyl Penicillin 10Lac / Vial ( Penicillin G ) , Injection 169 Betahistine ( 16 Mg ) , Tablet 170 Betahistine 8 Mg Tab 171 Betamethasone Dipropionate Ointment 0.05% ( 15Gm ) Tube 172 Betamethasone Sodium Phosphate ( Ml Contain Betamethasone Na Phosphate Equal To 4Mg Of Betame ( 1Ml Amp ) ) , Injection 173 Betamethasone Tab 0.5 Mg 174 Betamethasone Valerate Cream 0.05 % ( 0.05% ) , Eye Drops / Ointment 175 Betamethasone Valerate Oint 0.1% ( 15 Gm Tube ) , Ointment 176 Betamethasone Valerate Oint / Cream Ip. - 0.12% 177 Bevacizumab ( 100 Iu Inj ( 4 Ml Vial ) ) , Injection 178 Bicalutamide ( 50Mg ) , Tablet 179 Biphasic Isophane Insulin ( 30 / 70 100Iu / Ml ( 10 Ml Vial ) ) , Injection 180 Biphasic Isophane Insulin ( 30 / 70 40Iu / Ml ( 10 Ml Vial ) ) , Injection 181 Bisacodyl ( 5 Mg ) , Suppository 182 Bisacodyl Tab 5Mg 183 Bismuth Iodoform Paraffin Paste 200 Gm Jar 184 Bleomycin 15 Mg / Vial Vial 185 Bleomycin 15 Units / Vial 186 Blonanserin 2 Mg Tab 187 Blonanserin 4 Mg Tab 188 Bortezomib ( 2Mg ) , Injection 189 Bortezomib ( 3.5Mg Vial ) , Injection 190 Botropase Injection ( Haemocoagulase 1Cu ) 1Ml 191 Bromhexine Hcl 4 Mg+ Guaiphensin 50 Mg + Terbutaline Sulphate 1.25 Mg / 5Ml Syp ( 100 Ml Bottle ) , Syrup 192 Bromhexine Hydrochloride 4Mg / 5Ml Syrup ( 50Ml Bottle ) 193 Budesonide Nebulising Suspension Containing Budesonide 0.25Mg / Ml - 2Ml Amp 194 Budesonide Respules 0.25Mg / 2Ml Inhalation ( 2Ml Amp / Respule ) , Inhaler 195 Bupivacaine Hcl For Spinal Anaesthesia 0.5% ( Heavy ) Amp 4 Ml Amp 196 Bupivacaine Hydrochloride Inj - 0.25% ( 20 Ml Vial ) ( 20 Ml Vial ) , Injection 197 Bupivacaine Hydrochloride Inj. - 0.25Mg ( 20 Ml Vial ) 198 Bupivacaine Hydrochloride Inj. - 0.5% ( 20 Ml Vial ) 199 Bupivacaine Hydrochloride Inj. 0.5% - 20Ml Vial ( Not For Spinal Use ) 200 Bupivacaine Hydrochloride Inj. 4Ml Amp ( Not For Spinal Use ) ( 0.5% ) , Vial 201 Buppivacaine 5 Mg, Dextrose80 Mg / Ml, 4 Ml Inj Injection 202 Bupropion 150 Mg Tab 203 Buspirone 10 Mg Tab 204 Buspirone 5 Mg Tab 205 Busulphan 2 Mg Tab 206 Butorphanol Tartrate 1Mg / Ml 1 Ml Inj 207 Cabergoline 0.5 Mg 4 Tablets / Strip 208 Caffeine Citrate Inj. 20Mg / Ml ( 3 Ml Vial ) ( 20Mg / Ml 3 Ml Vial ) , Injection 209 Calamine Lotion Ip ( Contains Per 1000 Ml:- Calamine 150 Gm, Zinc Oxide 50 Gm, Bentonite 30 Gm, Sodium Citrate 5Gm, Liquified Phenol 5Ml, Glycerin 50 Ml Purified Waterfreshly Boiled And Cooled To Produced 1000Ml ) 50 Ml Bottle 210 Calcitriol 0.25 Mcg Cap 211 Calcium Acetate 667 Mg Tab 212 Calcium Carbonate 500 Mg Tab 213 Calcium Carbonate 625 Mg, Vitamin - D3 125 Iu / 5 Ml ( 100 Ml Syrup ) , Syrup 214 Calcium Carbonate Derived From Oyester Shell Equivalent To Elemental Calcium 500Mg And Vitamin D3 250 Iu ( ) , Tablet 215 Calcium Carbonate + Vitamin D3 + Zinc ( 200 Ml Syrup ) , Syrup 216 Calcium Chloride Inj. ( 10% ) , Injection Solution 217 Calcium Citrate 500Mg With Vitamin D3 200Mcg Tablet 218 Calcium Gluconate 200Ml Syrup 219 Calcium Gluconate Injection I.P. - 10%W / V ( 10Ml Amp ) 220 Calcium Leucovorin 50 Mg / Vial Inj 221 Calcium Phosphate ( 2 : 1 Ratio ( 100 Ml Bottle ) ) , Syrup 222 Calcium Syp 100Ml Syrup ( 240Mg / 5 Ml ) 223 Capecitabine 500 Mg Tab 224 Capreomycin 1000 Mg / Vial Injection ( 10 Ml ) , Vial 225 Carbamazepine 100 Mg / 5 Ml 100 Ml Bottle 226 Carbamazepine ( 200 Mg ) , Tablet 227 Carbamazepine ( Sr ) 100 Mg Tab 228 Carbamazepine Tab. - 400Mg 229 Carbimazole ( 10 Mg ) , Tablet 230 Carboplatin ( 150Mg 15 Ml Vial ) , Injection 231 Carboplatin ( 450Mg 45Ml Multidose Vial ) , Injection 232 Carboprost Promithamin-250Mcg / Ml Inj ( 1Ml Amp ) 233 Carboprost Tromethamine Injection I.P. ( 15-Methyl Pgf2a ) Inj 250Mcg / 1Ml 234 Carboprost Trome Thamine Inj Usp 0.25Mg / Ml Vial ( ) , Injection Solution For 235 Carboxymethylcellulose ( 5 Ml ) , Eye Drop 236 Carboxymethylcellulose Eye Drop Ip 1% W / V 10Ml Vial 237 Carboxymethylcellulose Sodium Eye Drop 0.5% ( 10Ml ) , Eye Drop 238 Carvedilol ( 3.125 Mg ) , Tablet 239 Carvedilol 6.25 Mg Tab 240 Cefadroxil 250 Mg Tab 241 Cefadroxil 500 Mg Tab 242 Cefadroxil Syrup ( 125 Mg / 5 Ml 30 Ml Bottle ) , Syrup 243 Cefazolin ( 1Gm ) , Injection 244 Cefazolin Inj 500Mg Vial 245 Cefepime 1Gm And Tazobactam 125 Mg Inj ( Vial ) , Injection Solution 246 Cefepime ( 250 Mg / Vial ) , Injection 247 Cefepime 500Mg / Vial Inj ( 500Mg / Vial ) , Injection Solution 248 Cefixime 100 Mg / 5 Ml 10 Ml Bottle 249 Cefixime 200 Mg Tab 250 Cefixime 50 Mg / 5Ml, 30 Ml, Drop ( 30 Ml ) , Drop 251 Cefixime ( 50 Mg Dt ) , Tablet 252 Cefixime 50 Mg Dt Tab ( ) , Tablet 253 Cefixime + Azithromycin 200 Mg + 250 Mg Tab 254 Cefixime Oral Suspension ( 100 Mg / 5 Ml ( 30 Ml Bottle ) ) , Suspension 255 Cefixime Syrup 50Mg / 5Ml ( 30 Ml Bottle ) , Syrup 256 Cefixime Tab Ip 100Mg Tab 257 Cefoperazone 1000Mg + Sulbactam 1000Mg Inj ( Vial ) , Injection 258 Cefoperazone 1Gm / Vial Vial 259 Cefoperazone 500Mg + Sulbactam 500Mg ( Vial ) , Injection 260 Cefotaxime + Sulbactam 1000 Mg + 500 Mg Vial 261 Cefpodoxime 100 Mg ( ) , Tablet 262 Cefpodoxime 200 Mg Tab 263 Cefpodoxime ( 50 Mg ) , Tablet 264 Ceftazidime ( 250Mg / Vial ) , Injection 265 Ceftazidime Inj ( 500Mg / Vial ) , Injection 266 Ceftriaxone 1000Mg + Sulbactam 500Mg ( Vial ) , Injection 267 Ceftriaxone Inj 250Mg Vial 268 Ceftriaxone Tab ( 250 Mg ) , Tablet 269 Ceftriaxone+Tazobactum 250Mg+31.25Mg Inj ( Vial ) , Injection 270 Ceftriaxone+Tazobactum ( 500Mg+62.5Mg Vial ) , Injection 271 Cefuroxime 250 Mg, Tablet 272 Cefuroxime 500 Mg, Tablet 273 Cefuroxime 750Mg Powder For Solution For Injection ( 750Mg ) , Injection 274 Centchroman Ip ( 30 Mg ) , Tablet 275 Cephalexin 100 Mg / Ml 10 Ml With Dropper 276 Cephalexin Dispersible Tablet 125 Mg 277 Cephalexine Cap. - 250Mg Capsule 278 Cephalexine Cap. - 500Mg 279 Cephalexine ( Each 5Ml Contains 125Mg ( 30Ml Bottle ) ) , Syrup 280 Cerumenolytic ( For Ear Wax ) Each 10 Ml Contains Paradichlorobenzene 2%Benzocaine 2.7%Chlorbutol 5%Turpentine Oil 15% 10 Ml Vial [ 110341 ] 281 Cetirizine Syp 5Mg / 5Ml 60 Ml Bottle Syrup 282 Cetirizine Syrup ( 5Mg / 5Ml 30 Ml Bottle ) , Syrup 283 Cetirizine Tab. - 10 Mg 284 Cetrimide + Choline Salicylate 0.01% + 8% All W / V 10 Gm Tube 285 Cetrimide + Choline Salicylate Gel For Oral Ulcer 15Ml Tube 286 Cetrimide Cream Bp ( 0.1% W / W ) , Tube 287 Charcoal Activated ( Powder ) 100 Gm Box / Pouch 288 Chlorambucil ( 2 Mg ) , Tablet 289 Chloramphenicol 0.5% ( 5Ml ) , Eye Drop 290 Chloramphenicol ( 1% ( 5 Ml Vial ) ) , Eye Drop 291 Chloramphenicol 1% W / W 50 / Pack 292 Chloramphenicol 500 Mg Capsule 293 Chloramphenicol Ear Drop 5% ( 5 Ml Vial ) 294 Chloramphenicol Eye Applicaps-1% 100 Applicaps Per Bottle 295 Chloramphenicol Eye Ointment 1% 4 Gram ( ) , Tube 296 Chloraxozone + Paracetamol 250 Mg + 500 Mg Tab 297 Chlordiazepoxide 10 Mg Tab 298 Chlordiazepoxide 20 Mg Tab 299 Chlordiazepoxide ( 25 Mg ) , Tablet 300 Chlorhexidine 0.2% Mouth Gargle 100 Ml 301 Chlorhexidine Gluconate Mouthwash 0.2% W / V Solution ( 50Ml Bottle ) , Solution 302 Chlorhexidine Gluconate Solution 303 Chlorhexidine Gluconate Solution 4% I.P. ( Antiseptic ) 500 Ml Bottle 304 Chlorine Based Compound ( Sodium Dicholoroiso Cyanurate ) Nadcc Tablets 75 Mg With Available Chloroine 45 Mg Bis ( 45 Mg ) , Tablet 305 Chloroquine Phosphate Inj 40Mg / Ml ( 5 Ml Amp ) 306 Chloroquine Phosphate Inj. - 64.5Mg / Ml 30Ml Vial ( ) , Injection Solution For 307 Chloroquine Phosphate Suspension Equivalent To Chloroquine ( 50Mg / 5Ml ( 60 Ml Bottle ) ) , Suspension 308 Chloroquine Phosphate Syrup. 309 Chloroquine Phosphate Tab. - 250Mg 310 Chlorpheniramine Maleate 10Mg / Ml Inj 10 Ml Vial 311 Chlorpheniramine Maleate Tab. - 4Mg 312 Chlorpromazine Hydrochloride 100 Mg Sugar Coated Tab 313 Chlorpromazine Hydrochloride ( 25 Mg ) , Tablet 314 Chlorpromazine Hydrochloride 50 Mg Tab 315 Chlorpromazine Inj Ip 25Mg / Ml ( 2Ml Amp ) 316 Chlorpromazine Tab 100 Mg 317 Chlorpromazine Tab 50 Mg 318 Chlorthalidone 50 Mg Tab 319 Cholecalciferol 60000 Iu Cap 320 Cholecalciferol Concentrate ( Powder Form ) Ph.Eur. 60000Iu / Gm 321 Choline Salicylate + Benzalkonium Chloride 9% + 0.02% 10 Gm Eye / Nasal Drop 322 Chymotrypsin And Trypsin 100000 Iu Tab 323 Cinnarizine ( 25 Mg ) , Tablet 324 Ciprofloxacin 0.3% + Dexamethosone Eye Drop 0.1% 325 Ciprofloxacin 125 Mg / 5 Ml 60 Ml Bottle 326 Ciprofloxacin Eye Ointment 0.3% ( 3Gm Tube ) 327 Ciprofloxacin Inj 100 Mg / 50Ml ( 100Ml Ffs Bfs Bottle ) 328 Ciprofloxacin Inj 2 Mg / Ml Inj 100Ml Glass Bottle ( ) , Injection Solution For 329 Ciprofloxacin Tab - 250Mg 330 Ciprofloxacin Tab - 500Mg 331 Ciprofloxacin + Tinidazole ( 250 Mg + 300 Mg ) , Tablet 332 Cisplatin ( 10 Mg Vial ) , Injection 333 Cisplatin 50 Mg Inj ( 50 Ml Vial ) 334 Clindamycin ( 150Mg / Ml ( 2 Ml Vial / Amp ) ) , Injection 335 Clindamycin ( 1% W / W 10 Gm ) , Gel 336 Clindamycin 300 Mg / Ml Inj ( 1 Each ) , Injection 337 Clobazam ( 10 Mg ) , Tablet 338 Clobazam 5 Mg Tab 339 Clobetasol 0.05% + Gentamicin 0.1% Cream 10 Gm ( 10 Gm Tube ) , Cream 340 Clobetasol Propionate 0.05% 15 Gm Tube 341 Clofazimine Cap 50 Mg Capsule 342 Clomiphene Citrate 100 Mg Tab 343 Clomiphene Citrate 25 Mg Tab 344 Clomiphene Citrate 50 Mg Tab 345 Clomipramine 25 Mg Tab 346 Clomipramine 50 Mg Tab 347 Clomipramine 75 Mg Tab 348 Clonazepam 0.25 Mg Tab 349 Clonazepam 0.5Mg Tab 350 Clonazepam ( 1 Mg ) , Tablet 351 Clonazepam 2Mg Tab 352 Clonidine 100 Mcg Tab 353 Clonidine 100 Mcg Tab Tablet 354 Clonidine Injection, 10Ml Vial ( 1Mg ) 355 Clopidogrel 75Mg + Aspirin 75Mg Tab 356 Clopidogrel + Aspirin 150Mg Cap 357 Clopidogrel + Aspirin ( 75 Mg + 150 Mg ) , Capsule 358 Clopidogrel Tab. - 75 Mg 359 Clotrimazole 1% 100 Gm Cream 360 Clotrimazole 1% W / V 15 Ml Solution 361 Clotrimazole 1%W / V +Lignocaine 2%W / V ( 10Ml ) , Eye Drop 362 Clotrimazole 1%W / V +Lignocaine 2%W / V Ear Drop 10Ml Vial Bfs / Ffs Squeeze ( 10Ml Vial ) 363 Clotrimazole 1% W / W 30 Gm 364 Clotrimazole Cream - 1% ( 15 Gm Tube ) , Cream 365 Clotrimazole I.P.- 2%W / W ( 15Gm Tube ) , Cream 366 Clotrimazole + Lignocaine Ear Drop 1% ( 5Ml Vial ) , Drop 367 Clotrimazole Suspension I.P 50Mg / 5Ml 368 Clotrimazole Vaginal 500 Mg Tab Tablet 369 Clotrimazole Vaginal Pessary Tab 100Mg 14 X 10 Tab 370 Clotrimazole Vaginal Tablet I.P. - 100Mg ( Without Applicator ) 371 Cloxacillin ( 125 Mg / 5 Ml 40 Ml Bottle ) , Syrup 372 Cloxacillin 250 Mg / Vial Vial 373 Cloxacillin Cap ( 250 Mg ) , Capsule 374 Cloxacillin Capsules 500Mg 375 Cloxacillin Sodium Inj. - 500Mg 376 Clozapine 100 Mg Tab 377 Clozapine 25 Mg Tab 378 Clozapine ( 50 Mg ) , Tablet 379 Cold Cough Drop , 15 Ml ( Phenyl Ephrine 5 Mg, Chlorphenaramine 0.5 Mg, Paracetamol 125 Mg / 5 Ml ) 380 Colistinethate Sodium Inj Bp ( 1 Moillion Iu ) , Injection 381 Colistin Sulphate ( 12.5 Mg / 5 Ml 30 Ml Bottle ) , Suspension 382 Compound Benzoic Acid Ointment 383 Compound Sodium Lactate Injection Ip ( Ringers Lactate ) 0.24 % W / V Of Lactic Acid ( Eq. To 0.32% W / V Of Sodium Lactate ) , 0.6 % W / V Sodium Chloride, 0.04 % W / V Potassium Chloride And 0.027 % W / V Calcium Chloride ( 500 Ml Bottle ) ( ) , Solution 384 Compound Tincture Benzoin Ip 385 Co Trimoxazole Oral Suspension Ip ( 5 Ml Each Trimethoprim 40 Mg Sulphamethoxazole 200 Mg ) , Bottle 386 Cream Sumag ( ) , Cream 387 Crystalline Penicillin 5 Lakh Iu / Vial Vial 388 Cyclobenzaprine 5 Mg Tab 389 Cyclopentolate 1% W / V ( 5 Ml ) , Eye Drop 390 Cyclophosphamide ( 1000Mg ( Vial / Amp ) ) , Injection 391 Cyclophosphamide 50 Mg Tab 392 Cyclophosphamide Inj ( 200 Mg / Vial ) , Injection 393 Cyclophosphamide Inj 500Mg / Vial ( Each ) , Injection Solution 394 Cycloserine 250 Mg 10 Capsules 395 Cyclosporine 25 Mg Tab 396 Cyclosporine 50 Mg Tab 397 Cyproheptadine Hcl + Tricholine Citrate ( 2Mg + 275 Mg / 5 Ml ( 200Ml Bottle ) ) , Syrup 398 Dacarbazine ( 200 Mg Per Vial ) , Injection 399 Dacarbazine Inj. ( Dtic ) ( 500 Mg Vial ) , Injection 400 Daunorubicin ( 20 Mg / Vial ) , Injection 401 Daunorubicin 50 Mg / Vial Vial 402 Deferasirox Dispersible ( 250Mg ) , Tablet 403 Deferasirox Dispersible ( 500Mg ) , Tablet 404 Deferasirox Dispersible Tab. 100Mg 405 Deferasirox Dispersible Tab. 400Mg 406 Desferioxamine Inj 0.5G / Vial 407 Desferioxamine Injection 500Mg 408 Des Venlafaxine 100 Mg Tab 409 Des Venlafaxine ( 50 Mg ) , Tablet 410 Dexamethasone ( 4 Mg ) , Tablet 411 Dexamethasone Sodium 0.5 Mg, Tab Tablet 412 Dexamethasone Sodium Inj 4Mg / 2Ml ( 2Ml Vial ) , Injection 413 Dexamethasone Sodium Phosphate Inj 8Mg / 2Ml ( 2Ml Vial ) 414 Dexamethasone Tab ( 0.5Mg ) , Tablet 415 Dexmedetomidine Hydrochloride Injection ( 100Mg ) , Injection 416 Dexmedetomidine Hydrochloride Injection 1Ml Amp ( 1 Ml Amp ) , Ampoule 417 Dextran 70 Injectable Sol Inj 500Ml ( Solution ) 418 Dextran Iv 40% ( 500Ml ) , Injection 419 Dextromethorphan 10Mg / 5Ml Syrup ( 60Ml Bottle ) 420 Dextromethorphan Hydrobromide Syrup 13.5 Mg / 5Ml ( 30 Ml Bottle ) 421 Dextrose 10% 500Ml Bfs Bottle ( ) , Injection Solution For 422 Dextrose 10% Inj 500Ml Ffs / Bfs Bottle ( ) , Injection Solution For 423 Dextrose ( 10% Inj 500 Ml Ffs Btl ) , Injection 424 Dextrose ( 25% 100 Ml Ffs Bottle ) , Injection 425 Dextrose 25% ( 500Ml Ffs Bottle ) , Injection 426 Dextrose 25% Inj 100Ml Ffs / Bfs Bottle 427 Dextrose 25% Inj 500Ml Bfs Bottle ( ) , Injection Solution For 428 Dextrose 25% Inj 500Ml Ffs / Bfs Bottle ( ) , Injection Solution For 429 Dextrose 50 %, ( 25 Ml ) Inj ( 50 % ) , Injection 430 Dextrose 50% Inj 100Ml Ffs / Bfs Bottle 431 Dextrose 5% 500Ml Bfs Bottle ( ) , Injection 432 Dextrose 5% ( 500Ml Ffs Bottle ) , Injection 433 Dextrose, D-25 0.25 25 Ml ( 25 Ml ) , Injection 434 Dextrose, D-50 0.5 25 Ml ( 25 Ml ) , Injection 435 Dextrose With Saline ( 5% + 0.9% ( 500Ml Ffs Bottle ) ) , Injection 436 Dextrose With Saline 5% + 0.9% Inj 500Ml Bfs Bottle 437 Diacerein + Glucosamine 50 Mg + 750 Mg Tab 438 Diazepam 10 Mg Tab. 439 Diazepam Inj. - 5 Mg / Ml ( 2 Ml Amp ) 440 Diazepam Tab 5 Mg 441 Diclofenac 50Mg +Paracetamol 325Mg+Chlorzoxazone 500Mg Tab 442 Diclofenac 50Mg +Seratopeptidase 10Mg Tab ( 10Mg ) , Tablet 443 Diclofenac Gel 1% 10Gm Tube 444 Diclofenac Gel 1% 30Gm Tube 445 Diclofenac + Menthol ( 30Gm ) , Tube 446 Diclofenac+Paracetamol+Chlorzoxazoe ( 50 Mg + 325 Mg + 250 Mg ) , Tablet 447 Dicyclomine ( 10Mg / Ml ( 2 Ml Amp ) ) , Injection 448 Dicyclomine 20Mg+Paracetamol 325Mg Tab 449 Dicyclomine 20Mg Tab 450 Dicyclomine Drops 451 Dicyclomine Hydrochloride 20 Mg Tab 452 Dicyclomine Hydrochloride Oral Solution 10 Mg / Ml 30 Ml Bottle ( 10 Mg ) , Solution 453 Dicyclomine + Paracetamol Tab 20 Mg + 500 Mg 454 Dicyclomine Syrup 455 Dicyclomine Tab. - 10Mg 456 Didanosine 250 Mg Tab 457 Didanosine 400 Mg Tab 458 Diethylcarbamazine 50 Mg Tab 459 Diethylcarbamazine Tab ( 100Mg ) , Tablet 460 Digestive Drop ( Digestive Enzyme And Multivitamin With L Lysine ) ( 15 Ml ) , Drop 461 Digoxin Inj. - 250Mcg / Ml 462 Digoxin Tab 0.25Mg ( 25X10 ) , Tablet 463 Dilitiazem Tab 60Mg 464 Dilitiazem Tablets I.P. 30 Mg 465 Diltiazem 5Mg / 1Ml 5 Ml Inj 466 Diltiazem Tablet ( 60 Mg ) , Tablet 467 Dimercaprol 50 Mg / Ml 2 Ml Amp 468 Dinoprostone Gel ( 0.5% ) , Gel 469 Diphenhydramine Sg Cap 25Mg Capsule 470 Diphenhydramine Syrup ( 12.5Mg / 5Ml ( 100 Ml Bottle ) ) , Syrup 471 Diphenhydramine Syrup 12.5Mg / Ml 472 Diphtheria Antitoxin 10000 Iu ( 10Ml Vial ) 473 Diproex Er Tablet 500Mg ( 500Mg ) , Tablet 474 Disodium Acid Phosphate + Sodium Phosphate 10 Gm + 8 Gm / 100 Ml 100 Ml Solution 475 Disodium Hydrogen Citrate 1.25Gm / 5Ml 100 Ml ( 100 Ml ) , Syrup 476 Dispersible Zinc Tab 10Mg 477 Disulfiram 250 Mg Tab 478 Divalproex Sodium 250 Mg Tab 479 Divalproex Sodium 500 Mg Tab 480 Divalproex Sodium 750 Mg Tab 481 Dobutamine 12.5 Mg / Ml 20 Ml Vial 482 Dobutamine Hcl 50 Mg / Ml Inj ( 5Ml Amp ) 483 Dobutamine Inj 50 Mg / 5 Ml 484 Docetaxel ( 120Mg Vial ) , Injection 485 Docetaxel -20Mg Inj 486 Docetaxel 80Mg Inj 487 Domperidone ( 10Mg ) , Tablet 488 Domperidone ( 1 Mg / Ml 10 Ml With Dropper ) , Drop 489 Domperidone +Ranitidine 150Mg Tab 490 Domperidone Suspension 1Mg / Ml ( 30Ml Bottle ) 491 Domperidone Suspension 5Mg / 5Ml 492 Donepezil 10 Mg Tab 493 Donepezil 5 Mg Tab 494 Dopamine Hcl 40 Mg / Ml Inj ( 5 Ml Amp ) 495 Doxophylline 400 Mg Tab 496 Doxorubicin Inj 10Mg 497 Doxorubicin ( Lypholozed ) 10 Mg / Vial 498 Doxorubicin ( Lypholozed ) 50 Mg / Vial 499 Doxorubicin ( Lypholozed ) ( 50Mg Vial ) , Injection 500 Doxycycline Cap 100 Mg 501 Doxycycline Tab. - 100Mg ( ) , Tablet 502 Doxylamine Succinate 10 Mg Tab 503 Doxylamine Succinate + Pyridoxine ( 10Mg+10Mg ) , Tablet 504 Dpt With Vvm 10 Doses 505 Drop Iron 15Ml 506 Drotaverine ( 40 Mg ) , Tablet 507 Drotaverine 80 Mg ( 10X10 ) , Tablet 508 Drotaverine Inj. - 40Ml / 2Ml ( 2Ml Amp ) ( 40Ml / 2Ml 2Ml Amp ) , Injection Solution For 509 Duloxetine ( 20 Mg ) , Tablet 510 Duloxetine 30 Mg Tab 511 Duloxetine ( 40 Mg ) , Tablet 512 Dydrogesterone 10 Mg Tab 513 Each Combipack Red Colour Blister Pack Contains 3Tab Of Artesunate 150Mg And 2 Tab Of Sulphadoxine Pyrimethamine ( 500Mg + 25Mg ) ( Age Group 9 To 14 Years ) , Tablet 514 Electrolyte E ( Multiple Electrolytes And Dextrose Inj Type V Ip ) I / V Fluid [ Each 100Ml Contains Inj Dextrose 5G, Sod.Acetate 0.64G, Sod.Chloride 0.50G, Sodium Citrate 0.075G, Kcl 0.075G, Ccl 0.035G, Magnesium Chloride 0.031G ] ( 500Ml Ffs Bottle ) 515 Electrolyte G ( Multi-Electrolyte With 5% Dextrose Iv Injection Type Iv Ip ) Intravenous Fluid [ Each 100Ml Contains: Anhydrous Dextrose 5 Gm, Sod.Chloride 0.37G, Potassium Chloride 0.13G, Ammonium Chloride 0.37G ] ( 500Ml Ffs Bottle ) ( 500 Ml ) , Bottle 516 Electrolyte M Inj 500Ml Bfs Bottle ( ) , Injection Solution For 517 Electrolyte M Inj 500Ml Ffs Bottle 518 Electrolyte P Inj 500Ml Ffs / Bfs Bottle ( ) , Injection Solution For 519 Elemental Iron 50 Mg / 5 Ml 150 Ml Bottle 520 Elemental Iron 50 Mg / Ml 15 Ml With Dropper 521 Eltrombopag 25 Mg Tab 522 Enalapril Maleate Inj. 1.25 Mg Per Ml ( ) , Injection 523 Enalapril Maleate Tab 2.5Mg 524 Enalapril Maleate Tab 5Mg 525 Ephedrine 30 Mg / Ml 1 Ml Amp 526 Epinephrine Hydrochloride Inj. - 1 Mg / Ml ( ) , Injection 527 Epirubicin ( 10Mg Vial ) , Injection 528 Epirubicin ( 50Mg Vial ) , Injection 529 Epirubicin Inj 100Mg / Vial Vial ( Each ) , Injection 530 Eplerenone 25 Mg Tab 531 Equine Anti Rabies Immunoglobulin Inj. 532 Erythomycin Stearate ( 250Mg ) , Tablet 533 Erythromycin ( As Estolate ) ( 125Mg / 5Ml, 60Ml Blttle ) , Suspension 534 Erythromycin ( As Estolate ) Powder For Susp ( 125 Mg / 5Ml 40Ml Bottle ) , Consumable 535 Erythromycin Stearate ( 500 Mg ) , Tablet 536 Erythropoietin 10000Iu Inj 537 Erythropoietin ( 4000 Iu Inj Vial ) , Injection 538 Escitalopram 10 Mg Tab 539 Escitalopram ( 20 Mg ) , Tablet 540 Escitalopram ( 5 Mg ) , Tablet 541 Escitalopram + Clonazepam 10 Mg + 0.5 Mg Tab 542 Esmolol 100 Mg / Vial Vial 543 Estradiol 10 Mg / Vial Vial 544 Estradiol 1 Mg / Gm 15 Gm Tube 545 Estradiol Cypionate + Medroxy Progesterone Acetate 5 Mg + 25 Mg / 0.5 Ml 0.5 Ml Inj 546 Ethacridine Lactate 1 Mg / Ml 50 Ml Solution 547 Ethamsylate 250Mg Tablet 548 Ethamsylate Inj ( 250Mg ( 2Ml Amp ) ) , Injection 549 Ethamsylate Tab 500Mg 550 Ethinyl Estradiol 0.01 Mg 10 Tablets 551 Ethinyl Estradiol 0.05 Mg 10 Tablets 552 Ethinyl Estriadiol+Norethisterone Tab ( 35 Mcg +1Mg ) , Tablet 553 Etiophylline ( 77 Mg ) + Theophylline ( 23 Mg ) Tab 554 Etiophylline And Theophylline ( 220 Mg / 2Ml ) , Injection 555 Etiophylline And Theophylline Paediatric Syrup. 556 Etiophylline Theophylline Sr Tab. - 300Mg ( ) , Tablet 557 Etiophylline +Theophylline Syrup ( 46.5+14 ) Mg / 5Ml ( 100 Ml Bottle ) ( ) , Bottle 558 Etophylline + Theophylline Sr Tablet 231Mg + 69Mg ( ) , Tablet 559 Etoposide ( 100Mg Vial ) , Injection 560 Etoposide 50 Mg 8 Capsule 561 Everolimus Tab 10Mg ( 4X7 ) , Tablet 562 Fentanyl Citrate Inj 50 Mcg / Ml ( 2Ml Ampoule ) , Ampoule 563 Ferrous Ascorbate 100Mg ( Elemental Iron ) +Folic Acid 1.5Mg Tablet 564 Filgrastim 300Mcg Inj 565 Filgrastim 300 Mcg ( Prefilled Syrings ) , Vial 566 Fluconazole 0.3% ( 5 Ml ) , Eye Drop 567 Fluconazole 100 Mg Tab 568 Fluconazole ( 150 Mg ) , Tablet 569 Fluconazole 200 Mg Tab 570 Fluconazole 50 Mg Tab 571 Fluconazole Eye Drop 3 Mg / Ml ( 10 Ml Vial ) ( 3 Mg ) , Eye Drop 572 Fluconazole Iv ( 2Mg / Ml ( 100Ml Bottle ) ) , Injection 573 Flumazenil 0.1 Mg / Ml 5 Ml Multiple Dose Vial 574 Flunarizine 10 Mg Tab 575 Flunarizine 5 Mg Tab 576 Fluoxamine ( 100 Mg ) , Tablet 577 Fluoxamine ( 50 Mg ) , Tablet 578 Fluoxetine 40 Mg Tab 579 Fluoxetine Cap 10 Mg 580 Fluoxetine Cap. Bp - 20 Mg 581 Flupenthixol 20 Mg / Ml 1 Ml Inj 582 Fluphenazine 2.5 Mg Tab 583 Fluphenazine 25 Mg / Ml 1 Ml Amp 584 Flurbiprofen Sodium 0.03% 5 Ml 585 Folic Acid Tab ( 400 Mcg ) , Tablet 586 Folic Acid Tab Ip - 5 Mg 587 Formoterol + Budesonide ( 6 Mcg + 100 Mcg / Puff ( 120 Mdi ) ) , Inhaler 588 Framycetin Sulphate 1% Cream ( 30 Gm Tube ) , Cream 589 Frusemide 20 Mg, Spironolactone 50 Mg, Tab Tablet 590 Frusemide Inj. - 10 Mg / Ml ( 2 Ml Amp ) 591 Frusemide Tab. - 40Mg 592 Furazolidone ( 25Mg / 5Ml ( 60 Ml Bottle ) ) , Suspension 593 Furazolidone Tab 100Mg. 594 Fusidic Acid 0.02 15 Gm Cream 595 Fusidic Acid Cream / Sodium Fusidic Ointment 2% 5Gm Tube ( 5 Gm ) , Tube 596 Gabapentine 100 Mg Cap 597 Gamma Benzene Hexachloride Solution 1% ( 100 Ml Bottle ) ( 100 Ml Bottle ) , Fluid 598 Gatifloxacin Eye Drop 0.3% 5Ml 599 Gefitinib Tab 250Mg 600 Gemcitabine ( 1000Mg Vial ) , Injection 601 Gemcitabine ( 1.4 Gm Vial ) , Injection 602 Gemcitabine ( 200Mg / Vial ) , Injection 603 Gentamicin + Betamethasone 0.3% W / V + 0.1% W / V 5 Ml Inj 604 Gentamicin Inj. - 40 Mg / Ml, 2Ml Amp 605 Gentamicin Inj ( 40 Mg / Ml 2 Ml Amp ) , Injection 606 Gentamicin Inj ( 80 Mg / Ml ( 2 Ml Amp ) ) , Injection 607 Gentamycin 0.3% Eye / Ear Drops ( 5Ml Ffs Squeeze Vial ) , Eye Drop 608 Gentamycin 40 Mg / Ml 10 Ml Vial ( 10 Ml Vial ) , Injection 609 Gentamycin + Hydrocortisone 0.3% + 1% 5 Ml Vial 610 Glibenclamide Tab 2.5 Mg 611 Glibenclamide Tab 5 Mg 612 Gliclazide Tab. - 80 Mg 613 Glimepiride 1 Mg Tab 614 Glimepiride 2 Mg Tab 615 Glimepiride + Metformin Hydrocloride Sr Tab 1 Mg + 500 Mg Tab 616 Gluteraldehyde Solution 2% ( 5 Litre Can ) , Solution 617 Glycerine Ip Solution ( 100Ml Bottle ) 618 Glycerine + Mag Sulphate Crystal 250 Ml Jar 619 Glycerine + Sodium Chloride Enema 15% + 15% 20-30 Ml Solution 620 Glycerine Suppository Usp 3 Gm Bottle 621 Glyceryl Trinitrate 0.5Mg ( Sublingual ) Tab 622 Glyceryl Trinitrate 5Mg / Ml Inj 10Ml Vial ( Nitroglycerine ) ( 5Mg / Ml ) , Injection Solution 623 Glycopyrolate 0.5% 5Ml And Neostigmin 2.5 Mg / 5 Ml Injection ( Each ) , Injection 624 Glycopyrrolate Inj. - 0.2 Mg / Ml ( 1 Ml Amp ) ( 1 Ml Amp ) , Injection Solution 625 Granisetron 1 Mg / Ml 1 Ml Amp 626 Griseofulvin Tab. Ip - 125 Mg 627 Haemoccel, 500 Ml Inj ( Electrolight Na, K, Ca, Cl ) 628 Haemocoagulase 1 Iu / Ml 10 Ml Inj 629 Haemoglobin Tube ( Tube ) , Consumable 630 Haemoglobi Pippate ( Pippate ) , Consumable 631 Haloperidol 1.5 Mg Tab 632 Haloperidol ( 5Mg ) , Tablet 633 Haloperidol Inj 5Mg / Ml ( 1 Ml Amp ) 634 Haloperidol Tab 10Mg 635 Halothane Bp 250Ml Solution 636 Hcg ( Human Chorionic Gonadotropin ) Inj 5000 Iu Vial 637 Hemotocyto Meter ( Meter ) , Consumable 638 Heparin ( 1000Iu / Ml 5Ml Vial ) , Injection 639 Heparin 25000 Iu 5 Ml Inj 640 Heparin Inj ( 5000Iu / Ml 5Ml Vial ) , Injection 641 Hepatitis B Immunoglobulin 100 Iu / Vial 642 Hepatitis B Immunoglobulin Im Inj 200 Iu / Vial 643 Hepatitis B Vaccine ( Hep-B ) 10 Doses 644 Homatropine 2% 1 Ml Vial Inj 645 Human Albumin 20% ( 50 Ml Vial ) 646 Human Albumin Solution I.P. 20%W / V ( 100 Ml Vial ) , Injection 647 Human Chorionic Gonadotropin 2000 Iu / Ml 1 Ml Amp 648 Human Chorionic Gonadotropin Inj 5000 Iu 1Ml Amp 649 Human Insulin Regular / Soluble ( 100Iu / Ml ( 10Ml Vial ) ) , Injection 650 Human Insulin Regular / Soluble ( 40Iu / Ml ( 10Ml Vial ) ) , Injection 651 Human Normal Immunoglobin ( 5Gm / 100Ml ) , Injection 652 Hyaluronidase 1500 Iu / 2 Ml ( 2 Ml Amp / Vial ) , Injection 653 Hydralazine Hydrochloride 20Mg / Ml Injection ( 1 Ml Amp / Vial ) 654 Hydrochlorothiazide Tab 25 Mg 655 Hydrochlorthiazide ( 12.5 Mg ) , Tablet 656 Hydrocortisone Sodium Succinate ( 100 Mg / Vial ) , Injection 657 Hydrocortisone Sodium Succinate Inj. 200Mg Vial ( ) , Injection 658 Hydroethylstarch 6% Solution With Sodium Chloride 0.9% Iv Infusion ( Hydroxy Ethylstarch Solution Ffs / Bfs ) ( 0.9% Iv ) , Bottle 659 Hydrogen Peroxide Sol 6%V 400 Ml Bottle 660 Hydroxyethylstarch 3% ( 500 Ml ) , Injection 661 Hydroxyethyl Starch 6% ( Each ) , Suspension 662 Hydroxyprogesterone Caproate Inj I.P. 250Mg / Ml 