View Bid Results For Embedding Molds Tenders

We found 32 Bid Results related to embedding molds tenders. You can find Contractor details who won embedding molds tenders along with contract details in Bid awards announcements section.

Filters
Stage
17
11
4
Tender Publishing Platform
5
27
State / UT
10
9
7
4
3
3
2
1
1
1
1
Contract Value
15
4
7
4
Publish Date
0
0
0
0
0
Sector
7
14
9
3
2
2
1
1
Ownership
4
19
9
3
1
Within keyword
Active filters:
Showing 1–1 of 32 tenders matching your filters
1.
Heavy Industries and Public Enterprises #10795480 AOC
Supply Of Medicines, Consumables And Lab.Reagents For The Year 2024-25 , Cssd , Sterile Biological Indicator Rapid ( For Steam) , Package Monitoring Indicator Steam (Type - 4) , Package Monitoring Indicator Steam (Type -5) , Instant Release Biological Indicator For Steam , Thermo Seal Tape (24Mm) , Sterilization Paper Bags 190X110x45 , Non Sterile Cut And Folded Gauze Swab 16 Ply , Biological Indicator ( For Steam) , Package Monitoring Indicator Steam (Type-4) , Package Monitorng Indicamtorsteam (Type - 5) , Sterilization Reel (20Cmx200mtrs) , Sterilization Reel (15Cmx200mtrs) , Sterilization Reel (20Cmx200mtrs) , Sterilization Paper Bags 190X 110X 45 , Non Sterile Ut And Folded Gauze Swab 16 Ply 7.5X7.5 Cm , Ctvs/ Cardiology Cosumables , Printer Paper Roll(3X57mmx30 Mtrs) For Lab. , Ivus Opticros Catheters (Cardiology/Interventional) , Ep Catheters And Ablatos (Cardiology/Interventional) , Iabo Balloons (Cardiology/Interventional) , Intravascular Coils (Cardiology/Interventional) , Sob Pprofile (25 Cassettes) Myoglobon Ckmb Troponin Ibnp D-Dimer , For Doing Varicose Vein Surgery / Sclerotherapy Requirement: , Sedi - Ati Radial Laser Fibres - , Dr Surgical Arterial Puncture Needle 18 G - , Abbot Setrol Injections 60Mg/2Ml , Butterfly Needle - , 23 Gauze Needle - , Luer Lock Syringes 5 Ml - , Evla Sheath - , Connectors - , Tegaderm 10 X 12 Cm - , For Doing Fistula Surgery Requirement: , Ethicon 7 0 Round Bodied Prolene Sutures , Ethicon 5 0 Round Bodied Prolene Sutures 811 , Ethicon 6 0 Round Bodied Prolene Sutures 856 , Ethicon 2 0 Round Bodied Prolene Sutures 8706 , Ethicon 2 0 Round Bodied Vicryl Sutures 844 , Ethicon 1 Round Bodied Silk Sutures , Ethicon 3 0 Round Bodied Silk Sutures 5085 , M3 Ioban , M3 Ioban - , Covidien Valley Lab Fx 8 Disposable Cautery Pencil - , Covidien Valley Lab Fx 8 Disposable Neutral Pad - , Gel For Usg Doppler Machine. , For Doing Embolectomy Surgery Requirement: , Edwards’S Fogarty Catheter No 3 , Edwards’S Fogarty Catheter No 4 , Edwards’S Fogarty Catheter No 5 , Romson’S Closed Suction Drain , For Doing Decortication Surgery Requirement: , Rusch Double Lumen Tube Ch 37 Left - , Rusch Double Lumen Tube Ch 35 Left - , Rusch Double Lumen Tube Ch 35 Right , Rusch Double Lumen Tube Ch 32 Right , Rusch Double Lumen Tube Ch 32 Left , Bbraun Epidural Catheter 18 Gauze , Bbraun Epidural Catheter 20 Gauze , Bbraun 3 Way Central Line Catheter 7 Fr , Bv Filter , Romson’S Icd Tube No 32 , Romson’S Icd Tube No 30 , Romson’S Icd Tube No 28 , Icd Under Water Sealed Bottle , Rusch Uroflow Meter Urinary Catheter , M3 Ioban ( Large ) , Surgical Talc ( Rohit Surgicals) , Ethicon 1 Round Bodied Vicryl Sutures 2347 , Ethicon 2 Round Bodied Vicryl Sutures , Ethicon 1 Round Bodied Prolene Sutures 843 , Ethicon 2 0 Round Bodied Prolene Sutures 2317 , Ethicon 1 0 Reverse Cutting Silk Sutures 5062 , For Doing Diaphragmatic Hernia Surgery Requirement: , Romo Adk 32 Abdominal Drain No 32 With Bag , Vypro Mesh , Vypro Mesh , Bare Optical Fibre 400 ?M (Lasotronix) , Bare Optical Fibre 600?M (Lasotronix) , Fused Radial Emission Fibre 400?M (Lasotronix) , 6Fr Laser Sheath , Ethilon 3-0 Round Bodied Prolene Suture , Microbiology , Andrades Indicator 1001-125Ml , Bhi Broth W/.05% Sps Lq 004 -10X20ml , Bhi Broth W/.05% Sps Lq 004 A- 10X 70Ml , Bhi Broth W/.05% Sps Lq 004 A- 10X 70Ml , Cled Agar M352-500G , Tcbs Agar M189-500G , Selinite F Broth M025s- 500 G , Xld M031-500 G , Hi Chrome Esbl Agar Base M1829 500 Gm , Koh Pellets Grm251-500G , Lactose Monohydrate , Phlyanethole Sulfonic Acid , Chemical Indicator For Autoclave Type 1 , Chemical Indicator For Autoclave Type 4 & 5 , K.Pheumoniae 700603 , Pseudonmonas Aeruginosa 27853 , Enterococcus Faecalis 29212 , Proteus Vulgaris 13315 , Salmonella Paratyphi A 9150 , Staph Epidermidis 12228 , Staph Saprophyticus 15305 , Acinetobacter Baumanni 1065 , Shigella Flexneri 2022 , Candida Albicans 10231 , Candida Krusei 2408 , Dilute Carbol Fuchisn 1125 Ml , Rhoodamine , Hoechst , Flurorescent Stain Kit For Mycobacteris , Calcoflour White , Bd Bactec Plus Standard Aeoribic Medium (Cat No 442192) , Bd Phoneix Nmic/Id -55 (Cat No-448935) , Bd Phoneix Nmic/Id -55 (Cat No-448763) , Phoneix Ast Broth (Cat No -246005) , Phoneix Id Broth , Phoneix Ast Indicator , Meropenam Strip , Nicu,Sncu , Umbilicus Venous Catheter (Uvc) , Umbilicus Venous Catheter (Uvc) , Umbilicus Venous Cath Holder , Rams Cannula, , Rams Cannula, , Rams Cannula, , Central Line , Peripherally Inserted Central Catheter, , Peripherally Inserted Central Catheter, , Sle Tubing , Sle 5000 (Mv) , Sle 2000 (Mv) , Sle 1000 (Cpap) , Neonatal Cpap Interface (Re-Usable_) , Neonatal Cpap Interface (Re-Usable_) , Neonatal Cpap Interface (Re-Usable_) , For Grbs Test ( Contour Ts , One Touch) , Gluco Strips For (Contour Ts For One Touch) , Iv Line For Lipid Infusion , Surf Cath No 6 F (Vygon) , Air O2 Blender , Curosurf (Presure Exact) , Physiotherapy , Electrodes With Wire; Tens, Ift, Muscle Stimulator , Electrodes Pods With Cable , Tens Cable With Electrodes , Traxen Collar , Gastroenterology , Biliary Covered Sems Stent 6 Cm , Speed Band Superview Super 7 , Savary Gillard Dilator Set , Cardiac Monitor , Argon Plasma Coagulation Probe Catheter , Esophageal Metal Stent Fully Covered 10F*10 Cm , Esophageal Metal Stent Fully Covered 10F*12 Cm , Biliary Uncovered Metal Stent 8 F*10 Cm , Sohendra Biliary Dilator 9 F , Ercp Cannula Straight , Ercp Cannula Angled , Fna-Expect-19 G , Fna-Expect-19 G Flex , Acquire 22 G Fnb Needle Biopsy , Hot Axios 10 Mmx 15Mm , Hot Axios 10 Mmx 20Mm , Disposable Cytology Brush,Model No Bc-V600p-3010 , Single Use Guidewire (Visiglide2)Model No,G-260-2545A , Ezdilate Ballon Dilator,15Mm , Micronester Embolisation Coil Mwce-35-5-10 , Cysrotome Cst 6F,8F , Sx-Elia Danis Stent , Small Snare Size For Esd/Emr 12Mm,15Mm , Sx-Ella Danis Stent Retriever , Otsc Clips , Otsc Twin Grasper , Otsc Stentfix , Metal Stent(Lumen Apposing Metal Stent)Hot Axios 10Mmx 10Mm , Plastic Biliary Stent Double Pigtail(7Frx7cf) , Plastic Biliary Stent Double Pigtail(7Frx10cf) , Cre Balloon 12-18Mm , Upper Gi Sclerotherapy Needle 23G 150Cm , Haemoclip Large Size (Single Use) , Gold Probe , Apc Probe , Colon Sclerotherapy Needle 23G 250Cm , Neutral Electrode For Adults With Cable , Snare 10Cm , Snare 20Cm , Terumo Guide Wire 260Cm Straight , Loop Basket , Mreye Embolisation Coil 35-10-10 , Sx Ella Stent Esophageal Danis , Ella Extractor , Ez Shot 3 Plus Single Use Aspiration Needle 1400(Mm) 2.8Mm(22G) , Ez Shot 3 Plus Single Use Aspiration Needle 1400(Mm) 2.8Mm(19G) , Acquire Endoscopic Ultrasound Biopsy Needle (22G) , Store Extraction Ballon , Expect Endoscopic Ultrasound Aspiration Needle (19G) , 7Fx7cm Dpt Bilary Plastic Stant , 10Fx7cm Dpt Bilary Plastic Stant , 10Fx5cm Dpt Bilary Plastic Stant , 19G Endoscopic Ultrasound Biopicy Needle Acqire , Arthriscope Complete Set For Knee , Interlocking For Tibal Nails (Usual Size) With Set , Pfn Nails (Short) With Set , Paediatric Electronic Tourniquet , Man Man Drillng Machine With All Attachments , Orthopaedics , Pre-Contoured Implants , (Elbow) 6 Holes= 25 Esch For Rrght And Left Matching Screws For The Implant , Distal Raidius Locking Precountoured Plate , 4Holes , 6 Holes , Matching Screws , Precontoured Locking Plates For Proximal Tibia: , Medial Plate : 4 Holes = 100 Nos (R/L) , Lateral Plate: 4 Holes = 10 Nos (R/) , Matching Screws : 50 Each , Precontoured Locking Plates Olecranon: , Right And Left , 4 Holes , 6 Holes , 8 Holes , Matching Screws:50 Nos , Distal Locking Precountoured Plates Fibula: , 6 Holes , 4 Holes , Distal Locking Precountoured Plates Tibia: , Right 4 Holes , Left 4 Holes , Right 6 Holes , Left 6 Holes , Ss Wire - 18 No , Ss Wire - 20 Nos , Orthopaedic Wire Cutters , Pliers : Large , Pliers : Small , Stryker Drill Machine , Dhs Set , Dhs Plates 4 Holes (125°) , Plate Holdeing Forceps Small , Plate Holdeing Forceps Large , Hemiarthroplastry Set , Bipolar Prothesis For Hips: All Sizes , Herbert Screws All Sizes , Proximal Locking Plates For Humerous With Screws Of All Sizes With Drill Bits 05,08,10 , Drill Bits , 2.7-200 , 3.5-200 , 4.5-50 , Bone Tap: All Sizes , Mini Drill Machines For Internal Fixation Of Hand And Foot Pharanges/ Metacarpels With All Screws Sizes And Drill Machines , Nextar Cutter , Colinear Clamp , Orthoscopic With All Attachments , Adult Electronic Tourniquet , Man Man Drilling Machine With All Attachments , Lcdcps Fro Femur , 7 Holes , 8 Holes , 6 Holes , Lcdcps 3.5Mm For Forearm , 6 Holes , 5 Holes , 8 Holes , Cortical Screws , 10Mm , 12Mm , 14Mm , 16Mm , 18Mm , 20Mm , 22Mm , 24Mm , Proximal Femur Locking Plate , Left 6 Holes , Right 6 Holes , Left 7 Holes , Right 7 Holes , Left 8 Holes , Locking Screws: , 6Mm X 70 , 6Mm X 75 , 6Mm X 60 , 6Mm X 65 , Cortical Screws 4.5 Mm , 10Mm To 52Mm , External Fixators- Forearms , External Fixators- Lower Limbs , Pre- Contoured Implants , Precontoured Distal Locking Plate Humerus (Elbow) 6 Holes-Left , Precontoured Distal Locking Plate Humerus (Elbow) 6 Holes- Right , Matching Screws For The Implants , K-Wire 1.8Mm , K-Wire 2.0Mm , Periosteal Elevators - Small , Periosteal Elevators - Large , Drill Bits: , Drill Bits 2.7 , Drill Bits 3.5 , Drill Bits 4.5 , Bone Tap All Sizes , Iccu , Hsnc Manchine , Bpap Mask , Cvp Cable , Transducer For Cvp , T-Tubing , Ventum Mask , Triple Lumen Central Line , Arterial Cannula , Abp Monitorine Cable , Bacterial Filter , Digital Weighting Machine , Protable Peripherial Doppler , Tracheostomy Tube Double Lumen 7F , Tracheostomy Tube Double Lumen 7.5F , Tracheostomy Tube Double Lumen 8F , Nebuliser T-Piece , Catheter Mount , Triple Lumen Straight Catheter , Neuro Surgery Ot Consumables , Surgiwear Plain Sheet (Large) D301 , Surgiwear Half Gown D800 , Ethicon Bonewax , Ethicon Surgical (4 X 8 Inch) , Surgiwera Verticular External Csf Drainage Bsystem Sh024 , Surgical Chabra Hydrocephalus Shunt Syatem (Medium Pressure) Sh 202 , Surgical Chabra Hydrocephalus Shunt Syatem (Low Pressure) Sh 202 , Surgiweara O Scope Cover , Surgiwear C A-Arm Cover , Integra Duragen Plus , Opthalmology , Cassettes (Fml) , Phaco Sleeves (2 In Each Packet) , Flyn Scleral Depressor , 20-Diopter Lens , 28-Diopter Lens , Foldable Lens Acyfold (Appaswamy) , Indivent Opthalmoscope (Heine Or Topcan) , Virology , Vidas Dengue Igm (60 Test Per Kit) , Vidas Sars Cov2 Igg (60 Tests) , Microtips Without Filter , Devyser Brca For Ngs (Cat No 8-A 100-24) , Devyser Library Clean (Cat No 8- A 204) , Ms-103 -1001 Miseq Reagent Nano Kit V2 (300- Cycle) , Dna Extraction Kit , Illumina Phix Control V3 (Fc-110-3001) , Qubit 1X Ds Dna Hs Assay Kit(Cat No Q3 2851 , Qubit Tubes , Tween 20 Molecular Biology Grade , 96 Well Low Profile Hard Shell Semi Skirted Pcr Plates (Hsl9601) , Microseal F Foil Seals(Cat No Msf 1001) , Microseal B Film (Cat No Msb 1001) , Influenza A/B And Rsv With Sars Cov-2Rt Qpcr Kit With Hini/H3n2 Detection With Extraction Kit , Hla B27 Rt-Pcr Qualitative Kit With Extraction Kit , Hpv 16 &18 Rt-Pcr Kit With Extraction Kit , Dengue Ns1 Ag Elisa , Dengue Igm Elisa , Chikungunya Igm Elisa , Hepatitis A Igm Elisa , Hepatitis E Igm Elisa , Torch Rapid Ict Test , Vidas Anti Hbs (Cat No. 30318) , Vidas Anti Hbe/ Hbe Ag (Cat No. 30305) , Vidas Anti Hbc (Cat No -30314) , Vidas Anti Hav Total (Cat No.30312) , Micro Tips With Filter 1000?L , Micro Tips With Filter -200?L , Micro Tips With Filter -20?L , Micro Tips With Filter -10?L , Micro Centrifuge Tubes-2Ml , Micro Centrifuge Tubes-1.5Ml , Molecular Grade Water , Hard Shell Pcr Plates – 96 Well (Hsp9601) , 0.2Ml 8 Tube Pcr Strips, Low Profile, Clear (Tls 0801) , 0.2Ml Flat Pcr Tube 8 Cap Strips, Optical , Ultraclear (Tcs0803) , Nitrile Gloves Small , Nitrile Gloves Medium , Dna Away , Rnase , Vidas Dengue Igm (60 Test Per Kit) , Vidas Sars Cov2 Igg (60 Tests) , Microtips Without Filter , Hav Igm Rapid Kits , Hev Igm Rapid Kits , Dengue Nsidg, Igm/Igg Rapid Kit , Stool Ict Bkits (Rota, Astro, Noro & Adenovirus) , Dna Diluent , Qubit 1X Ds Dna Br Assay Kit , Rtpcr Tropical Fever Panel With Extraction Kit , Urology , 5Fr 26Cm Dj Stent Both End Open , 5Fr 26Cm Dj Stent Silicon Both End Open , Urs Forceps Tri-Pong 3 Fr (Cook Company) , Urs Forceps Bi Prong 3 Fr Cook Company , Dakota Nitional Stone Retervial Basket ) , Dakota Nitional Stone Retervial Basket , Karl Storz Stone Holdin Bi-Pronge Forceps For Pcnl ) , Ureteral Access Sheath, Cook Company , Amplatz Sheath Dilator Set (Boston Scientific Company) , Radiotherapy , Art. Nº 35763/2Ma , Art. Nº 35764/2Ma , Art. Nº 35788/2Ma , Art. Nº 35787/2Ma , (Ref 8526In) , Tegaderm (10Cm×12Cm) , Digital Water Bath , Laser Sagittal Only For Mould Room , Wax Bolus , Mould Cupboard / Self , Dental , Chromatic Alginate Powder Impression Material , Aquasil Soft Putty Regular Set , Heat Cure Powder + Liquid , Cold Cure Denture Base Material , Bausch Artifoil Articulating Film Ultra Thin , Denture Reliners , Modeling Wax , Gingival Retraction Material , Fiber Post With Drills , Plaster Of Paris , Hot Plate , Alu Wax , Rpd Tray , Cd Tray , Bulkfill Composite , Biocreamic Rc Sealer , Composite Polishing Disk Super Snap , Composite Instrument Kit , Irrigation Needle Single Vented , Temporary Filling Material Cavit , Paper Points F1,F2,F3 , Fiber Post , Multilink N System Composite Kit , Endoblock , Peeso Reamer No. 1,2,3 , Endomotor (Cordless) , Apex Locator , Endo Box , Sonic Activator , Composite Polishing Strips , Gp Protapper Gutta Percha , Endo Access Bur Fg1l(Fg.2) , 12 Fluted Bur , Application Handpiece Standard Push Button , Rc Chlorhexidene 2% , Saddle Matrix System , Endoflas , Metal Molar , Hand Protaper 21Mm, 25Mm , Biodentine , Tropical Fluide Api Gel , Lentulospira , Centon-N , Disposable Fluoride Foam Tray , Brix 3000 Gel , Gdc Mouth Mirror Front Surface Both Sides , Pediatric Rotary Files , Air Rotes Led For Uncooperative And Special Children , Irrigation/Obturation Navi Tip , Bite Block No. 1,2,3 , Dental Finger Shield , Temporary Filling Material , Edta Solution , Splinting For Kids , Dpi Polishing Paste Propol (Prophylaxis Mask) , Detartrine Polish Paste , Prophy Brushes (Pask Of 100) Nylon Latch Type , Brushes For Low Speed Hand Piece , Polishing Brush (Pack Of 100) , Coe Pak Periodontal Peripack , Vishal Dentocare Peripack , Periodontal Plus Ab (Local Drug Delivery Tetracycline Fibre) , Advanced Biotech Osseograft Dmbm (Dmbm-Xenograft) , Advanced Biotech Heal Guide (Gtr/Gbr Membrane) , Infibra Fiber Splint-2Mm , Kids-E Dental E Splint 2,, , Waldent Gracey Curettes Set Of 7 , Waldent Goldman Fox + William Pobe (15/735) , Gdc Double End Probes Gold Man Fox William , Probe To Measure Pocket Depths , Gdc Making Probe-3(Pow6) , Prevest Hemostal Gel , Woodpecker Scaler Tip For Usd & Ems Scalers (Set) , Waldent Any Tooth Ultrasonic Scaler Tips Kit , 0.022 Mbt Bracket , Assorted Bands (Molars) , Self Etching Primer 3M Bond/Composite (Ortho) , Orthodontic Wires Sequence 0.012 To 19X25 , Pattern Resin , Ceramic Finishing & Polishing Burs , Acrylic Burs , Crown Prep Kit , Resin Based Rc Sealer , Straight Elevator , Gp Points