663 Hydroxypropyle Methyle Cellulose Opthalmic Solution 2% 2Ml Pfs 664 Hydroxypropyl Methylcellulose Eye Drops ( 2% 5 Ml Vial ) , Eye Drop 665 Hydroxy Urea ( 500Mg ) , Capsule 666 Hyoscine Butylbromide Inj. - 20Mg / Ml 667 Hyoscine Butylbromide Tab 10Mg. 668 Hyoscine Butyl Bromind 1 Mg ( Amp ) , Injection 669 Ibandronic Acid Inj ( 6Mg ) , Injection 670 Ibuprofen 100Mg + Paracetamol 125Mg Per 5 Ml Syrup ( 60 Ml Bottle ) , Syrup 671 Ibuprofen 10Mg+Paracetamol 125Mg Syrup 672 Ibuprofen 200 Mg, Tablet 673 Ibuprofen 400Mg+ Paracetamol 325Mg Tablet ( ) , Tablet 674 Ibuprofen ( 400Mg ) , Tablet 675 Ibuprofen Syrup 100Mg / 5Ml ( 60 Ml Bottle ) ( 60 Ml Bottle ) , Syrup 676 Icthyol Glycerine 1% 30 Ml Solution 677 Ifosphamide 1Gm Lyophilised Each Vial + 3Amp Of Mesna 100Mg / 2Ml Inj 678 Ifosphamide + Mesna ( 1Gm ) , Injection 679 Imatinib 100 Mg Cap 680 Imatinib Cap / Tab ( 100 Mg ) , Tablet 681 Imatinib Mesylate 400 Mg Tab 682 Imipenem 250Mg+Cilastatin 250Mg Powder For Solution ( 1 Each ) , Injection 683 Imipramine 25 Mg Tab 684 Imipramine 75 Mg Tab 685 Iv Dns 500 Ml Injection 686 Inj. Pantaprazole ( 40Mg ) 687 Insulin Aspart In Disposable Pen 300Iu With Minimum 4 Needles Per Pen 31G Needle 688 Insulin Aspart Penfill 300 Iu With Free Permanent Pen ( One Pen Per Five Cartridges And Ten Needles Per Pen ) 689 Insulin Biphasic Lispro 25:75 100 Iu / Ml ( 3 Ml Cartridge ) ( Firm Has To Supply Compatible Pen Along With Cartridges As And When Required Without Any Extra Cost ) , Cartridges 690 Insulin Biphasic / Premix 50:50 ( 100 Iu / Ml ( 10 Ml Vial ) ) , Injection 691 Insulin Biphasic / Premix 50:50 ( 40 Iu / Ml ( 10 Ml Vial ) ) , Injection 692 Insulin Human Mixtard Inj. - 30:70 ( ) , Injection Solution 693 Insulin Lispro In Disposable Pen 300Iu With Minimum 4 Needles Per Pen 31G Needle 300Iu ( Prefilled Syringe ) , Pens 694 Insulin Soluble Inj. - 40 Iu / Ml 695 Intraocular Irrigating Solution Sodium Chloride 0.49 % W / V, Potassium Chloride 0.075 % W / V, Calcium Chloride 0.048 %, Magnesium Chloride 0.03 % W / V, Sodium Acetate 0.39 % W / V, Sodium Citrate 0.17 % W / V. 500 Ml Ffs 696 Intravenous Fat Emulsion 20% W / V ( 20% W / V ) , Bottle 100Ml 697 Intravenous Immuglobin ( Ivig ) ( Each ) , Injection 698 Ipratropium Bromide Inhaler 20Mcg Per Puff 200Dose 699 Ipratropium Bromide + Levosalbutamol ( 20Mcg+50Mcg, 200 Mdi ) , Inhaler 700 Ipratropium Bromide Powder For Inhalation 250Mcg / Ml 701 Irinotecan 100 Mg Inj ( 1 Ml Amp ) 702 Irinotecan ( 40Mg / Vial ) , Injection 703 Irinotecan Hydrochloride ( 100 Mg ) , Injection 704 Iron And Folic Acid Enteric Coated Tab Dried Ferrous Sulphate Equ. To Ferrous Iron 100 Mg And Folic Acid 0.5 Mg ( Blue Tablet ) 705 Iron And Folic Acid Enteric Coated Tab Dried Ferrous Sulphate Ip Eq. To 45 Mg Elemental Iron And 400 Mcg Folic Acid Ip ( Pink Color ) - Wifs Junior 706 Iron And Folic Acid Enteric Coated Tab. Dried Ferrous Sulphate Ip Equ. To Ferrous Iron 100 Mg And Folic Acid Ip 0.5 Mg Granules ( Red Tablet ) ( ) , Tablet 707 Iron And Folic Acid Entric Coated Tab Dessicated Ip 67Mg Equivalent To 20Mg Of Elmental Iron 708 Iron And Folic Acid Sugar Coated Tab Dried Ferrous Sulphate Ip Eq. To 45 Mg Ferrous Iron And 400 Mcg Folic Acid Ip ( Pink Colored Tab ) - Wifs Junior Ifa Tablets ( Detail Specification As Per Tender ) ( ) , Tablet 709 Iron Dextran 50 Mg / Ml ( 2 Ml Amp ) , Injection 710 Iron Ferrous Sulphate Folic Acid 100Ml ( Each 5Ml Contains Ferrous Sulphate I.P Equivalent To Elementary Iron 100Mg Folic Acid I.P 0.5Mg ) , Syrup 711 Iron Folic Acid Syrup, Each Ml Containing 20Mg Elemental Iron&100Mcgfolic Acid With Suitable Anti-Oxidant, Antimicrobial Agent And Food Grade Flavouring Agent.The Bottle Should Have 6 Fragmented Markings At Equal Intervals ( If An Artificial Sweetening Is Used It Should Be Highlighted On The Label. Warning Should Be Put On Label Medication Should Be Kept Out Of Reach Of Children. ( As Per Attached Specification ) ( 50Ml Bottle With Auto Dispenser ) ) , Syrup 712 Iron Sucrose 20Mg ( 20 Mg ) , Injection 713 Iron Sucrose Inj Usp 100 Mg / 5 Ml ( 5 Ml Amp ) 714 Iron Syrup 200 Ml ( Elemental Iron 40 Mg, Ammonium Citrate 200 Mg, Cyanocobalamin 7.5 Mg, Folic Acid 0.5 Mg, Zinc Sulphate 7 Mg / 5 Ml ) 715 Isoflurane ( 250 Ml Amber Color Bottle ) , Inhalation 716 Isoflurane Solution ( Liquid For Inhalation ) 100Ml ( Amber Color Bottle ) 717 Isoprenaline 2 Mg / Ml 1 Ml Inj 718 Isosorbide-5-Mononitrate ( Tab.20 Mg ) , Tablet 719 Isosorbide Dinitrate Tab Ip - 5 Mg 720 Isosorbide Mononitrate Tab. - 20Mg 721 Isoxsuprine ( 10Mg ) , Tablet 722 Isoxsuprine Hydrochloride Inj. - 5Mg / Ml ( 2 Ml Amp ) ( 2 Ml ) , Injection 723 Isoxsuprine Tablets I.P. 20 Mg Tablet 724 Itraconazole Cap ( 100 Mg ) , Capsule 725 Ivermectin Tab Usp 6Mg 726 Iv Human Immunoglobin 5Mg / 100Ml ( 1 Each ) , Injection 727 Ketamine Hydrochloride Inj. 10Mg / Ml ( 10Ml Vial ) 728 Ketamine Hydrochloride Inj ( 50Mg / Ml ( 10 Ml Vial ) ) , Injection 729 Ketamine Hydrochloride Inj. 50Mg / Ml ( 2 Ml Amp ) 730 Ketoconazole Ointment 2% 15Gm Tube ( 15 Gm ) , Ointment 731 Ketoconazole Tab 200Mg ( ) , Tablet 732 Labetalol 100 Mg Tab 733 Lactobacillus 150 Million Spores 1 Sachet 734 Lactobacillus Tab ( Lactobacillus 60 Million Spores ) . 735 Lactulose Solution 3.35Gm / 5 Ml 736 Lactulose Syrup ( 10Gm / 15Ml ) , Syrup 737 Lamotrigine Dt ( 50 Mg ) , Tablet 738 Lamotrigine Dt Tab ( 100 Mg ) , Tablet 739 L-Asparaginase 5000 Iu Lyophilised ( Vial ) , Injection 740 Letrozole ( 2.5 Mg ) , Tablet 741 Leuprolide Depot Inj ( 3.75Mg ) , Injection 742 Levamisole 50 Mg Tab 743 Levetiracetam 250 Mg Tab 744 Levetiracetam 500 Mg Tab 745 Levocetirizine + Monteleukast ( ( 2.5 Mg + 4 Mg ) / 5 Ml, 30 Ml Bottle ) , Suspension 746 Levocetirizine + Monteleukast 5 Mg + 10 Mg Tab 747 Levocetirizine Tab 5Mg 748 Levodopa + Carbidopa 200 Mg + 50 Mg Tab 749 Levodopa +Carbidopa Tab 250Mg + 25Mg 750 Levofloxacin ( 250Mg ) , Tablet 751 Levofloxacin 500 Mg ( 100 Ml Ffs Bottle ) , Injection 752 Levofloxacin 500Mg Inj 100Ml Ffs / Bfs Bottle ( ) , Injection Solution 753 Levofloxacin 500Mg Tablet 754 Levonorgestrel Emergency Contraceptive ( 0.75Mg ) , Tablet 755 Lidocaine 2% Inj. - 30 Ml Vial ( ) , Injection Solution 756 Lignocaine 2 % ( 21.3 Mg / Ml ( 30 Ml Vial ) ) , Injection 757 Lignocaine 2% + Adrenaline 5 Mcg / Ml ( 30 Ml ) , Vial Inj 758 Lignocaine Hydrochloride Eye Drops - 4% ( 5 Ml Vial ) 759 Lignocaine Hydrochloride For Spinal Anaesthesia ( Heavy ) 0.05 2 Ml Amp 760 Lignocaine Hydrochloride Gel 2% W / V ( 30 Gm Tube ) 761 Lignocaine Hydrochloride Topical Solution Usp 762 Linazolid ( 300Ml ) , Injection 763 Linezolid 200Mg / 100Ml ( 100Ml Ffs Bottle ) , Injection 764 Linezolid Tab ( 600 Mg ) , Tablet 765 Liquid Paraffin Ip - 500 Ml Solution 766 Lithium Carbonate 300 Mg Tab 767 Lithium Carbonate 400 Mg Tab 768 Lithium Carbonate ( Sr ) ( 450 Mg ) , Tablet 769 Lmwh Low Molecular Weight Heparin Inj 4000Iu / Ml. ( ) , Injection Solution 770 Lmwh Low Molecular Weight Heparin Inj. - 6000 Riu / Ml ( ) , Injectn Solution 771 Lomustine 40Mg Cap 772 Lorazepam 1 Mg Tab 773 Lorazepam 2 Mg / Ml 1 Ml Vial 774 Lorazepam 2 Mg / Ml 2 Ml Vial 775 Lorazepam 2 Mg Tab 776 L-Ornithine +L-Aspartate 5Mg Inj 777 Losartan Potassium, Hydrochlorthiazide ( 50 Mg + 12.5 Mg ) , Tablet 778 Losartan Tab - 25 Mg ( 10X10 ) , Tablet 779 Losartan Tab - 50 Mg 780 Lysol Ip ( Cresol With Soap Solution ) ( 5Ltr Jar ) 781 Magnesium Hdroxide+Aluminium Hydroxide ( 625Mg+312Mg / 5Ml ) 100Ml Solution 782 Magnesium Hydroxide + Aluminium Hydroxide Simethecon 250 Mg + 250 Mg + 50 Mg / 5 Ml 170 Ml Bottle ( Syrup ) , Syrup 783 Magnesium Suplhate Inj - 50 % W / V ( 2Ml Amp ) 784 Magnesium Suplhate Injection I.P.50 % W / V 10Ml Amp 785 Magnesium Suplhate Injection I.P.50 % W / V ( 1 Ml Amp ) ( 1 Ml Amp ) , Ampoule 786 Mannitol ( 20% 100 Ml Ffs Bottle ) , Injection 787 Mannitol Inj, 10% 100 Ml Bottle 788 Mannitol Inj. 10% 350Ml Bottle ( ) , Injection Solution For 789 Mannitol Inj. 20% 350Ml Ffs Bottle 790 Mannitol Injection I.P. 20% 100Ml Bottle ( ) , Injection Solution For 791 Mebendazole 100 Mg Tab 792 Medroxy Progesterone Acetate 10 Mg Tab 793 Medroxy Progesterone Acetate ( 150Mg / Ml 1 Ml Amp ) , Injection 794 Mefenamic Acid + Dicyclomine Tab ( 250 Mg + 10 Mg ) , Tablet 795 Mefenamic Acid + Drotaverine Hcl 250 Mg + 80 Mg Tab 796 Mefloquine 250Mg Tab 797 Mehylcobalamine 1500 Mcg, Alpha Lipoic Acid 100 Mg, Folic Acid 1.5 Mcg, Thiamine Mononitrate 10 Mg, Pyridoxine Hcl 3 Mg Cap Capsule 798 Memantine ( 10 Mg ) , Tablet 799 Menadione Usp ( Vitamin K3 ) ( 10 Mg / Ml ( 1 Ml Amp ) ) , Injection 800 Mephentermine Inj 15Mg / Ml 10Ml Vial 801 Mephentermine Inj 30Mg / Ml ( 10 Ml Vial ) , Injection 802 Meropenem Inj 125Mg / Vial ( Each ) , Injection 803 Mesalamine ( 5-Aminosalicylic Acid 400 Mg ) Tab 804 Mesalamine ( 5-Aminosalicylic Acid ) Usp 800 Mg Tab 805 Metformin 500Mg + Gliclazide 80Mg Tablet ( 10X10 ) , Tablet 806 Metformine 500Mg + Glibenclamide 5Mg ( Tab ) , Tablet 807 Metformin + Glimepiride 500 Mg + 2 Mg Tab 808 Methocarbamol 100 Mg / Ml 10 Ml Inj 809 Methotrexate ( 10 Mg ) , Tablet 810 Methotrexate 2.5 Mg Tab 811 Methotrexate 5 Mg Tab 812 Methotrexate ( 7.5 Mg ) , Tablet 813 Methotrexate Inj 15Mg / Ml ( Vial ) 814 Methotrexate Inj 500Mg Vial 815 Methotrexate Inj 50Mg ( 2Ml ) 816 Methylcobalamin + Alpha Lipoic Acid ( 1500 Mcg + 100 Mg ) , Capsule 817 Methylcobalamine ( Vitamin B12 ) 500 Mcg / Ml 3 Ml Inj 818 Methylcobalamin Inj ( 500 Mcg / Ml ( 10 Ml Vial ) ) , Injection 819 Methylcobalamin / Mecobalamin ( 500 Mcg ) , Tablet 820 Methyldopa Tab. - 250Mg 821 Methyl Ergometrine Inj Meleate - 0.2 Mg / Ml ( 1Ml Amp ) 822 Methyl Ergometrine Maleate Tab. - 0.125Mg 823 Methyl Phenidate 10 Mg Tab 824 Methyl Phenidate 20 Mg Tab 825 Methyl Prednisolone ( 500Mg ) , Injection 826 Methyl Prednisolone Sodium Succinate Inj.1000Mg Vial 827 Methyl Prednisolone Sodium Succinate Inj. Usp - 125Mg ( 10Ml ) , Vial 828 Methyl Prednisolone Sodium Succinate Inj. Usp - 40Mg Vial 829 Methyl Prednisolone Sodium Succinate Inj. Usp - 500Mg 830 Methyl Prednisolone Sodium Succinate Tablet - 8 Mg 831 Methyl Prednisolone Tab - 16 Mg 832 Methyl Prednisolone Tab - 4Mg 833 Metoclopramide Inj. - 5Mg / Ml ( 2 Ml Amp ) 834 Metoclopramide Syrup ( 5Mg / 5Ml ( 30 Ml Bottle ) ) , Syrup 835 Metoclopramide Tab. - 10Mg 836 Metoprolol ( 50Mg ) , Tablet 837 Metoprolol + Amlodipin 25 Mg + 2.5 Mg Tab 838 Metoprolol Inj 1 Mg / Ml ( 5Ml Vial ) , Injection Solution 839 Metoprolol + Ramipril 25 Mg + 2.5 Mg Tab 840 Metronidazole 0.01 15 Gm Cream 841 Metronidazole 100Mg / 5Ml Syrup ( 30Ml ) 842 Metronidazole Benzoate Oral Suspension ( 100Mg Of Base / 5 Ml ( 60Ml Bottle ) ) , Suspension 843 Metronidazole Inj. 500Mg / 100Ml ( 100 Ml Ffs Bfs Bottle ) 844 Metronidazole Tab 200 Mg 845 Metronidazole Tab ( 400Mg ) , Tablet 846 Miconazole Cream I.P. 2% W / W ( 15 Gm Tube ) , Consumable 847 Micronised Progesterone ( 100 Mg ) , Tablet 848 Micronised Progesterone 400 Mg Tab 849 Micronised Progestrone ( 200 Mg ) , Tablet 850 Micronised Progestrone 50 Mg / Ml 4 Ml Amp 851 Micronised Progestron Inj. - 200Mg / Ml 852 Midazolam Inj. - 1Mg / Ml 10Ml Vial 853 Midazolam Inj. - 1Mg / Ml 5Ml Amp 854 Mifepristone 200Mg Tab 855 Milk Of Magnesia 11.25 Ml, Liquid Paraffin 3.75Ml Phenolphthalein 50Mg / 15Ml ( Cremaffin Pink Formula ) 170Ml Syrup 856 Mirtazapine 15 Mg Tab 857 Mirtazapine 30 Mg Tab 858 Mirtazapine 7.5 Mg Tab 859 Misoprostol 100 Mcg 4 Tables / Pack 860 Misoprostol ( 200Mcg ) , Tablet 861 Misoprostol 400 Mcg 4 Tablets / Strip 862 Modafinil 100 Mg Tab 863 Mometasone 0.10% 15Gm Tube 864 Morphine Sulphate Inj. Ip 10Mg / Ml ( 1Ml Ampoule ) , Injection Solution 865 Morphine Sulphate Inj. Ip 15Mg / Ml 866 Moxifloxacin 0.5% W / V ( 5 Ml ) , Eye Drop 867 Moxifloxacin ( 100Ml ) , Injection 868 Moxifloxacine + Dexamethasone 0.5% + 0.1% W / V Drop 869 Moxifloxacine Eye Drop 0.5%W / V 870 Moxifloxacin + Prednisolone 5 Mg + 3 Mg / 5 Ml Drop 871 Multivitamin 10Ml Amp Inj 872 Multivitamin Drops ( Approx 22 Drops ) ( ) , Drop 873 Multivitamine 100Ml Syrup ( 100 Ml ) , Syrup 874 Multivitamine 200Ml Syrup 875 Multivitamin Sugar Coated Tablet 876 Multivitamin Syrup 60 Ml ( Each 5Ml Contains-Vitamin A ( Palmitate ) Ip 1600 Iu+Vitamin D3 Ip 200 Iu ( +Vitamin B2 Ip 1.00Mg+Vitamin B6 Ip 0.50Mg+Niacinamide Ip 15.00Mg+D-Panthenol Ip 1.00Mg ) , Syrup 877 Multivitamin Without Iron Syrup ( 100Ml ) , Syrup 878 Multivitamin With Protein 200 Ml ( 200 Ml ) , Syrup 879 Multivitamin With Zinc Drop 15Ml ( 15 Ml ) , Drop 880 Mupirocin ( 2% W / W ( 5 Gm Tube ) ) , Ointment 881 N- Acetyl Cysteine Inj 200Mg / Ml In 10Ml Amp 882 N- Acetyl Cysteine Inj 200Mg / Ml In 1Ml Amp 883 Naloxone Inj. - 0.4 Mg / Ml ( 1Ml Ampoule ) , Injection Solution 884 Naltrexone ( 50 Mg ) , Tablet 885 Neomycin+Bacitricin Ointment 5Mg+500 Iu / G 886 Neostigmine ( 0.5Mg / Ml ( 1Ml Amp ) ) , Injection 887 Azothioprine 50 Mg Tablet 888 Azothioprine 75 Mg Tablet 889 Azothioprine 100 Mg Tablet 890 Neostigmine 30Mg Tablet 891 Neostigmine 60 Mg Tablet 892 Netilmycin 25 Mg / Ml 1 Ml Vial 893 Nicorandil 5 Mg 10 X 10 Tab 894 Nifedipine Capsule - 5Mg Cap 895 Nifedipine ( Sublingual ) 10 Mg Tab 896 Nifedipine Tablets - 10Mg Tab 897 Nilotinib 150Mg Tab 898 Nilotinib 200Mg Tab 899 Nimesulide 100 Mg Tab 900 Nimesulide +Paracetamol 100 + 325 Mg, Tablet 901 Nimesulide +Paracetamol+Serratiopetidase 100 + 325 + 10 Mg Tab 902 Nitrazepam 5 Mg Tab 903 Nitrofruantoin ( 100Mg ) , Tablet Capsule 904 Nitrofruantoin Tablet Ip 100Mg 905 Nitroglycerine Inj. Usp - 25 Mg / 5Ml ( 5Ml Amp ) 906 Non-Ionic Contrast Media ( 350 Mg , 100Ml ) , Consumable 907 Noraderanaline Bitartrate Inj 2 Mg Base / 2Ml ( 2Ml Amp ) ( 2 Mg Base / 2Ml ) , Injection 908 Noraderanaline Inj. - 2 Mg Base / 2 Ml Amp 909 Norethisterone Enanthate 200 Mg / Ml 1 Ml Inj 910 Norethisterone Tablets 5Mg 911 Norfloxacin 200 Mg Tab 912 Norfloxacine 400Mg And Tinidazole 600Mg Tab 913 Norfloxacin +Metronidazole 30Ml Syrup 914 Norfloxacin + Metronidazole Suspension 100Mg+100Mg / 5Ml ( 30 Ml Bottle ) , Bottle 915 Norfloxacin Tab. - 400Mg 916 Norfloxacin + Tinidazole ( ( 100 Mg + 100 Mg ) 30Ml Syrup ) , Syrup 917 Norfloxacin + Tinidazole 400Mg Tab 918 Norfloxacin +Tinidazole 400Mg Tab 919 Normal Saline Injection 0.9% ( 500Ml Ffs Bottle ) 920 Nortriptyline 10 Mg Tab 921 N S 3% Hypotonic ( 100Ml ) , Injection 922 Octreotide 30Mg Injection 923 Ofloxacin 0.3% W / V Of Ofloxacin Ph.Eur. ( 5 Ml Vial ) , Eye Drop 924 Ofloxacin 200Mg +Tinidazole 600Mg Tab 925 Ofloxacin + Dexamethasone 10 Ml Eye Drop ( 10 Ml ) , Drop 926 Ofloxacin + Dexamethosone ( 0.3%+ 0.1% ( 10 Ml ) ) , Eye Drop 927 Ofloxacin Infusion ( 2Mg / 1Ml ( 100Ml Ffs Bottle ) ) , Bottle 928 Ofloxacin Inj 2Mg / 1Ml 100Ml 929 Ofloxacin+ Metronidazole ( 30Ml ) , Syrup 930 Ofloxacin + Ornidazole ( 50 Mg + 125 Mg ) / 5Ml 30 Ml Bottle ( 30 Ml ) , Suspension 931 Ofloxacin Suspension 932 Ofloxacin Suspension 50Mg / 5 Ml 30 Ml Bottle 933 Ofloxacin Tab - 400 Mg 934 Olanzapine 10Mg Tab 935 Olanzapine 10 Mg / Vial Vial 936 Olanzapine 20Mg Tab 937 Olanzapine 2.5 Mg Tab 938 Olanzapine ( 5 Mg ) , Tablet 939 Olanzapine 7.5 Mg Tab 940 Olopatadine Hydrochloride Ophthalmic Solution Usp 01% W / V -5Ml ( ) , Eye Drop 941 Olopotadine Antiallergic ( 0.1% W / V ( 5 Ml Vial ) ) , Eye Drop 942 Omeprazole 10 Mg Tab 943 Omeprazole 40Mg ( Vial ) , Injection 944 Omeprazole Cap. - 20Mg ( ) , Capsule 945 Omeprazole Capsule ( 40 Mg ) , Capsule 946 Omeprazole + Domperidone 20 Mg + 10 Mg ( Capsule ) , Capsule 947 Ondansetron 2 Mg Tab 948 Ondansetron ( 2Mg / 5Ml 30Ml Bottle ) , Syrup 949 Ondansetron 8Mg Inj 950 Ondansetron ( Drops ) Syrup ( 2Mg / 5Ml ( 10 Ml Bottle ) ) , Syrup 951 Ondansetron Inj. - 2 Mg / Ml ( 2 Ml Amp ) 952 Ondansetron Inj - 2 Mg / Ml ( 4 Ml Amp ) ( 4 Ml Amp ) , Injection Solution For 953 Ondansetron Syrup 2Mg / Ml 954 Ondansetron Tab 4 Mg 955 Ornidazole Tab ( 500 Mg ) , Tablet 956 Ors Packet Who Formula Sodium Chloride 2.5G, Potessium Chloride 1.5G, Sodium Citrete 2.09G Dextrose 13.6G, 20.5Gm Pouch ( ) , Powder 957 Ors Who Powder Glucose Anhydrous 13.5G / L, Sodium Chloride 2.6G / L, Potassium Chloride 1.5G / L, Trisodium Citrate 2.9G / L 958 Oseltamivir 12 Mg / Ml Syrup 75Ml Bottle 959 Oseltamivir Cap 30 Mg 960 Oseltamivir Cap 45 Mg 961 Oseltamivir Cap 75 Mg 962 Oseltamivir 75 Mg Syp 963 Oxaliplatin ( 100Mg ) , Injection 964 Oxaliplatin ( 50Mg Inj 25 Ml Vial ) , Injection 965 Oxcarbazepine 150 Mg Tab 966 Oxcarbazepine ( 300 Mg ) , Tablet 967 Oxcarbazepine ( 600 Mg ) , Tablet 968 Oxytocin ( 5 Iu / Ml ( 2Ml Amp ) ) , Injection 969 Oxytocin Inj. - 10 Iu / Ml 970 Oxytocin Inj ( 5 Iu / Ml ( 1Ml Amp ) ) , Injection 971 Paclitaxel-260Mg Inj ( ) , Injection 972 Paclitaxel Nanoparticle / Protein Bound Particles Inj. ( 100Mg Vial ) , Vial 973 Paliperidone 1.5 Mg Tab 974 Paliperidone 3 Mg Tab 975 Pancuronium 2 Mg / Ml 2 Ml Amp 976 Pantoprazole 40 Mg, Domperidone 10 Mg ( Tab ) , Tablet 977 Pantoprazole Tab 40 Mg 978 Paracetamol 1000Mg I V Infusion 100 Ml Ffs Bottle 979 Paracetamol 100 Mg / Ml, 150 Ml Drop ( 150 Ml ) , Consumable 980 Paracetamol 150 Mg / Ml ( 15 Ml Bottle With Dropper ) , Drop 981 Paracetamol + Chlorphenaramine+ Phenylephrine 250 Mg + 2.5 Mg + 10 Mg Tab 982 Paracetamol Drop 100 Mg / Ml 983 Paracetamol Drop 10Mg / Ml 984 Paracetamol Inj 150Mg / Ml 2Ml Amp ( 2Ml Amp ) , Injection Solution 985 Paracetamol Oral Drops ( 100 Mg / Ml ( 15 Ml Bottle With Dropper ) ) , Drop 986 Paracetamol + Phenylephrine + Chlorpheniramine Maleate ( 125Mg+2.5 Mg+1Mg ) / Ml ( 15 Ml Bottle With Dropper ) , Drop 987 Paracetamol Syrup / Suspension 125 Mg / 5Ml ( 60Ml Bottle ) 988 Paracetamol Tab. - 500Mg 989 Paracetamol Tab 650 Mg ( 650 Mg ) , Tablet 990 Paroxetine Cr 12.5 Mg 991 Paroxetine Cr 25 Mg 992 Pemetrexed ( 100 Mg Vial ) , Injection 993 Pemetrexed ( 500Mg ) , Injection 994 Pentazocin Lactate Inj. - 30Mg / Ml ( 1 Ml Amp ) 995 Pentoprazole 40Mg, Domperidone 10Mg Tab Tablet 996 Pentoprozole 40Mg +Domperidone 10Mg Tab 997 Permethrin Cream 5% ( 30 Mg ) , Cream 998 Permethrin Lotion 5% W / V 60 Ml Bottle 999 Petrollium Jelly Ip 500 Gm 1000 Pheniramine Maleate ( 22.75 Mg / Ml ( 2 Ml Amp ) ) , Injection 1001 Phenobarbitine 20 Mg / Ml, 60 Ml, Syp Syrup 1002 Phenobarbitone ( 200 Mg / Ml ) , Injection 1003 Phenobarbitone Syp 200Mg / 5Ml ( ) , Syrup 1004 Phenobarbitone Tab. - 30 Mg 1005 Phenobarbitone Tab. - 60 Mg ( ) , Tablet 1006 Phenylepherine Hcl & Tropicamide 5% + 1% Drop 1007 Phenytoin Sodium 250 Mg / 5 Ml Inj ( 5Ml Vial ) 1008 Phenytoin Sodium ( 50 Mg / Ml ( 2Ml Amp ) ) , Injection 1009 Phenytoin Sodium Inj. - 100 Mg ( ) , Vial 1010 Phenytoin Sodium Oral Suspension - 25 Mg / Ml ( 100 Ml Bottle ) , Suspension 1011 Phenytoin Sodium Tab 100Mg 1012 Pilocarpine Eye Drops 4% 1013 Pilocarpine Hydrochloride Eye Drops Bp 2% 1014 Pilocarpine Nitrate Inj. Ip 0.5 % W / V ( 1 Ml ) , Injection 1015 Piogliatazone Tab. - 15Mg 1016 Piogliatazone Tab. - 30 Mg 1017 Piperacillin + Tazobactam 1000 Mg + 125 Mg Vial 10 Ml Vial ( ) , Injection 1018 Piperacillin + Tazobactam 2000 Mg + 250 Mg 20Ml Vial ( ) , Injection 1019 Piracetam 200 Mg / 15 Ml 15 Ml Solution 1020 Piroxicam Capsules 20 Mg 1021 Potassium Chloride Inj. - 150 Mg / 10Ml 1022 Potassium Chloride Inj. 150Mg / Ml 1023 Potassium Chloride Oral Solution 100Mg / Ml 1024 Potassium Chloride Syrup 200Ml ( Each ) , Syrup 1025 Povidone Iodine Cream 250 Gm 1026 Povidone Iodine Ointment 5% 15Gm Tube 1027 Povidone Iodine Ointment 5% 250Gm Jar 1028 Povidone Iodine Solution 5% ( 100 Ml Bottle ) , Solution 1029 Povidone Iodine Surgical Scrub Solution. - 7.5% ( 500 Ml Bottle ) , Solution 1030 Povidone Iodine Vaginal Pessary - 200 Mg 1031 Pralidoxime Chloride Injection I.P. ( Pam ) -1Gm ( 20 Ml Amp ) , Injection 1032 Pralidoxime ( Pam ) Inj. - 25 Mg / Ml ( 20 Ml Amp / Vial ) , Injection 1033 Prazosin Tab 5 Mg 1034 Prednisolone 10 Mg Tab 1035 Prednisolone ( 5Mg ) , Tablet 1036 Prednisolone Eye Drops ( 10 Mg / Ml ( 5 Ml ) ) , Eye Drop 1037 Prednisolone Tab 20 Mg 1038 Pregabalin + Methylcobalamin 75 Mg + 750 Mcg Tab 1039 Premixed Insulin Biphasic Analogue 25 / 75 In Penfill 300Iu Permanent Pen One Pen Per Five Cartidges And Ten Needles Per Pen 1040 Premixed Insulin Biphasic Analogue 30 / 70 In Penfill 300Iu Permanent Pens One Pen Per Five Cartridges And Ten Needles Per Pen 1041 Primaquin 15Mg Tab 1042 Primaquin ( 2.5Mg ) , Tablet 1043 Primaquin ( 7.5Mg ) , Tablet 1044 Procaine Penicillin 4 Lac Iu / Vial Vial 1045 Procyclidine 5 Mg Tab 1046 Promethazine ( 50 Mg ) , Tablet 1047 Promethazine Inj 25 Mg / Ml ( 10 Ml Vail ) 1048 Promethazine Inj 25 Mg / Ml ( 2 Ml Amp ) ( 2 Ml Amp ) , Injection 1049 Promethazine Syrup. - 5 Mg / 5Ml ( 60 Ml ) , Syrup 1050 Promethazine Tab 25 Mg 1051 Proparacaine 0.50% 5 Ml / Vial 1052 Propofol 1% ( 10Ml / 5Ml 20Ml ) , Injection 1053 Propofol Sodium ( 1% W / V 10Mg / Ml, 10Ml Vial ) , Injection 1054 Propofol Sodium Inj 1%W / V 10Mg / Ml 20Ml Vial ( 10Mg / Ml ) , Vial 1055 Propranolol 40 Mg Tab 1056 Propranolol Tab ( 10 Mg ) , Tablet 1057 Propranolol Tr 20 Mg Tab 1058 Prostaglandin E2 Gel 0.5Mg ( 3Gm Tube ) 1059 Protamine Sulphate Inj 10Mg / Ml 1060 Providone Iodine 1% 1% 5 Ml 1061 Pyrazinamide 750Mg Tablet ( 10X10 ) , Tablet 1062 Pyridostigmine 60 Mg Tab 1063 Pyridoxine Tab 10Mg 1064 Quetiapine ( 100 Mg ) , Tablet 1065 Quetiapine 200 Mg Tab 1066 Quetiapine ( 50 Mg ) , Tablet 1067 Quinine Dihydrochloride 150 Mg / Ml 2 Ml Amp 1068 Quinine Dihydrochloride ( 300Mg / Ml ( 2Ml Amp ) ) , Injection 1069 Quinine Sulphate 150Mg / 5Ml Syrup 60 Ml 1070 Quinine Sulphate ( 300Mg ) , Tablet 1071 Quinine Sulphate Inj. - 300Mg / Ml . 1072 Quinine Sulphate ( Ip 600Mg ) , Tablet 1073 Rabeprazole 10 Mg Tab 1074 Rabeprazole ( 20 Mg ) , Tablet 1075 Rabies Immunoglobulin Inj-300 Iu ( 2Ml Vial Pfs ) ( ) , Vial 1076 Rabies Vaccine Inj ( Vero Cell Culture ) Inj. Intra Dermal ( ) , Vial 1077 Rabies Vaccine Ip Human ( Purified Chick Embryo Cell Culture ) ( ) , Vaccine 1078 Rabies Vaccine Ip Inj Human ( Chick Embryo / Vero Cell Culture ) Intra Muscular ( ) , Injection Solution 1079 Ramipril Tab 2.5 Mg 1080 Ramipril Tab 5 Mg 1081 Ranibizumab Inj ( 10Ml / Mg ) , Injection 1082 Ranitidine ( 150Mg ) , Tablet 1083 Ranitidine 15 Mg / Ml 100 Ml Bottle 1084 Ranitidine ( 50Mg / 2Ml , 2Ml Amp ) , Injection 1085 Recombiant Factor Vii 1Mg Inj 1086 Recombiant Factor Vii 2Mg Inj 1087 Recombinant Anti - Hemophilic Factor Viii ( 1000 Iu Inj / Vial ) , Injection 1088 Recombinant Anti - Hemophilic Factor Viii ( 250 Iu Inj / Vial ) , Injection 1089 Recombinant Anti - Hemophilic Factor Viii ( 500 Iu Inj / Vial ) , Injection 1090 Rectified Spirit ( 90% ) Solution 1091 Rh-Erythropoetin 2000 I.U Pfs 1092 Ribavirin 200 Mg Cap ( ) , Capsule 1093 Rifampicin Cap ( 300 Mg ) , Capsule 1094 Rifampicin Cap ( 450 Mg ) , Capsule 1095 Rifampicin Cap ( 600 Mg ) , Capsule 1096 Ringer Lactate Ip I / V 0.24 % W / V Of Lactic Acid ( Eq. To 0.32% W / V Of Sodium Lactate ) , 0.6 % W / V Sodium Chloride, 0.04 % W / V Potassium Chloride And 0.027 % W / V Calcium Chloride ( 500Ml Ffs Bottle ) , Injection Solution 1097 Risperidone 1Mg Tab 1098 Risperidone 2 Mg Tab 1099 Risperidone 4 Mg Tab 1100 Risperidone + Trihexiphenidyle ( 2 Mg + 2 Mg ) , Tablet 1101 Risperidone + Trihexiphenidyle ( 3 Mg + 2 Mg ) , Tablet 1102 Risperidone + Trihexiphenidyle 4 Mg + 2 Mg Tab 1103 Rituximab -100Mg Inj 1104 Rituximab -500Mg Inj 1105 Rosuvastatin. 10 Mg Tab 1106 Roxithromycin 150Mg Tablet 1107 Roxithromycin 300 Mg 1108 Roxithromycin 50 Mg / 5 Ml 30 Ml Bottle 1109 S-Adenosyl-L-Methionine 400 Mg Tab 1110 Salbutamol 2.5 Mg / 3 Ml 3 Ml Inj 1111 Salbutamol ( 2Mg / 5Ml ( 100Ml Bottle ) ) , Syrup 1112 Salbutamol Inhalation Ip 100Mcg / Dose ( 200 Metered Dose Container ) , Inhaler 1113 Salbutamol Nebuliser Solution Bp-Sabutamol Sulphate Eq. To Salbutamol 1Mg Per Ml 2.5 Ml Amp 1114 Salbutamol Sulphate ( 2 Mg ) , Tablet 1115 Salbutamol Sulphate Syrup 2Mg / 5Ml 60Ml ( ) , Bottle 1116 Salbutamol Sulphate Tab Ip 4Mg ( 4Mg ) , Tablet 1117 Salicylic Acid 0.02 30 Gm Tube 1118 Salicylic Acid Ointment 6% 1119 Salmeterol 25 Mcg + Fluticasone 125 Mcg Inhaler ( 120Mdi ) 1120 Salmeterol 25 Mcg + Fluticasone 250 Mcg Inhaler ( 120Mdi ) ( 250 Mcg ) , Inhaler 1121 Secnidazole ( 500 Mg Tab ) , Tablet 1122 Serratiopeptidase 10 Mg Tab 1123 Sertraline ( 100 Mg ) , Tablet 1124 Sertraline 50 Mg Tab 1125 Sevoflurane Usp Inhalation Anesthetic 250 Ml ( 250 Ml ) , Bottle 1126 Sics Blade-Sideport ( Sideport Entry Knife ) , Consumable 1127 Sildenafil 50 Mg Tab 1128 Silver Nitrate 500 Ml Each 1129 Silver Sulphadiazine Cream Usp 1% ( 500 Gm Jar ) , Cream 1130 Silver Sulphadiazine Cream Usp 1% W / W 25Gm 1131 Sitagliptin ( 100 Mg ) , Tablet 1132 Sitagliptin ( 50 Mg ) , Tablet 1133 Sodium Bicarbonate Inj. - 7.5% W / V ( 10Ml ) , Ampoule 1134 Sodium Chloride 0.3% Iv 100Ml ( 1 Each ) , Injection 1135 Sodium Chloride 0.45% + Dextrose 5% ( 500 Ml Ffs Bottle ) , Injection 1136 Sodium Chloride 1 / 2 Normal, Hyper Tonic And Dextrose 5% Inj 1137 Sodium Chloride Inj Iv 0.9% 500Ml ( Glass Bottle ) ( ) , Injection Solution 1138 Sodium Chloride Inj Iv 500Ml Bfs Bottle ( ) , Injection Solution 1139 Sodium Chloride N / 2 Injection Ip ( 0.45% ) ( 500Ml Ffs Bottle ) , Injection 1140 Sodium Chloride N / 2 Injection Ip 500Ml Bfs Bottle ( ) , Bottle 1141 Sodium Chloride Normal Saline ( 100Ml Ffs Bottle ) , Solution 1142 Sodium Chloride ( Ophthalmic ) 5% 10 Ml Solution 1143 Sodium Citrate 3.8% - 500 Ml Solution 1144 Sodium Hyaluronate ( Intraocular ) 10 Mg / Ml 2Ml Inj 1145 Sodium Hypochlorite 0.03 5 Ltr 1146 Sodium Hypochlorite 5% Solution 5Ltr 1147 Sodium Hypochlorite Solution 100 Ml Bottle 1148 Sodium Thiopentone ( 500Mg ) , Injection Powder 1149 Sodium Thiopentone Inj. - 0.5 Gm Powder / Vial ( 20Ml Vial ) 1150 Sodium Valporate 300 Mg Tab 1151 Sodium Valproate 100 Mg / Ml 5 Ml Inj 1152 Sodium Valproate 200 Mg / 5 Ml 100 Ml Bottle 1153 Sodium Valproate ( 200Mg ) , Tablet 1154 Sodium Valproate 500 Mg Tab 1155 Sodium Valproate + Valproate 333 Mg + 145 Mg Tab 1156 Soframycin Ointment 30 Mg Tube ( ) , Ointment 1157 Soluble Insulin 30% Isophane Insulin 70% 100 Iu Inj 1158 Sorafenib ( 200Mg ) , Tablet 1159 Spironolactone Tab 100Mg ( 10X10 ) , Tablet 1160 Streptomycin Inj 0.75G 1161 Succinyl Choline Inj. - 50Mg / Ml ( 10 Ml Vial ) ( 10 Ml Vial ) , Injection Solution 1162 Succinyl Choline Inj. - 50Mg / Ml 1Ml Amp 1163 Sulfacetamide Eye Drops - 20% 1164 Sulfamethoxazole 200Mg And Trimethoprim 40Mg Per 5Ml Suspension 50Ml Bottle 1165 Sulfamethoxazole And Trimethoprim ( 100 Mg And 20Mg ) , Tablet 1166 Sulfamethoxazole And Trimethoprim ( 400Mg + 80Mg ) , Tablet 1167 Sulfamethoxazole And Trimethoprim ( 800Mg + 160Mg ) , Tablet 1168 Sulfamethoxazole +Trimethoprim Tab ( 200 Mg + 40 Mg ) , Tablet 1169 Sulphadoxine 500Mg And Pyrimethamine 25Mg Tab. 1170 Surfactant Bovine ( 135 Mg Phopholipid Per 5 Ml ) 5Ml Vial ( ) , Vial 1171 Surfactant Suspension ( For Intratrcaheal ) Natural Surfactant Inj 25 Mg / Ml 1172 Surfactant Suspension ( Intratrcaheal ) Bovine 4Ml Amp - Natural Inj ( ) , Ampoule 1173 Surgical Spirit Bp - 500 Ml ( ) , Bottle 1174 Swine Flu Vaccine 1175 Syp. Alkaline Citrate With K Oral Solution 100Ml Syrup 1176 Syp. Cefodroxil 125Mg / 30Ml Syrup 1177 Syp. Cetirizine 5Mg / 5Ml 30Ml Syrup 1178 Syp. Ferric Ammonium Citrate 200Mg +Folic Acid 0.5Mg+Vitamin B 125Mcg+Zinc 5Ml Syrup 1179 Syphalis Card Igg+Igm S / S Above 99.5 % Syrup 1180 Syrup 100Ml Bottle. ( 5Ml 100Mg Elemental Fe Iron & Folic Acid Syrup ( As Per The Standards Provided ) ( ) , Syrup 1181 Syrup 50Ml Bottle ( Each 1 Ml Contains 20 Mg Elemental Iron And 100 Mcg Folic Acid Syrup ( As Per The Standards Provided ) With Dropper ) ) 1182 Syrup Cefpodoxime 50 Mg 1183 Tab Amitryptyline ( 25 Mg ) , Tablet 1184 Tab Citalopram ( 20 Mg ) , Tablet 1185 Tablet Domeperidone ( 10Mg ) , Tablet 1186 Tadalafil 10 Mg Tab 1187 Tamoxifen ( 10 Mg ) , Tablet 1188 Tamoxifen ( 20Mg ) , Tablet 1189 Tamsulosin ( 0.4Mg ) , Tablet 1190 Tamsulosin 4Mg Tab 1191 Tamsulosin + Dutasteride 0.4 Mg + 0.5 Mg Tab 1192 Teicoplanin 200 Mg / Vial Vial 1193 Telmisartan, Hydrochlorthiazide ( 40 Mg + 12.5 Mg ) , Tablet 1194 Telmisatran 20 Mg Tab 1195 Telmisatran 40 Mg Tab 1196 Temozolomide ( 100Mg ) , Capsule 1197 Temozolomide 20Mg Cap 1198 Temozolomide -250Mg Cap 1199 Terbutaline Suplhate Inj 1200 Terbutaline Suplhate Tab. - 2.5Mg 1201 Terlipressine Inj. 1Mg / 10Ml Vial ( 1 Each ) , Injection 1202 Tetanus Immunoglobulin ( Usp / Ip 250 Iu / Vial ) , Injection 1203 Tetanus Immunoglobulin Usp / Ip ( 500 Iu / Vial ) , Vial 1204 Tetanus Toxide Inj 5Ml ( ) , Injection Solution 1205 Tetracycline Eye Oint 1% 1206 Tetracycline Eye Ointment 1% 5 Gm 1207 Thalidomide 100 Mg Tab 1208 Thiocholchecocide 4 Mg Tab 1209 Thiocholchecocide 8 Mg Tab 1210 Thiopentone Injection 1Gm 1211 Thyroxine Sodium 25 Mcg 100 Per Bottle 1212 Thyroxine Sodium 75 Mcg 100 Per Bottle 1213 Thyroxine Sodium Tab 100 Mcg ( 100 Tab Bottle ) ( 100 Tab ) , Tablet 1214 Thyroxine Sodium Tab 50Mcg ( 100 Tab Bottle ) 1215 Tianeptin 12.5 Mg Tab 1216 Timolol Maleate Eye Drop I.P. 0.5 %W / V ( 5 Ml Vial ) ( 5 Ml ) , Solution 1217 Tinidazole 150 Mg / 5 Ml 60 Ml Bottle 1218 Tinidazole Tab 300 Mg 1219 Tinidazole Tab 500Mg 1220 Tobramycin ( 0.3% 5Ml ) , Eye Drop 1221 Tobramycin + Dexamethasone ( 0.3%W / V + 0.1%W / V ( 5Ml Vial ) ) , Eye Drop 1222 Topiramate 100 Mg Tab 1223 Topiramate 25 Mg Tab 1224 Topiramate 50 Mg Tab 1225 Torasemide ( 10Mg ) , Tablet 1226 Torasemide 20 Mg / 2 Ml Vial 1227 Torasemide Inj 100Mg / 2Ml ( ) , Injection 1228 Torasemide Tab 20Mg 1229 Total Parenteral Nutrition ( Including Carbohydrate + Proteins + Fats Solution 2000 Ml ) , Infusion 1230 Tpn ( Total Parenteral Nutrition ) Including Carbohydrate + Proteins + Fats Solution ( Brand: Oliclinomel N7 2000 Ml ) 1231 Tramadol ( 100Mg / Ml ( 2 Ml Amp ) ) , Injection 1232 Tramadol Cap 50Mg 1233 Tramadol Inj. - 50Mg / Ml. ( 2Ml Amp ) 1234 Tramadol Tab. - 100Mg 1235 Tranexamic Acid 500 Mg Tab Tablet 1236 Tranexamic Acid Inj. - 125Mg / Ml Amp 1237 Tranexamic Acid Injection Bp / Ip ( 100Mg / Ml ( 5Ml Amp ) ) , Injection 1238 Trastuzumab 440Mg Inj. 1239 Trastuzumav Inj ( 440Mg ) , Injection 1240 Triamcinolone Acetate - 40Mg / Ml Inj 1241 Tricholine Citrate + Sorbitol ( 550 Mg + 7.15 G / 10 Ml ( 100 Ml Bottle ) Syrup ) , Syrup 1242 Trifluoperazine 5 Mg Tab 1243 Trifluoperazine + Trihexyphenidyle 5 Mg + 2 Mg Tab 1244 Trihexyphenidyl 2Mg Tab 1245 Tropicamide Eye Drops 1% 5Ml Vial 1246 Trypan Blue-Dye ( 1Ml ) , Consumable 1247 Tt With Vvm 10 Doses 1248 Tuberculin Diluted Ppd 5 Tu / 0.1 Ml, 5 Ml 1249 Ultravist 300Mg ( 50 Ml / Vial ) , Injection 1250 Urograffin 76% Solution For Injection 20Ml Vial 1251 Urograffin 76% Solution For Injection 50Ml Vial Bottle 1252 Urokinase 5 Lac Iu / Vial Inj 1253 Ursodeoxy Cholic Acid 150 Mg Tab 1254 Ursodeoxy Cholic Acid 300 Mg Tab 1255 Valethamate Bromide Inj. - 8Mg / Ml 1256 Vancomycin Hydrochloride ( 1000Mg Vial ) , Injection 1257 Vancomycin Hydrochloride ( 250Mg Vial ) , Injection 1258 Vancomycin Hydrochloride ( 500Mg ) , Injection 1259 Vecuronium Bromide Inj 2Mg / Ml ( 2Ml Amp ) 1260 Vecuronium Bromide Inj 4Mg / Ml Amp 1261 Venlafaxine ( 150 Mg ) , Tablet Capsule 1262 Venlafaxine 75 Mg ( Cap ) , Capsule 1263 Venlafaxine Er / Pr ( 37.5 Mg ) , Tablet Capsule 1264 Verapamil Sugar Coated Tab Ip - 40Mg 1265 Verapamil Tab 40 Mg Ip ( ) , Tablet 1266 Verapamil Tab 80 Mg 1267 Vildagliptin + Metformin ( 50Mg + 500Mg ) , Tablet 1268 Vildagliptin Tab ( 50 Mg ) , Tablet 1269 Vinblastine -10Mg Inj. 1270 Vincristine Sulphate ( 1Mg / Ml ( Cytocristin Inj ) 1 Ml Vial ) , Injection 1271 Vitamin A Cap Usp Soft Gelatin Capsule ( 1 Lakh Iu ) , Capsule 1272 Vitamin A Cap Usp Soft Gelatin Capsule ( 2 Lakh Iu ) , Capsule 1273 Vitamin A ( Soft Gelatin Cap ) 50000 I.U 1274 Vitamin A Syrup ( 100000 Iu / Ml With Market Spoon For 1Ml And 2 Ml ( 100 Ml Bottle ) ) , Syrup 1275 Vitamin B1 10Mg, B2 10Mg, B6 3Mg, B12 15Mcg, Niacinamide 100Mg, Calcium Panthenol 50Mg, Folic Acid 1.5Mg, Vitamin C 150Mg, Biotin 100Mcg Or More Tab ( ) , Tablet 1276 Vitamin B1 10Mg, B2 10Mg, B6 3Mg, B12 15Mcg, Niacinamide 75Mg, Calcium Panthenol 50Mg ( Folic Acid 1.5Mg, Vitamin C 150Mg, Biotin 100Mcg Or More ) , Tablet 1277 Vitamin B12 500 Mcg / Ml 10 Ml Vial 1278 Vitamin B12 Inj 500 Mcg / Ml ( 30 Ml Amp ) 1279 Vitamin B1 ( Thiamine ) 100 Mg Tab 1280 Vitamin B1 ( Thiamine ) 75 Mg Tab 1281 Vitamin B Complex Injection Nfi Formula 30Ml / Vial ( 30Ml / Vial ) , Injection 1282 Vitamin B Complex Nfi Formula ( 100Ml Bottle ) , Syrup 1283 Vitamin B Complex Nfi Formula ( 200Ml Bottle ) , Syrup 1284 Vitamin B Complex Syp 200 Ml 1285 Vitamin. B Complex Tab. Nfi ( Prophylactic ) 1286 Vitamin C Tab 500 Mg Tablet 1287 Vitamin D3 ( Cholecalciferol ) ( 400 Iu / Ml ( 100 Ml Bottle ) ) , Syrup 1288 Vitamin D3 Drop 10Ml ( Cholecalciferol 400 Iu ) ( 10 Ml ) , Drop 1289 Vitamin D3 Granules ( 60000 Iu Sachet ) , Powder 1290 Vitamin E 200 Mg Tab 1291 Vitamin E 50 Iu / Ml 10 Ml Bottle With Dropper 1292 Vitamin-E Capsule Usp ( 400 Mg ) 1293 Vitamin K1 Inj 1Mg / 0.5Ml ( 0.5 Ml Amp ) 1294 Vitamin K Inj. - 10 Mg / Ml 1295 Vitamin K Inj ( Phytonadione Inj ) 1Mg / 0.5Ml ( ) , Injection Solution For 1296 Voglibose ( 0.3Mg Tab ) , Tablet 1297 Voglibose Dispersible 0.3Mg Tab 1298 Warfarin Sodium- 5 Mg ( 5 Mg ) , Tablet 1299 Water For Injection 5 Ml Amp 1300 Water For Injection Inj 10 Ml Amp 1301 Water For Injection Ip ( 2 Ml Amp ) , Injection 1302 Xylometazoline Nasal ( 0.1%W / V ( 10 Ml Vial ) ) , Drop 1303 Zinc Sulphate 10 Mg Elemental Zinc / 5 Ml 100 Ml Bottle 1304 Zinc Sulphate 10 Mg Elemental Zinc / 5 Ml 200 Ml Bottle 1305 Zinc Sulphate Dispersible ( 10Mg ) , Tablet 1306 Zinc Sulphate Syrup - 20Mg / 5Ml ( 50 Ml Bottle ) , Syrup 1307 Zoledronic Acid ( 4Mg Vial ) , Injection 1308 Zolpidem 10 Mg Tab 1309 Zonisamide 100 Mg Tab 1310 Zonisamide 50 Mg Tab 1311 Prostaglandin E2 ( Dinoprostone Gel ) 0.5 Mg Pfs 1312 Alkaline Citrate With Pottasium Solution 100Ml 1313 Amlodipine 5 Mg Tab 1314 Anti D Immunoglobin 300 Mcg Inj 1315 Calcium Citrate - 1000Mg ( Elemental Ca Equivalent To 250 Mg And Vitamin D3 400 Iu ) Tab 1316 Calcium With Vitamin D Tablets Calcium Carbonate 650Mg Eq. To Elemental Calcium 250Mg And Cholecalciferol 125 Iu 1317 Calcium With Vitamin D Tablets Usp Calcium Carbonate 1.25G Eq. To Elemental Calcium 500Mg And Cholecalciferol Ip 250 Iu 1318 Cefotaxime Sodium Inj 250 Mg Vial 1319 Cefotaxime Sodium Inj ( 500 Mg / Vial ) , Injection 1320 Cefotaxime Sodium Inj. - 1 Gm Vial 1321 Ceftazidime 1Gm / Vial Inj ( 1 Gm / Vial ) , Injection Solution For 1322 Ceftriaxone Inj 500Mg Vial 1323 Ceftriaxone+Tazobactum ( 1Gm+125Mg, Vial ) , Injection 1324 Ciprofloxacin 0.3% ( 5Ml Vial ) , Eye Drop 1325 Ciprofloxacin 500Mg + Tinidazole 600Mg Tab 1326 Cough Syrup ( Each 5Ml Contains Ammonium Chloride 138Mg, Diphenhydramine Hcl 14.08Mg, Sodium Citrate 57.03Mg, Menthol 2.5Mg ) 1327 Dextromethorphan 10Mg / 5Ml Syrup ( 100 Ml Bottle ) , Syrup 1328 Dextrose 5% Inj 500Ml Ffs / Bfs Bottle ( ) , Bottle 1329 Dextrose With Saline 5% + 0.9% Inj 500Ml Ffs / Bfs Bottle 1330 Diclofenac Sodium + Paracetamol +Serratiopeptidase 50 Mg +325 Mg + 10 Mg Tab 1331 Diclofenac Sodium 25 Mg / Ml ( 3Ml Amp ) , Injection 1332 Diclofenac Sodium 50Mg + Paracetamol 325Mg Tab 1333 Diclofenac Sodium Tab 50 Mg 1334 Dispersible Zinc ( 20Mg ) , Tablet 1335 Enoxaparin ( 20Mg / 0.2Ml ) ( 0.2 Ml Prefilled Syringe ) , Injection 1336 Enoxaparin Sodium 40Mg ( 20Mg / 0.2Ml ) Prefilled Syringe Inj Syrings 1337 Enoxaparin ( 40Mg Equivalent To- 4000 Iu Vial / Pfs ) , Injection 1338 Enoxaparin ( 60Mg Equivalant To- 6000 Iu Vial / Pfs ) , Injection 1339 Formaldehyde ( Formalin ) 37% Acq Dilute 34 Ml Formaledehyde Solution With Water To Produce 100Ml ( 450 Ml Bottle ) 1340 Human Anti D. Immunoglobulin ( Monoclonal ) ( 300Mcg / Vial ) , Injection 1341 Inj. Ceftriaxone ( 1G ) 1342 Meropenam 500Mg Inj 1343 Meropenem 250 Mg / Vial ( 250Mg / Vial ) , Injection 1344 Meropenem ( 1000 Mg ( Vial ) ) , Injection 1345 Metformin ( 500 Mg ) , Tablet 1346 Nicotine 14 Mg Tab 1347 Nicotine 2 Mg Tab 1348 Nicotine 4 Mg Tab 1349 Nicotine Transdermal Patch 21 Mg 1350 Nicotine Transdermal Patch 7 Mg 1351 Norfloxacine 400Mg And Tinidazole 600Mg Tablet 1352 Ofloxacin + Ornidazole ( 200Mg And 500Mg ) , Tablet 1353 Ofloxacin Tab - 200Mg 1354 Pantaprazole 40Mg Tab 1355 Paraffin Liquid ( Liquid Paraffin 1.25Ml + Milk Of Magnesia 3.75Ml + Sodium Picosulphate 3.33Ml ) - Syrup 1356 Pentaprazole Inj. - 40Mg 10Ml Vial ( ) , Injection Solution 1357 Piperacillin + Tezobactin ( 4.5 G ) , Injection 1358 Povidone Iodine Solution-5% ( 500 Ml ) , Bottle 1359 Providone Iodine + Metronidazole 5 % + 1 % 15 Gm Tube 1360 Rabies Vaccine Ip Human Cell Culture 2.5 Iu / Dose ( Intra Muscular Use ) 1361 Ringer Lactate Inj Iv 500Ml Ffs / Bfs Bottle ( ) , Injection Solution 1362 Snake Venom Anti Serum Ip Liquid Form ( ) , Injection 1363 Sodium Chloride 0.9% Injection Ip 100Ml Bottle ( ) , Injection Powder 1364 Sodium Chloride Inj Iv 500Ml Bottle ( ) , Injection Solution 1365 Streptokinase Inj 15 Lac Iu 1366 Syp. Antacid Mint Flavour 170Ml Syrup 1367 Ampicillin ( 500 Mg / Vial ) , Injection 1368 Ampicillin Trihydrate ( 500Mg ) , Capsule 1369 Human Anti D. Immunoglobulin ( Polyclonal ) Bp / Ep / Usp / Ip ( 300Mcg / Vial ( Vial / Pfs ) ) , Injection 1370 Ceftrixone 250 Gram Inj 1371 Inj .Paracetamol Amp. 1372 Inj. Cefotaxime 1 Gram 1373 Inj. Cefotaxime 250 M, G 1374 Inj. Ceftazidime 1 Gram 1375 Inj. Diltizam30 Mg 1376 Ofloxacin + Ornidazole ( 200Mg And 500Mg ) , Tablet 1377 Inj. Tetanus Toxoid 5Ml Vial 1378 Tab Misoprostrol 200 Mcg 1379 Albumin 100 Ml Bottle ( Each ) 1380 Albumin 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) 1381 Albumin ( Mfg- Pathogyme Diagnostics ) ( 200 Ml ( 4 X 50 Ml ) ) 1382 Bcg ( 1 Ml Each ) Syringe 1383 Chlorquine Phosphate 64.5 Mg / Ml, 5 Ml Inj 1384 Dexamethasone + Gentamycin Eye Drop 0.1%+0.3% 1385 Dextrose 25 %, 25 Ml Inj 1386 Diclofenac Sodium Injection, 3Ml 1387 Diphenhydramine Inj 50Mg / Ml 1388 Drop Paracetamol 100Mg / 15Ml 1389 Dusting Powder, 10 Gm ( Neomycin Sulphate 5 Mg, Baccitracin 250 Unit, Sulphacetamide Sodium 60 Mg ) 1390 Ferric Ammonium Citrate 200Mg, Folic Acid 0.5Mg Tab 1391 Halothane 200Ml 1392 Heparin And Benzyl Nicotinate 20Mg Oint. 1393 Heparin Sodium Benzyl Nicotinate Oint 1394 Hydrocortisone Sodium Succinate Inj. 200 Mg / Vial 1395 Hydrogen Peroxide ( Conc. ) H2o2 ( 500 Ml ) 1396 Inj. B-Complex 30Ml 1397 Inj. Diclofenac 30Ml 1398 Inj. Heamocoagulase 1Cu 1Ml 1399 Inj. L-Ornithine L-Aspartate 10Ml 1400 Inj. Meropenam 125Mg 1401 Inj. Primacort Hydrocotisone 200 Mg 1402 Inj. Sigmacrome ( Obrochrome ) 10Ml 1403 Iron & Folic Acid Entric Coated 100Mg, Of Elemental Iron ( Adult ) +Fa 1.5Mg Tab. 1404 Iv Dextrose 40% 1405 Labetalol 5 Mg / Ml, 2 Ml Inj 1406 Nimesulide Oint Gel 20Gm 1407 Oint. Gentamycin Sulphate 15Gm 1408 Tannic Acid With Glycerine ( Gum Paint ) 80% + 20% 10 Ml Vial ( 10 Ml ) , Lotion 1409 Inj. Myopyrolate 5Ml Ampule 1410 Inj. Pheneramine Malate 1411 Paracetamol Suppository 400 Mg 1412 Glycine 1.5% 3 Litre Bottle 1413 Normal Saline 0.45% 3 Litre Bottle 1414 Inj. Carboprost / Prostodin 1415 Inj. Methergin 0.24 1416 Inj.Human Chorionic Ganadotraphin 2000U 1417 Tab. Cabergoline 0.5 Mg 1418 Tab. Bromocriptine 50 Mg, 25 Mg 1419 Tab. Letrozole 2.5 Mg 1420 Tab. Pyridoxine 25 Mg 1421 Inj . Methotrexate 1422 Tab. Methotrexate 7.5Mg Tab 1423 Inj. Largactil 1424 Inj. Duvadilon ( Lsoxsuprine ) 1425 Inj. Hydrallazine 1426 Tab. Medroxy Progesteione Acetrate 10 Mg 1427 Tab Piracetam 800Mg 1428 Inj.Human Chorionic Ganadotraphin 5000U 1429 Tab Citicholine 500Mg 1430 Tablet Tamsulosin Dutasteride 1431 Cream Sucralfat 20Gm 1432 Ad Syringe 0.1 Ml 1433 Ad Syringe 0.5 Ml 1434 Barium Chloride Powder ( Powder ) , Consumable 200Gm 1435 Benedicts Solution ( Qualitative ) 100Ml 1436 Black Disinfectant Fluid ( Phenyl ) As Per Schedule O Grade - Iii Per Lit 1437 Black Disinfectant Fluid ( Phenyl ) Strength : Specification As Per Schedule O Grade - I Per Lit 1438 Blood Cell Counter Key ( Key ) , Consumable 1439 Blood Culture Media Aerobic For Adult ( Bact / Alert Fa Plus ) , Each 1440 Bloting Paper ( Paper ) , Consumable 100 Per Pack 1441 Carbondioxide Gas In Medium Size Cylinder ( B Type ) Refilling 1442 Carbondioxide Gas In Small Size Cylinder ( A Type ) , Refilling 1443 Cetrimide 15% W / V + Chlorhexidine 1.5% W / V ( 1 Liter Bottle ) , Bottle 1444 Cetrimide + Chlorhexidine ( Conc. ) ( 15%+7.5% ) ( 1 Liter Bottle ) ( 15%+7.5% ) , Liquid 1445 Curved Blade Having Telescoping Shaft ( 10Cm-14Cm With Integrated Hand Activation Control Buttons ) , Consumable 1446 Edta Powder ( 250 Gm ) , Consumable 1447 Edta Vial With Safty Cap ( 2Ml. ) Capsule 1448 Gentian Violet Crys Sol 1% 1449 Id Wrist Band ( Identification For Mother / Child Specific Colour ) ( Wrist Band / No ) , Consumable 1450 Insulin Syringe ( Each ) , Consumable 1451 Oxidized Regenerated Cellulose Based Topical Absorbable Hemostat, Structured Non-Woven Material, With Bactericidal Property. Ease-Of-Use In Both Open And Minimally Invasive Procedures ( Size 4X 4Approved By Us Fda ) , Consumable 1452 Pistol Grip Curved Coagulating Shears With Ergonomic Handle In The Following Shaft Lengths 23 Cm. Can Seal Blood Vessels Upto And Including ( 5Mm In Diameter ) , Consumable 1453 Pistol Grip Curved Coagulating Shears With Ergonomic Handle Shaft Lengths 45 Cm. Can Seal Blood Vessels Upto And Including ( 5Mm In Diameter ) , Consumable 1454 Tri-Iodothyronine ( T3 ) , Consumable 1455 X-Ray Developer Powder ( 13.5 Liter ) , Consumable 1456 A V Fistula Sterilized Twin Needle ( 17 G ( Two Needle Pack ) ) , Consumable [ 700786 ] 1457 A.V. Blood Line ( Post Haemodialysis Tubing ) [ 700428 ] 1458 Adult - Double Lumen Catheter Set ( Size: 11.5 Fr-12 Fr, 13Cm To 15Cm ( Curved ) ) , Consumable [ 700824 ] 1459 Adult - Double Lumen Catheter Set ( Size: 11.5 Fr-12 Fr, 13Cm To 15Cm ( Straight ) ) , Consumable [ 700823 ] 1460 A-V Blood Lines With Av Pressure Transducer ( Acceptable For Fitting To All Standard Dialyzers ) With Side Tubing- ( For Heparinization And Av Pressure Monitoring ) Ce And Iso Certificate Essential With Protector For All Machines Types And Dialysers ( Medical Grade Pvc Like Of Fresenius Bain ( Dora ) , Dialife , Nipro, B Raun Browndone, Biolight Or Equivalent Post-Pump Tubing Sets Options Medical Grade Clear Tubing Guarded Access Ports For Reduced Infection Risks Parts Of Superior Quality ) , Consumable 1461 Dialysis Starting Kit Disposable:A ) Sterile Tray With Top ( Disposable ) , Size Not Less Than 30X30cm B ) Sterile Drape Size Not Less Than 45X45 Cm 1No C ) Cotton Ball 6 No D ) ( D ) Cotton Gauze Pieces 1, E ) Artery Forceps-1 No ( Disposable ) ( Mfg By Precious Life Care Pvt Ltd ) ) , Consumable [ 700770 ] 1462 Fistula Sterilized Twin Needle ( 16 G ( Two Needle Pack ) ) , Consumable [ 700785 ] 1463 Hemodialysis Fluid For Bicarb Made ( Part A 10 Ltr +Part B 500Gm 2 / Pkt ) , Consumable [ 700254 ] 1464 Hemodialysis Fluid For Bicarb Made ( Part A Powder To Make 10 Ltr + Part B 500Gm 2 / Pkt ) , Consumable [ 700822 ] 1465 Sterilant Cold Disinfectant For Dialysis Containing Peracetic Acid Hydrogen Peroxide Acetic Acid ( 5 Ltr Can ) , Consumable [ 700820 ] 1466 Sterilant Hot Disinfectant For Dialysis Containing 21% ( Approx ) Citric Acid, Malic Acid, Lactic Acid ( 5 Ltr Can ) , Consumable [ 700821 ] 1467 1.3 / 1.4 Dora Dialiser Fluid 1468 Bacilocid 500Ml Solution 1469 Backout Solution 5 Lit. 1470 Benzoin Powder ( For Lab Use ) 100Gm 1471 1 / 2 Ccs Cut Needle 48 Mm Stainless Steel Length 45 Cm Size 4 1472 1 / 2 Ccs Cut Needle 48 Mm Stainless Steel Length 45 Cm Size 5 1473 1 / 2 Ccs Cut Needle 48 Mm Stainless Steel Length 45 Cm Size 6 1474 1.3 / 1.4 Adult Dialyzer ( Dialyzer - Multiple Use- Hollow Fiber Size As Given Polysulphone Or Polyethersulfone ) 1475 1.5 / 1.6 Adult Dialyzer ( Dialyzer - Multiple Use- Hollow Fiber Size As Given Polysulphone Or Polyethersulfone ) 1476 1.5 / 1.6 Dialyzers Multiple Use Made Of Polysulphone Or Polyethersulfone Low / Middle Flux, Hi Performance Dialyser Performance Enhanced Technology With Hi Biocompatibility Housed In Medical Grade Polycarbonate Openable Ends For Easy Cleaning Caps ( For Dialysate Inlet Utlet For Safer Storage Openable Caps ( Red And Blue ) Hi Quality Sterilisation Procedure Using Gamma Radiation And Should Meetings Standards Of European Ce / Iso13485:2003Sterlised ) , Consumable 1477 1%W / V Available Iodine In A Non-Oxynol With Soluble Iodine Suractant Base With Sodium Iodide ( < 1% W / V And Surfactant < 5% W / V 500 Ml ) , Consumable 1478 5-0 Da Polyglactin 910 Coated With Polyglactin 910 And Calcium State Mono With 1 / 4 Circle Spatulated Needle ( 12 Foils / Pkt ) 1479 5Mm Lap Dissecting Hook ( 32 Cm Long ) , Consumable 1480 Abdominal Belt ( 32 Inch Each ) , Consumable 1481 Abdominal Belt ( 34 Inch Each ) , Consumable 1482 Abdominal Belt ( 36 Inch Each ) , Consumable 1483 Abdominal Belt ( 38 Inch Each ) , Consumable 1484 Abdominal Drain Set 28 No 1485 Abdominal Drain Set 32 No 1486 Absolute Alcohol ( Ethanol ) ( 1X500 Ml = 500 Ml ) , Consumable 1487 Absorbable Gelatine Sponge Ip 80Mm X 50Mm X 10Mm 1488 Absorbent Cotton Roll 100 Gm Each Consumable 1489 Absorbent Cotton Wool Ip 500 Grms ( Each ) , Consumable 1490 Acd-A Solution 500Ml, Model : Pb-1Ac500j8b ( Packing Size : 2 Bags / Foil Or 12 Foils / Box ) , Consumable 1491 Acetic Acid - Solution ( 3% 100 Ml Bottle ) , Consumable 1492 Acetone Detection Kit ( 100 Gm ) , Powder 1493 Acetone Solution ( 100 Ml Bottle ) , Consumable 1494 Adhesive Plasters Usp 7.5 Cm X 5 Mts / Roll 1495 Adhesive Roll 1 Inch X 5 M / Roll 1496 Adult - Double Lumen Catheter Set 11.5 F-12 Fr, 13Cm ( Curved ) , Kit 1497 Adult - Double Lumen Catheter Set 11.5 F-12 Fr, 13Cm ( Straight ) , Set 1498 Adult - Double Lumen Catheter Set ( Size: 11.5 Fr-12 Fr, 13Cm ( Curved ) ) , Consumable 1499 Adult - Double Lumen Catheter Set ( Size: 11.5 Fr-12 Fr, 14Cm ( Curved ) ) , Consumable 1500 Adult - Double Lumen Catheter Set ( Size: 11.5 Fr-12 Fr, 15Cm To ( Straight ) ) , Consumable 1501 Advanced Rfenergy Hand Instrument Of 5Mm Shaft Diameter For Laparoscopic Procedure With Shaft Length 35Cm With 55Degree Articulation And Should Be Both Hand ( Foot Activated ) , Consumable 1502 Advanced Rfenergy Hand Instrument Of 5Mm Shaft Diameter For Laparoscopic Procedure With Shaft Length 35Cm With 55Degree Articulation And Should Be Both Hand ( Foot Activated With Curved Tip ) , Consumable 1503 Advanced Rfenergy Hand Instrument Of 5Mm Shaft Diameter For Open Procedure With Shaft Length 14Cm And Should Be Both Hand And ( Foot Activated ) , Consumable 1504 Advanced Rfenergy Hand Instrument Of 5Mm Shaft Diameter For Open Procedure With Shaft Length 25Cm And Should Be Both Hand And ( Foot Activated ) , Consumable 1505 Advanced Rfenergy Hand Instrument Of 5Mm Shaft Diameter For Open Procedure With Shaft Length 35Cm And Should Be Both Hand And ( Foot Activated ) , Consumable 1506 Advanced Rf Energy Hand Instruments Of 12Mm Shaft Diameter For Open Procedures With Shaft Lengths ( 22Cm And Should Be Both Hand & Foot Activated ) , Consumable 1507 Advanced Rf Energy Hand Instruments Of 5Mm Shaft Diameter For Laparoscopic Procedures With Shaft Lengths ( 35Cm And Should Be Both Hand & Foot Activated With Curved Tip ) , Consumable 1508 Advanced Rf Energy Hand Instruments Of 5Mm Shaft Diameter For Laparoscopic Procedures With Shaft Lengths ( 45Cm And Should Be Both Hand & Foot Activated ) , Consumable 1509 Advanced Rf Energy Hand Instruments Of 5Mm Shaft Diameter For Open Procedures With Shaft ( Lengths 14Cm And Should Be Both Hand & Foot Activated With Curved Tip ) , Consumable 1510 Advanced Rf Energy Hand Instruments Of ( 5Mm Shaft Diameter For Open Procedures With Shaft Lengths 25Cm And Should Be Both Hand & Foot Activated With Curved Tip ) , Consumable 1511 Alkaline Phosphatase ( Alp ) Dea 300 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1512 Alkaline Phosphatase Kit ( Kinetic ) 10X2.2Ml 44 Test / Kit Consumable 1513 Alkaline Phosphate ( 100 Ml ( 5 X 20 ) ) , Consumable 1514 Alkaline Phosphate Kit ( Autospan ) 25 Kit 1515 Alkaline Phosphate Kit ( Erba ) 25 Kit 1516 Alphacypermetherin 5% Wdp ( As Per Attached Specifications In Rc ( Confirming To Is 15603 Standards To Be Supplied In In 25Kg Or 20Kg Pack . 