Files 21Mm, 25Mm , H File (15-40) 21Mm, 25Mm , Spreader (15-40) , Probe , Agate Spatula , Miscellenous , Edan Se 1200 Express Ecg Machine Paper , Edan Se 1200 Express Ecg Cable , Ge Case Tmt Cam 40 Cable , Ge Case Tmt Communication Cable , Holter Monitor Bpl Trak 45 Data Cable , Hp Photo Paper Echo , Ge Mac 2000 Ecg Machine Cable With Chest Ball With Limb Leads , Bpl 108T Digi Ecg Machine Cable , Anaesthesia , 3-Way Port , P.N.S. Needle , Stylet (Adult) , Stylet (Pedia) , Magill Forcep (Adult) , Magill Forcep (Pedia) , E.T Tube (Cuffed) , E.T. Cuffed (South Facing) , E.T Tube North Facing (Silicone) , Armour Tube (Cuffed) , Lma (Laryngeal Mask Airway) , Central Venous Catheter Set (Certofix Triv720) , Epidural Catheter Set (B Brown) , Gluco Meter (Dr. Morpean) , Others , Afga X Ray 8*10 , Nasal Prongs Paediatric , Oxygen Mask Child , Sodium Chromo Glycate , Waste Box , Ceruloplasmin Cal , Chromic Cat Gut 2Nw 4242 , Glucometer(Accucheck) , Glucometer(Glucospot) , Glucometer(Glucospot)Strip , Glucometer(Accucheck)Strip , Bpl Ecg Paper 9103Z Fold , Insulin Syringe , Main Ot , Prolene Mesh 15 X5 Cm , Ethilon 5-0 (Nw3316) , Pds 3-0(Nw9237)R/B , Pds 4-0(Nw9204)R/B , Silk 4-0 (Nw5001)R/B , Silk 5-0 (Nw5081)R/B , Vicryl Rapide 4-0(W9918) , Abg Macchine , Fluid Pack S2 (42 Days On Board) 1Pc , S1 Rinse Solution (72 Days On Board) 2 Pc , S3 Fluid Pack A (42 Days On Board) 1Pc , Mss Cassette Glu/Lac (23 Days On Board) , Micro Electrodes Ca++ , Micro Electrodes Cl , Micro Electrodes K+ , Micro Electrodes Na+ , Micro Electrodes Pco2 Avl , Micro Electrodes Ph Avl , Micro Electrodes Po2 Avl , Micro Electrodes Ref , Combittrol Plus B Level 2 , Combittrol Plus B Level 3 , Combittrol Plus B Level 1 30Pcs , Thb Cuvette Pack , Deprotinizer 125 Ml , Hb Calibrator 5X1.1 , Cleaning Kit For Cl- , Printer Paper 221 , Censor Contact (Scon) , Pm Kit Cobas B 221 , Rcon 03112071180 , Others , Cryoprecipitate , Lactulose Enema , Fluoresenic , Foleys Catheter 15 , I/V Cannula , Lead Electrode , Suture Thread , Chest Tube No 28 With Under Water Seal Bag , Capillary Tube , Pap Satin Kit , Ethanol 95 % , Shoe Cover , Surgical Cap (Disposable) , Hand Wash , Foleys Catheter , Catgut 0-Nw 4246 , Prolene Mesh 15X15cm , Prolene Mesh 6X11cm , Vicryl Rapid 0 9963 , Lancet , Surgical Blade 10 , Foleys Catheter 8 , Foleys Catheter12 , Foleys Catheter 10 , Foleys Catheter 16 , Foleys Catheter 18 , Nebulization Mask(Adult) , Cannula 26G , Eyepatch For Phototherapy , Nebulization Mask(Pedia) , Romovac 14 , Romovac 16 , Chest Drainage Tube 14 , Chest Drainage Tube 16 , Disposable Gown , Ent Prosthesis , Romovac 5 , Romovac 6 , Peradex , Hme Filter , Cautery Plate(Patient Side) Disposable , Flexometallic Tube 6 , Flexometallic Tube 7 , Flexometallic Tube 8 , Ent Implants , Disposable Apron , Monopolar Cautery Cable , Opsite Plaster , Ecg Paper (Philips T-20)200 Pages , Sccral Ano , Urine Vial (Container) , Hernia Mesh , Sterizone , Cannula Fixator , Suction Catheter 08 , Folleys Catheter 8 G (Pedia) , Folleys Catheter 10 G (Pedia) , Folleys Catheter 12 G (Pedia) , Kit Kath 26 G , Elbow Length Gloves , Infant Feeding Tube 7 Fg , Infant Feeding Tube 8 Fg , Infant Feeding Tube 10 Fg , Suction Catheter Fr No. 6 , Nasogastric Tube No. 6 Fr , Nasogastric Tube No. 8 Fr , Nasogastric Tube No. 10 Fr , Laryngscope With Blade Size 1 , Laryngscope With Blade Size 1.5 , Laryngscope With Blade Size 2 , Laryngscope With Blade Size 2 , Plastic Apron , E.C.G Paper 210Mm X 295 Mm , Hand Sanitizer , Suction Tap , K-Wire 1 Mm , K-Wire 1.5 Mm , K-Wire 2 Mm , K-Wire 2.5 Mm , K-Wire 4 Mm , K-Wire 6 Mm , Catgut 1-0 (5 Matric) Sn 4259 , Catgut 2-0 Sn 4245 , Keratone Blade 2.8 , Lens Pc + 24.50 , Lens Pc + 25.50 , Lens Ac 23.001 , Apron For Dressing , Silicon Anesthesia Mask Size O , Bandaid (Round) , Stress Ball , Needle And Thread For Autopsy , B.P Cuff And Probe For Bpl Monitor Icu , Dead Body Bag , Catgut Suture 3-0 Sn 4259 , Catgut Suture 2-0 Sn 4241 , Blade Handle 7.0 , Vicryl 1-0 Sn 2347 , Vicryl 1-0 Sn 2346 , Vicryl 2-0 Sn2304 , Mersilk 3-0 Nw 50003 , Hb Estimation Strips , Hb Estimation Strips , Ecg Paper Rolls Cardiat Bpl 6208T View , Mersilk 4-0 Cutting Non Absorable , Surgical Blade 21 , Oxygen Mask Adult , Vicose 6-0 , Chest Tube Size (Pead) 12 , Chest Tube Size 16 , Chest Tube Size 22 , Laryngscope Blade Bulk , Xray Fuji Film , Xray Fuji Film , Casette 50/60 With Solution Pack , Lab. Reagents , Sysmex Xn 330 And An 550 Reagents , Xn Check (3X 1.5 Ml , Xn Calibrator 1X1.5 Ml , Elite H 580 (Transasia) , Elite H580 Cleaner , Elite H580 Lyse 1 , Elite H580 Lyse 2 , Elite H580 Lyse 3 , Elite H580 Dil , Trilevel Quality Control H580( , Calibrator For H580 (H-Cal) , Calibrator Xp-100 , Quality Control Xp-100 , Pm Kit , Elite H360 , H360 Diluent , H360 Lyse , H360 Cleaner , H360 Calibrator , H360 Control H/N/L , Haemotology Analyser ( For Horriba Abx Pentra Xl80) , Abx Minoclear(5X100ml) , Pm Kit , Esr Analyser Ves Matic Cube Touch30 , Transponder 1000 , Transponder 5000 , Urine Test Strip Reagents , Uro Drip Strip Reagets 5,Para (1 X 100) , Uro Drip Strip Reagets 10,Para (1 X 100) , Sysmex Xn 1000 New Haemato-Analyser , Cell Pack (Dcl) , Sulfolyser , Lysercell Wdf , Flourocell Wdf , Cell Pack (Dfl) , Flurocell Ret , Sulfolyser , Flurocell Wnr , Lysercell Wnr , Xn-Check L1 , Xn-Check L2 , Xn-Check L3 , Cell Clean , Erba H7100 , H7100 Diluen 20Litre , H7100 Ret , H7100 Lyse 1 , H7100 Lyse 2 , H7100 Fluro Ret , H7100 Fluro Diff , H7100 H Clean , H7100 H C Control For Diff (Lnh) , H7100 C Ret Control For Ret (Lnh) , H7100 Cal , Ecl 412 , Factor Viii Reagent , Factor Ix Reagent , Thrombin Reagent (Fibronogen) , Owrens Venonal Butter , Control , Standard Plasma , Biochemistry , Cfas(12X3ml) , Cfas Pac(3X1ml) , Cfas Puc(5X1ml) , Cfas Puc Norm(4X3ml) , Cfas Puc Path(4X3ml) , Cfas Protein(5X1ml) , Cfas Lipid(3X1ml) , Preciset Rf(5X1ml) , Control Set Rf(4X1ml) , Cfas Hba1c(3X2ml) , Precicontrol Hbaic Norm(4X1ml) , Precicontrol Hbaic Path(4X1ml) , Il6 Control , Anti Tpo Control , D-Dimer Control(2X1ml/2X1ml) , D-Dimer Calibrator(6X0.5Ml) , Perci Control Clinchem Multi-1(4X5ml) , Perci Control Clinchem Multi-2(4X5ml) , Tosoh Combi Calibrator Set , Hbsag G2 Cobas E100 , Hbsag Pc , Hiv Combi Pt Cobas E100 , Hiv Pc , Anti-Hcv G2 Cobas E100 , Anti-Hcv Pc , Nt Probnp Cobas E100 , Nt Probnp Calset , Precicontrol Cardiac , Trop T Hs Stat Cobas E100 , Trop T Hs Stat Calset , Troponin Pc , Afp Elecsys Cobas E 100 V1.1 , Afp G2 Cs Elecsys V2.1 , Amh Pc Elecsys , Anti-Cpp Pc Elecsys , Transferrin , Cell Wash Solution L / Naoh-D , Cell Wash Solution Ll / Acid Wash , Eco-D, Cobas , Naoh D Cobas , Sms Cobas , Sample Cleaner 1 Cobas , Sample Cleaner 2 Cobas , Ra/Rf Calibrator , Cobas C Pack Multi , Hemolysing Reagent , Reaction Celles (C 311) - 18 Sections (3 Sets) , Kit Maintenance 1 Year Cobas C311 , Lamp Halogen Assy 12V/50W , Kit Maintenance 6 Months Cobas C311 , Complement C3c , Complement C4 , Ceruloplasmin , Crp Hs , Aslot Q , Anti Hav Igm Elecsys Cobas 100 , Anti Hbs Elecsys Cobas E100 , Anti Hbc Igm Cobas E100 , Anti Hbc Total Cobas E100 , Ec Cartridge S 500 T , Ec Cartridge S Plus Ica 500 T , Precicontrol Puc Norm , Precicontrol Puc Path , Precicontrol Multimarker -Il6 Control , Iron Standard , Hb Vario Transasia Extra Column , Magnesium (Roche) With Calibrator , Amh Pc Eleccsys , Volex Cup , Vacutainer Plain Vial , Aliquot Cups , Roche Pediatric Cups (Blue/White) , Thyroglobulin Cobas E 411 (With Control & Calset) , Anti-Thyroglobulin Cobas (With Control & Calset) , Anti-Tsh Cobase 411 (With Control & Calset) , Acth Cobase 411 (With Control & Calset) , Growth Hormone Cobase 411 (With Control & Calset) , Phosphate Cobase 411 (With Control & Calset) , Nt Pro Bnp Cobase 411 (With Control & Calset) , Rcon 03112071180 Cobas Abg B211 , Gmmi Pm Kit B221 (3 Years) 578512000` Cobas Abg B211 , Histopathology Labrotary , Microscopic Cover Glass 20Mm X 25 Cm , Microscopic Cover Glass 24Mm X 40 Cm , Microscopic Cover Glass 24Mm X 50 Cm , Microscopic Cover Glass 24Mm X 60 Cm , Microscopic Cover Glass 25Mm X 60 Cm , Tissue Embedding Molds Small (Steel) , Tissue Embedding Molds Medium (Steel) , Tissue Embedding Molds Large (Steel) , Brain Knife (Grossing) , Self-Adhesive Labels 12 X 21 Mm , Aluminium Slide Drying Tray , Cassette (Plastic) , Microspoic Slide Staining Rack , Aluminium Slide Tray , Microtome Brush , Mayers Haematoxylin , Weigerts Iron Haematoxylin , Eosin 2% (Liquid) , Haematoxylin (Powder) , Microkrom Ultra Pap Stain Kit 5 Gm , Eosin Water Solution (Powder) , Silver Stain Nfor H Pylori , Van Giesons Stain Kit , Pottasium Hdroxide , Congo Red , Periodic Acid , Schiffs Reagents , Bouins Fixative , Acid Fuchsin , Anilone Blue , Phospgomolybdic Acid , Ponceau (Acid Red) , Methenamine , Sodium Borate , Gold Chloride , Silver Nitrate , Congo Red Stain Kit , Periodic Acid Schiff Stain Kit , Masson Trichrome Stain Kit , Jones Methenamine Silver Stain Kit , Her1 And Her2 Ihc Kit , Perls Prussian Blue , Er/Pr , Ki 67 , Trop T (Kit) , Leptospria Test , Hev Igm Elisa Kit , Hav Igm Elisa Kit , Dengue Ns1ag Elisa Kit , Thyroid Reagents Tosoh Classic Radiance Semiautomated Clia , T3 Reagents , T4 Reagents , Tsh Reagents , Combi Calibrator Set , Clia Plates ( Light Reaction Cell Reagents) , Medicines , Dermatology Dept , Tab. Deflazacort6mg , Tab .Albendazole & Ivermectin , Tab Bilastine 20Mg , Tab Methylpredisolone 8Mg , Cap. Itraconazole130 , Syp.Aciclovir , Syp.Levocetirizine , Oint.Fusidic Acid & Hydrocortisone Acetate , Syp.Lysine, Zinc With Essential Vitamins , Tab.Progesteron 200Mg , Tab.Aceclofenac 100Mg & Drotaverine Hcl 80Mg , Tab.Folic Acid 5Mg , Tab.L Carnitine, Coenzyme Q10 Zinc, Lycopene & Astaxanthin , Cream Terbinafine , Cream Clobetasol , Cream.Luliconazole 1% W/W , Clobetasole Propionate Lotion , Clobetasone Butyrate & Miconazole Nitrate , Cream Fluticasone , Cream Mometasone , Cream Clobetasole Propionate & Salicylic Acid , Ahaglow Cream , Tab Luliconazole 100Mg , Tab Luliconazole 200Mg , Paediatric Dept , Syp.Ds Drotaverin , Syp.Zinc Gluconate , Paracetamol Drop , Syp.Fexofenadine , Syp.Levosalbutamol, Ambroxol Hcl & Guaiphensin , Oxymetazoline Hcl Nasal Solution , Syp Calstar (Oral Iron) , Syp.Ondensetron , Tobramycin E/D , Tab .Lansoprazole15mg , Basallius Calausi Suspention , Syp.Levosalbutamol , Syp.Salbutamol Sulphate , Syp Alluminium Magnesium Hydroxide , Ent Dept , Tab Cefpodoxime 500Mg , Betadin Gargle , Oint.Mupirocin , Tab.Aceclofenac+ Pcm+Serratiopetidase , Tab Cefpodoxime 200 Mg , Otomycin-S Ear Drop , Oint.Fluticasone , Fluticasone Furoate (27.5Mcg) Nasal Spray , Gastro Dept , Tab Sucralfate , Tab.Esomeprazole+ Domperdone , Tab Sambrac 800Mgs-Adenosyle, L-Methionine 400Mg , Tab.Rifaximin 550Mg , Tab.Drotaverine Hcl & Mefenamic Acid , Obg Dept , Tab .Ferrous Ascorbate & Folic Acid , Tab.Medroxyprogesterone Acetate , Tab Febuxostat 40Mg , Ortho Dept , Tab.Aceclofenac & Rabiprazole , Tab .Trypsin-Chymotrypsin , Tab.Elocaxenib 90Mg+ Chondroitin 50Mg + Methyl Sulfonyl 250 , Tab.Calcium Carbonate, Pyridoxal 5 Phosphate, L Methylfolate , Methylcobalamin (1500Mcg) + Alpha Lipoic Acid (100Mg) + Vitamin B6 (Pyridoxine) (3Mg) + Folic Acid (1.5Mg) + Vitamin D3 (1000Iu) , Tab.Pcm+Aceclofenac+Thiocolchicoside , Tab.Pregabalin 75 & Nortriptylin 10Mg , Tab.Coral Calcium, Cissus Quadrangularis Vit D3 & Vit K2 , Tab Rabiprazole40mg , General Medicine Dept , Tab.Domperidone & Naproxen , Tab.Benfotiamine, Alpha Lipoic Acid, Methylcobalamine Nositol, Vit A, Minerals ) , Tab.Nitrofurantoin 100Mg , Tab.Fluvoxate 200Mg , Syp.Lactulose , Syp.Dextromethorphan Hcl, Phenylephrine Hcl, Chlorpheniramine , Tab Lycosin (15/150) , Tab .Esomeprazole Domperidone , Tab.Rabeprazole & Domperidone , Tab Rabeprazole 20Mg , Tab.Rabeprazole & Levosulpiride , Tab Cefuroxime500mg , Tab.Flupentixol & Mlitracen , Tab.Aceclofenac & Thiocolchicoside , Tab Luragin 3Mg , Tab.Diclofenac 50+Pcm+Serratiopetidase , Tab.Frusemide & Spironolactone , Syp.Disodium Hydrogen Citrate Sodium , Tab. Cefpodoxime Pivoxil 200Mg , Tab Torsemide10mg , Tab.Telmisartan & Hydrochlorothiazide 12.5 , Dental Dept , Tab Cefiroxime 500Mg , Tab .Aceclofenac+ Pcm+Serratiopetidase , Betadine Gargle , Hexidine M/W , Neuro Sx Dept , Tab.Etoricoxib , Tab.Gabapentin & Ntp , Tab.Cycobenzaorine 15Mg , Tab Caro D3 Max , Tab.Tolperisone150 & Diclofenac 50 , Tab.Mesalazine 1200Mg , Tab Levipil 500Mg , Anaethesia , Inj. Etomidate , Inj.Vecuronium , Inj. Rocuronium , Inj. Ropivacaine , Inj. Dexmedetomidine , Inj. Sugamadex , Inj. Dexmedetomidine , Asthalin Puff , Other Medicines , Inj.Eporise (Recombinant Human Erythropoietin Alfa , Inj.Rejneuron , Inj.Betnesol 12Mg , Tab Aceclofenac (100Mg)+Paracetamol+Serratiopeptidase (15Mg) , Tab Itraconozole 100Mg , Tab Fosmomycin , Tab.Bromelain 90Mg+Trypsin 48Mg + Rutoside 100Mg , Tab Etoricoxib , Cetyl Alcohol And Stearyl Alcohol Lotion , Syp.Phenylephrene Hydrochloride And Chlorphenarmine Malete , Tab.Diclofenac Potassium, Paracetamol, Trypsin And Chymotripsin , Providone Iodine 2% Gargle , Mucus Extractor , Tab.Diacerein And Glucosamine , Tab.Febuxastat , Tab.Prebiotic And Probiotic , Tab.Multimineral, Multivitamin With Grape Seed Extract , Tab Chlorpheniramine 4Mg+Phenylephrine 10Mg , Syp.Dextromethophran Hydrobromide, Phenylephrene Hydrochloride And Chlorpheneramine Mealate) , Inj. Ocetrotide , Inj Calcium Chloride , Inj.Citicoline (250Mg/Ml) , Inj.Pilocarpine , Inj.Carbetocin , Oint.Selfoin-D , Oint.Selfoin , E/D Proparacaine , Lignocaine Nasal Spray , Diclofenac Spray , Midazolam Spray , Inj.Clindamycin 600 Mg , Syp.Antihistamine , Turpentine Oil , Inj.Iron , Budesonide Respules , Tab.Montelukast + Levocetrizine , Mometasone And Fusidic Acid Cream , Ozenoxacin Cream , Beclometasone + Fusidic Acid Oint , Clobetasol + Fusidic Acid , Luliconazole Cream , Beclometasone , Oint.Desonide , Oint. Minoxidil + Finasteride , Benzoyl Peroxide Gel , Sun Ban Lotion , Moist Lotion , Lotion Gamma Benzene Hexa Chloride , Boro Spirit Ear Drops , E/D Polymixin B + Chlromphenicol+Dexamethasone , Tab. Senna , Tab.Mifepristone+Misprostol , Inj.Cefuroxime , Tab. Vitamin K , Inj.Doxycycline , Syp.Zinc Sulphate , E/D. Hydroxypropylmethylcellulose (0.3% W/V) , Oint.Hydroxypropylmethylcellulose (0.3% W/V) , Oint.Lidocaine And Prilocaine , Tab.Pantoprazole 40Mg And Domperidone 30Mg , Chlorhexidine Gluconate+Silver Nitrate , Benzyl Benzoate Ointment , Cyclobiotic Ear Drops (Lidocaine (2% W/V) + Clotrimazole (1% W/V) + Beclometasone (0.025% Wv ) + Ofloxacin (0.3% W/V) , Benzocaine (2.7%W/V)+Chlorbutol (5%W/V)+Paradichlrobenzene (2%W/V)Terpintine Oil (15%W/V) , Sodium Chloride 0.65% Nasal Spary , Syp.Elemental Iron 100 Mg , Inj. Etomedate 20Mg , Inj. Phenyl Phenylephirine 10Mg/Ml , Inj. Terlipression , Inj. Esmolol , Tab.Deflazacort 12Mg , Tab. Fexofenadine 120 Mg , Tab. Monteklukast , Tab. Drotaverin 40Mg , Tab.Dicyclomine (10Mg) + Mefenamic Acid (250Mg) , Syp. Montenulakast , Psychatry Dept , Tab. Resperidone 2Mg , Tab.Olanzepam 5Mg , Tab.Olanzepam 10Mg , Tab. Amamisulpiride 10Mg , Tab. Aripiprazole 5Mg , Tab. Aripiprazole 10Mg , Tab. Quetiapine 25/50/100 Mg , Tab. Escitalopram 10Mg , Tab. Fluoxetine 40Mg , Tab. Fluoxetine 20Mg , Tab. Sertraline 25/50/100Mg , Tab. Clonazepam 0.25Mg , Tab. Clonazepam 10Mg , Tab. Altonil 3Mg , Tab. Trixexyphenidyl 2Mg , Tab. Chlordiazeproxide 10Mg , Tab.Flupentixol-0.5Mg + Melitracen-10Mg , Tab. Olanzapine 10 Mg , Tab. Risperidone 3Mg , Tab. Quitaipine 100Mg , Tab. Ariprazole 10Mg , Tab. Mirtazipine Mg , Tab. Sertaline , Tab. Sodium Valporate , Inj.Lorazepam 2Mg , Inj. Haloperidol 5Mg , Inj. Phenargan 50Mg , Inj. Thiamine , Tab. Levetiracetam , Tab. Lorazepam 2Mg , Tab. Tramadol , Tab. Pregabalin 50Mg , Tab. Pregabalin 75Mg , Tab. Thiamine 100Mg , Tab. Clozapine 50Mg , Tab. Lithium 400Mg , Tab. Oxcarabazepine , Tab.Lacosamide , Tab. Clonazepam 0.25Mg , Tab. Vitamin D 6000Iu , Syp. Vitamin D3 Drop , Nicu , 20% Lipids , 10 % Amino Acid , Inj.Sildenafil 10Mg , Inj.Prostaglandin E1 , Blood And Blood Plasma Subsitutes , Fresh Frozen Plasma , Platelet Rich , Red Blood Cells , Whole Blood , Inj.Dextran-40 , Coagulation Factor Ix , Coagulation Factor Viii , Coagulation Factor Vii , Activated Prothrombin Complex Concentrates , Inj.Zyrop (Recombinant Human Erythropoietin Alfa) , Volulyte (Hydroxyethyl Starch(Hes) (6% W/V) , Inj.N-Butyl Cyanoacrylate , Opthalmology Dept , Dexamethasone Intravitreal Implant , E/D Travoprost , Inj Avastin , Inj Razumab , E/D Carboxymethyl Cellulose , E/D Sodium Hyaluronate1.8Mg , E/D Moxifloxacin , Tab.Quinine 300Mg , Tab Eyetamin Total , E/D. Chlorpheniramine Maleate-0.01%W/V + Methylcellulose-0.2%W/V + Naphazoline-0.1%W/V , E/D Chloramphenicol (4Mg) + Dexamethasone (1Mg) + Polymyxin B (5000Iu) , Ed /Selfoin , E/D Nepafenac , Moxofloxacin E/D , Moxofloxacin E/Oint , Loc Fresh Ultra E/D , Travoprost E/D , Voriconazole E/D , Pilocarpine Injection , Cyclopentolate E/D , Paracaine E/D , Gangcyclovir E/Oint , Occupal Ointment , E/D Proparacaine , E/Dn.Epafenac Eye Drop , List Of Edl Items , Tab.Duloxetine , Tab.Tapentadol , Tab.Tapentadol , Tab.Gabapentin , Tab.Gabapentin , Tab.Pregabalin , Tab.Pregabalin , Syp.Pregabalin 100Ml , Tab.Nortriptyline , Tab.Nortriptyline , Syp.Hydroxyzine 100Ml , Tab.Hydroxyzine , Hydrocortisone Cream/Gel/Oint , Inj.Naloxone , Tab.Linezolid , Sodium Aminosalicylate Granules , Inj.Rifabutin , Tab.Bedaquiline , Tab.Sofosbuvir , Tab.Tenovir Aalafenamide Fumarate , Tab.Sofosbuvir +Velpatasvir , Tab.Favipiravir , Tab.Favipiravir , Inj.Remdesivir , Tab.Buprenorphine , Codeine Oral Solution , Tab Clonidine , Tab. Labetalol , Tab. Captopril , Tab. Lisinopril , Tab. Clofibrate , Tab. Finofibrate , Tab. Indapamine , Tab. Ketorolac , Gum Paint (Tannic Acid) , Wax Solvent Ear , Combo Ear Drop , Tab. Sucralfate , Tab. Senna , Inj.Methylprednisolone , Surgical Blade 21 , Tab. Ormeloxifene , Tab. Glicazide , Tab Mifepristone+Misprostol , Tab. Diphenlhydantoin , Tab. Montelukast Sodium , Tab. Montelukast Sodium , Syp.Montelukast , Hydroxyethyl Starch , Formoterol Inhaled Bronchodialator , Salmeterol Inhaled Bronchodialator , Inj;Cefuroxime , Tab. Vitamin K , Extra Items , Inj. Cefuroxime 1.5 G , Inj.Methylprednisolone , Tab S Adenosyl Methionine , Cap.Vit E + Omega 3 Fatty Acid For Fatty Liver , Tab. Silymarin + L Ornithoses Tablets)For Liver , Tab Glutathione 500 For Liver , ?Tab Pilohenz For Piles , Sucralfate+Metrinidazole + Lignocaine Cream , Inj. Emicizumab 30Mg , Inj. Emicizumab 60Mg , Ursodeoxycholic Acid 150 , Ursodeoxycholic Acid 300 , Vitamin C + Zinc , L-Glutathione,Silymarin , Tab.Semeral , Tab.Cilnidipine + Telmisartan , Trypsin (48Mg) + Bromelain (90Mg) + Rutoside (100Mg) + Diclofenac (50Mg) , Syp.Multivitamin , Ergotamine (1Mg) + Caffeine (100Mg) , Spironolactone (100 Mg) , Torasemide (20Mg) , Ibuprofen (400Mg) + Paracetamol (325Mg) , Midodrine (2.5Mg) , Diphenoxylate (2.5Mg) + Atropine (0.025Mg) , Acamprosate (333Mg) , Clonidine (100Mcg) , Thiamine 100Mg,Zinc 12Mg,Selenium 200Mcg , Taurine (500Mg) + Acetylcysteine (150Mg) , Lactic Acid Bacillus , Calcium Polystyrene Sulphonate (15Gm) , Tranexamic Acid (500Mg) + Mefenamic Acid (250Mg) , Lactobacillus Reuteri , Omeprazole (20Mg) + Tinidazole (500Mg) + Amoxycillin (750Mg) , Acebrophylline (200Mg) , Disodium Hydrogen Citrate (1.4Gm/5Ml) , Cilnidipine (20Mg) , Cilnidipine (5 Mg) , Cilnidipine (10Mg) , Inj.Diclofenac-50Mg + Methocarbamol-500Mg + Paracetamol-325Mg , Camylofin (50Mg) + Diclofenac (50Mg) , Inj.Camylofin (50Mg) + Diclofenac (50Mg) , Inj.Clindamycin (300Mg) , Inj.Clindamycin (600Mg) , Inj.Soluble Insulin 30% & Isophane 7% , Inj.Insulin Glargine (100Iu) , Inj.Insulin Lispro (100Iu/Ml) , Enema.Glycerin Ip 15% W/V Sodium Chloride Ip 15% W/V , Magnesium Sulphate Powder , Tab.Montelukast (10Mg) + Fexofenadine (120Mg) , Tab.Metadoxine (500Mg) + Silymarin (140Mg) + L-Ornithine L-Aspartate (150Mg) + Vitamin B6 (Pyridoxine) (3Mg) + Folic Acid (1.5Mg) , Syp.Ambroxol (30Mg/5Ml) + Levosalbutamol (1Mg/5Ml) + Guaifenesin (50Mg/5Ml) , Tablet.Alpha Ketoanalogue , Tab.Lansoprazple 15Mg , Sachet.Bacillus Clausii (2Billion Spores) , Racecadotril (10Mg) + Saccharomyces Boulardii (2.5Billion Cfu) + Lactobacillus (100Million Spores) , Sachet.Lactobacillus Rhamnosus,Xylitol,Sorbitol,Maltodextrin, , Sachet.Esomeprazole (10Mg) , Lansoprazole 30 , Inj.Progesterone (100Mg/Ml) , Inj.Cefuroxime (500Mg) + Clavulanic Acid (125Mg) , Inj.Domperidone (30Mg) + Pantoprazole (40Mg) , Prochlorperazine (5Mg) , Diclofenac-50Mg + Methocarbamol-500Mg + Paracetamol-325Mg , Recombinant Human Erythropoietin Alfa (4000Iu/Ml) , Inj. Levocarnitine , Syp. Calcium D3 , Syp. Deferiprone , Tab.Paroxetin 12.5 , Tb. Voglibose 0.3 , Betamethasone (0.1% W/V) + Neomycin (0.5% W/V) , Ointment Tropoxyl (Eye) , D-Panthenol (5% W/W) , Normal Saline 1000Ml
Contract Date: May 05, 2026 Contract Value : 3.00 Crore
Government Departments No of Bidders 3
2.