1 Metric Ton ) ) , Consumable 1517 Alt / Gpt 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1518 Aluminium Potassim Sulphate ( Each ) , Consumable 1519 Ambu Bag / Adult Each -1700Ml, With Oxygen Connecting Tube , Should Be Supplied With A Carry Pouch , Ambu Bag Should Be Complete With Required Autoclavable Valves And Other Accessories, ( Should Have Silicon Rubber Bellow To Withstand Autoclave At 134 Deg.C ) , Consumable 1520 Ambu Bag Adult ( Silicon ) ( Each ) , Consumable 1521 Ambu Bag Child ( Silicon ) ( Each ) , Consumable 1522 Ambu Bag / Resuscitator Silicon 200-250 Ml Infant Size-Each, With Oxygen Connecting Tube , Should Be Supplied With A Carry Pouch , Ambu Bag Should Be Complete With Required Autoclavable Valves And Other Accessories, ( Should Have Silicon Rubber Bellow To Withstand Autoclave At 134 Deg.C ) , Consumable 1523 Ambu Bag ( Silicon Type ) Paediatrics Each 1400-1700 Ml With Oxygen Connecting Tube , Should Be Supplied With A Carry Pouch , Ambu Bag Should Be Complete With Required Autoclavable Valves And Other Accessories, ( Should Have Silicon Rubber Bellow To Withstand Autoclave At 134 Deg.C ) , Consumable 1524 Ammonium Sulphate ( Analar ( Gr / Ar ) ( 1X500 Gm = 500Gm ) , Consumable 1525 Amunation Boot, Per Pair As Per Measurment 1526 Ankle Boot, Per Pair As Per Measurment 1527 Anti A1 Lection Sera5 Ml Vial ( Each ) , Consumable 1528 Anti Abd Grouping Serum 3X10ml Consumable 1529 Anti Ab Sera Igm 5 Ml Vial ( Each ) , Consumable 1530 Anti A Sera Igm ( 10 Ml Vial ) , Consumable 10Ml 1531 Anti B Sera Igm ( 10 Ml Vial ) , Consumable 1532 Anti-D ( Polyvalent ) ( 1X10 Ml ) , Consumable 1533 Anti D Sera Igg+Igm 10Ml Vial ( Each ) , Consumable 1534 Anti H Sera 10 Ml Vial ( Each ) , Consumable 1535 Apit ( 2X4 Ml ) , Consumable 1536 Apo-A ( 100 Tests ) , Consumable 1537 Apo-B ( 100 Tests ) , Consumable 1538 Aso Kit ( 25 Test / Packet ) 1539 Ast / Got 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1540 Auto Cleanser For Cbc Machine ( 4 Liter ) , Consumable 1541 Auto Dill Solution For Cbc Machine ( 20 Liter ) , Consumable 1542 Auto Lyser Solution For Cbc Machine ( 500Ml ) , Consumable 1543 Auto Pippets Fixed Volume 1000 Micro Liters Each 1544 Auto Pippets Fixed Volume 10 Micro Liters Each 1545 Auto Pippets Fixed Volume 20 Micro Liters Each 1546 Babcock- Laparoscopic 10Mm A Traumatic Babcock, Straight 360 Degree Rotating With Insulated Shaft, A Traumatic Jaws With Ratchet Mechanism, Plastic Grip ( 36 Cms Length, Independently Moving Jaws ) , Consumable 1547 Babcock- Laparoscopic 5Mm A Traumatic Babcock, Straight 360 Degree Rotating With Insulated Shaft, A Traumatic Jaws With Ratchet Mechanism, Plastic Grip ( 36 Cms Length, Independently Moving Jaws ) , Consumable 1548 Baby Diapers Small ( 10 Diaper Per Pkt ) 1549 Baby Oxygen Mask Set Of All Sizes 1550 Balanced Salt Solution 500 Ml Bottle ( Each ) , Consumable 1551 Barium Chloride 10% ( 500 Ml Bottle ) 1552 Barium Chloride 10% ( Mfg- Precious Life Care Pvt Ltd ) ( 500 Ml Bottle ) , Consumable 1553 Basic Carbol Fuchsin For Afb Staining 25 Gm / Pkt 1554 Basic Carbol Fuchsin For Afb Staining ( Mfg- Precious Life Care Pvt Ltd ) ( 25 Gram / Packet ) , Consumable 1555 B.B. Silk 6 Reels X 25 Mts Length 25 Mts.Black Braided Silk Without Needle In Reels Non Absorbable Surgical Sutures Usp-, 2-0 ( 6 Reels Is Per Box Rate Should Be Quoted For 6 Reels ) , Surgical Material 1556 B.B. Silk 6 Reels X 25 Mts Length 25 Mts. Black Braided Silk Without Needle In Reels Non Absorbable Surgical Sutures Usp 3-0 ( 6 Reels Is Per Box Rate Should Be Quoted For 6 Reels ) , Consumable 1557 B.B. Silk 6 Reels X 25 Mts Size:1 / 0 ( 6 Reels Is Per Box Rate Should Be Quoted For 6 Reels ) , Surgical Material 1558 B.B. Silk 6 Reels X 25 Mts Size:3 / 0 Length 25 Mts 1559 B.B Silk Size-3 / 0 ( 12 Foils / Pkt ) ( 3 / 8Cir Rcut Needle 26Mm Length 76 Cm ) , Needle 1560 B.B Silk With 1 / 2 Cir Rb Needle 20 Mm Length 75 Cm Non Absorbable Surgical Suture Usp Size 3-0, ( 12Foils / Pkt ) , Needle 1561 B.B Silk With 1 / 2 Cir Rb Needle Size:2 / 0 30 Mm Length 75 Cm Surgical Material 1562 B.B Silk With 1 / 2 Cir Rb Needle Size:3 / 0 20 Mm Length 75 Cm 1563 B.B Silk With 1 / 2 Cir Rb Needle Size:4 / 0 20 Mm Length 75 Cm, 12 Foils Per Packet 1564 Benedicts Qualitative Reagent ( 1X5 Lit ) , Consumable 1565 Serum Bilirubin Total / Direct ( Autospan / Erba ) Kit Each 1566 Bilirubin ( Direct ) As 300 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1567 Bilirubin Kit ( Colorimeter Semi Auto ) 4X60 Ml 480 Test / Kit Consumable 1568 Bilirubin Standard 1X5 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1569 Bilirubin ( Total ) 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1570 Biochemistry Calibrator 5X5 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1571 Biochemistry Control Serum L1 ( 5X5 Ml ) , Consumable 1572 Biochemistry Control Serum L1 5X5 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1573 Biochemistry Control Serum L2 ( 5X5 Ml ) , Consumable 1574 Biochemistry Control Serum L2 5X5 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1575 Black-Braided Silk With 1 / 2 Cir Cd Cutting Needle 16 Mm Length 75 Cm 3 / 0 ( 14 Foils / Pkt ) 1576 Black-Braided Silk With 1 / 2 Cir Length 75 Cm Size 3 / 0 ( 12 Foils / Pkt ) , Consumable 1577 Black-Braided Silk With 1 / 2 Cir Rb Needle 20 Mm Length 75 Cm 1 / 0 13 Foils / Pkt 1578 Black-Braided Silk With 1 / 2 Cir Rb Needle 30 Mm Length 75 Cm 2 / 0 12 Foils / Pkt 1579 Blood Culture Media Aerobic For Pediatric ( Bact / Alert Pf Plus ) , Each 1580 Blood Culture Media Anaerobic For Adult ( Bact / Alert Fa Plus ) , Each 1581 Blood Culture Media Anaerobic For Pediatric ( Bact / Alert Pf Plus ) , Each 1582 Blood Culture Media Fungus- Bottles Per Year, Fungus Can Be Tested By All Quoted Bottles. In The Same Bottle Bacteria And Fungus Can Be Tested.; Fungus Can Be Tested By All Quoted Bottles. In The Same Bottle Bacteria And Fungus Can Be Tested. ( - ) , Consumable 1583 Blood Culture Media Mycobacterium Spp ( Bact / Alert Mp ( Plastic ) ) , Each 1584 Blood Gluose ( God / Pod ) ( 1000 Ml ) , Consumable 1585 Blood Urea ( Bun ) Uv ( 1000 Ml ) , Consumable 1586 Blood Urea ( Autospan / Erba ) 1587 Blood Vessel Introducers Needles 16G, Sterilized, Set 1588 Bone Wax Sterilised ( 2 Gm / Packet ) , Consumable 1589 Bovine Albumin ( 22% W / V ) ( 1X5=5 Ml ) , Consumable 1590 Bovine Albumin ( Each ) , Consumable 1591 Brain Thromboplastin ( 5Ml Bottle ( Mfg- Tulip Diagnostics ) ) , Consumable 1592 Brain Thromboplastin For Prothrombin Time ( Pt Reagent ) 5Ml ( Liquiplastin ) 1593 Calcium Arsenazo 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1594 Cannula Fixer Set Consumable 1595 Cannula Fixer Set ( Piece ) , Each 1596 Capillary Tube 100 Pieces Consumable 1597 Carbol Fuchsin For Zn Stain ( 500Ml Bottle ) 1598 Carelyte 503 ( Calibrator 1&2 ) , Consumable 1599 Carelyte 503 ( Complete Tubing Set ) , Consumable 1600 Carelyte 503 ( Enzyme Cleaning Solution ) , Consumable 1601 Carelyte 503 ( Pottasium Electrode ) , Consumable 1602 Carelyte 503 ( Pump Tubing ) , Consumable 1603 Carelyte 503 ( Refernce Electrode ) , Consumable 1604 Carelyte 503 ( Sodium Electrode ) , Consumable 1605 Carelyte 503 ( Thermal Printer Roll ) , Consumable 1606 Cassette 10 X 12 1607 Cassette 12 X 15 1608 Catgut Chromic Size:2 / 0 Length 150 Cm 1609 Catgut Chromic With 1 / 2 Cir Cutting Needle 12Mm, Length 70Cm No.3-0, 12 Foils Per Pakt 1610 Catgut Chromic With 1 / 2 Cir Rb Needle 30 Mm Length 70Cm No. 1 -0, 12 Foils Per Packet 1611 Catgut Chromic With 1 / 2 Cir Rb Needle 40 Mm Length 75Cm No. 1 Consumable 1612 Catgut Chromic With 1 / 2 Cir Rb Needle 40 Mm Length 75Cm No. 2 Consumable ( Each ) , Consumable 1613 Cell Clean For 5-Part Hematology Analyser ( Model : Sysmex Xs-800I ( Japan ) ) ( Pack Size 50 Ml ) , Consumable 1614 Cell Pack For 5-Part Hematology Analyser ( Model : Sysmex Xs-800I ( Japan ) ) ( Pack Size 20000 Ml ) , Consumable 1615 Cell Pack, Reagent Pack For Cell Counter ( ( Erma And Mindrug ) Complete Set ) , Consumable 1616 Mindray Diluent M52 For Cbc Model No. Mindray Bc 5150 20 Lit. 1617 Mindray Lh Lyse M52 100 Ml For Cbc Model No. Bc 5150 1618 Mindray Diff Lyse M52 500 Ml For Cbc Model No. Bc 5150 1619 Mindray Cleanser M52 1 Lit For Cbc Model No. Bc 5150 1620 Mindrayauto Hematology Analyzer ( Paper Roll ) , Consumable Model No. Bc5150 1621 Central Venous Catheter Kit - Single Lumen 1622 Central Venous Catheter Kit Single Lumen 18 G 1623 Cervical Collar / Each-Soft, Medium Sized 1624 Chikungunya Card Test 1 Gg + 1 Gm ( 25 Test / Kit ) 1625 Chlorhexidine 0.5 % Propanol 70 %, 100 Ml Hand Rub 1626 Chlorhexidine Acetate 0.5 %, Medicated Gauze 1627 Cholesterol 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1628 Cholesterol Hdl Direct 160 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1629 Cholesterol Kit End Point Enzymatic Kit 50 Test / Kit 1630 Cholesterol Kit End Point Enzymatic Kit 5X20ml 200 Test / Kit 1631 Chromic ( 12 Foils / Pkt ) ( 3 / 8 Rb Needle 30 Mm, Length 76 Cm, Size - 2 / 0 ) , Needle 1632 Chromic Catgut ( 12 Foils / Pkt ) ( Size:1 / 0 Length 150 Cm ) , Consumable 1633 Chromic Catgut Monofilament With 1 / 4 Circle Reverse Cutting Needle 6-0 ( 12 / Pkt ) 1634 Chromic Catgut No 1.0 Round Dody, 40 Mm 12 Foils / Pkt 1635 Chromic Catgut , Round Body Needle No. 1.0 1636 Chromic Catgut Suture ( 12 Foils / Pkt ) ( 3 / 8 Cir R Cutting Needle 19 Mm Needle, Suture Length 76 Cm Size 4 / 0 ) , Needle 1637 Chromic Catgut Suture ( 3 / 8 Cir Rcutting Needle 16 Mm, Suture Length 76 Cm ( 5 / 0 12 Foils / Pkt ) ) , Sutures 1638 Chromic Size - 1, ( 12 Foils / Pkt ) ( 1 / 2 Cir Rb Needle 40 Mm, Length 76 Cm ) , Needle 1639 Chromic Size - 1, 12 Foils / Pkt ( 1 / 2 Cir Rb Needle 45 Mm, Length 100 Cm ) , Needle 1640 Chromic With 1 / 2 Cir Rb Needle 20 Mm Length 76 Cm, 3-0 Usp, Absorbable Surgical Suture Surgical Material 12Foils / Box 1641 Chromic With 1 / 2 Cir Rb Needle 30 Mm Length 76Cm, 2-0 Usp, Absorbable Surgical Suture Surgical Material 12 Foils / Box 1642 Chromic With 1 / 2 Cir Rb Needle 40 Mm Length 76 Cm ( With Needle ) ) Absorbable Surgical Sutures Usp, ( Size 1, 12 Foils / Pkt ) , Surgical Material 1643 Chromic With 1 / 2 Cir Rb Needle Size:1 / 0, 30 Mm Length 76Cm Absorbable Surgical Suture Surgical Material 1644 Chromic With Cd Cutting Needle 12 Mm Length 70Cm Size:3 / 0 1645 Chromic With Cd Rb Needle 30 Mm Length 76 Cm Size:2 / 0 Absorbable Surgical Suture Surgical Usp, 12 Foils / Boxmaterial 1646 Chromic With Cd.Rb Needle Absorbable Surgical Suture ( 12 Foils / Pkt ) ( 40 Mm Length 76 Cm Size:1 / 0 ) , Surgical Material 1647 Chromic With St Rb Needle ( 12 Foils / Pkt ) ( 60 Mm Length 76 Cm Size:2 / 0 ) , Consumable 1648 Citric Acid Analar / Gr / Ar ( 1X500 Gm = 500Gm ) , Consumable 1649 Cleanac-3 4000 Pack Size 5L ( Cell Counter ( Model No- Mek-6420P-Japan ) ) , Consumable 1650 Cleanac 3N-5Litre Solution ( Each ) , Consumable 1651 Cleanac-4000 Pack Size 5L ( Cell Counter ( Model No- Mek-6420P-Japan ) ) , Consumable 1652 Cleanac 5 Litre Solution ( Each ) , Consumable 1653 Close Wound Drainage Device Under Negative Pressure ( Closed Wound Suction Unit ) Size 200 Ml ( Catheter Size 16 ) , Consumable 1654 Close Wound Drainage Device Under Negative Pressure ( Closed Wound Suction Unit ) Size 200 Ml ( Catheter Size 18 ) , Consumable 1655 Cloth Based Surgical Adhesive Tape Roll ( 1 Inch X 5 Mtr / Roll ) , Consumable 1656 Coated Polyster Braided With Cd White D Needle 25 Mm ( Curved Reverse Cutting Or Curved Round Body Or Taper Cut ) Size:2 / 0 1657 Coated Polyster With Cd Green Needle 17 Mm ( Curved Reverse Cutting Or Curved Round Body Or Taper Cut ) Size:2 / 0 Length 90Cm 1658 Collagen Sheets - 10 X 10 Cm Sheet 1659 Complete Absorbable Mesh Fixation Device With Minimum Strap Length 7Mm2point Fixation To Hold The Mesh And Device Should Be Of ( 25 Absorbable Straps ) , Consumable 1660 Conc Hcl ( 1X500 Ml = 500 Ml ) , Consumable 1661 Conc Washing Solution 500 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1662 Con. ( Hno3 ) Nitric Acid ( 2.5 Liter ) , Consumable 1663 Coombs Ahg Sera 5Ml ( Each ) , Consumable 1664 Coombs Reagent 5 Ml Bottle ( Each ) , Consumable 1665 Coombs Serum ( Anti Human Globulin ) ( Polyvalent ) ( 1X5=5 Ml ) , Consumable 1666 Corrugated Drainage Sheet, Sterile, Multichannel, Single Use ( 2 Inch X 6 Inch ( Pvc ) -Piece ) , Consumable 1667 Cotton Crape Bandage 10Cm X 4M ( Box Of 10 Bandages ) 1668 Cotton Crape Bandage 15Cm X 4M ( Box Of 10 Bandages ) 1669 Cotton Delivery Belt 1670 Cover Slip 18 X 18 Mm - 10Gm 1671 Cover Slip ( 50 Per Pkt ) 18 X 18 Mm, Thickness 0.17 Mm 1672 Cpk Mb Kit ( Reckon ) 25 Test / Kit 1673 Creatine Calorimeter For Semi Auto Kinetica 4X60ml 480 Test Kit 1674 Creatinine 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 1675 Creatinine Calorimeter For Semi Auto Kinetic 4X60ml 480Test / Kit 1676 Creatinine Mfg By Ba 400 Biosystems Diagnostics Pvt Ltd ( 600 Ml ) , Consumable 1677 Creatinin Kit Consumable Each 1678 Cresent Knife ( 1 Each ) , Consumable 1679 Crp ( Hs ) ( 100 Tests ) , Consumable 1680 Crp Kit 1X100 Biolab Qualitative ) 1681 Crp Latex Slide Per Test 1682 Crp Test Kit ( Latex / Card ) ( 25 Test / Kit ) 1683 Crp Test Kit ( Latex / Card ) , Kit Of 25 Tests ( Mfg- Pathogyme Diagnostics ) ( 25 Test / Kit ) , Consumable 1684 Crp Test Kit ( Autospan ) Each 1685 Curved Scissors- Laparoscopic 5Mm Size, 360 Degree Rotating With Insulated Shaft, Non Ratchet , Plastic Grip ( 36 Cms Length, Monopolar Pin Provision For Usage With Electro Surgical Unit, Independently Moving Jaws ) , Consumable 1686 Cvp Line Complete Set 1687 Cyanemeth Solution For Hb ( Mfg By Beacon Diagnostic ) ( 5 Lit Can ) , Consumable 1688 Cytochrome Stain With Buffer ( 500 Ml ) , Consumable 1689 D-Dimer ( 10X3 Ml ) , Consumable 1690 Delivery Set 1691 Dengu Card- Antigen ( 25 Card / Pkt ) , Consumable 1692 Dengue Card Test 100 Test Kit 1693 Dengue Duo Serum Plasma 10 Test / Kit ( Sd ) 1694 Dental X-Ray Film Size 31 X 41 Mm ( 150 Films / Pkt ) 1695 Developer Powder ( 22.5 Ltr ) 1696 Developer Single Bath Liquid Concentrated Of Consistent Quality. It Sould Have Favoutable Contrast / Fog Ratio And Good Shelf Life-2 Lit Can ( To Make 9 Liters Working Solution ) ( Bromodex Mp Developer Concentrate ) 9Ltr Packing 1697 Developer Single Bath Liquid Concentrated Of Consistent Quality. It Sould Have Favoutable Contrast / Fog Ratio And Good Shelf Life-3 Lit Can ( To Make 13.5 Liters Working Solution ) ( Bromodex Mp Developer Concentrate ) 13.5 Ltr Packing 1698 Developer Single Bath Liquid Concentrated Of Consistent Quality. It Sould Have Favoutable Contrast / Fog Ratio And Good Shelf Life - ( 5 Ltr Can To Make 22.5 Liters Working Solution ) 1699 Diagnostic Strips For Urine Sugar / Albmin Packing: Amber Colored, 100 Strips / Pkt ( Mfg By - Anmol Laboratories Pvt Ltd ) , Consumable 1700 Dialysis Starting Kit Disposable:A ) Sterile Tray With Top ( Disposable ) , Size Not Less Than 30X30cm B ) Sterile Drape Size Not Less Than 45X45 Cm 1No C ) Cotton Ball 6 No D ) Cotton Gauze Pieces 1 1701 Dialysis Starting Kit Disposable:A ) Sterile Tray With Top ( Disposable ) , Size Not Less Than 30X30cm B ) Sterile Drape Size Not Less Than 45X45 Cm 1No C ) Cotton Ball 6 No D ) ( D ) Cotton Gauze Pieces 1, E ) Artery Forceps-1 No ( Disposable ) ( Mfg By Precious Life Care Pvt Ltd ) ) , Consumable 1702 Digital X Ray Film -10X12 ( 150 Films / Pkt ) 1703 Digital X Ray Film -11X14 ( 150 Films / Pkt ) 1704 Digital X Ray Film -8X10 ( 150 Films / Pkt ) 1705 Digital X-Ray Film Size 14 X 17 ( ( 100 Sheet Per Packet ) ) , Film 1706 Dionised Water 5 Ltr Cane ( Each ) , Consumable 1707 Disinfectant Renaclean Cold Sterilant ( 5 Ltr Can ) 1708 Disinfectant Renasteril Hot Disinfectant ( 5 Ltr Can ) 1709 Disinfectant With Stabilizer By 0.01%W / V Agn03 And H2p04 ( Each ) , Consumable 1710 Disposable ( 24-G Each ) , Needle 1711 Disposable Apron Consumable 1712 Disposable Cap Consumable 1713 Disposable Cup For Urine-Sputum 30Ml 80 To 90 Mm Diameter 100 / Pkt 1714 Disposable Dust Mask - Jl246c Equivalent To N-95 Mask 1715 Disposable Examination Gloves Made Of Natural Rubber Latex, Pre-Powdered, Non-Streile, Conforming To Is 15354:2003 And Amendment Thereof. Size:- Large 1716 Disposable Examination Gloves Made Of Natural Rubber Latex, Pre-Powdered, Non-Streile Medium 1717 Disposable Examination Gloves Made Of Natural Rubber Latex, Pre-Powdered, Non-Streile Small 1718 Disposable Needle 20-G-No-Isi Marked 1719 Disposable Needles 22G Consumable 1720 Disposable Needles 23G 1721 Disposable Needles 26G X 1 / 2 Consumable 1722 Disposable Needles Is 10654:2002 22G 1723 Disposable Needles Is 10654:2002 ( 23G ) , Needle 1724 Disposable Needles Is 10654:2002 24G 1725 Disposable Needles Is 10654:2002 26 G 1726 Disposable Needles Is 10654:2002 26G X 1 / 2 1727 Disposable Paper Gloves Size 7, 1 / 2 Inches Consumable 1728 Disposable Paper Gloves Size 7 Inches Consumable 1729 Disposable Plastic Appron ( Full Size ) 1730 Disposable Pricking Lancet 100 Units Consumable 1731 Disposable Pricking Lancet ( Pkt Of 200 Units ) 1732 Disposable Scalp Vein Set Size 20 No 1733 Disposable Scalp Vein Set Size 22 No 1734 Disposable Sharp Collection Containers 1.5 L 1735 Disposable Sharp Collection Containers ( 1.5 L Mfg By - Precious Life Care ) , Each 1736 Disposable Sharp Collection Containers ( 5 L ( Mfg By - Precious Life Care ) ) , Each 1737 Disposable Sharp Collection Containers 5 Ltr 1738 Disposable Spinal ( L.P. ) Needle ( 25G ) , Surgical Material 1739 Disposable Spinal Needle 18 No 1740 Disposable Spinal Needle 22 No 1741 Disposable Spinal Needle 23 No 1742 Disposable Spinal Needle, Mfg By Alpha Medicare And Devices Pvt. Ltd. ( 23 No ) , Needle 1743 Disposable Spinal Needle, Mfg By Alpha Medicare & Devices Pvt. Ltd. ( 18 No ) , Needle 1744 Disposable Spinal Needle, Mfg By Alpha Medicare & Devices Pvt. Ltd. ( 22 No ) , Needle 1745 Disposable Sterile Gloves Bis Specification Gloves, Surgical Rubber, Hypoallergic Latex, 100%, 7 Inc 1746 Disposable Sterile Gloves Bis Specification Gloves, Surgical Rubber, Made Of Hypoallergic Latex, 100%, 6 1 / 2 Inches 1747 Disposable Sterile Gloves Bis Specification Gloves, Surgical Rubber, Made Of Hypoallergic Latex, 100%, 6 Inches 1748 Disposable Sterile Gloves Bis Specification Gloves, Surgical Rubber, Made Of Hypoallergic Latex, 100%, 7 1 / 2 Inches 1749 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422, 6.5 Inch / Pair 1750 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422, 7.5 Inch / Pair 1751 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422, 7 Inch / Pair 1752 Disposable Sterile Gloves B.I.S Specification Gloves, Surgical Rubber, Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422-92, 6 Inch / Pair 1753 Disposable Sterile Gloves Isi Marked Surgical Rubber Hypoallergenic Latex 100% Powder Free 7 1 / 2 Inc 1754 Disposable Sterile Gloves Isi Marked Surgical Rubber Made Of Hypoallergenic Latex 100% Powder Free 6 1 / 2 Inches 1755 Disposable Sterile Gloves Isi Marked Surgical Rubber Made Of Hypoallergenic Latex 100% Powder Free 6 Inches 1756 Disposable Sterile Gloves Isi Marked Surgical Rubber Made Of Hypoallergenic Latex 100% Powder Free 7 Inches 1757 Disposable Sterile Gloves Isi Marked Surgical Rubber Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422-92, Powder Free 6.5 Inch / Pair 1758 Disposable Sterile Gloves Isi Marked Surgical Rubber Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422-92, Powder Free 6 Inch / Pair 1759 Disposable Sterile Gloves Isi Marked Surgical Rubber Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422-92, Powder Free ( 7.5 Inch / Pair ) , Consumable 1760 Disposable Sterile Gloves Isi Marked Surgical Rubber Made Of Hypoallergic Latex 100%, Electronically Tested Sterilized By Gamma Irradiation / Eto Is No : 13422-92, Powder Free 7 Inch / Pair 1761 Disposable Sterile Hypodermic Syringe 10Ml ( Each ) , Consumable 1762 Disposable Suction Catheter Assorted Covering All Sizes 10, 12, 14, 16, 18 Consumable 1763 Disposable Suction Catheter Size 12 1764 Disposable Suction Catheter Size 14 1765 Disposable Surgeon Cap ( Box Of 100 Caps ) 1766 Disposable Syringe 50 Ml 1767 Disposable Syringe ( For Vitamin K Inj ) ( 1Ml With Needle 26G ) , Consumable 1768 Disposable Syringes Is 10258:2002 With Needle Is 10654:2002 10Ml 1769 Disposable Syringes Is 10258:2002 With Needle Is 10654:2002 20Ml 1770 Disposable Syringes Is 10258:2002 With Needle Is 10654:2002 Cgs 10Cc ( In Ribbon Pack ) 1771 Disposable Syringes Is 10258:2002 With Needle Is 10654:2002 Cgs 2Cc ( In Ribbon Pack ) 1772 Disposable Syringes Is 10258 2002 With Needle Is 10654 2002 Cgs 5Cc In Ribbon Pack 1773 Disposable Syringes Is 10258:2002 With Needle Is 10654:2002, Mfg By Ph Health Care Pvt Ltd ( 10Ml ) , Consumable 1774 Disposable Syringes With Needle - Cgs 10Cc Consumable 1775 Disposable Syringes With Needle - Cgs 2Cc Consumable 1776 Disposable Syringes With Needle - Cgs 5Cc Consumable 1777 Disposable Syringe With Needle 20Ml Each 1778 Disposable Syringe With Needle ( 2Ml Each ) , Syrings 1779 Disposable Syringe With Needle ( 3Ml Each ) , Syrings 1780 Disposable Syringe With Needle 5Ml Each 1781 Disposable Syringe With Needle Cgs 1Cc With Mark 0-1Ml Consumable 1782 Disposable Three Layer Surgical Mask ( Box Of 100 Mask ) 1783 Dissecting Hook Having Telescoping Shaft ( 10Cm-14Cm With Integrated Hand Activation Control Buttons ) , Consumable 1784 Distilled Water 5 Litre ( Each ) , Consumable 1785 Dj Stent For Ureter 6 Fr 1786 Dj Stent For Ureter 8 Fr 1787 Double Blood Bag 450 Ml Cpda ( Each ) , Consumable 1788 Double Lumen Hoemodialysis Catheter With Pur Ext Tube 1789 Double Lumen Polyurethane Cvp Catheter 4 To 5 Fr ( Length 8 To 13 Cm ) , Consumable 1790 Double Lumen Polyurethane Cvp Catheter, 5 Fr, G-17 X 20, Length 15Cm 1791 Double Lumen Polyurethane Cvp Catheter, 5 Fr, G-17 X 20, Length 8Cm 1792 Double Lumen Polyurethane Cvp Catheter 5 Fr ( Length 13 To 15 Cm ) , Consumable 1793 Dpx ( 1 X 250 Lit ) , Consumable 1794 Drabkin Solution For Hb ( 1X5 Lit ) , Consumable 1795 Ea- 50 ( Modified ) ( For Cytology ) ( 1X125 Ml ) , Consumable 1796 Ecg Jelly 250 Gms 1797 Ecg Paper ( Chemical Coated ) 50Mm X 20Mm Roll 1798 Ecg Paper ( Chemical Coated ) 50Mm X 30 Mtr. Roll 1799 Ecg Paper ( Chemical Coated ) ( 80Mmx 20 Mtr Each ) , Consumable 1800 Ecg Paper Computerizesd Triple Channel 20M 1801 Ecg Paper Computerizesd 6 Channel 20M 1802 Ecg Paper Computerizesd 12 Channel 20M 1803 Ecg Roll Three Channel 20M 1804 Ecg Roll 112 Mm 1805 Ecg Roll 108 Mm 1806 Serum Cholesterol Kit ( Autospan / Erba ) 1807 Esr Tube ( Western Green ) 1808 Esr Tube Stand ( Western Green ) 1809 Edta K3 Vial Each 1810 Edta Solutions K3 ( 500 Ml ) 1811 Edta Solutions K3 ( Mfg By ) ( 500 Ml Bottle ) , Consumable 1812 Edta Vaccutainer 3 Ml + Needle ( Each ) , Consumable 1813 Edta Vial Consumable Each 1814 Egc Roll 66 Mm X 15 Mm 1815 Egc Roll, Mfg By Life-O-Line Technologist ( 66 Mm X 15 Mm Roll ) , Consumable 1816 Ehrilichs Aidehyde Reagen ( 2X250 Ml ) , Consumable 1817 Electrolyte Solution A 250Ml ( 250Ml ) , Consumable 1818 Electrolyte Solution B 250Ml ( 250Ml ) , Consumable 1819 Endotracheal Tube Internal Dia 2.5 Mm To 5 Mm 1820 Endotracheal Tube Internal Dia 5.5Mm To 9.5Mm 1821 Endotracheal Tube Internal With Radioopaque Line ( Dia 2.5 Mm To 5 Mm ) , Consumable 1822 Endotracheal Tube, Soft Cuff Towards The Distal End Kink Resistant Inflation Tube Murphy Eye At Distal End With Polished Smoothness Standard 15 Mm Connector Sterile, Single Use Curved Shaped Blister Pack-Suiting The Shape Of Product ( Size 3 ) , Tube 1823 Endotracheal Tube, Soft Cuff Towards The Distal End Kink Resistant Inflation Tube Murphy Eye At Distal End With Polished Smoothness Standard 15 Mm Connector Sterile, Single Use Curved Shaped Blister Pack-Suiting The Shape Of Product ( Size 4 ) , Tube 1824 Endotracheal Tubes Size 5.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Combi Blister Pack 1825 Endotracheal Tubes Size 5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1826 Endotracheal Tubes Size 6.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1827 Endotracheal Tubes Size 6 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1828 Endotracheal Tubes Size 7.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1829 Endotracheal Tubes Size 7 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1830 Endotracheal Tubes Size 8.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1831 Endotracheal Tubes Size 8 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1832 Endotracheal Tubes Size 9.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue Line 1833 Endotracheal Tubes Size 9.5 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Line ( Size 9.5 ) , Consumable 1834 Endotracheal Tubes Size 9 Cuffed Should Have Low Pressure High Volume Cuff And Radio Opaque Blue ( 25 Each ) , Consumable 1835 Endotreheal Tube Size 3 Cuffed -Piece, Should Have Silicon Tube With Radio Opaque Blue Line 1836 Endotreheal Tube Size 4 Cuffed -Piece, Should Have Silicon Tube With Radio Opaque Blue Line 1837 Enema 100 Ml ( Sodium Acid Phosphate 10 Gm, Sodium Phosphate 8 Gm / 100 Ml ) 1838 Eosin 2% Solution ( 1X250 Ml ) , Consumable 1839 Esbachs Reagent ( 125 Ml ) , Consumable 1840 Exchange Transfusion Catheter With Four Way Adaptor Size- 4 Cm, L-40 Cm 1841 E-Z Cleaner 100Ml ( Each ) , Solution 1842 Factor Ix Deficient Plasma ( <1% ) ( 10X1 Ml ) , Consumable 1843 Factor Vii Deficient Plasma ( <1% ) ( 10X30 Ml ) , Consumable 1844 Fauchets Reagents ( 125 Ml ) , Consumable 1845 Fdp Kit ( 4 Ml ) , Consumable 1846 Feeding Tube ( Catheter ) 10G 1847 Femoral Catheters Double Lumen Kit Curved Double Lumen Catheter Set 12 F ( Curved ) Adult, Set 1848 Femoral Catheters Single Lumen Set Adult ( Size - 6F To 8F, Length 13 Cm To 15 Cm ) , Consumable 1849 Femoral Catheters Single Lumen Set Pediatric ( Size - 3F To 4F, Length 13 Cm To 15 Cm Or Less ) , Consumable 1850 Femoral Catheters Single Lumen Size Adult ( Set Of 12 Different Sizes ) , Set 1851 Femoral Catheters Single Lumen Size Size Pediatrics ( Set Of 12 Different Sizes ) , Set 1852 Femoral Guide Wires : Straight ( 0.325 Mm Size ) Should Meet The Following Standards : European Ce, Iso13485, Sterile, Fda, Set 1853 Femoral Guide Wires : Straight / J Tip ( ( 0.325 Mm Size ) Sterile: Ce / Iso13485 Marked ) , Consumable 1854 Field Stain A 500Ml 1855 Field Stain A ( Mfg- Precious Life Care Pvt Ltd ) ( 500 Ml Bottle ) , Consumable 1856 Field Stain B 500Ml 1857 Field Stain B ( Mfg- Precious Life Care Pvt Ltd ) ( 500 Ml Bottle ) , Consumable 1858 Filter Paper Sheet ( ( Whatmann No 01 ) Sheets ) , Consumable 1859 Fistula 16G, Single Sterilized Eto Single Needle Packing 1860 Fistula 17G, Single Sterilized Eto Single Needle Packing 1861 Fistula And Wound Management System ( Size 104-159 Mm ) , Consumable 1862 Fistula And Wound Management System ( Size 156-228 Mm ) , Consumable 1863 Fistula And Wound Management System ( Size 208-297 Mm ) , Consumable 1864 Fistula Sterilized Twin Needle ( 16 G ( Two Needle Pack ) ) , Consumable 1865 Fixer: It Shall Be Powder Fixer To Produce Clean Radiographs Available In Pack Size Size:- 13.5 Ltr 1866 Fixer: It Shall Be Powder Fixer To Produce Clean Radiographs Available In Pack Size Size:- 9 Ltr 1867 Fixer Powder ( Bromex Acid Fixer With Hardner ) ( 22.5 Ltr / Pkt ) 1868 Flow Regulator ( Dial Flow ) ( Each ) , Consumable 1869 Foldable Iol Sterile Lens + 18.5 D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1870 Foldable Iol Sterile Lens +18D ( Each ) , Lens 1871 Foldable Iol Sterile Lens + 18D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1872 Foldable Iol Sterile Lens + 19.5D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1873 Foldable Iol Sterile Lens +19D ( Each ) , Lens 1874 Foldable Iol Sterile Lens + 19D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1875 Foldable Iol Sterile Lens + 20.5D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1876 Foldable Iol Sterile Lens +20D ( Each ) , Lens 1877 Foldable Iol Sterile Lens + 20D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1878 Foldable Iol Sterile Lens + 21.5D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1879 Foldable Iol Sterile Lens +21D ( Each ) , Lens 1880 Foldable Iol Sterile Lens + 21D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1881 Foldable Iol Sterile Lens + 22.5D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1882 Foldable Iol Sterile Lens +22D ( Each ) , Lens 1883 Foldable Iol Sterile Lens + 22D ( Usfda Approved, As Per Specification ) ( Each ) , Consumable 1884 Foldable Iol Sterile Lens Pc+14D ( Lens-2 ) , Pc+16D ( Lens-3 ) , Pc+18D ( Lens-5 ) , Pc+19D ( Lens-5 ) , Pc+19.5D ( Lens-5 ) , Pc+20D ( Lens-15 ) , Pc+20.5 ( Lens-15 ) , Pc+21D ( Lens-13 ) , Pc+21.5D ( Lens-11 ) , Pc+22D ( Lens-11 ) , Pc+22.5D ( Lens-5 ) , Pc+23D ( Lens-5 ) , Pc+24D ( Lens-3 ) , Pc+26D ( Lens-2 ) ( 100 Lens Per Box ) , Lens 1885 Foleys Catheter Size 12-2 Way ( 10 Each ) , Consumable 1886 Foleys Catheter Size 14-2 Way 1887 Foleys Catheter Size 14-3 Way 1888 Foleys Catheter Size 18- 2 Way 1889 Foleys Catheter Size 20-2 Way ( 12 Each ) , Consumable 1890 Foleys Catheter Size 22-2 Way ( 13 Each ) , Consumable 1891 Foleys Catheter Size 24-2 Way ( 14 Each ) , Consumable 1892 Foleys Urinary Catheter 2 Way ( Size 22 Each ) , Consumable 1893 Foleys Urinary Catheter 2 Way Size 8 1894 Foleys Urinary Catheter 3 Way Size 12 1895 Foleys Urinary Catheter 3 Way Size 16 1896 Foleys Urinary Catheter 3 Way Size 18 1897 Foleys Urinary Catheter 3 Way Size 20 1898 Foleys Urinary Catheter 3 Way Size 22 1899 Foleys Urinary Catheter Pediatrics Size 10 1900 Foleys Urinary Catheter Silkolatex 2 Way Sterile, Non Toxic Size 10 1901 Foleys Urinary Catheter Silkolatex 2 Way Sterile, Non Toxic Size 10 1902 Foleys Urinary Catheter Size 16 2 Way 1903 Formaldehyde 40% ( Conc. Formaline ) ( 1 X 30 Lit ) , Consumable 1904 Formaldehyde ( Formolene Liquid 450 Ml 1905 Formaldehyde ( Formolene ) Tab 1906 Fouchets Reagent ( 100 Ml Bottle ) 1907 G6pd Deficiency Test Kit - 10 Test 1908 Gauze Sponge / Each ( Size 3 X 3 ) , Consumable 1909 Gauze Swab / Pad 4 Layer 20X40 1910 Gauze Swab / Pad 6 Layer 10 × 10 1911 Gauze Swab / Pad 6 Layer 20 × 20 1912 Gentian Violet ( Gram Stain ) 100Ml Bottle 1913 Giemsa Stain ( Merck / Span ) ( 125 Ml ) , Consumable 1914 Glacial Acetic Acid ( 2.5 Liter ) , Consumable 1915 Glass Slide 75Mm X 25Mm 1.1 Mm 1916 Glass Slide 75Mm X 25Mm 1.35 Mm 1917 Glass Slide 75Mm X 25 Mm ( 50 Slide / Pkt ) - Thickness-1.35Mm, Detail Specifications-I-With Smooth Edges, Without Any Scrathtches. Ii-Glazed Glass.Iii-No Visual Or Chromatic Abbretions 1918 Glass Test Tube 12 X 100 ( Medium Size ) Heavy Quality 100 / Pkt 1919 Glass Test Tube 12 X 75 ( Small Size ) Heavy Quality 100 / Pkt 1920 Glass Test Tube 5 Without Edge 1921 Gloves Latex Autoclavable 8 No ( Pair ) Made Of Natural Latex Micro Rough Finish For Better Grip 1922 Glucometer Strip ( 1X100 ) 1923 Glucometer Strips 1*50 , Consumable 1924 Glucose Kit ( God / Pod ) 500Ml 1925 Blood Glucose Kit ( Autospan / Erba ) 1926 Glucose Pouch ( 100 Gram Pack ( Mfg - Bhandari Products ) ) , Consumable 1927 Glutaraldehyde Solution 2% In 5 Litre Can ( 2 Strips / Vials Per Each Can ) ( 5 Litre Can ) , Consumable 1928 Gold Chloride ( 1X1 Gm ) , Consumable 1929 Gram Iodine ( Gram Stain ) 100Ml 1930 Grasper- Laparoscopic 5Mm Straight 360 Degree Rotating With Insulated Shaft, Toothed A Traumatic Grasper With Ratchet Mechanism, Plastic Grip ( 36 Cms Length, Independently Moving Jaws ) , Consumable 1931 Guide Wire 3Mm 1932 H2so4 ( Sulphuric Acid ) ( 25% 500 Ml Bottle ) , Consumable 1933 H2so4 ( Sulphuric Acid ) ( 5% 500 Ml Bottle ) , Consumable 1934 Haematoxyline Solution ( Harris ) ( 1X125 Ml ) , Consumable 1935 Haemocoagulase 1 Nih Unit / Ml, 1 Ml Inj 1936 Haemoglobin Colour Scale With Paper Each 1937 Haemoglobinometer ( Square Tube Pattern ) 1938 Haemoglobinometer Tube ( Square Pattern ) 1939 Capillary Tube Consumable 1940 Handpiece ( Blue ) , Consumable 1941 Handpiece ( Transducer ) , Each 1942 Hba 1 C ( Glycosylated Hb ) ( 100 Tests ) , Consumable 1943 Hba Ag Elisa 96 Kit 1X96 ( Each ) , Consumable 1944 Hba Ag Rapid Card Test ( Each ) , Consumable 1945 Hbsag 25 Test Per Kit ( Sd Biolab ) 1946 Hcv Elisa ( 96 Test Kit ) , Consumable ( Sd Biolab ) 1947 Hcv Kit Card Test ( 25 Test / Kit ) , Digonstic 1948 Hdl Kit 50 Test 1949 Hdl Kit Ppt ( 2X50ml 200 Test / Kit ) , Consumable 1950 Hdl / Ldl Standard ( 1X1 Ml ) , Consumable 1951 Heamoglobin Colour Scale Book With Special Strip Complete ( 1 X 200 ) , Consumable 1952 Hematology Cell Counter Reagents As Per Requirement Of Cell Counter Cleaning Solution 100 Ml 1953 Hematology Cell Counter Reagents Dilutent ( 20 Ltr ) 1954 Hematology Cell Counter Reagents Lysis Solution 500Ml ( Each ) , Solution 1955 Hematology Cell Counter Reagents Rinse Solution ( 20 Ltr ) 1956 Hemodialysis Fluid For Bicarb Made ( Part A 10 Ltr +Part B 500Gm 2 / Pkt ) , Consumable 1957 Hemodialysis Powder For Bicarb Made ( Part A Powder To Make 10 Ltr + Part B 500Gm 2 / Pkt ) , Consumable 1958 Hemoglobin Color Scale ( Starter Kit ) Components ( 1 ) Color Scale 01 / Kit ( 2 ) Test Strip 1000 / Kit ( 3 ) Printed Literature For Method Of Use / Kit ( 4 ) Lancet -1000 / Kit 1959 Hemolynac 3N-2340 500Ml ( Each ) , Consumable 1960 Hemolynac-3N-2340 Pack Size 500 Ml ( Cell Counter ( Model No- Mek-6420P-Japan ) ) , Consumable 1961 Hiv 1+2 ( Rapid ) Per Card J Mitra 1962 Hiv 1&2 Test Cards Each 1963 Hiv Elisa Kit ( Hiv Micro Elisa Ag+Ab 4Th Generation ) ( 96 Test Kit ) , Consumable 1964 Hiv Kit Card ( 25 Test / Kit ) 1965 Hpmed Solution Consumable ( Pack Size: 16 Bottles Of 50 Ml ) , Make- Polti S.P.A. ; Model-Sani System ( Country Of Origin- Italy; ) , Consumable 1966 Hub Cutter- Non Electric Lockable Safety Portable Box For Disposal Of Hypodemic Needles. Consumable 1967 Hypodermic Needles For Single Use Bis Gauze ( 23 Length, 25 Mm +-1 ) , Needle 1968 Hypodermic Needles For Single Use -Gauze 22 Bis Length, 25 +1 / -2 1969 Hypodermic Needles For Single Use -Gauze 23 Bis Length, 25 +1 / -2 1970 Hypodermic Syringe For Single Use 10Ml Bp / Bis ( Without Needle ) 1971 Hypodermic Syringe For Single Use 1Ml, Is : 10258 ( 10 Ml Vial ) 1972 Hypodermic Syringe For Single Use 2Ml Bp / Bis ( Without Needle ) 1973 Hypodermic Syringe For Single Use 5Ml Bp / Bis ( Without Needle ) 1974 Icd Bag 1000 Ml 1975 Icd Bag, Mfg By Life-O-Line Technologist ( 1000 Ml ) , Bag 1976 Indicator Sol, For Ph ( Litmus Sol ) ( 1X500 Ml = 500 Ml ) , Consumable 1977 Individual Ast Panel For Fungus ( Ast Ys07 ) , Each 1978 Individual Ast Panel For Gram Negative Organism ( Gn N280 ) , Each 1979 Individual Ast Panel For Gram Positive Organism ( Gp P628 ) , Each 1980 Individual Identification Panel For Aerobic Gram Negative Organism ( Gnid ) , Each 1981 Individual Identification Panel For Aerobic Gram Positive Organism ( Gpid ) , Each 1982 Individual Identification Panel For Anaerobic Gram Negative Organism ( Anc ) , Each 1983 Individual Identification Panel For Anaerobic Gram Positive Organism ( Anc ) , Each 1984 Individual Identification Panel For Fungus ( Yst ) , Each 1985 Infant Feeding Tube ( 10 G Each Piece ) , Consumable 1986 Infant Feeding Tube ( 7G Each Piece ) , Consumable 1987 Infant Feeding Tube ( Catheter ) Size: 3G 1988 Infant Feeding Tube ( Catheter ) Size: 4G 1989 Infant Feeding Tube ( Catheter ) Size: 5G 1990 Infant Feeding Tube ( Catheter ) Size: 8G 1991 Infant Feeding Tube Size: 5G 1992 Infant Feeding Tube Size: 6G 1993 Infant Mucus Extractor Sterile Pvc ( Each ) , Surgical Material 1994 Instrument Sterilant 10 Minute Sporicidal Sterilant Aldehyde Free Containing Sodium Perborate ( ( 810 Grm Packet ) ) , Powder 1995 Instrument Wash 500Ml With Spray Pump 1996 Insulin Syringe 40 Units / Ml Iso 8537:2007 1997 Insulin Syringe / Each ( Graduation Upto 100 Units ) 30 G Needle, 40 Units / Ml ( 30 G Needle, 40 Units / Ml ) , Syrings 1998 Intra Camral Saline ( R.L ) - Sep- ( Eto Sterelied, Specialy ( Manufactured For Intra Camral ) , Consumable 1999 Intracath Cannula For Single Use ( Intravascular Catheters ) Bis ( Gauze 22, Length 25 ) , Consumable 2000 Intravenous Set ( Children ) With Airway And Needle 2001 Iron Alum Ferric Amino Sulphate ( 1X500 Ml = 500 Ml ) , Consumable 2002 Isopropyl Alcohol ( Propanol ) ( 1 X 2.5 Lit ) , Consumable 2003 Iv Cannula Size With Inj.Valve ( Port ) ( 18G ) , Consumable 2004 Jugular Catheters : Double Lumen Kit ( Curved ) , Set 2005 K3 Blood Vaccutainer Edta-100 Tubes / Pkt 2006 Kellys Pad Disposable 2007 Kellys Pad Rubber / Each 2008 Keratome 3.2 Keratome €“Round Stock 3.2Mm Full Handle Knives E.T.O. Sterile Angled Bevel Up 45 Deg 2009 Kit For Total Protein ( Including Albumin And Total Protein ) 100Ml Bottle 2010 Kores Indelible Ink Marker Pen 2011 K Wire Length 375Mm Size:1.6Mm Roll 2012 K Wire Length 375Mm Size:1.8Mm Roll 2013 K Wire Size:1Mm 2014 Sleeper, Per Pair All Size 2015 L-Alanyl L-Glutamine Solution For Infusion ( 20%W / V ) ( Each ) , Consumable 2016 Laser Fiber For Dental Laser , Make- Faith Inovation ; Model-Fd10b ; ( Country Of Origin- India ) , Consumable 2017 Latex Based Baloon Capacity ( 30-50Ml ) Foleys Catheter ( Size 14- 2 Way ) , Consumable 2018 Latex Based Baloon Capacity ( 30-50Ml ) Foleys Catheter ( Size 14-3 Way ) , Consumable 2019 Latex Based Baloon Capacity ( 30-50Ml ) Foleys Catheter ( Size 18- 2 Way ) , Consumable 2020 Latex Based Baloon ( Capacity 30-50 Ml ) Foleys Urinary Catheter ( 3 Way Size 20 ) , Consumable 2021 Latex Based Baloon Capacity ( 3 Ml ) Foleys Catheter ( 3 Way, Size - 12 ) , Consumable 2022 Latex Based Baloon Capacity ( 3Ml ) Foleys Urinary Catheter Peadiatrics ( 2 Way Size 8 ) , Consumable 2023 Latex Based Baloon Capacity ( 3Ml ) Foleys Urinary Catheter Peadiatrics ( Size 10 ) , Consumable 2024 Latex Examination Gloves ( Large ) , Consumable 2025 Latex Examination Gloves ( Medium ) , Consumable 2026 Latex Examination Gloves ( Small ) , Consumable 2027 Ldh Kit Pack ( 50 Ml Bottle ) , Consumable 2028 Lead Letter 0-9 Sets ( 100 Clips / Pkt ) 2029 Lead Letter A To Z Set 100 Clips Per Pack 2030 Leishmann Stain Sol With Buffer Tablet Ph ( 1X5 Lit ) , Consumable 2031 Leishman Stain 500 Ml 2032 Leishman Stain ( Mfg- Precious Life Care Pvt Ltd ) ( 500 Ml Bottle ) , Consumable 2033 Lenstip ( 1 Each ) , Consumable 2034 Light Weight Composite Mesh : Polypropylene And Polyglycolic Acid Partially Absorbable Composite Mesh With Large Pore Size 6 X 11 Cm 2035 Liquid Hand Wash Solution With Dispenser Consumable ( 500 Ml ) , Consumable 2036 Liquor Ammonia ( 500 Ml ) , Consumable 2037 Long Line Silicon Catheter, G-24, Fr-2, L-30Cm 2038 Low-Profile Titenium Chemo Port With Cilicon Catheter ( 9.6 Fr, 6.6Fr, 3.9Fr, ) Length -60Cm, Guide Wire, Peel-Away Desilet, Hubsite Needle ( 22G*20Mm ) 2039 Mackintosh Double Colour Water Proof Rubber Marked Isi Hospital Rubber Sheeting Is:4135-1974 Packing And Making : As Per Clause No 4.1 And 4.3 / Mtr 2040 Malaria Antigen Card Pf / Pv Card ( As Per Nvbdcp Guidelines ) ( 10 Card, 10 Dropper, 1 Buffer Solution ) 2041 Maryland Dissector- Laparoscopic 5Mm Curved Maryland Dissector With Tapering End, 360 Degree Rotating With Insulated Shaft, Non Ratchet , Plastic Grip ( 36 Cms Length, Monopolar Pin Provision For Usage With Electro Surgical Unit, Independently Moving ) , Consumable 2042 Masson Trichrome Staining Kits ( 100 Test ) , Consumable 2043 Measure Volume ( Drip Set ) , Each 2044 Medical X-Ray Film-Polyester Based Imaging Film 35.6Cm X 35.6Cm ( 14X14 ) Size:- 50 Sheets In One Packet 2045 Medical X-Ray Film-Polyester Based Imaging Film 35.6 Cm X 43.2Cm ( 14X17 ) Size:- 50 Sheets In One Packet 2046 Mercuric Oxide ( 25 Gm ) , Consumable 2047 Methanol ( Acetone Free ) For Leishman Staining ( 1X2.5 Lit ) , Consumable 2048 Methyl Blue For ( Z N ) 125 Ml Bottle 2049 Methyl Blue For ( Z N ) ( Mfg- Precious Life Care Pvt Ltd ) ( 125 Ml Bottle ) , Consumable 2050 Methyline Blue ( 100 Ml ) , Solution 2051 Methyline Blue 0.1% Solu. 100Ml 2052 Microalbumin Urine ( 100 Tests ) , Consumable 2053 Micro Pipet 1000 Fix And Variable Each 2054 Micropiptte Tips 100 Per Pack 2055 Microtips ( 2-200 Ul ) 1X1000 ( Each ) , Consumable Pkt 2056 Microtips Yellow ( 10-200Ul ) 1X1000 ( Each ) , Consumable 2057 Micro And Macro Tips Stand 2058 Plain Plastic Tube ( Small ) 2059 Plain Plastic Tube ( Medium ) 2060 Plain Plastic Tube ( Large ) 2061 Adhesive Bandage Strip ( Band Aid Type ) 2062 Micro Volume Drip Set 2063 Milkiwhite Gel Based Sanitizer 1.Ethinol ( Cas-64-17-5 ) 58-62% 2. Benzoil Coline Chloride 0.52% 1 % 3. ( Ph Neutral Contact Time 15 Se 4. Pack Size 100 Ml & 100 Ml With Dispensor ) , Consumable 2064 Milkiwhite Gel Based Sanitizer 1.Ethinol ( Cas-64-17-5 ) 58-62% 2. Benzoil Coline Chloride 0.52% 1 % 3. Ph Neutral Contact Time 15 Sec 4. ( Pack Size L& 500 Ml With Dispensor ) , Consumable 2065 Mindray Bc 2800, Auto Hematology Analyzer ( M 18 Cfl Lyes ) , Consumable 2066 Mindray Bc 2800, Auto Hematology Analyzer ( M 18 Cleanzer ) , Consumable 2067 Mindray Bc 2800, Auto Hematology Analyzer ( M 18 Diluent ) , Consumable 2068 Mindray Bc 2800, Auto Hematology Analyzer ( M 18 Probe Cleanzer ) , Consumable 2069 Mindray Bc 2800, Auto Hematology Analyzer ( M 18 Rinse ) , Consumable 2070 Mindray Bc 2800, Auto Hematology Analyzer ( Paper Roll ) , Consumable 2071 Mindray Bc 2800, Auto Hematology Analyzer ( Quality Control ) , Consumable 2072 Mindray Bc 5300, Auto Hematology Analyzer Part -5 ( M- 53 Cleaner ) , Consumable 2073 Mindray Bc 5300, Auto Hematology Analyzer Part -5 ( M- 53 Diluent ) , Consumable 2074 Mindray Bc 5300, Auto Hematology Analyzer Part -5 ( M- 53 Leo ( Ii ) Lyes ) , Consumable 2075 Mindray Bc 5300, Auto Hematology Analyzer Part -5 ( M- 53 Leo ( I ) Lyes ) , Consumable 2076 Mindray Bc 5300, Auto Hematology Analyzer Part -5 ( M- 53 Lh Lyes ) , Consumable 2077 Mindray Bc 5300, Auto Hematology Analyzer Part -5 ( M- 53 Probe Cleaner ) , Consumable 2078 Mindray Bc 5300, Auto Hematology Analyzer Part -5 ( Quality Control ) , Consumable 2079 Montex Test 2Tu ( 1 Vial ) , Consumable 2080 Mva Kit ( Mannual Vaccum Aspiration Kit ) 2081 Mva Kit ( Mannual Vaccum Aspiration Kit ) ( As Per Attached Specification ) ( Mfg By Women Care Global ) , Consumable 2082 N / 10 Hcl 500Ml 2083 N-95 Mask 2084 Nah2 Po4 ( Anhydrous ) Analar / Gr / Ar ( 1X500 Gm = 500Gm ) , Consumable 2085 Nasal Prong ( Each ) , Consumable 2086 Nebulization Mask-Kit ( Adult ) 2087 Nebulization Mask - Kit, Mfg By Life-O-Line Technologist ( Pediatrics ) , Consumable 2088 Nebulization Mask - Kit ( Pediatrics ) 2089 Needle Hypodermic0insulin ( Metallic Non0sterile ) Needle 2090 Needle Hypodermic Size Is 10654:2002 23G 2091 Needle Hypodermic Size Is 10654:2002 24G 2092 Neomycin And Sulfacetamide Sprinkling Powder 5 Gm ( Each ) , Consumable 2093 Neubauers Chamber ( Each ) , Consumable 2094 Non Foldable Iol Sterile Lens Ac + 18 2095 Non Foldable Iol Sterile Lens Ac + 20 2096 Non Foldable Iol Sterile Lens Pc+14D , Lens 2097 Non Foldable Iol Sterile Lens Pc+16D , Lens 2098 Non Foldable Iol Sterile Lens Pc+18D , Lens 2099 Non Foldable Iol Sterile Lens Pc+19D , Lens 2100 Non Foldable Iol Sterile Lens Pc+19.5D , Lens 2101 Non Foldable Iol Sterile Lens Pc+20 D , Lens 2102 Non Foldable Iol Sterile Lens Pc+20.5 D , Lens 2103 Non Foldable Iol Sterile Lens Pc+21 D , Lens 2104 Non Foldable Iol Sterile Lens Pc+21.5 D , Lens 2105 Non Foldable Iol Sterile Lens Pc+22 D , Lens 2106 Non Foldable Iol Sterile Lens Pc+22.5 D , Lens 2107 Non Foldable Iol Sterile Lens Pc+23 D , Lens 2108 Non Foldable Iol Sterile Lens Pc+24 D , Lens 2109 Non Foldable Iol Sterile Lens Pc+26 D , Lens 2110 Non Foldable Iol Sterile Lens Ac+19D , Lens 2111 Non Foldable Iol Sterile Lens Pc + 18.5 ( Each ) , Lens 2112 Ns-1 Elisa Dengue Kit With 96 Wells 2113 Nylon Suture, Macrofilment Spatulated, Micropoint Double Armed Size 10-0 ( 12 Foils / Pkt ) , Sutures 2114 Nylon Suture Spatulated Micropoint Reverse Cutting Needle, Double Armed Suture Size 9-0 ( 12 Foils / Pkt ) , Sutures 2115 Occult Blood Test Kit ( Haem Test Kit ) ( 1 X 100 Strips ) , Consumable 2116 Og6 ( For Cytology ) ( 1X125 Ml ) , Consumable 2117 Optia Granulocyte Depletion Set, Model : 10300 ( Packing Size : 6 Kits ) , Consumable 2118 Oxidized Regenerated Cellulose Based Topical Absorbable Hemostat, Structured Non-Woven Material, With Bactericidal Property. Ease-Of-Use In Both Open And Minimally Invasive Procedures ( Size 1X 2Approved By Us Fda ) , Consumable 2119 Oxidized Regenerated Cellulose Based Topical Absorbable Hemostat, Structured Non-Woven Material, With Bactericidal Property. Ease-Of-Use In Both Open And Minimally Invasive Procedures ( Size 2X 4Approved By Us Fda ) , Consumable 2120 Oxygen Mask Adult ( Standard Size ) 2121 Oxygen Mask Paediatric ( Standard Size ) 2122 Oxygen Nasal Cannula Neonatal 2123 Oxygen Nasal Canula ( Neonatal ) 7 White Colour Tubing And Threaded Nut 25 Pcs / Pkt 2124 Paediatric - Double Lumen Catheter Set 6.5 F - 8.5 Fr, 13Cm ( Curved ) , Kit 2125 Paediatric - Double Lumen Catheter Set 6.5 F - 8.5 Fr, 13Cm ( Straight ) , Set 2126 Paediatric Drip Set ( Set ) , Digonstic 2127 Paediatric Epidural Set ( 19G Needle, Metal Stylet, 22G Catheter, 0.22Micron Epidural Catheter Lor Syringe ) 2128 Adult Epidural Set With Catheter 2129 Pandys Reagent Csf ( 125 Ml ) , Consumable 2130 Papaniculau Stain Kit ( 125Ml Bottle ) 2131 Paper Adhesive Microporous Surgical Tape 3 Inch X 5 M / Roll ( 10 Roll / Pkt ) ( 3 Inch X 5 M / Roll ( 10 Roll / Pkt ) ) , Consumable 2132 Paper Adhesive Plaster 1 / 2 X 9.0Mts 2133 Paper Adhesive Plaster 1 X 9.0Mts 2134 Paper Adhesive Plaster Microporous Surgical Tape 1 Inch X 9 M / Roll 2135 Paper Adhesive Plaster Microporous Surgical Tape 2 Inch X 5M / Roll 2136 Paper Adhesive Plaster Microporous Surgical Tape 4 Inch X 9 M / Roll 2137 Paper Adhesive Plaster Microporous Surgical Tape 6 Inch X 10 M / Roll 2138 Paper Adhesive Plaster Microporous Surgical Tape 6 Inch X 5M / Roll 2139 Paraffin Wax Histology ( 58-60 ) ( 1X1 Kg = 1 Kg ) , Consumable 2140 Patch Buprenorphine ( 10Mcg ) , Consumable 2141 Patch Buprenorphine ( 20Mcg ) , Consumable 2142 Personal Protection Kit ( Kit ) , Consumable 2143 Pistol Grip Curvedcoagulating Shears Ergonomic Handle With Att Shaft Lenght 36Cm Can Seal Blood Vessel Upto And Inclding ( 5Mm In Diameter ) , Consumable 2144 Pistol Grip Curved Coagulating Shears With Ergonomic Handle In The ( Folloeing Shaft Lengths 36 Cm Can Seal Blood Vessels Upto And Including 5 Mm In Diameter ) , Consumable 2145 Pistol Grip Curved Coagulating Shears With Ergonomic Handle Shaft ( Langths 36 Cm Can Seal Blood Vessels Upto And Including 5 Mm In Diameter Att ) , Each 2146 Plain Disposable Vial 3Ml ( Each ) , Consumable 2147 Plain Vial ( 12 X 75 With Screw Cap Each ) , Consumable 2148 Plain Vial With Screw Cap ( 12 X 75 ) , Consumable 2149 P O P Powder 1 Kg Pkt 2150 Plastic Bottle ( 300Ml ) , Consumable 2151 Plastic Bottle ( 500 Ml ) , Consumable 2152 Platelet Dilution Fluid ( 100 Ml Bottle ) 2153 Platelet Dilution Fluid ( Mfg- Precious Life Care Pvt Ltd ) ( 100 Ml ) , Consumable 2154 Polyamide Size - 1 / 0, 12 Foils / Pkt ( 3 / 8 R Cutting Needle 45 Mm, Length 70 Cm ) , Needle 2155 Polyamide Size - 2 / 0, 12 Foils / Pkt ( 3 / 8 R Cutting Needle 45 Mm, Length 70 Cm ) , Needle 2156 Polyamide Size - 8 / 0, 12 Foils / Pkt ( 3 / 8 Cir Micro Point Spatulated 6 Mm, Length 38 Cm ) , Consumable 2157 Polyamide With Cd R Cut Extra Penetrating Needle ( 12 Foils / Pkt ) ( Size 4 / 0 ) , Consumable 2158 Polybutylate Coated With Polyester Braided ( Green ) With 1 / 2 Cir Tap Cut V-5 Da Needle 17Mm, Non-Abs Surg Suture Usp 2-0 Length 90Cm ( 12 Foils / Pkt ) 2159 Polyester Braided Coated With Cd White Dn 17 Mm Curved Rb 90Cm 2 / 0 ( 12 Foils / Pkt ) 2160 Polyester Braided Coated With Cd White Dn 17 Mm ( Curved Rev Cut ) Cut 90 Cm 2 / 0 ( 12 Foils / Pkt ) 2161 Polyester Braided Coated With Cd White Dn 17 Mm Taped Cut 90 Cm 2 / 0 ( 12 Foils / Pkt ) 2162 Polyester Braided Coated With Cd White Dn 25Mm ( Curved Rb ) 2-0 Length 90Cm ( 12 Foils / Pkt ) 2163 Polyethylene High Pressure Extension Tube, Length - 100Cm 2164 Polyethylene High Pressure Extension Tube, Length - 150Cm 2165 Polyethylene High Pressure Extension Tube, Length - 200Cm 2166 Polyglactin 30 Mm 1 / 2 Circle Round Body 90 Cm Size 1 / 0 ( 12 Foils / Pkt ) , Consumable 2167 Polyglactin 40 Mm 1 / 2 Circle Round Body 90 Cm Size 1 ( 12 Foils / Pkt ) 2168 Polyglecaprone With 1 / 2 Cir Oval Rb Needle 26 Mm Length 70 Cm ( 12 Foils / Pkt ) 2169 Polyglycolic Acid Absorbable Surgical Suture ( 12 Foils / Pkt ) ( 1 / 2 Cir Rb Needle 20 Mm, Length 70 Cm Size -3 / 0 ) , Needle 2170 Polyglycolic Acid Absorbable Surgical Suture ( 12 Foils / Pkt ) ( 1 / 2 Cir Rb Needle 40 Mm, Length 90 Cm Size -2 / 0 ) , Needle 2171 Poly L-Lysine Coated Slides ( 50 Lidess X 1 ) , Consumable 2172 Poly L-Lysine Sol ( For Immunochisto Chemistry ) ( 1X100 Ml ) , Consumable 2173 Polymaide Mono Filament ( Nylon ) With Cd Cut Needle 20 Mm Length 70 Cm Size 2 / 0 ( 12 Foils / Pkt ) 2174 Poly Propylene Mesh 15 X 15 Cm 2175 Poly Propylene Mesh 7.5Cmx15cm 2176 Poly Propylene Mono Filament Sterile Precut With 1 / 2 Cir Rb D Needle 16Mm Length 70 Cm Non Absorbable Surgical Sutures Usp Size 5 / 0 ( 12Foils / Pkt ) , Consumable 2177 Poly Propylene Mono Filament Sterile Precut With 1 / 2 Cir Rb Heavy Needle 16 Mm Length 70 Cm Non Absorbable Surgical Sutures Usp 5 / 0 ( 12 Foils / Pkt ) 2178 Poly Propylene Mono Filament Sterile Precut With 1 / 2 Cir Rb Heavy Needle 30Mm Length 70 Cm Non Absorbable Surgical Sutures Usp Size 1 2179 Poly Propylene Mono Filament Sterile Precut With 1 / 2 Cir Rb Needle 25 Mm Length 70 Cm Non Absorbable Surgical Sutures Usp Size 3 / 0 2180 Poly Propylene Mono Filament Sterile Precut With 1 / 2 Cir Rb Needle 30 Mm Length 70 Cm Non Absorbable Surgical Sutures Usp Size 1 / 0 2181 Poly Propylene Mono Filament Sterile Precut With 1 / 2 Cir Rb Needle 30 Mm Length 70 Cm Non Absorbable Surgical Sutures Usp Size 2 / 0 ( 12 Foils / Pkt ) , Surgical Material 2182 Poly Propylene Monofilament Sterile Precut With 1 / 2 Cir Rb Needle 30Mm Length 70Cm Size : 1 / 0 ( 12 Foils / Pkt ) , Consumable 2183 Poly Propylene Monofilament Sterile Precut With 1 / 2 Cir Rb Needle 30Mm Length 70Cm Size:2 / 0 ( 12 Foils / Pkt ) 2184 Poly Propylene Mono Filament Sterile Precut With 1 / 2 Cir Rb Needle 40 Mm Length 70 Cm Non Absorbable Surgical Sutures Usp Size 1 / 0 2185 Poly Propylene Monofilament Sterile Precut With 1 / 2 Cir Rb Needle 40 Mm Length 70 Cm Size 1 ( 12 Foils / Pkt ) , Needle 2186 Polypropylene Size - 1, ( 12 Foils / Pkt ) ( 1 / 2 Cir Rb Needle 45 Mm, Length 90 Cm ) , Needle 2187 Polypropylene Size-2 / 0 ( 12 Foils / Pkt ) ( 1 / 2 Cir Rb Needle 25Mm, Length 45 Cm ) , Needle 2188 Poly Propylene With 1 / 2 Cir Rb Needle 16 Mm Length 70 Cm Size:4 / 0 ( 12 Foils / Pkt ) , Consumable 2189 Polytaxine Powder ( 1X5 Gm ) , Consumable 2190 Post Operative Bag With Window Size 100 Mm ( 1 Each ) , Consumable 2191 Post Operative Bag With Window Size 70 Mm ( 1 Each ) , Consumable 2192 Powder Developer Suitable For Processing Medical X-Ray Films. One Developer Box Shall Contain Part A And Part B Which Are Mixed At The Time Of Preparation Of Solution Of Specific Capacity Size:- 13.5 Ltr 2193 Powder Developer Suitable For Processing Medical X-Ray Films. One Developer Box Shall Contain Part A And Part B Which Are Mixed At The Time Of Preparation Of Solution Of Specific Capacity Size:- 9.0 Ltr 2194 Powder Protien +Vitamins +Corbohydrates & Minerals 200Gm 2195 Pregnancy Detection Kit Ce Marked / Isi Marked 30 Test / Kit 2196 Pregnancy Test Card ( 10 Card Pack ( Mfg- Oscar Medicare Pvt Ltd ) ) , Consumable 2197 Prolene 1-0 Rb 1 / 2 Circle 30 Mm, L 70 Cm ( 12 Foils / Pkt ) 2198 Prolene Mesh 7.5 X 15 Cm ( 12 Foils / Pkt ) 2199 Protein ( Total ) ( 600 Ml ) , Consumable 2200 Protien ( Total ) Mfg By Ba 400 Biosystems Diagnostics Pvt Ltd ( 600 Ml ) , Consumable 2201 Protien ( Urine ) Ba 400 Biosystems Diagnostics Pvt Ltd ( 240 Ml ) , Consumable 2202 Ptah Staining Kits ( 100 Test ) , Consumable 2203 Ptfe Material, Iv Cannula, With Luer-Lock, G-18 2204 Ptfe Material, I.V. Safety Cannula, With Luer-Lock, G-16 2205 Pt Kit ( Time ) ( Ist 1.00 - 1.20 ) ( 2X4 Ml ) , Consumable 2206 Ptk ( Nishchay Kit ) Each 2207 Pyrethrum Extract 2% Conforming To No. Is 1051-1980 2208 Quadraple Blood Bag 450 Ml Sagm ( Each ) , Consumable 2209 Quick Diff Staining Kits For Pap Smear ( 100 Test ) , Consumable 2210 Quincke Bevel Pediatric Spinal Needle, G-25, Length 1.2 Inch 2211 Quincke Pediatric Spinal Needles G-25, Length 2.0 Inch 2212 Ra Factor 50 Test Kit Qualicative 2213 Ra Factor Rapid Kit 1 ) Should Be Based On Latex Agglutination Slide Test 2 ) Qualitative And Semi Quantative Testing Facility Possible 3 ) Test Speed Must Be < 2 Minutes ( 25 Test / Kit ( Mfg By Beacon Diagnostic ) ) , Consumable 2214 Rbc Dialuation Fluid ( Mfg- Precious Life Care Pvt Ltd ) ( 500 Ml Bottle ) , Consumable 2215 Reaction Rotor 10 Pc ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 2216 Reagent For Hdl Cholestrol Test ( 100 Ml ( 4 X 25 ) ) , Consumable 2217 Hdl Cholesterol ( Autospan / Erba ) 2218 Reticulocyte Kit ( 100 Tests ) , Consumable 2219 Reuse Prevention Syringe 10 Ml 2220 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe With Detachable Needles Complaint To Iso 7886:4 Type I And B, Flow Wrap / Blister Pkg Using Medical Grade Breathable Paper, Eto Sterilized, Non Latex Stopper 3Ml 2221 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringewith Detachable Needles Complaint To Iso 7886:4 Type I And Type B, Flow Wrap / Blister Package Using Medical Grade Breathable Paper, Eto Sterilized, Non Latex Stopper 2Ml 2222 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe With Detachable Needles Complaint To Iso 7886:4 Type I, B, Flow Rap / Blister Pack Using Medical Grade Breathable Paper, Eto Sterilized, Nonlatex Stopper ( Prefd Matr Thmoplast Ela ) 5Ml 2223 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe With Fixed / Detachable Needles Complaint To Iso 7886:4 Type I And B, Flow Wrap / Blister Pkg Using Medical Grade Breathable Paper, Eto Sterilized. ( 10 Ml ) , Syrings 2224 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe With Fixed / Detachable Needles Complaint To Iso 7886:4 Type I, B, Flow Wrap / Blister Pack Using Medical Grade Breathable Paper, Eto Sterilized ( 2Ml ) , Syrings 2225 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe With Fixed / Detachable Needles Complaint To Iso 7886:4 Type I, B, Flow Wrap / Blister Pack Using Medical Grade Breathable Paper, Eto Sterilized ( 3Ml ) , Syrings 2226 Reuse Prevention Syringe-Sterile Single Use Reuse Prevention Syringe With Fixed / Detachable Needles Complaint To Iso 7886:4 Type I, B, Flow Wrap / Blister Pack Using Medical Grade Breathable Paper, Eto Sterilized ( 5Ml ) , Syrings 2227 Reuse Prevention Syringe-Sterile With Detachable Needles Complaint To Iso 7886:4 Typei And Typeb 3Ml 2228 Reuse Prevention Syringe-Sterile With Detachable Needles Complaint To Iso 7886:4 Type I And Type B, Flow Wrap / Blister Package Using Medical Grade Breathable Paper, Eto Sterilized, Non Latex Stopper ( Preferred Material Thermoplastic Elastomer ) 5Ml 2229 Rhyroid Stimulating Hormone ( Tsh ) , Consumable 2230 Rib Belt Large ( Mfg By - Precious Life Care ) , Each 2231 Rib Belt Medium ( Mfg By - Precious Life Care ) , Each 2232 Rib Belt Small ( Mfg By - Precious Life Care ) , Each 2233 Roll Bandage 05 Cm X 05 M Tana X Bana ( 26S X 26S ) Reed X Pik ( 34X 24 ) 2234 Roll Bandage 10 Cm X 05 M Tana X Bana ( 26S X 26S ) Reed X Pik ( 34X 24 ) 2235 Roll Bandage 15 Cm X 05 M Tana X Bana ( 26S X 26S ) Reed X Pik ( 34X 24 ) 2236 Roll Bandage 7.5 Cm X 05 M Tana X Bana ( 26S X 26S ) Reed X Pik ( 34X 24 ) 2237 Rolled Bandage 10Cm × 5M 2238 Rolled Bandage 15Cm × 5 M 2239 Rolled Bandage 5Cm × 5M 2240 Rolled Bandage 7.5Cm × 5M 2241 Rpr Rapid Card Test Kit ( 50 Test / Pkt ) 2242 Ryles Tube ( Pvc ) Size : Adult: 16 2243 Ryles Tube ( Pvc ) Size : Adult ( 18 ) , Tube 2244 Ryles Tube ( Pvc ) Size : Children: 10 2245 Ryles Tube ( Pvc ) Size : Children : 12 2246 Ryles Tube ( Size 14 Each Piece ) , Consumable 2247 Safranine ( Gram Stain ) 500 Ml Bottle 2248 Safranine ( Gram Stain ) ( 500 Ml Bottle ( Mfg-Sunlabs ) ) , Consumable 2249 S.Albumin ( Each ) , Consumable 2250 Salt Testing Kit Each 2251 Sargramostim ( Recombinant Human Granulocyte Macrophage Colony Stimulating Factor ) ( 500 Mcg / Ml ) , Injection 2252 S. B12 ( 100 Tests ) , Consumable 2253 S.Calcium ( Each ) , Consumable 2254 Scalp Vein Set ( Size 24G, Disposable ) , Consumable 2255 Schirmer Strip For Ophthalmic Use 2256 S Direct Billirubin ( 1000 Ml ) , Consumable 2257 Seman Diluting Fluid 100 Ml. 2258 Semen Dilution Fluid ( 100 Ml Bottle ) , Consumable 2259 Serum Amylase ( Mfg By Beacon Diagnostic ) ( 100 Ml ) , Consumable 2260 Serum Creatinine ( Mfg- Pathogyme Diagnostics ) ( 100 Ml ( 2 X 50 Ml ) ) , Consumable 2261 Serum Electrolite Na+ K+ Kit Analizer ( 50 Test Per Kit ) , Consumable 2262 Serum T3 Kit, Elisa ( 96 Test Kit Each ) , Consumable 2263 Serum T4 Kit, Elisa ( 96 Test Kit Each ) , Consumable 2264 Serum Tsh Kit, Elisa ( 96 / Pkt ) , Consumable 2265 Sevoflurane 20Cc ( Each ) , Consumable 2266 S. Ferritin ( Each ) , Consumable 2267 S. Folate ( 100 Tests ) , Consumable 2268 Sgot Kit ( Kinetic ) 5X20ml 200 Test / Kit 2269 Sgpt ( 100 Ml ( 4 X 25 ) ) , Consumable 2270 Sgpt Kit Lyphozyme 5X20 Ml 2271 Short Iv Catheter With Straight Guidewire. L-20, Fr-2, G-22 2272 Short Iv Catheter With Straight Guidewire. L-4, Fr-2, G-22 2273 Short Iv Catheter With Straight / J Tip Guidewire ( L-4, Fr-2, G-22 ) , Consumable 2274 Sics Blade-Cresent ( 15 Degree ) , Consumable 2275 Sics Blade ( Disposable ) Cresent Nife 2.8 ( Specialy Long Matel Handle, Micro Sharp Edge, Isi / Iso ( Manufaturer, Eto Stereliged ) , Consumable 2276 Silk No 1 Cutting Needle 1X12 ( 1X12 ) , Consumable 2277 Silver Sulphadiazine Cream 500Gm 2278 Single Lumen Cathater 2279 Sulphur Powder 500Gm Pkt 2280 Single Umbilical Catheter With Luer Lock Stopcock Fr-2, L-40 Cm 2281 Single Umbilical Catheter With Luer Lock Stopcock Fr-3, L-40 Cm 2282 Single Umbilical Catheter With Luer Lock Stopcock Fr-4, L-40 Cm 2283 Single Umbilical Catheter With Luer Lock Stopcock Fr-5, L-40 Cm 2284 S. Iron ( Ferrozine ) ( 100 Tests ) , Consumable 2285 Size Of Cassette ( 10 Inch X 12 Inch ) , Consumable 2286 Size Of Cassette ( 14 Inch X 17 Inch ) , Consumable 2287 Size Of Cassette ( 8 Inch X 10 Inch ) , Consumable 2288 Size Of Film 10 Inch X 12 Inch Digital X Ray Film ( Dihl ( Pack Of 150 ) ) , Film 2289 Size Of Film 10 Inch X 12 Inch ( Dihl ) , Consumable 2290 Size Of Film 14 Inch X 17 Inch Digital X Ray Film ( Dihl ( Pack Of 100 ) ) , Film 2291 Size Of Film 14 Inch X 17 Inch ( Dihl ) , Consumable 2292 Size Of Film 8 Inch X 10 Inch Digital X Ray Film ( Dihl ( Pack Of 150 ) ) , Film 2293 Size Of Film 8 Inch X 10 Inch ( Dihl ) , Consumable 2294 Skin Closure Stapler ( 35 Pins High Quality Medical Grade Plastic, Cartridge With Ss Rectangular Design Pins With Wire Diameter 0.60 Mm And Size After Closure 7.2 X 4.3 Mm ) 2295 S.Lipase ( Each ) , Consumable 2296 Sliver Nitrate ( 1X25 Gm = 25 Gm ) , Consumable 2297 Sickel Cell Test Kit ( Tulip ) 2298 Sodium Chloride Nacl Analar / Gr / Ar ( 1X500 Gm = 500Gm ) , Consumable 2299 Sodium Citrate 3.8% ( Mfg- Precious Life Care Pvt Ltd ) ( 500 Ml Bottle ) , Consumable 2300 Sodium Hydroxide ( Naoh ) ( Analar / Gr / Ar ) ( 1X500 Gm = 500Gm ) , Consumable 2301 Sodium Hypo Chloride 5 Lit Jar 2302 Sodium Metabisuiphite ( Na2s2o3 ) ( Analar ( Gr / Ar ) ( 1X500 Gm = 500Gm ) , Consumable 2303 Sodium Nitroprusside ( 100 Gm ) , Consumable 2304 Spectra Optia Collection Set, Model : 10110 / 10120 ( Packing Size : 6 Kits ) , Consumable 2305 Spectra Optia Exchange Set, Model : 10220 ( Packing Size : 6 Kits ) , Consumable 2306 Spectra Optia Platelet Kit, Model : 10400 ( Packing Size : 6 Kits ) , Consumable 2307 S. Phosphorus ( Each ) , Consumable 2308 Spinal ( L.P. ) Needle Disposable 24G Consumable 2309 Spinal ( L.P. ) Needle Disposable 26G Consumable 2310 Spinal Needle 24 G Each 2311 Spinal Needle 26 G ( Each ) , Needle 2312 Spinal Needle G-22 L-120 Mm*0.71 / Piece 2313 Spinal Needle ( G-22 L-120 Mm ) , Consumable 2314 Spinal Needle G-23 With Metal Stylet. 2315 Spinal Needle G-27 L-120 Mm*0.40 / Piece 2316 Spinal Needle With Metal Stylet, Mfg By Nipro Medical India Pvt. Ltd. ( G-23 ) , Needle 2317 ( Ss ) Powder ( 1X25 Gm = 25 Gm ) , Consumable 2318 Sstromatolyser-4Ds For 5-Part Hematology Analyser ( Model : Sysmex Xs-800I ( Japan ) ) ( Pack Size 126 Ml ) , Consumable 2319 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Aptt- Sta Cepha Screen 4 ) , Consumable 2320 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Aptt- Sta Cepha Screen 4 ) , Consumable 2321 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Pt –Sta Neoplastin Cl + 5 ) , Consumable 2322 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Sta-Cacl2 ) , Consumable 2323 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Sta- Cleaner Solution ) , Consumable 2324 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Sta- Coagcontrol N+P ) , Consumable 2325 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Sta- Desorb-U ) , Consumable 2326 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( Sta- Satellite Cuvette ) , Consumable 2327 Stago Diagnostica Stago S.G.S, Model - Sta Satellite Fully Automated Coagulation Machine ( White Stirrer For Pt Test ) , Consumable 2328 Stain ( 1X25 Gm = 25 Gm ) , Consumable 2329 Staining Kit Reticulin ( 100 Test ) , Consumable 2330 Staining Kits ( 100 Test ) , Consumable 2331 Stainless Steel Wire 28G 2332 Stainless Steel Wire 30G 2333 Sterigen-C Electrolyte Solution One Pack Of 10 Ltr. For Sterigen 400 Daf , Make- Faith Inovation; Model- Sterigen Sg 400 Daf ; ( Country Of Origin- India ) , Consumable 2334 Sterilant Cold Disinfectant For Dialysis Containing Peracetic Acid Hydrogen Peroxide Acetic Acid ( 5 Ltr Can ) , Consumable 2335 Sterilant Hot Disinfectant For Dialysis Containing 21% ( Approx ) Citric Acid, Malic Acid, Lactic Acid ( 5 Ltr Can ) , Consumable 2336 Sterile Hypodermic Syringe With Needle, Mfg By Ph Health Care Pvt Ltd ( 20 Ml ) , Consumable 2337 Sterile Hypodermic Syring With Needle 10 Ml 2338 Sterile Hypodermic Syring With Needle 20 Ml 2339 Sterile Hypodermic Syring With Needle ( 5 Ml ) , Syrings 2340 Sterile Hypodermic Syring With Needle, Mfg By Ph Health Care Pvt Ltd ( 10Ml ) , Consumable 2341 Sterlium 500 Ml 2342 S. Tibc Kit ( 100 Tests ) , Consumable 2343 S. Total Protein ( Each ) , Consumable 2344 S. Transferin ( 100 Tests ) , Consumable 2345 Strip For Albumin Urine And Suger 50 Per Pack 2346 Strip For Malaria Antigen, P Vivex, P Falciparum ( 50 Tests ) 2347 Stromatolyser-4Dl For 5-Part Hematology Analyser ( Model : Sysmex Xs-800I ( Japan ) ) ( Pack Size 5000 Ml ) , Consumable 2348 Suction Catheter Assorted 10 No / Each 2349 Suction Catheter Assorted 9 No / Each 2350 Suction Catheter, Sterile ( Size Fg 20 ( Disposable, Sterile Each ) ) , Consumable 2351 Suction Catheter, Sterile ( Size Fg 22 ( Disposable, Sterile Each ) ) , Consumable 2352 Suction Catheter, Sterile ( Size Fg 6 ( Disposable, Sterile Each ) ) , Consumable 2353 Sugar Albumin Strip 50 Per Pack 2354 Sulfolyser For 5-Part Hematology Analyser ( Model : Sysmex Xs-800I ( Japan ) ) ( Pack Size 5000 Ml ) , Consumable 2355 Sulfur Powder 500Gm 2356 Surface And Fogging Disinfectant Stabilised H202, 10-11%W / V With Diluted Silver Nitrate Sol. 0.01%W / V ( 5 Litre Can ) , Each 2357 Surface Disinfectant - 10 Minute Aldehyde Free Disinfectant Containing Potassium Mono Per Sulphate Powder ( 5 Kg Packet ( Mfg By Zenith Chemicals Allied Industries ) ) , Consumable 2358 Surface Disinfectant 10 Minute Aldehyde Free Disinfectant Containing Potassium Mono Per Sulphate Powder ( ( 5Kg Packet ) ) , Powder 2359 Surgical Blade, Size 11 2360 Surgical Blade, Size 15 ( 100 / Pkt ) 2361 Surgical Blade, Size 22 ( 50 / Pkt ) 2362 Surgical Blade, Size 23 ( 100 / Pkt ) 2363 Surgical Blade, Size 24 ( 50 / Pkt ) 2364 Suter ( 8 / 0 ( 01 Box ) ) , Consumable 2365 Sutureless Dural Graft Substitute ( 1X3 ) , Consumable 2366 Sutureless Dural Graft Substitute ( 2X2 ) , Consumable 2367 Sutureless Dural Graft Substitute ( 3X3 ) , Consumable 2368 Sutureless Dural Graft Substitute ( 4X5 ) , Consumable 2369 Suture Mersilk 8-0 ( 12 Foil ) 2370 Suture Needles Curved 1 / 2 Circle Round Bodyassorted Size 11-15 2371 Suture Needles Curved 1 / 2 Circle Round Bodyassorted Size 1-5 2372 Suture Needles Curved 1 / 2 Circle Round Bodyassorted Size 16-20 2373 S.Vitamin D3 ( 100 Tests ) , Consumable 2374 Swab Stick With Tube-Sterile ( 70-80 Mm Length 10- 15 Mm Diameter ) , Unit 1 ( 100 / Pkt ( Mfg- Laboratories Pvt Ltd ) ) , Consumable 2375 Synethetic Absorbable Suture 1 / 0 With 1 / 2 Cir Rb Needle Size: 1 / 0 Length 90Cm 2376 Synthetic Absorbable Suture 1 With 1 / 2 Circle Taper Cut Needle ( H ) Size :1 40Mm Length 90Cm Polyglycolic Acid ( Pga ) ( 12 Foils Per Pkt ) 2377 Synthetic Absorbable Suture 2 / 0 With 1 / 2 Cir Rb Needle Size:2 / 0 30Mm Length 90Cm-Polyglycolic Acid ( Pga ) 12 Foils / Pkt 2378 Synthetic Absorbable Suture 2 / 0 With 1 / 2 Cir Rb Needle Size:2 / 0 40Mm Length 90Cm-Polyglycolic Acid ( Pga ) 2379 Synthetic Absorbable Suture 3 / 0 With 1 / 2 Cir Cutting Needle Size:3 / 0 36Mm Length 70Cm -Polyglycolic Acid ( Pga ) 2380 Synthetic Absorbable Suture 3 / 0 With 1 / 2 Cir Cutting Needle Size:3 / 0 36Mm Length 70Cm -Polyglycolic Acid ( Pga ) 12 Foils / Pkt 2381 Synthetic Absorbable Suture 3 / 0 With 1 / 2 Cir Rb Needle Size:3 / 0 20Mm Length 70Cm-Polyglycolic Acid ( Pga ) 2382 Synthetic Absorbable Suture 3 / 0 With 1 / 2 Cir Rb Needle Size:3 / 0, 40Mm Length 90Cm-Polyglycolic Acid ( Pga ) 2383 Synthetic Absorbable Suture 3 / 0 With Cd Cutting Needle Size : 3 / 0 22Mm Length 45Cm - Polyglycolic Acid ( Pga ) ( 12 Foils Per Pkt ) 2384 Synthetic Absorbable Suture 4 / 0 With 1 / 2 Cir Rb Needle Size:4 / 0 20Mm Length 70Cm -Poly Glycolic Acid ( Pga ) 2385 Synthetic Absorbable Suture 4 / 0 With 1 / 2 Cir Rb Needle Size:4 / 0 20Mm Length 70Cm -Poly Glycolic Acid ( Pga ) ( 12 Foils / Pkt ) 2386 Synthetic Absorbable Suture 4 / 0 With 3 / 8 Cir Cutting Needle Size:4 / 0 16Mm Length 45 Cm -Polyglycolic Acid ( Pga ) 2387 Synthetic Absorbable Triclosan Coated Polyglactin 910, Size 1, Needle 40Mm, 1 / 2 Circle Round Body , 90Cm Length 2388 Synthetic Absorbable Triclosan Coated Polyglactin 910, Size 1-0, Needle 40Mm, 1 / 2 Circle Round Body , 90Cm Length 2389 Synthetic Absorbable Triclosan Coated Polyglactin 910, Size 1, 40Mm, 1 / 2 Circle Reverse Cutting Os Needle , 90Cm Length 2390 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 1, Needle 36.4 Mm, 1 / 2 Circle Taper Point Ct-1 90Cm 2391 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 1-0, Needle 36.4 Mm, 1 / 2 Circle Taper Point 90Cm 2392 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 2-0, Needle 26Mm, 1 / 2 Circle Taper Point 70Cm 2393 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 3-0, Needle 17Mm, 1 / 2 Circle Taper Point 70Cm 2394 Synthetic Absorbable Triclosan Coated Poliglecaprone 25, Size 2-0, 26 Mm, 1 / 2 Circle Round Body, Visiblack Jb Needle 70Cm 2395 Synthetic Absorbable Triclosan Coated Poliglecaprone 25, Size 3-0, 26 Mm, 3 / 8 Circle Reverse Cutting, 70Cm 2396 Oxidized Regenerated Cellulose Based Topical Absorbable Hemostat, Fibrillar / Layer Form, With Bactericidal Property. Fibril Material ( 7Layers ) For Broad Surface Area Coverage. Approved By Us Fda Size 2X4 Inch 2397 Oxidized Regenerated Cellulose Based Topical Absorbable Hemostat, Structured Non-Woven Material, With Bactericidal Property. Ease-Of-Use In Both Open And Minimally Invasive Procedures. Approved By Us Fda Size 2X4 Inch 2398 Macroporus Partially Absorbable Mesh Made Up Of Approximately Equal Parts Of Polypropylene Monofilament Fiber ( 6-0 ) And Poliglecaprone 25 Monofilament Fiber ( 5-0 ) With Pore Size 2.7 Mm Having A Weight Of 39 G / M2 And Containing Blue Orientation Stripes Of Polypropylene. 15Cmx15cm 2399 Complete Absorbable Mesh Fixation Device With Minimum Strap Length 7.0 Mm 2-Point Fixation To Hold The Mesh And Device. 25 Absorbable Tracks 2400 Absorbable Unidirectional Barbed Device, Symmetric Anchoring Pattern, Triclosan Coated Polydioxanone, Size 1-0, 36Mm , 1 / 2 Circle Taper Point Ct-1 Needle, 45Cm With Fixation Tab 2401 Test Tube 12 X 100 ( Medicm Size ) 100 / Pkt 2402 Test Tube 12 X 75 ( Small Size ) 100 / Pkt ( 12 X 75 ( Small Size ) 100 / Pkt ) , Tube 2403 Test Tube 15X125 / 1*100 / Pkt 2404 Test Tube Medium ( 12X100 ) 100Eack / Pkt ( Each ) , Consumable 2405 Three Layer Surgical Mask 100 Per Pack 2406 Three Way Stop Cock Consumable 2407 Thrombin Time Kit ( 10X3 Ml ) , Consumable 2408 Thyroxine ( T4 ) , Consumable 2409 Tips For Auto Pipettes 200 To 1000 Micro Litres 500 / Pkt ( 200 To 1000 Micro Litres 500 / Pkt ) , Each 2410 Tips For Auto Pipettes 2 To 100 Micro Litres 1000 / Pkt ( 2 To 100 Micro Litres 1000 / Pkt ) , Each 2411 Tips For Auto Pippetes 10 To 100 Micro Litres 1*100 / Pkt 2412 Tissue Paper Roll ( Each ) , Consumable 2413 Tmt Graph Paper A4 Size, 100 Piece / Pkt 2414 Total Protein 100 Ml Bottle 2415 Total Protein Lysozyme 1X50 Ml 2416 Total Protein ( Mfg By Beacon Diagnostic ) ( 100 Ml ) , Consumable 2417 Tourniquet With Belt ( Good Quality Pairs ) , Pairs 2418 Tracheostomy Tube ( Pvc ) Sterile Single Use - ( Adult ) ( Size 4 Each Piece Soft Flexible Flange At For Each Fixation 15 Mm Connector At Terminal End Which Can Be Rotated In 360 Degree Direction Non-Irritant ) , Tube 2419 Tracheostomy Tube ( Pvc ) Sterile Single Use - ( Adult ) ( Size 5 Each Piece Soft Flexible Flange At For Each Fixation 15 Mm Connector At Terminal End Which Can Be Rotated In 360 Degree Direction Non-Irritant ) , Tube 2420 Tracheostomy Tube ( Pvc ) Sterile Single Use - ( Adult ) ( Size 7 Each Piece Soft Flexible Flange At For Each Fixation 15 Mm Connector At Terminal End Which Can Be Rotated In 360 Degree Direction Non-Irritant ) , Tube 2421 Tracheostomy Tube ( Pvc ) Sterile Single Use - ( Adult ) ( Size 8 Each Piece Soft Flexible Flange At For Each Fixation 15 Mm Connector At Terminal End Which Can Be Rotated In 360 Degree Direction Non-Irritant ) , Tube 2422 Transfer Bag ( Each ) , Consumable 2423 Triglyceride 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 2424 Triglyceride Kit Enzymet 5X20ml 200Test / Kit 2425 Serum Trigyceride ( Autospan / Erba ) 2426 Triple Lumen Jugular Catheter 12 X 16 2427 Triple Lumen Jugular Catheter Kit ( Size 12F, 16+ / - 1Cm ) , Consumable 2428 Triple Lumen Polyurethane Cvp Catheter, 7.5 Fr, G-14X18x18, Length 15Cm 2429 Triple Lumen Polyurethane Cvp Catheter, 7.5 Fr, G-14X18x18, Length 20Cm 2430 Triple Lumen Polyurethane Cvp Catheter 7 To 7.5Fr ( G-14-16X18x18, Length 16-20 Cm ) , Consumable 2431 Triple Lumen Polyurethane Cvp Catheter 7 To 7.5 Fr ( G-14-16X18x18x18, Length 15-16Cm ) , Consumable 2432 Trisodium Citrate 3.8% ( 500 Ml Bottle ) 2433 Trisodium Citrate 3.8% ( Mfg- Precious Life Care Pvt Ltd ) ( 500 Ml Bottle ) , Consumable 2434 Trisodium Citrate Analar / Gr / Ar ( 1X500 Gm = 500Gm ) , Consumable 2435 Triway Cannula ( 3 Way Stop Cock ) 2436 Troponin 1 Kit ( 10 Test Per Pack ) , Consumable 2437 Troponin T ( Ctn - T ) Card Test ( 50 Test ) , Consumable 2438 Trucut Biopsy Needle 18 G Length 15 Cm 2439 Typhoid Card Test Kit ( For Igg And Igm Antibody Detection ) ( 25 Test Kit ) 2440 Umbical Cord Clamps - Plastic Material ( Box Of 100 Clamps ) , Consumable 2441 Urea ( Brethelot ) 3X100ml Lyphozyme 2X10ml 2442 Urea / Bun – Uv 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 2443 Urea Kit Berthelot 50 Test / Kit 2444 Urea Uv Gloh 5X20ml 2445 Uric Acid 600 Ml ( Model Ba 400 System ( Mfg Bybio System ) ) , Consumable 2446 Uric Acid Biosystem 2447 Uric Acid ( Mfg- Pathogyme Diagnostics ) ( 50 Ml ( 2 X 25 Ml ) ) , Consumable 2448 Uric Acid ( Autospan ) ( 50 Ml ( 2 X 25 Ml ) ) , Consumable 2449 Uric Acid ( Erba ) ( 50 Ml ( 2 X 25 Ml ) ) , Consumable 2450 Urinary Drainage Bag 2 Litre Cap With Non Return Valve ( Eo Sterile ) 2451 Urinary Drainage Bag ( Paediatric ) ( 100 Ml / Pc ) , Consumable 2452 Urine Albumin & Suger Test Kit 1*100 Pkt 2453 Urine Container 5Ml Disposable ( 50 Per Pkt ) 2454 Urine Culture Pot 30 Ml. 2455 Urine ( Multi Strip ) , Consumable 2456 Urine Strip 2 Parameter 2457 Uri Stix 100 Test 2458 Urosticks ( 50 / Pkt ) , Consumable 2459 Usg Gel ( 250 Ml Bottle ) , Consumable 2460 Usg Thermal Paper Each 2461 Variable Auto Pippets 10 To 100 Micro Litres 2462 Variable Auto Pippets 20 To 200 Micro Litres 2463 Variable Auto Pippets 100 To 1000 Micro Litres 2464 Variable Auto Pippets 0.5 To 50 Micro Litres 2465 Vaseline White / Yellow 1 / 2Kg 2466 Vdrl Kit ( Strip ) ( 50 Test / Kit ) , Consumable 2467 V.P Shunt High Pressure ( Venticular Peritonial Shunt, ( Venticular Catheter 15Cm Length, 1 Distilled Catheter 75 L, Struit Stylet ) ( Each ) , Consumable 2468 V.P.Shunt ( Low Pressur ) , Consumable 2469 V.P.Shunt ( Medium Pressur ) , Consumable 2470 Vtm - Hi - Media With 2 Swab : ( For Swine Flu ) Vtm Standard Kit ( 3Ml Vial With 2 Regular Swabs ) 2471 Wbc Diluting Fluid 500Ml 2472 Whitacre - Pencil Point Spinal Needle 25 G With Introducer 2473 White Petrollium Jelly 500 Gm 2474 Widal 4X5 Ml 2475 Widal Test Kit Rapid 2476 Wound Suction No 18 2477 X-Ray Cassets ( 6.5X8.5 ) , Consumable 2478 X-Ray Cassets ( 8X10 ) , Consumable 2479 X-Ray Film 10 X 12 50 Sheets / Pack 2480 X-Ray Film 12 X 12 50 Sheets / Pack 2481 X-Ray Film 12 X 15 50 Sheets / Pack 2482 X-Ray Film 14 X 14 50 Sheets / Pack 2483 X-Ray Film 14 X 17 50 Sheets / Pack 2484 X-Ray Film 6.5 X 8.5 50 Sheets / Pack 2485 X-Ray Film 8 X 10 50 Sheets / Pack 2486 X-Ray Film Fixer ( Powder To Make 13.5 Liters-Pkt ) , Consumable 2487 X-Ray Film Fixer ( Powder To Make 9 Liters-Pkt ) , Consumable 2488 X-Ray Hangers ( 10X12 ) , Consumable 2489 X-Ray Hangers ( 12X15 ) , Consumable 2490 X-Ray Hangers ( 6.5X8.5 ) , Consumable 2491 X-Ray Hangers ( 8X10 ) , Consumable 2492 Xro Catheter With Ptfe Material, I.V. Safety Cannula, With Luer-Lock ( G-18 ) , Consumable 2493 Xro Catheter With Ptfe Material, I.V. Safety Cannula, With Luer-Lock ( G-20 ) , Consumable 2494 Xro Catheter With Ptfe Material, I.V. Safety Cannula, With Luer-Lock ( G-22 ) , Consumable 2495 Xylene ( Sulphur Free ) ( 1 X 2.5 Lit ) , Consumable 2496 Absorable Surgical Suture Rb Needle Size No 1-0, 30 Mm Length -70 Cm , 12 Foils Per Packet , Polyglycolic Acid ( Pga ) 2497 Adhesive Tape 7.5Cm X10 Mtr / Roll 2498 Ambu Bag ( 250 Ml ) 2499 B.B Silk ( 12 Foils / Pkt ) ( 3 / 8 Rcut Needle 45 Mm Length 76 Cm, Size 2 / 0 ) ) , Consumable 2500 B.B Silk With 1 / 2 Cir Rb Needle Size:1 / 0 20 Mm Length 75 Cm Non Absorbable Surgical Sutures Usp Surgical Material 2501 B.B Silk With 1 / 2 Cir Rb / Cutting Needle 30 Mm Length 75 Cm Non Absorbable ( Size 2-0, 12 Foils / Pkt ) , Consumable 2502 Biomedical Waste Collection Plastic Bag ( Yellow ) ( As Per Attached Detail Specifications ) ( 450X450 Mm 55 Micron 100 / Pkt ) , Consumable 2503 Biomedical Waste Collection Plstic Bag ( Black 750 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2504 Biomedical Waste Collection Plastic Bag ( Black 900 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2505 Biomedical Waste Collection Plstic Bag ( Blue 750 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2506 Biomedical Waste Collection Plstic Bag ( Blue 900 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2507 Biomedical Waste Collection Plstic Bag ( Red 750 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2508 Biomedical Waste Collection Plstic Bag ( Red 900 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2509 Biomedical Waste Collection Plstic Bag ( Yellow 750 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2510 Biomedical Waste Collection Plstic Bag ( Yellow 900 X 900 Mm 55 Micron 100 / Pkt ) , Bag 2511 Bleaching Powder Gr-Ii Is 1065 / 1989 With Upto Date Amendment Packed In 25 Kg Hdpe Bags Isi Marked Stable Consumable 2512 Blood Administrations Set 2513 Blood Bag With Acd / Cpd Solution ( Disposable Sterilised ) With Needle ( 100 Ml ) , Bag Hll 2514 Blood Bag With Acd / Cpd Solution ( Disposable Sterilised ) With Needle ( 350 Ml ) , Bag ( Hll ) Single 2515 Blood Bag With Acd / Cpd Solution ( Disposable Sterilised ) With Needle ( 350 Ml ) , Bag ( Hll ) Double 2516 Blood Bag With Acd / Cpd Solution ( Disposable Sterilised ) With Needle ( 350 Ml ) , Bag ( Hll ) Triple 2517 Blood Grouping Anti Sera A Monoclonal ( 10 Ml Vial ( Mfg- Tulip Diagnostics ) ) , Consumable 2518 Blood Grouping Anti Sera B Monoclonal ( 10 Ml Vial ( Mfg- Tulip Diagnostics ) ) , Consumable 2519 Blood Grouping Anti Sera D Monoclonal ( 10 Ml Vial ( Mfg- Tulip Diagnostics ) ) , Consumable 2520 Blood Sugar Kit 500Ml 2521 C B C Paper Roll 56’’ 2522 C.P.D.A.Blood Bag 350 Ml Consumable 2523 Chromic Size - 1 / 0 ( 12 Foils / Pkt ) ( 3 / 8 Cir Rb Needle 40 Mm, Suture Length 76 Cm ) , Needle 2524 Cleanser M52 1 Lit 2525 Coagulater 2526 Cotton Thread 10 No. Each 2527 Diagnostic Strips For Urine Sugar / Albmin Packing: 100 Strip / Pkt 2528 Diff Lyse M52 500 Ml 2529 Disposable Needles 23 No 2530 Disposable Sterile Gloves Size 6 Inches Consumable 2531 Disposable Sterile Gloves Size 61 / 2 Inches Consumable 2532 Disposable Sterile Gloves Size 7, 1 / 2 Inches Consumable 2533 Disposable Sterile Gloves Size 7Inches Consumable 2534 Disposable Syringe 5 Ml 2535 Ecg Jelly 250 Gms 2536 Glucometer With Strip 2537 Hbs Antigeng Kit Card ( Pack Of 10 Card Test With 10 Dropper, 1 Buffer Solution, 10 Pricking Lancet And 10 Alcohol Swab ) , Digonstic 2538 I V Cannula With Inj.Valve ( Port ) ( Size 26G Each ) , Consumable 2539 I.V Cannula With Injection Valve Size : 18G 2540 I.V. Cannula With Injection Valve 20G 2541 I.V. Cannula With Injection Valve ( Size 24 G ) , Consumable 2542 Intravenous Set With Airway And Needle ( ( Adult ) ) , Surgical Material 2543 Iv Cannula ( Two Way ) Size 20 2544 Iv Cannula ( Two Way ) Size 22 2545 Iv Cannula ( Two Way ) Size 24 2546 Iv Cannula Size 24G With Inj.Valve ( Port ) 2547 Iv Cannula Size 26G 2548 Iv Cannula Size With Inj.Valve ( Port ) ( 22G ) , Consumable 2549 Latex Based Baloon Capacity ( 30-50Ml ) Foleys Catheter ( Size 16- 2 Way ) , Consumable 2550 Phenyl - As Per Schedule O ( Grade 1 ) 10 Lt Jar ( Isi Marked ) , Consumable 2551 Pop Bandage ( 4 Inch ) , Consumable 2552 Pop Bandage ( 6 Inch ) , Consumable 2553 Bleaching Power Gr-Ii ( 25Kg ) Bags Consumable 2554 A.V Fistula Needle - 16 No 2555 A.V Fistula Needle - 17 G 2556 A-V Blood Lines With Av Pressure Transducer ( Acceptable For Fitting To All Standard Dialyzers ) With Side Tubing- ( For Heparinization And Av Pressure Monitoring ) Ce And Iso Certificate Essential With Protector For All Machines Types And Dialysers ( Medical Grade Pvc Like Of Fresenius Bain ( Dora ) , Dialife , Nipro, B Raun Browndone, Biolight Or Equivalent Post-Pump Tubing Sets Options Medical Grade Clear Tubing Guarded Access Ports For Reduced Infection Risks Parts Of Superior Quality ) , Consumable 2557 A-V Blood Lines With Av Pressure Transducer Protector For All Machines Types And Dialysers ( Acceptable For Fitting To All Standard Dialysers ) , Set 2558 Giemsa Stain 100Ml 2559 Glass Tube Plain 4” 2560 Glass Tube Plain 6” 2561 Group Confermation Card+ Solution Matrix Gel System 2562 Plaster Of Paris Bandage 10 Cm X 2.7 Mtr / Roll 2563 Plaster Of Paris Bandage 15Cm X 2.7Mtr / Roll 2564 Plaster Of Paris Bandage Bp 10 Cm X 2.7 Mtr / Roll 2565 Prolin No 1 2566 Prolin No 2-0 2567 Rub In Hand Solution 100Ml / 500Ml 2568 Surgical Scalpel Blade With Handle 2569 T3, Reagent ( Mini Vidas ) / Biomerieux 2570 T4 Reagent ( Mini Vidas ) Biomerieux 2571 Test Tube Glass 10 Ml 2572 Tsh Reagent ( Mini Vidas ) Biomerieux 2573 Wiper Big 2574 Wiper Medium 2575 Wiper Small 2576 Disposable Masks ( Non-Woven ) Material 2577 Utility Gloves For Large Latex 2578 Utility Gloves For Medium Of Latex 2579 Baby Vest - The Baby Vest Should Be A Double Breasted Upper Garment & Single Jersey Knit ( 100% Cotton ) 150-160 Gsm. Size Should Be:- Length-9”, Chest Size Should Be 9”, Sleeve Length Should Be 1¾” & Width 6”. Piping Is Must & The Piping Made Of Cotton-Cambric. It Should Have Side Wise Stretching. ( Specs Attached Seperately ) { For All New Born } 2580 B. B. Silk Size 2 / 0 , 110 Cm With 1 / 2 Cr Cutting Needle 2581 Mackintosh Sheet - Rubber Makintosh Double Colour Rubber Sheeting, High Polymer ( 55% Grade A )  Water Proof Colour ( Green, Blue, Red ) , Thickness-0.4Mm, Width-90Cm Roll Of 30 Mtr Compliant To Is 4135 ( 1974 ) { For Labour Table Ot & Maternity Beds } 2582 Synthetic Absorbable Suture With 1 / 2 Circle Round Body Needle 40 Mm Length - 90 Cm Polyglycolic Acid 2583 Disposable Masks ( Non-Woven ) Material 2584 Nylon No .1, 1 / 2 Circle Needle 40 Mm, 110 Cm, Nonabsorblr Suture 2585 Vicryl No.1 2347 D , 40Mm 1 / 2 Circle Cut, Tapper, Heavy, Double Needle, 180 Cm, Pga Absorble, Suture 2586 Endotrachial Tube 3.5; ( Uncuffed ) 2587 Endotrachial Tube 4; ( Uncuffed ) 2588 Endotrachial Tube 4.5; ( Uncuffed ) 2589 Endotrachial Tube 5; ( Uncuffed ) 2590 Endotrachial Tube 5.5; ( Uncuffed ) 2591 Endotrachial Tube 5.5; 2592 Endotrachial Tube 6.5; 2593 Endotrachial Tube 7; 2594 Endotrachial Tube 7.5; 2595 Endotrachial Tube 8; 2596 Endotrachial Tube 8.5; 2597 Acetic Acid 1 % 500Ml 2598 Lugol’S Lodine 500Ml 2599 Tolmdine Blue 500Ml 2600 Formalin Solution 5 Lit. 2601 Sodium Hypochlorite Solution Or Bleaching Power 25Kg 2602 Ear Buds 100 Per Pack 2603 Ear Speculum ( Set ) 2604 Foreign Body Spud Ear 2605 Foreign Body Spud Nasal / 2606 Liquid Soap 500Ml 2607 Thermometer -40 Digree 2608 Scissor Encleation ( Medium ) 2609 Scissors Big ( Tailor Type ) 2610 Shoe Rack Affordable, Stackable 6-Tier Storage Shoe Rack Holds Up To 24 Shoes, Made From Metal And Plastic - 34W X 11D X 41H 2611 Sonography Jelly 500 Ml 2612 Sonography Jelly 5 Lit. 2613 Vein Spy Equipment 2614 Walker Non Folding 2615 Walker Folding 2616 Walking Stick 3 / 4 Base 2617 Walking Stick Double Grig 2618 Walking Stick Single Base 2619 Walking Stick Single Grip 2620 Ward Linen Trolly 2621 New Born Sheet 2622 Alcohol Based Hand Rub 70% 2623 P.T.Inr Test Kit ( Beccon ) 2624 Pap Smear Kit 2625 Formalin Solution Per Litres 2626 Glycerine Per Litre 2627 Distilled Water Per Litre 2628 Phenol Per Litre 2629 Histology Slides For Histology Lab Set Of 60 Slide 2630 Benedict’S Reagent 500Ml Bottle 2631 Acetic Acid 10% 500Ml Bottle 2632 Litmus Paper 100 Per Pack 2633 Ammonium Sulphate 500Gm 2634 Sodium Nitroprusside 500Gm 2635 Liquor Ammonia 500Ml 2636 Sulphur Powder ( Fine ) 500Gm 2637 Wbc Diluting Fluid 100Ml 2638 Rbc Diluting Fluid 100Ml 2639 Leishmann Stain 500Ml 2640 Dextrose Powder 500Gm 2641 Xylene 500Ml 2642 Paraffin Wax 1 Kg 2643 Nitric Acid 500Ml 2644 Haematoxylin& Eosin Stain 100Ml 2645 Dpx Mount Pre Bottle 100Ml 2646 Egg Albumin Pre Bottle 100Ml 2647 Ethanol ( Absolute ) 500Ml 2648 Rapid Pap Stain 100Ml 2649 May Grunwald Giemsa Stain ( Mgg ) Per Litres 2650 Ziehl-Neelsen Stain ( Zn Stain ) 100Ml 2651 Glass Slides ( Sunbeam–Frosted ) 2652 Cover Slip ( Glass ) 22 X 40 2653 Cover Slip ( Glass ) 22 X 60 2654 Field Stain Pre Bottle 2655 Filter Paper Per Pack 2656 Bloating Paper Per Pack 2657 Distilled Water Per Litres 2658 Reticulocyte Solution ( New Methylene Blue ) Pre Bottle 2659 Fitefaraco Stain Per Litres 2660 Grocott’Smethamine Silver ( Gms ) Stain Pre Bottle 2661 India Ink Per Litres 2662 Sodium Metabisulphite Pre Bottle 2663 Pas ( Periodic Acid Schiff ) Stain Pre Bottle 2664 Edta Vacutainer ( Purple Top ) Per Piece 2665 Sodium Citrate Vacutainer ( Light Blue Top ) 2666 Multistix 10 Sg ( 10 Parameter Urine Analysis Strip ) 2667 Glucose Per Pack Of 100 Test God Pod 2668 Urea Per Pack Of 100 Test Gldh 2669 Creatinine Per Pack Of 100 Test Modified Jaffe’S 2670 Billirubin ( Total And Direct ) Per Pack Of 100 Test Diazo 2671 Sgpt Per Pack Of 100 Test Nadh Oxidation 2672 Sgot Per Pack Of 100 Testnadh Oxidation 2673 Alp Per Pack Of 100 Test Nitrophenyl Phosphate 2674 Total Protein Per Pack Of 100 Test Biuret 2675 Albumin Per Pack Of 100 Test Bcg 2676 Total Cholesterol Per Pack Of 100 Test Chod Pod 2677 Triglyceride Per Pack Of 100 Test Trinder 2678 Hdl Per Pack Of 100 Test Direct 2679 Ldl Per Pack Of 100 Test Direct 2680 Uric Acid Per Pack Of 100 Test Uricase Pod 2681 Uristix ( Strips For Qualitative Urine Ketone Bodies And Protein Detection ) 1 / 100 2682 Troponin I Qualitative Kit 1 / 100 2683 Troponin T Qualitative Kit 1 / 100 2684 Ck-Mb Per Pack Of 100 Testnadp Reduction 2685 T3 Per Pack Of 100 Testimmunoturbidimetry ( Biomerieux ) 2686 T4 Per Pack Of 100 Testimmunoturbidimetry ( Biomerieux ) 2687 Tshimmunoturbidimetry ( Biomerieux ) 2688 Amylase Per Pack Of 100 Test For Semiautomated Biochemistry Analyser 2689 Lipase Per Pack Of 100 Test For Semiautomated Biochemistry Analyser 2690 Ldh Per Pack Of 100 Test For Semiautomated Biochemistry Analyser 2691 Sodium Per Pack Of 100 Test For Semiautomated Biochemistry Analyser 2692 Potassium Per Pack Of 100 Test For Semiautomated Biochemistry Analyser 2693 Distilled Water Per Litres 2694 Vacutainer ( Plain ) Red Coloured Cap 1 / 100 2695 Vacutainer ( Fluoride ) Grey Coloured Cap 1 / 100 2696 Sterilium Per Litres 2697 Microtips ( 10-200 Μl ) 1 / 100 2698 Microtips ( 100-1000 Μl ) 1 / 100 2699 Micro And Macro Tips Stand1 / 100 2700 Micro Pipettes ( 10-100 Μl ) Per Piece 2701 Micro Pipettes ( 20-200 Μl ) Per Piece 2702 Micro Pipettes ( 100-1000 Μl ) Per Piece 2703 Micro Pipettes ( 0.5-50 Μl ) Per Piece 2704 Micro Pipettes Standper Piece 2705 Glass Tubes Small 5Ml 2706 Rubber Pipette Bulb ( 25 Ml ) Per Piece 2707 Rubber Pipette Bulb ( 60 Ml Size ) Per Piece 2708 Pipette Fillers Per Piece 2709 Bottle Top Dispenserper Piece 2710 Acetone2.5 Litre X 1 2711 Acetic Acid 2.5 Litre X 1 2712 Liquid Ammonia500 Ml X 1 2713 Ammonium Chloride 500 Gm X1 2714 Alpha Naphthol 100 Gm X 1 2715 Ammonium Molybdate 500 Gm X1 100 Gm X 1 2716 Ammonium Oxalate 500 Gm X1 2717 Agar Powder 500 Gm X1 2718 Barium Chloride 500 Gm X1 2719 Benzoic Acid 500 Gm X1 2720 Benzidine Powder 100 Gm X 1 2721 Bovine Albumin 5 Gm X1 2722 Benedicts Reagent 5 Litre X 1 2723 Barfoeds Reagent 125 Ml X 1;500 Ml X 1 2724 Bromine Water 500 Ml X 1 2725 Bile Salt 500 Gm X1 2726 Boric Acid 500 Gm X1 2727 Butanol 500 Ml X 1 2728 Copper Sulphate 500 Gm X1 2729 Calcium Carbonate 500 Gm X1 2730 Calcium Chloride 500 Gm X1 2731 Citric Acid500 Gm X1 2732 Chloroform 500 Gm X1 2733 Carbolic Acid / Phenol 500 Gm X1 2734 Cupric Acetate 500 Gm X1 2735 Disodium Hydrogen Phosphate 500 Gm X1 2736 Dipotassium Hydrogen Phosohate 500 Gm X1 2737 Dextrose 500 Gm X1 2738 Dextrin 500 Gm X1 2739 Ethanol 500 Ml X 1 2740 Esbachs Reagent 125 Ml X 1 2741 Egg Albumin Powder 2742 D- Fructose250 Gm X 1 2743 Formaldehyde Solution 500 Ml X 1 2744 Formic Acid 500 Ml X 1 2745 Fehlings Solution A 500 Ml X 1 2746 Fehlings Solution B 500 Ml X 1 2747 Ferric Chloride 500 Gm X1 2748 Ferric Ammonium Sulphate 500 Gm X1 2749 Fouchets Reagent 125 Ml X 1 2750 Gelatin 500 Gm X 1 2751 Hydrochloric Acid ( Hcl ) 2.5 Litre X 1 2752 Hydrogen Peroxide 500 Ml X 1 2753 Iodine Crystals 100 Gm X 1 2754 Lead Acetate Trihydrate 500 Gm X1 2755 Lactose 500 Gm X1 2756 Mercuric Chloride 100 Gm X 1 2757 Mercuric Nitrate 100 Gm X 1 2758 Methyl Red 25 Gm X 1 2759 Methylene Blue 125 Ml X 1; 100 Ml X 1 2760 Magnesium Sulphate 500 Gm X1 2761 Methanol 500 Ml X 1 2762 Mercuric Sulphate100 Gm X 1 2763 Molischs Reagent500 Ml X 1 2764 Maltose 250 Gm X 1 2765 Millons Reagent500 Ml X 1 100 Ml X 1 2766 Ninhydrin 10 Gm X 1 2767 Ninhydrin Reagent 500 Ml X 1 2768 Ortho-Toludine 100 Gm X 1 2769 Potassium Hydroxide 500 Gm X1 2770 Potassium Dichromate 500 Gm X1 2771 Potassium Chromate 500 Gm X1 2772 Potassium Iodide500 Gm X1 250 Gm X 1 2773 Phenopthaleine Indicator 100 Ml X 1 2774 Phenol Red 100 Ml X1 2775 Potassium Chloride 500 Gm X1 2776 Potassium Dihdrogen Phosphate 500 Gm X1 2777 Potassium Ferricyanite 500 Gm X1 2778 Phenylhydrazine 250 Gm X 1 2779 Peptone 500 Gm X1 2780 Picric Acid 500 Gm X1 2781 Resorcinol 500 Gm X1 2782 Sodium Hydroxide 500 Gm X1 2783 Sulphur Powder 500 Gm X1 2784 Sucrose 500 Gm X1 2785 Sulphosalicylic Acid 500 Gm X1 2786 Sodium Dithionite 500 Gm X1 2787 Sodium Nitrite 500 Gm X1 2788 Sodium Nitrate 500 Gm X1 2789 Sodium Acetate 500 Gm X1 2790 Sodium Carbonate 500 Gm X1 2791 Sodium Bicarbonate 500 Gm X1 2792 Starch 500 Gm X1 2793 Sodium Chloride 500 Gm X1 2794 Sodium Sulphate 500 Gm X1 2795 Silver Nitrate100 Gm X 1 2796 Sodium Hydrogen Carbonate 500 Gm X1 2797 Sodium Dihydrogen Phosphate 500 Gm X1 2798 Sulphuric Acid 2.5 Litre X 1 2799 Seliwanoffs Reagent 125 Ml X 1 2800 Sodium Citrate 500 Gm X1 2801 Sodium Potassium Tartarate 500 Gm X1 2802 Sodium Nitroprusside 100 Gm X 1 2803 Sodium Dihydrogen Phosphate 500 Gm X1 2804 Trichloro Acetic Acid 500 Gm X1 2805 Zinc Oxide 500 Gm X1 2806 Nitric Acid 500 Ml X 1 2807 Phenylhydrazine Hydrochloride 250 Gm X 1 2808 Bromophenol Blue 125 Ml X 1 2809 1-Amino-2-Naphthol-4-Sulphonic Acid 25 Gm X 1 2810 2, 4-Dinitrophenyl Hydrazine 100 Gm X 1 2811 2-Amino-2-Methyl-1-Propanol 500 Ml X 1 2812 4-Amino Antipyrine 100 Gm X 1 2813 8-Hydroxyquinoline 100 Gm X 1 2814 Alpha Ketoglutaric Acid 25 Gm X 1 2815 Bromocresol Green 5 Gm X 1 2816 Cholesterol 25 Gm X 1 2817 Creatinine 5 Gm X 1 2818 Diacetylmonoxime 25 Gm X 1 2819 Disodium Phenyl Phosphate 25 Gm X 1 2820 Ehrlich’S Aldehyde Reagent 100 Ml X 1 2821 Glycine 5 Gm X 1 2822 L-Alanine 5 Gm X 1 2823 L-Aspartic Acid 5 Gm X 1 2824 L-Leucine 10 Gm X 1 2825 L-Proline 5 Gm X 1 2826 Nessler’S Reagent 100Ml X 1 2827 O-Cresolphthalein 25 Gm X 1 2828 Oxaloacetate 5 Gm X 1 2829 Ph Indicator Papers Ph Range 1-14 1 Pack 2830 Ph Indicator Papers Ph Range 3.5-6.0 1 Pack 2831 Ph Indicator Papers Ph Range 6.5-9.0 1 Pack 2832 Phosphotungstic Acid 100 Gm X 1 2833 Potassium Thiocyanate 500 Gm X1 2834 Sodium Hypobromite Solution 100 Ml X 1 2835 Sodium Pyruvate 25 Gm X 1 2836 Sodium Tungstate 100 Gm X 1 2837 Sulphanilic Acid 100 Gm X 1 2838 Tartaric Acid 100 Gm X 1 2839 Thiosemicarbazide 25 Gm X 1 2840 Unconjugated Bilirubin 1 Gm X 1 2841 Urea 500 Gm X1 2842 Uric Acid 25 Gm X 1 2843 Whatman Paper No. 1 100 Nos. X 1 2844 Test Tubes 12 × 100 Mm ( Borosil ) 2845 Test Tubes12 × 75 Mm ( Borosil ) 2846 Test Tubes18 × 150 Mm ( Borosil ) 2847 Sterile, Autoclavablepetriplates, Optical Clear ) ( Gamma Irradiated ) 100 Mm × 15 Mm Pack Of 20 Plates ( Borosil ) 2848 Tuberculin Syringe 1 / 100 Pack 2849 Sterile Cotton Swab In Screw Capped Plastic Tubes 75Mm Packed In 12 Mm Tube Per Piece 2850 Sterile Cotton Swab Sticks 100 Per Pack 2851 Urine Container 1 / 100 ( 30 Ml ) 2852 Stool Container 1 / 100 ( 50 Ml ) 2853 Micropipette Tips ( Nucleases Autoclavable Polystyrene Free ( 500 Μl-1000 Μl ) 1 / 1000 Tips 2854 Micropipette Tips ( Nucleases Autoclavable Polystyrene Free ) ( 1Μl-500 Μl ) 1 / 1000 2855 Dropping Bottle ( Plastic ) 2856 Filter Paper ( 46×57 Cm ) 1 / 50Big Sheet 2857 Forcep ( Pointed ) 2858 Teasing Needle 2859 Metal Loop Holder ( W / O Loop ) Any Size Of Nichrome Wire Can Be Inserted 1×24Pack 2860 Antibiotic Zonescale Per Psize 370 Mm×65 Mm 2861 Cleaning Brush For Test Tubes Nylon Material 2862 Filter Paper ( Watsmen No 6 ) Pack 2863 Cotton Bundle Roll 2864 Plastic Tray 24X18x6 2865 Steam Indicatortape 1 No 2866 Serum Vials 1 Pack Of 500 Vials 2Ml 2867 Screw Capped Plastic Tubes 1 Pack Of 500 Vials 2868 Serum Vial Stand ( For 2 Ml Vials ) 2869 Durham’S Tube 1 Pack Of 500 2870 Multichannel Pipette ( 50 Ul-300 Ul ) 2871 Micropipette Tip Stand ( 1Μl-500 Μl 2872 Micropipette Tips Stand ( 500 Μl-1000 Μl ) 2873 Acetone 500 Ml 2874 Alberts Metachromatic Stain Kit ( Stain A &B ) 500 Ml 2875 Barium Chloride 500 Gm 2876 Carbol Fuchsin 25Gm 2877 Phenol ( Crystal ) 500 Gm 2878 Cedar Wood Oil - 30Ml. 30Ml 2879 Distilled Water 5 Ltr 2880 Ethanol Absolute , 500 Ml 5Lit 2881 Crystal Violet 125 Ml 2882 Methylene Blue Solution 25 Gm 2883 Ph- Paper Range - 2 - 10.5 2884 Saffranin 125 Ml 2885 Spirit 500 Ml 2886 Sulphuric Acid Conc. 5 Ltr 2887 Gram Stain Kit 2888 Liquid Paraffin 500Ml 2889 Tissue Paper / Laboratory Paper 50 Role 2890 Xylene 500 Ml 2891 Hydrogen Peroxide 3% 1 Lit 2892 Lactophenol Cotton Blue Stain 100 Ml 2893 Hydrochloric Acid Conc. 500 Ml 2894 India Ink Stain 100 Ml 2895 Potassium Hydroxide Pellets 500 Gm 2896 Sodium Hydroxide 500 Gm 2897 Nichrome Wire Loop 2Mm 2898 Nichrome Wire Loop 4Mm 2899 Aluminium Foil Roll 500 Gm 2900 Disposable Syringe With Needle 2 Ml 2901 Disposable Syringe With Needle 2 Ml 2902 Kovacs Reagent ( For Indole Test ) 100 Ml 2903 Grams Iodine 125 Ml 2904 Blood Culture Bottle ( Adult ) ( ) 70 Ml 2905 Blood Culture Bottle ( Pediatric ) ( ) 20 Ml 2906 Sodium Hypochlorite Solution 5 Lit 2907 Haem Test Kit ( Stool For Occult Blood Test ) 1 Pack Of 200 Test 2908 Rapid Afb Stain Kit ( Ba1523, 2X100ml ( Biolab ) 100 Ml 2909 Lugol’S Iodine 125 Ml / Bottle 2910 Normal Saline 500 Ml / Bottle 2911 Golves ( 7.5 No ) 50 Pairs / Pack 2912 Liquid Soap 500 Ml 2913 Hand Sanitizer 500Ml 2914 Normal Saline 500 Ml / Bottle 2915 Vaccutainers ( Plain ) Red Coloured Cap 100 / Pack 2916 Triple Sugar Iron Agar 500 Gm Mo21- 500G, 2917 Peptone 500 Gm Rm667- 500G, 2918 Agar Agar Powder 500 Gm Rm026-500 G, 2919 Bile Esculin Agar ( Mv972 ) 100 Gm M340-100 G, 2920 Cooked Meat Medium 500 Gm M149-500G, 2921 Fluid Thioglycolate Medium 500 Gm Mm009-500G, Hi Media 2922 Deoxycholate Citrate Agar 500 Gm M065-500 G, 2923 Mac-Conkey Agar 500 Gm M081-500G, 2924 Mannitol Salt Agar Base 100Gm M118-100 G, 2925 Sabouroudcyclohexamide Agar 500 Gm M063-500 G, 2926 Simmons Citrate Agar 500 Gm M0009-500 G, 2927 Tcbs Agar 500 Gm M189- 500 G, 2928 Urea 40% Fd048 10 Ml 2929 Urea Agar Base 500 Gm M112-500G, Hi Media 2930 Ready Water Testing Kit K015 2931 Tuberculin P.P.D 1 Tu 2932 Nutrient Agar 500 Gm M877-500G, Hi Media 2933 Meuller Hinton Agar 500 Gm M1084-500 Gm 2934 Brain Heart Infusion Broth 500Gm 10210-500G 2935 Spore Strips 25 Strips / Pack Dd032-1Pk 2936 Glucose Broth 500 Gm Pack M-860 2937 L J Media 10 Bottles / Box Sl-001-10Sl 2938 Field Stain Kit 1 K-011L 2939 Ferric Chloride 500 Gm Rm1379 2940 Mr-Vp Broth 100 Gm -M070 2941 Methyl Red Indcator 125 Ml Bottle -1007 2942 Glucose 500 Gm 2943 Lactose 500 Gm 2944 Sucrose 500 Gm 2945 Mannitol Disk 1 Vial Dd006-1Vl 2946 Corn Meal Agar 100 Gm M146-100G 2947 Moeller Decarboxylase Broth Lysine 100 Gm M687-100G 2948 Moeller Decarboxylase Broth Ornithine 100 Gm M688-100G 2949 Moeller Decarboxylase Broth Arginine 100 Gm M689-100G 2950 Phenol Red Broth Base 500 Gm M054-500G 2951 Sodium Chloride 500 Gm Rm853-500G 2952 Beef Extract Powder 500 Gm Rm669-500G 2953 Glucose - Phosphate Broth 100 Gm M070-100G 2954 Barritt Reagent A 100 Ml R029-100 Ml 2955 Barritt Reagent A 100 Ml R030-100 Ml 2956 Macconkey Double Strength Broth 500 Gm Hi Media 2957 Amikacin Antibiotic Disc 30Mcg Sd035-5Vl 2958 Amoxyclav Antibiotic 20+10Mcg Sd063-5Vl 2959 Ampicillin Antibiotic 10Mcg Sd002-5Ct 2960 Aztreonam Antibiotic Disc 30Mcg Sd212- 5Ct 2961 Ampicillin + Sulbactum Antibiotic Disc ( 10+10 ) Mcg Sd112-5Ct 2962 Bacitracin 0.04 Unit Dd015-1Vl 2963 Cefotaxime Antibiotic Disc 30Mcg Sd040 - 2964 Cefoxitin Antibiotic Disc 30Mcg Sd041 - 2965 Clindamicin Antibiotic Disc 2Mcg Sd051-5Ct 2966 Cefotaxime + Clavulanic Acid Antibiotic Disc ( 30+10 ) Mcg Sd724-5Ct 2967 Ceftazidime + Clavulanic Acid Antibiotic Disc ( 30+10 ) Mcg Sd207-5Ct 2968 Cefalexin 30 Mcg Sd048–5Ct 2969 Ceftriaxone Antibiotic Disc 30Mcg Sd065 – 5Ct 2970 Cefazoline Antibiotic Disc 30Mcg Sd047-5Ct 2971 Cefepime Antibiotic Disc 30Mcg Sd219- 5Vl 2972 Cefuroxime Antibiotic Disc 30Mcg Sd061-5Ct 2973 Chloromphenicol Antibiotic Disc 30Mcg Sd006- 5Vl 2974 Ciprofloxacin Antibiotic Disc 5Mcg Sd060- 5Vl 2975 Cefixime 30Mcg Sd211- 5Ct 2976 Colistin E-Strip ( 0.5 ) 10Mcg Em020-30St 2977 Ceftazidime 30Mcg Sd062- 5Vl 2978 Co-Trimaxazole ( 1.25+23.75 ) Mcg Sd010-5Vl 2979 Cefoperazone Sulbactum 75 / 10Mcg Sd254-5Ct Hi Media 2980 Doxycycline 30Mcg Sd012-5Vl 2981 Imipenam Antibiotic Disc 10Mcg Sd073-5Vl 2982 Imipenam + Edta Antibiotic Disc ( 10+750 ) Mcg 2983 Ertapenem Antibiotic Disc 10Mcg Sd280-5Vl 2984 Levofloxacin Antibiotic Disc 5Mcg Sd216 – 5Vl 2985 Linezolid Antibiotic Disc 30Mcg Sd215-5Ct 2986 Meropenam Antibiotic Disc 10Mcg Sd727- 5Vl 2987 Moxifloxacin 5Mcg Sd217- 5Ct 2988 H.S Gentamicin 120Mcg Sd195-1Vl 2989 Netilmicin Antibiotic Disc30mcg Sd085-5Ct 2990 Nitrofurantoin Antibiotic Disc 300Mcg Sd023-5Vl 2991 Norfloxacin Antibiotic Disc 10Mcg Sd057-5Vl 2992 Nalidixic Acid Antibiotic Disc 30Mcg Sd021-1Vl 2993 Ofloxacin Antibiotic Disc 5Mcg Sd087-5Ct 2994 Optochin Antibiotic Disc 5Mcg Dd009-1Vl 2995 Oxidase Disc Antibiotic Disc Dd018-1Vl 2996 Penicillin G Antibiotic Disc 10 Units Sd028- 5Ct 2997 Piperacillin Antibiotic Disc 100Mcg Sd066-5Ct 2998 Piperacillin / Tazobactum Antibiotic Disc ( 100+10 ) Mcg Sd210-5Vl 2999 Polymyxin B E- Strip Part A 240-.01Mcg Part B32-.001Mcg / Ml Em043-30St 3000 Polymyxin B 50Mcg 3001 Tigecycline Antibiotic Disc 15Mcg Sd278-5Ct 3002 Novobiocin 5Mcg 3003 Gentamicin 10Mcg Sd016-5Vl 3004 Teicoplanin Antibiotic Disc 30Mcg Sd213-5Ct 3005 Tetracycline Antibiotic Disc 30Mcg Sd037-5Vl 3006 Tobramycin Antibiotic Disc 10Mcg Sd044-5Vl 3007 Vancomycin Antibiotic Disc 30Mcg Sd045-5Ct 3008 Vancomycin E- Strip 256-.015Mcg / Ml Em060-30St 3009 Fosfomycin 200Mcg Sd179- 5Vl 3010 Azithromycin 15Mcg Sd204- 3011 Erythromycin 15Mcg Sd013-5Ct 3012 Hbsag Test Kit 10 Tests / Kit 3013 Hcv Test Kit 10 Tests / Kit 3014 Rpr Test Kit 25 Tests ( 5 Ml Reagent ) / Kit 3015 Malaria Ag ( Pv / Pf ) Test Kit 10 Tests / Kit 3016 Widal Slide Agglutination Test Kit 25 Tests ( 5 Ml Reagent ) / Kit 3017 Dengue Ns1 Antigen Elisa 96 Tests / Kits 3018 Ra Factor Test Kit 25 Tests ( 5 Ml Reagent ) / Kit 3019 Aso Titre Test 25 Tests ( 5 Ml Reagent ) / Kit 3020 Crp Test 25 Tests ( 5 Ml Reagent ) / Kit 3021 Widal Tube Agglutination Test 25 Tests ( 5 Ml Reagent ) / Kit 3022 Torch Elisa 1 / 96 Test 3023 Hbeag Strip Rapid Card Test 10 Tests / Kit 3024 Hepatitis A Rapid Card Test 10 Tests / Kit 3025 Weil Felix Tube Agglutionation Test 25 Tests ( 5 Ml Reagent ) / Kit 3026 Atcc Strain-Enterococcus Fecalis 29212 Pack Of 2 Swabs – 0366-P 3027 Atcc Strain - E.Coli 25922 Pack Of 2 Swabs -0335-P 3028 Atcc Strain - E.Coli 35218 Pack Of 2 Swabs – 0495-P 3029 Atcc Strain Pseudomonas Aeruginosa 27853 Pack Of 2 Swabs -0353-P 3030 Atcc Strain Staphylococcus Aureus 25923 Pack Of 2 Swabs -0360-P 3031 Atcc Strain Staphylococcus Aureus 29213 Pack Of 2 Swabs – 0365-P 3032 Atcc Klebsiella Pack Of 2 Swabs – 01005 P 3033 Pneumoniae Baa - 1705 3034 Atcc Klebsiella Pack Of 2 Swabs - 0784-P 3035 Pneumoniae 700603 3036 Atcc Candida Albicans 10231Pack Of 2 Swabs - 0443-P 3037 Atcc Candida Tropicalis 750 Pack Of 2 Swabs - 0767-P 3038 Antisera - Salmonella 1 Set 3039 Antisera – Shigella Dysenteriae 3040 Antisera – Shigella Flexnari 3041 Antisera – Shigella Sonnie 3042 Antisera - Vibrio Cholerae 1 Set 3043 Methylene Blue Stain 100Ml 3044 Carbol Fuschin ( Strong ) 100Ml 3045 Sulfuric Acid ( Conc. ) Per Liter 3046 Ecg Electrode ( Disposal ) Other 3047 Electric Setlizier 10*5 Other 3048 Electric Setlizier 14*5 Other 3049 Electric Setlizier 16*5 Other 3050 Electric Setlizier 18*5 Other 3051 Electric Setlizier 20*5 Other 3052 Reusable Preformed Supraglotic Airway Device With Sizes 1, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3053 Reusable Preformed Supraglotic Airway Device With Sizes 1.5, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3054 Reusable Preformed Supraglotic Airway Device With Sizes 2, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3055 Reusable Preformed Supraglotic Airway Device With Sizes 2.5, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3056 Reusable Preformed Supraglotic Airway Device With Sizes 3, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3057 Reusable Preformed Supraglotic Airway Device With Sizes 4, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3058 Reusable Preformed Supraglotic Airway Device With Sizes 5, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3059 Reusable Preformed Supraglotic Airway Device With Sizes 6, -Should Have Silicon Cuff , Reinforced Tip, Pilot Balloon Withtactile Indication, Autoclavable , Us Fda , Ce & Iso Certified. 3060 Supraglotic Airway Device With Integrated Gastric Access And Intubation :- 3061 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 1 Usfda Ce & Iso Certified 3062 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 1.5 Usfda Ce & Iso Certified 3063 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 2 Usfda Ce & Iso Certified 3064 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 2.5 Usfda Ce & Iso Certified 3065 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 3 Usfda Ce & Iso Certified 3066 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 4 Usfda Ce & Iso Certified 3067 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 5 Usfda Ce & Iso Certified 3068 Reinforced Tip With Gastric Drainage Port And Intubating Laryngeal. Pilot Balloon Withtactile Indication, Mri Safe And Phthalate Free Material. Integrated Bite Absorption Area. Soft & Thin Cuff & Available With Sizes 6 Usfda Ce & Iso Certified 3069 Manual Resuscitators With Built In Pressure Limitation – Adult Withface Mask Of Size 3 / 4 & 5, O2 Tidal Volume 1300 Ml, Reservoir Volume 1500 Ml; 100% Latex Free & Double Layered. Built-In- Pressure Limitation, Single Shutter Valve, Integrated Hand Strap, Autoclavable, Provision To Attach Peep Valve. Usfda , Ce & Iso Certified 3070 Manual Resuscitators With Built In Pressure Limitation – Paediatric / Neonatewith Face Mask Of Size 0 & 2 Max. Tidal Volume - 300 Ml; Volume Of O2 Reservoir - 1500 Ml / Volume 100% Latex Free Outer Cover & Double Layered. Single Shutter Valve, Integrated Hand Strap, Autoclavable , Pressure-Limiting Valve , Provision To Attach Pressure Manometer, Usfda , Ce & Iso Certified 3071 Ecg Electrodes With Offset Connector. Highly Conductive Wet Gel , Combination Of Instant And Long-Term Adhesives , Breathable Micro Porous Material , Special Soft Spongeoffset Connector Concept, High Quality Ag / Agcl Sensor 3072 Airway Visualization System ( Adult ) :-Display Monitor With Video Output Capability. Work On Aaa Consumable Batteries & Runs Continuously Upto 90 Mints. Can Work On Reusable Batteries Too If Required, Anti Fog Lens With White Led Light Source, Supplied With 3Pcs Of Size 3 Channelled And 1 Pc Of Size 3 Non-Channelled Blades, 510 K , Iso & Ce Certified 3073 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 18, 3074 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 20, 3075 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 22, 3076 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 24, 3077 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 26, 3078 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 28, 3079 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 30, 3080 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 32, 3081 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 34, 3082 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 36, 3083 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 38, 3084 Reusable Armored Tube Made Of 100% Siliconized, Radio Opaque, Mounted Connector, Pilot Balloon With Universal Port. Size- 40, 3085 Broad Spectrum Antimicrobial / Antibacterial / Double Lumen Polyurethane Cvc Catheter Kit, Catheter And Extension Line Along With Hub Should Be Impregnated. Kit Should Contain- Fr-7, G-14X18, L-16Cm.With J Guide Wire, Rollerson, Syringe, Dilator, Scalpel. Needle Free Cannula Transduction Probe, Catheter Stabilization Device. 3086 Broad Spectrum Antimicrobial / Antibacterial Triple Lumen Polyurethane Cvc Catheter, Catheter And Extension Line Along With Hub Should Be Impregnated. Kit Should Contain- Fr-7, G-16X18x18, L-16Cm. With J Guide Wire, Rollerson, Syringe, Hub Stopper Impregnated With 70% Isopropyl Alcohol Swab Dilator, Scalpel. Needle Free Cannula, Transduction Probe, Catheter Stabilization Device 3087 Broad Spectrum Antimicrobial / Antibacterial Double Lumen Polyurethane Hd Catheter, Catheter Lumen And Extension Line Along With Hub Should Be Impregnated. Kit Should Contain- Fr-12, L-13Cm. With J Guide Wire, Rollerson Syringe With Dilator, Scalpel. Needle Free Cannula, Transduction Probe, Catheter Stabilization Device. 3088 Broad Spectrum Antibacterial / Antifungal Triple Lumen Polyurethane Hd Catheter, Catheter And Extension Line Along With Hub Should Be Impregnated. Kit Should Contain- Fr-12, L-16Cm. With J Guide Wire, Rollerson Syringe, Dilator, Scalpel. Needle Free Cannula, Transduction Probe, Catheter Stabilization Device. 3089 Hydrocolloid Scar Free Nasal Pads To Prevent Cpcp, Bipap, And Oxy Mask, To Avoid Pressure Ulcers Or Bruises On The Nose. Sizes S / L. Ce Certified. 3090 Hemostatic Dressing In Sponge / Pad From Made Of 100% Natural Biopolymer With A Net Positive Charge, Gama Sterilized And Moisture Proof. Usfda Approved. Sizes- 5*5, 3091 Hemostatic Dressing In Sponge / Pad From Made Of 100% Natural Biopolymer With A Net Positive Charge, Gama Sterilized And Moisture Proof. Usfda Approved. Sizes- 8*8 3092 Urethral Catheter Made Up Of Soft Color Less, Clear, Breathable, Odorless, 3093 100% Silicon Having White Opaque Line And White Cyclindercal Balloon Tip 5 To 10 Ml Balloon Capacity. Sizes- 8, Should Be Us Fda Approved. 3094 100% Silicon Having White Opaque Line And White Cyclindercal Balloon Tip 5 To 10 Ml Balloon Capacity. Sizes- 12, Should Be Us Fda Approved. 3095 100% Silicon Having White Opaque Line And White Cyclindercal Balloon Tip 5 To 10 Ml Balloon Capacity. Sizes- 14, Should Be Us Fda Approved. 3096 100% Silicon Having White Opaque Line And White Cyclindercal Balloon Tip 5 To 10 Ml Balloon Capacity. Sizes- 16, Should Be Us Fda Approved. 3097 100% Silicon Having White Opaque Line And White Cyclindercal Balloon Tip 5 To 10 Ml Balloon Capacity. Sizes- 18, Should Be Us Fda Approved. 3098 Non-Absorbable Polymer Locking Clips Provide Cool Secure Ligation; Clip Locks Onto The Vessel. Clip Sizes Medium, Medium-Large, Large And Extra-Large. The Non-Absorbable Polymer Clip Is Inert, Nonconductive, Radiolucent, And Does Not Interfere With Ct Or X-Ray Diagnostics. Fda Approved 3099 Multifunctional Mask With The Multiple Integrated Attachment Of Nebulizer Mask, Venture Mask, Oxygen Mask, With 7” Double Oxygen Tube. Should Have Oxygen Outlet Diverter And Fenestration Opening Slits On Both Sides. Fda Approved 3100 Polymer Ligation Device With Locking Mechanism, Sterile, Radiolucent Property, Usfda Approved. Cartridges Should Have Self-Adhesive Backing.Sizes- A- Medium Large Polymer Ligation Device. 3101 Polymer Ligation Device With Locking Mechanism, Sterile, Radiolucent Property, Usfda Approved. Cartridges Should Have Self-Adhesive Backing. Sizes- B- Medium Large Polymer Ligation Device. 3102 Polymer Ligation Device With Locking Mechanism, Sterile, Radiolucent Property, Usfda Approved. Cartridges Should Have Self-Adhesive Backing.Sizes- C- Medium Large Polymer Ligation Device. 3103 Open Applicator-Matt Finishing Stainless Steel Applier, With Us Fda Approved. 3104 Endo Applicator- Matt Finishing Stainless Steel Applier, With Us Fda Approvedsizes- A- 32.5Cm For Ml / L / Xl 3105 Endo Applicator- Matt Finishing Stainless Steel Applier, With Us Fda Approvedsizes- B- 45Cm For Ml / L / Xl 3106 Micro Titanium Ligation Device With Locking Mechanism, Sterile, Usfda Approved. Cartridges Should Have Self-Adhesive Backing. 3107 Open Applicator-Matt Finishing Stainless Steel Applier, With Us Fda Approved. 3108 Postpartum Hemorrhage Balloon Silicon Catheter For Control Of Obstetrical Bleeding Or Management Of Pph. Size- 24Fr, Length- 54Cm, Balloon Capacity-500Ml, Fda Approved 3109 Cervical Ripering Balloon For Mechanical Dilation L-40Cm. Fr.-18, Balloon Capacity 80Ml. 3110 Pur Catheter Non Shrinkable Iv Line With Prefilled 70% Isopropyl Alcohol Cap For Peripheral Veins. Xro, And With Non- Return Valve 3111 Short Iv Catheter For Neonates With Straight Guide Wire. G-22, L-10, 12Cm 3112 Arterial Catheter With Floswitch And Straight Guide Wire, G-18, L-6 / 13Cm 3113 Short Ptfe Material Emergency Catheter With Floswitch And Stabilising Device. G-14, L- 13 16Mm. 3114 Reinforced Epidural Wired Polyurethane Catheter Kit With Stainless Steel Needle. Size- Catheter-19G, Needle-17G. 3115 Suture Free Securement Hydrocolloid Device S 3116 Suture Free Securement Hydrocolloid Device M 3117 Suture Free Securement Hydrocolloid Device L 3118 Medicated Catheter Stabilization Device With Medical Grade Pvc Clamp Should Have Id Tag S 3119 Medicated Catheter Stabilization Device With Medical Grade Pvc Clamp Should Have Id Tag M 3120 Medicated Catheter Stabilization Device With Medical Grade Pvc Clamp Should Have Id Tag L 3121 Vascular Haemostatic Pad To Stop External Bleeding And Catheterization Site Bleeding , Should Be 100% Chitosin Material, Size-2”X2” Single Pack. Sterilized. 3122 Paracain Eye Drop 0.5% 3123 Trypan Blue-Dye 0.4% 3124 Plastering In C.M 1:5-12 Mm Thick With Including Cost And Conveyance Of All Materials And Including All Labour Charges Etc Complete 3125 Spectacles For Nschool Childrem Na. Frame- Material- Ployflex Unbreakable Frame With All Different Sizes Suitable For Children ( From 8-20 Yrs ) . Nb. Lenses- Cr Hardcoated Lenses ( Fiber ) Of Prescribed Numbers. Nc. Case-Plastic Case Printed As Followos- Nname Of The District....... Nnpcb & Vi, Nmadhya Pradesh Nnot For Sale Nd. Accessiores- Ni. Dori, Nii. Cleaning Cloth ( Slevet ) , Niii. Prescription Card, N 3126 Screening And Free Spectacles For Near Work To Old Person Na. Frame- Material- Ployflex Unbreakable Frame With All Different Sizes Suitable For Old Person Nb. Lenses- Cr Hardcoated Lenses ( Fiber ) Of Prescribed Numbers. Nc. Case-Plastic Case Printed As Followos- Nname Of The District....... Nnpcb & Vi, Nmadhya Pradesh Nnot For Sale Nd. Accessiores- Ni. Dori, Nii. Cleaning Cloth ( Slevet ) , Niii. Prescription Card, N 3127 Spectacles After Cataract Surgery ( Where Bifocal Lens Will Be Needed ) Na. Frame- Material- Ployflex Unbreakable Frame With All Different Sizes Suitable For Cataract Patient. Nb.Lenses- Cr Hardcoated Lenses ( Fiber ) Of Prescribed Numbers. Nc. Case-Plastic Case Printed As Followos- Nname Of The District....... Nnpcb & Vi, Nmadhya Pradesh Nnot For Sale Nd.Accessiores- Ni. Dori, Nii. Cleaning Cloth ( Slevet ) , Niii. Prescription Card, N 3128 Gastro Intestinal Anastomotic Stapler 60 Mm With Dual Firing Knob And Inbuilt Knife In Every Cartridge, Gia6038s, Gia6048s, Gia6025s 3129 Gastro Intestinal Anastomotic Stapler 80 Mm With Dual Firing Knob And Inbuilt Knife In Every Cartridge, Gia8038s, Gia8048s 3130 Gastro Intestinal Anastomotic Stapler 100 Mm With Dual Firing Knob And Inbuilt Knife In Every Cartridge, Gia10038s, Gia10048s 3131 Gastro Intestinal Anastomotic 60 Mm Cartridge With Fresh Knife-White / Blue / Green, Gia6025l, Gia6038l, Gia6048l 3132 Gastro Intestinal Anastomotic 80 Mm Cartridge With Fresh Knife-White / Blue / Green, Gia8038l, Gia8048l 3133 Gastro Intestinal Anastomotic 100 Mm Cartridge With Fresh Knife-White / Blue / Green, Gia10038l, Gia10048l 3134 Reusable Gastro Intestinal Anastomotic Stapler 60 Mm With Dual Firing Knob And Inbuilt Knife In Every Cartridge, Gia60rs 3135 Reusable Gastro Intestinal Anastomotic Stapler 80 Mm With Dual Firing Knob And Inbuilt Knife In Every Cartridge, Gia80rs 3136 Gastro Intestinal Anastomotic 60 Mm Cartridge With Fresh Knife-White / Blue / Green For Reusable Stapler, Gia6025rl, Gia38rl, Gia6048rl 3137 Gastro Intestinal Anastomotic 80 Mm Cartridge With Fresh Knife-White / Blue / Green For Reusable Stapler, Gia8038rl, Gia8048rl 3138 Curved End To End Anastomotic Stapler 25 Mm With Tilt-Top Anvil 3139 Curved End To End Anastomotic Stapler 28 Mm With Tilt-Top Anvil 3140 Curved End To End Anastomotic Stapler 31 Mm With Tilt-Top Anvil, Eea31 Circular Stapler 3141 Curved End To End Anastomotic Stapler 33 Mm With Tilt-Top Anvil, Eea33 Circular Stapler 3142 Endo Gastro Intestinal Anastomotic Universal Stapler Can Accommodate All Sizes Of Cartridges Also Both Straight And Roticulator Cartridges 3143 Bladeless Trocar -5Mm / 11Mm / -12Mm, Nonb12sts, Nonb5stf 3144 Optical Bladeless Trocars-5 Mm / 11Mm / 12Mm / 15Mm, Onb12sts, Onb5stf 3145 Hemorrhoid Stapler 33 Mm Diametre With Detachable Anvil And Staple Height 3.5 Mm, Hem3335 3146 Hemorrhoid Stapler 33 Mm Diametre With Detachable Anvil And Staple Height 4.8 Mm, Hem3348 3147 Appose Ulc Skin Stapler With 35 Wide Staples 3148 Premium Single Use Skin Stapler Remover 3149 Med Wound Protector 5 - 9Cm, Wpsmd509 3150 Sml Wound Protector 2.5 - 6Cm, Wpsm256 3151 Premium Surgiclip Iii 9.0 3152 3X6 Endobag Specimen Retrieval 3153 5 X 8 Endobag Specimen Retriev 3154 Endo Clip* Ii Med / Lrg Applier 3155 Premium Surgiclip* Ii M-9.75 3156 Premium Surgiclip* Ii M-11.5 3157 Fred Anti Fog Kit 3158 Monofilament Glycomer 631* 3-0 75Cm , Undyed 24Mm 3 / 8 Circle Reverse Cutting 3159 Monofilament Glycomer 631* 0 75Cm , Undyed 37Mm 1 / 2 Circle Reverse Cutting 3160 Monofilament Glycomer 631* 2-0 75Cm , Undyed 37Mm 1 / 2 Circle Reverse Cutting 3161 Monofilament Glycomer 631* 0 , 150Cm Loop , Violet 40Mm 1 / 2 Circle Taper Point 3162 Monofilament Glycomer 631* 1 , 90Cm , Violet 40Mm 1 / 2 Circle Taper Point 3163 Monofilament Glycomer 631* 2-0 75Cm , Violet 26Mm 1 / 2 Circle Taper Point 3164 Monofilament Polyglyconate* 3-0 75Cm , Green 20Mm 1 / 2 Circle Taper Point 3165 Monofilament Polyglyconate* 1, 150Cm Loop, Green 40Mm 1 / 2 Circle Taper Point 3166 Monofilament Polyglyconate* 1 90Cm , Green 48Mm 1 / 2 Circle Taper Point 3167 Monofilament Polyamide * 1 150Cm , Loop , Black 48Mm 1 / 2 Circle Taper Point 3168 Coated, Braided Lactomer 91* 3-0 75Cm , Undyed 24Mm 3 / 8 Circle Reverse Cutting 3169 Coated, Braided Lactomer 91* 3-0 75Cm , Violet 22Mm 1 / 2 Circle Taper Point 3170 Coated, Braided Lactomer 91* 0 90Cm , Violet 37Mm 1 / 2 Circle Reverse Cutting 3171 Coated, Braided Lactomer 91* 2-0 90Cm , Violet 37Mm 1 / 2 Circle Reverse Cutting 3172 Coated, Braided Lactomer 91* 0 90Cm , Violet 40Mm 1 / 2 Circle Reverse Cutting 3173 Coated, Braided Lactomer 91* 1 90Cm , Violet 40Mm 1 / 2 Circle Reverse Cutting 3174 180 Absorbable Polyglyconate Knotless Wound Closure Device With Unidirectional & Dual Angled Cut Barbs Geometry * 0 45Cm , Green 37Mm 1 / 2 Circle Taper Point 3175 180 Absorbable Polyglyconate Knotless Wound Closure Device With Unidirectional & Dual Angled Cut Barbs Geometry * 2-0 30Cm , Green 37Mm 1 / 2 Circle Taper Point 3176 90 Glycomer 631 Knotless Wound Closure Device With Unidirectional & Dual Angled Cut Barbs Geometry 3-0 58Cm , Undyed 24Mm 3 / 8 Circle Reverse Cutting 3177 90 Glycomer 631 Knotless Wound Closure Device With Unidirectional & Dual Angled Cut Barbs Geometry 3-0 45Cm , Undyed 24Mm 3 / 8 Circle Reverse Cutting 3178 Polybutester With Polytribolate Coating Knotless Wound Closure Device With Unidirectional & Dual Angled Cut Barbs Geometry 1 45Cm , Blue 37Mm 1 / 2 Circle Taper Point 3179 Polyester Self Gripping Mesh For Open Inguinal Hernia Repair, Size 14X9cm L&R 3180 Polyester Self Gripping Mesh For Open Incisional Hernia Repair, Size 20X15cm 3181 Polyester Self Gripping Mesh For Open Incisional Hernia Repair, Size 15X15cm 3182 Synthetic Absorbable Triclosan Coated Polyglactin 910, Size 1, Needle 40Mm, 1 / 2 Circle Round Body , 90Cm Length 3183 Synthetic Absorbable Triclosan Coated Polyglactin 910, Size 1-0, Needle 40Mm, 1 / 2 Circle Round Body , 90Cm Length 3184 Synthetic Absorbable Triclosan Coated Polyglactin 910, Size 1, 40Mm, 1 / 2 Circle Reverse Cutting Os Needle , 90Cm Length 3185 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 1, Needle 36.4 Mm, 1 / 2 Circle Taper Point Ct-1 90Cm 3186 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 1-0, Needle 36.4 Mm, 1 / 2 Circle Taper Point 90Cm 3187 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 2-0, Needle 26Mm, 1 / 2 Circle Taper Point 70Cm 3188 Synthetic Absorbable Triclosan Coated Polydioxanone, Size 3-0, Needle 17Mm, 1 / 2 Circle Taper Point 70Cm 3189 Synthetic Absorbable Triclosan Coated Poliglecaprone 25, Size 2-0, 26 Mm, 1 / 2 Circle Round Body, Visiblack Jb Needle 70Cm 3190 Synthetic Absorbable Triclosan Coated Poliglecaprone 25, Size 3-0, 26 Mm, 3 / 8 Circle Reverse Cutting, 70Cm 3191 Oxidized Regenerated Cellulose Based Topical Absorbable Hemostat, Fibrillar / Layer Form, With Bactericidal Property. Fibril Material ( 7Layers ) For Broad Surface Area Coverage. Approved By Us Fda Size 2X4 Inch 3192 Oxidized Regenerated Cellulose Based Topical Absorbable Hemostat, Structured Non-Woven Material, With Bactericidal Property. Ease-Of-Use In Both Open And Minimally Invasive Procedures. Approved By Us Fda Size 2X4 Inch 3193 Macroporus Partially Absorbable Mesh Made Up Of Approximately Equal Parts Of Polypropylene Monofilament Fiber ( 6-0 ) And Poliglecaprone 25 Monofilament Fiber ( 5-0 ) With Pore Size 2.7 Mm Having A Weight Of 39 G / M2 And Containing Blue Orientation Stripes Of Polypropylene. 15Cmx15cm 3194 Complete Absorbable Mesh Fixation Device With Minimum Strap Length 7.0 Mm 2-Point Fixation To Hold The Mesh And Device. 25 Absorbable Tracks 3195 Absorbable Unidirectional Barbed Device, Symmetric Anchoring Pattern, Triclosan Coated Polydioxanone, Size 1-0, 36Mm , 1 / 2 Circle Taper Point Ct-1 Needle, 45Cm With Fixation Tab 3196 Vicryl 4-0 Round Body 3197 Triways Foleys Catheter 16 French 3198 K 91 Catheter 3199 Tuberculin Syringe 3200 Sterile Cotton Swab Sticks Individualy Wrapped In Plastic Cover 100 Swab Sticks / Pack 3201 Micropipette Tips ( Nucleases Autoclavable Polystyrene Free ) ) ( 500 Μl-1000 Μl ) 1 Pack Of 1000 Tips 3202 Filter Paper ( 46×57 Cm ) Big Sheet 3203 Forcep ( Pointed ) 3204 Teasing Needle 3205 Metal Loop Holder ( W / O Loop ) Any Size Of Nichrome Wire Can Be Inserted 1×24 3206 Nichrome Wire Loop 2Mm 3207 Nichrome Wire Loop 4Mm 3208 Antibiotic Zonescale Size 370 Mm×65 Mm 3209 Cleaning Brush For Test Tubes Nylon Material 3210 Spatula128 ( Make- Steel ) 3211 Concavity Slide ( 1 Cavity ) 10 Slides / Pack 3212 Filter Paper ( Watsmen No 6 ) 3213 Plastic Tray 24X18x6 3214 Rubber Bulb For Glass Pipette For 1 Ml 3215 Rubber Bulb For Glass Pipette For 5 Ml Pipette 3216 Test Tube Racks For 12 × 100 Mm Tubes 3217 Test Tube Racks For 12 × 75 Mm Tubes 3218 Test Tube Racks For 18 × 150 Mm Tubes 3219 Steam Indicator Tape 1 No 3220 Autoclave Drum ( Stainless Steel ) 6” X 6 “ 3221 Serum Vials 1 Pack Of 500 Vials 3222 Screw Capped Plastic Tubes 5 Ml ( 1 Pack Of 500 Vials ) 3223 Serum Vial Stand 3224 Durham’S Tube 1 Pack Of 500 3225 Micro Pipette Holding Stand ( 50 Ul-300 Ul ) 3226 Micro Pipette Holding Stand ( 10 Ul-10 Ul ) 3227 Multichannel Pipette ( 50 Ul-300 Ul ) 3228 Conical Flask ( Flat Bottom ) 2000Cc 3229 Conical Flask ( Flat Bottom ) 1000 Cc 3230 Conical Flask ( Flat Bottom ) 500 Cc 3231 Conical Flask ( Flat Bottam ) 250 Cc 3232 Conical Flask ( Flat Bottam ) 100 Cc 3233 Conical Flask ( Flat Bottam ) 50 Cc 3234 Measuring Jar 500 Ml 3235 Measuring Jar 100 Ml 3236 Glass Volumetric Pipette 1 Ml 3237 Glass Volumetric Pipette 5 Ml 3238 Petri Plates ( Glass ) 100 X 15 Mm ( Pack Of 10 Plates ) 3239 Micromotor 3240 Hand Piece ( Straight And Contra-Angle ) 3241 Air Rotor 3242 Minor Surgical Kit 3243 Bone Plating Kit 3244 Mouth Mirror 3245 Probe 3246 Periosteal Elevator 3247 Light Cure Unit 3248 Tooth Filling Instruments 3249 Wire Twister 3250 Wire Cutter 3251 Lead Screen 3252 Lead Apron With Thyroid Collar 3253 Adult Extraction Forceps 3254 Pediatric Extraction Forceps 3255 Artery Forceps 3256 Attendent Bed 2*6 3257 Autoclave 16*24 Electric ( S.S. ) 3258 Autoclove ( Large ) 12*20 3259 Autoclove ( Medium ) 12*15 3260 Autoclove Gasket Small 3261 Autoclove Gasket Larg 3262 Autoclove Gasket Medium 3263 Autoclove Indicator Roll 3264 B.P.Apparatus Digital 3265 B.P.Apparatus Stand Model 3266 B.P.Cuff Adult 3267 B.P.Cuff Infant 3268 B.P.Cuff Paediatric / Child 3269 Baby Weighing Machine Digital 3 Digit 3270 Balance With Agitator 3271 Bed Side Locker Deluxe ( Steel ) Top Epoxy Powder Coated 3272 Bed Side Screen 4 Panel 3273 Bed Side Screen 3 Fold 3274 Bio Waste Bucket 10 Lit. 3275 Bio Waste Bucket 25 Lit. 3276 Bio Waste Bucket 50 Lit. 3277 Carbondioxide Gas In Medium Size Cylinder ( B Type ) , Miscellaneous 3278 Carbondioxide Gas In Small Size Cylinder ( A Type ) , Miscellaneous 3279 Stainic Rack ( Each ) 3280 Ventilator Adult -Model New Port E-360 3281 Stop Watch 3282 Scissor Grip Curved Coagulating Shears With Curved Tapered Tip For Precise Dissection And With 240 Degree Activation Triggers That Support Multiple Hand Positions In The Following Shaft ( Lengths 17 Cm Can Seal Blood Vessels Upto And Including 5 Mm In Diameter ) , Each 3283 Scissor Grip Curved Coagulating Shears With Curved Tapered Tip For Precise Dissection And With 240 Degree Activation Triggers That Support Multiple Hand Positions In The Following Shaft ( Lengths 9Cm Can Seal Blood Vessels Upto And Including 5 Mm In Diameter ) , Each 3284 Glass Beaker 200 Ml 3285 Glass Conical Flask 100 Ml 3286 Glass Conical Flask 200 Ml 3287 Franulum Retractor 3288 Oxyagen Flow Meter ( Rotometer ) 3289 Oxygen Cylender Key 3290 Steel Bowel 10 3291 Steel Bowel 4 3292 Steel Bowel 8 3293 Steel Container For General Use 2 Lit With Led 3294 Steel Container For General Use 5 Lit With Led 3295 Steel Container For General Use 10 Lit With Led 3296 Steel Container For General Use 20E Lit With Led 3297 Steel / Iron Rack Four Selves 3298 Strecher Trolley Deluxe 3299 Three Bucket Trolly For Cleaning / Moping 3300 Stethoscope Adult 3301 Stethoscope Pediatric 3302 Glass Slide 75×25×1 Mm ( Borosil ) 3303 Cover Slip ( Microscope Cover Glass ) 22X22 Mm ( Borosil ) 3304 Conical Flask ( Flat Bottam ) 2000 Cc ( Borosil ) 3305 Conical Flask ( Flat Bottam ) 1000 Cc ( Borosil ) 3306 Conical Flask ( Flat Bottam ) 500 Cc ( Borosil ) 3307 Conical Flask ( Flat Bottam ) 250 Cc ( Borosil ) 3308 Conical Flask ( Flat Bottam ) 100 Cc ( Borosil ) 3309 Conical Flask ( Flat Bottam ) 50 Cc ( Borosil ) 3310 Glass Rod 3311 Measuring Jar500 Ml ( Borosil ) 3312 Measuring Jar100 Ml ( Borosil ) 3313 Glass Volumetric Pipette1 Ml ( Borosil ) 3314 Glass Volumetric Pipette5 Ml ( Borosil ) 3315 Petri Plates ( Glass ) ( Pack Of 10 Plates ) 100 X 15 Mm ( Borosil ) 3316 Concavity Slide ( 1 Cavity ) 3317 Spirit Lamp 3318 Rubber Bulb For Glass Pipette For 1 Ml Pipette 3319 Rubber Bulb For Glass Pipette For 1 Ml Pipette 3320 Test Tube Racks For 12 × 100 Mm Tubes 3321 Test Tube Racks For 12 × 75 Mm Tubes 3322 Test Tube Racks For 18 × 150 Mm Tubes 3323 Autoclave Drum ( Stainless Steel ) 11X9 3324 Autoclave Drum ( Stainless Steel ) 11X9 3325 Pediatric Surgical Set 3326 Right Angle Refracter 3327 Deavers Refracter 3328 Proctoscope Adult 3329 Fibreless Video Scope, Available With Three Optional Sizes Of Inner Diameter 1.2Mm, 2.2Mm & 2.8 Mm, Should Have Suction Port & Oxygen Delivery Port, Should Be Usfdashould Be Compatible With A-View Monitor Of Size 8.5 Inches With 8 Gb Memory. 3330 Laryngoscope Adult 3331 Laryngoscope Child 3332 Suction Machine Electric 3333 Flying Cacher 3334 Fumigator For Ot 3335 Gum Boot Rubber Medium Size Per Pair 3336 Attendent Stool Ss Square
Contract Date: Jan 31, 2020 Contract Value : 50.00 Lakh
Statutory Bodies & Commissions/Committees No of Bidders 15
Madhya Pradesh View Result →
TenderDetail
Loading tenders