Health and Family Welfare #10639880 Price Bid
Notice Inviting E-Tender For The Procurement Of Imported Special Chemicals And Kits For Pathology Department Notice Inviting E-Tender For The Procurement Of Imported Special Chemicals And Kits For Pathology Department , Beem Capsules For Electron Microscopy Imported , Flat Embedding Moulds Em Grade 20 Numbered Cavities Measures: 14Mm(L) X5mm(W)X 4-6Mm(D). Rubber Green , Boats For Making Glass Knives For Electron Microscopy Imported , Carbon Steel Razor Blades Single Edge 0.09”Thick For Trimming Of Em Blocks , Cardboard Boxes Matchbox Style For Labeling And Storage Of Em Blocks Size 50X32x11mm, Strong And Rigid, Covered With White Paper Both Inside And Outside , Copper Gilder Grid (200Mesh) (Imported Em Grade) , Copper Gilder Grid (300Mesh) (Imported Em Grade) , Copper Gilder Grid (100Mesh) (Imported Em Grade) , Copper Grids Single Slot 2 Mm Formvar Coated Em Grade , Ddsa (Imported Em Grade , Dibutyl Phthalate (Imported Em Grade) , Dmp-30 (Imported Em Grade , Dumont Tweezer Hp Ss Type 5/45 For Em Use (Imported Em Grade) , Dumont Tweezer Ss Am Type 7 For Em Use(Imported Em Grade) - , Forceps High Precision Style N5 (Super Thin Tip) For Em , Epon 812 (Imported Em Grade) , Epoxy Resin Cy212 (Imported Em Grade) , Resin Kit For Araldite Em Embedding , Resin Kit For Epon Embedding For Electron Microscopy Imported , Ethanol 100% For Molecular Biology , Ethanol 200 Proof For Em Processing (Fischer) , Formaldehyde 16% Em Grade 10 Ml Glass Ampoule , 50% Glutaraldehyde Em Grade Glass Ampoule Of 10Ml , Imported Diatome Diamond Knife For Ultra Thin Sectioning 3.5 Mm 45 O Angle , Lead Citrate For Em , Nma For Em Processing (Imported Em Grade) , Osmium Tetra Oxide (Imported Em Grade 4 % Solution Glass Ampoule Of 10Ml , Osmium Tetra Oxide (Imported Em Grade 2% Solution Glass Ampoule Of 10Ml , Propylene Oxide For Electron Microscopy Imported , Sodium Cacodylate (Imported Em Grade) , Sucrose (Imported Em Grade) , Symcollidine Buffer Ampoule (Imported Em Grade) , Symcollidine Buffer (Imported Em Grade) , Uranyl Acetate (Imported Em Grade) , Uranyl Acetate (Imported Em Grade) , Capsule Molds Type A: 10 Cavities, 8Mm Diameter Body, 5Mm Diameter Tip, 11Mm Height, Tapered Tip. , Perfect Loop For Em , Grid Box For Em With 50 Slots Square Shape , Cellulose Filter 0.22Ml (3Mm) For Em , Millipore Syringe Filter 0.22Ml (33Mm) For Em , Millex Filter 0.2Mm , Millex Filter 0.3Mm , Wooden Box For Glass Knives Fpr Em , Glass Strips For Making Glass Knives For Em 400X25x6.4Mm , Toludine Blue Loba/ E Merck , Calcium Chloride , Liquid Nitrogen (50 Litres)
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 4
3.
Health and Family Welfare #10464562 Price Bid
Supply Of Consumable Items ( Chemicals , Diagnostic Kits And Glassware Items For Pathology Department ) -1 Mortar And Pestle Stone 2 Mortar And Pestle Disposable 3 Falcon Tubes 50Ml 4 Falcon Tubes 15Ml 5 Micropipette Tips White For 10 Μl 6 Beads For Magnetic Stirrer 7 Pcr Vials 0.5 Μl 8 Rack For 1.5 Ml Ependorf Tubes 20 Positions 9 - 20 Oc Pcr Mini Cooler For 0.2 Ml Tubes 10 Cryobox For Storage Of Cryogenic Vial 11 Pcr Tubes With Ultra Thin Walls ( Consumable ) Dnaase And Rnase Free With Domed Cap 0.2 Ml 12 Pcr Micro Tips For 0.5-10 Ul Autopipette 13 Filter Barrier Aerosol Tips For 0.5 -10 Ul Autopipette 14 Pcr Tube Freezer Storage Box With Cover For 0.2 Ml Tubes With 96 Wells Position 15 Microcentrifuge Tube ( 1.5-2 Ml Size ) Freezer Storage Boxes With 80 Wells 16 Millipore Syringe Filter 0.22Μl ( 33Mm ) For Em 17 Plastic Cups 20Ml 18 Plastic Cups 50Ml 19 Magnetic Bar Small 20 Magnetic Bar Large 21 Glass Screw Vials With Screw Caps 2Ml ( 9Mm ) Amber Colour, ( Rivera / Borosil ) 22 Glass Screw Vials With Screw Caps 2Ml ( 9Mm ) Transparent ( Rivera / Borosil ) 23 Plastic Screw Vials With Screw Caps 2Ml ( 9Mm ) Amber Colour, Tarson 24 Plastic Screw Vials With Screw Caps 2Ml ( 9Mm ) Transparent, Tarson 25 Utility Carrier Aluminium Heavy Duty Sample To Be Shown ( 380×240×115Mm ) 26 Dropping Bottle ( 30Ml, ) 27 Dropping Bottle ( 60Ml ) 28 Dropping Bottle ( 250Ml ) 29 Dropping Bottle ( 500Ml ) 30 Wash Bottle ( 250Ml ) 31 Wash Bottle ( 500Ml 32 Wash Bottle ( 1000Ml 33 Glass Beaker ( 50Ml ) 34 Glass Beaker ( 100Ml ) 35 Glass Beaker ( 500Ml ) 36 Glass Beaker ( 1000Ml ) 37 Glass Beaker ( 25Ml ) 38 Syringe Filter ( 25Mm ) 39 Pipette Bulb ( Upto 100Ml ) 40 Pipette Stand ( 5 ) 41 Reagent Reservoir ( 75Ml ) 42 Dancing Shaker 43 Rotospin-Test Tube Rotator ( 24×1.5Ml Tubes ) 44 Rotospin-Rotary Mixer ( 20×15Ml Tubes ) 45 Rotospin-Rotary Mixer ( 12×50Ml Tubes ) 46 Rack For Micro Centrifuge Tube-5Ml ( 16Places ) 47 Rack For Micro Centrifuge Tube-1.5Ml ( 24Places ) 48 Rack For Micro Centrifuge Tube-0.5Ml ( 24Places ) 49 Polywire Micro Tube Rack ( 1.5Ml ) 96 Places 50 Universal Combi Rack 51 Test Tube Stand ( Small ) 52 Test Tube Stand ( Large ) 53 Micro Pestle 54 Tube Conical Bottom ( 15Ml Sterile ) 55 Tube Conical Bottom ( 50Ml Sterile ) 56 Float Rack ( 1.5 Ml ) 57 Drying Rack ( 20 Pegs ) 58 Drying Rack ( 30 Pegs ) 59 Cryo Presevation Vial-Self Standing Sterile ( 1.8Ml ) 60 Cryo Presevation Vial-Self Standing Sterile ( 4.5Ml ) 61 Card Board Cryo Box ( 100 Places For 1Ml / 2Mlvials ) 62 Card Board Cryo Box ( 36Places For 15Ml / 50Mlvials ) 63 0°C Mini Cooler ( 32 Places For 1.5 Ml Vials ) 64 -20°C Mini Cooler ( 32 Places For 1.5 Ml Vials ) 65 Ice Bucket ( 2.5 Liter Capacity ) 66 Cryo Gloves Water Proof–Wrist M 67 Amber Storage Vials 2Ml 68 Amber Storage Vials 4.5Ml 69 Tissue Culture Flack With Filter Cap- Sterile 25Cm2 70 Tissue Culture Flack With Filter Cap- Sterile 75Cm2 71 Tissue Culture Flack With Filter Cap- Sterile 175Cm2 72 Parafilm M 4”×125’ 73 Parafilm Dispenser 74 Petri Seal 0.5×108 75 Indicator Tape For Steam Autoclave 1×500 76 3 / 8 Tough-Spots 5-Up Assorted Colours 77 Cryo Blades 32.5×12.7Mm 78 Cryo Tags 38×19Mm 79 Tough Tags Station 80 Kimwipes 11.17×21.3Cm 81 Kimwipes 37.33×42.16Cm 82 Nitrile Gloves ( Small ) 83 Nitrile Gloves ( Medium ) 84 Nitrile Gloves ( Large ) 85 Hand Protector Grip 86 Measuring Scoop ( 10 ) 87 Measuring Scoop ( 50 ) 88 Measuring Scoop ( 100 ) 89 Measuring Scoop ( 1000 ) 90 Measuring Scoop ( 500 ) 91 Ria Vial ( Flow Cytometer Tubes ) 12×75Mm 92 Pcr Tube Rack 96Places 93 Magnetic Stirrer Hot Plate 18×18Cm 94 Assorted Round Magnetic Stirrer Bar With Pivot Ring 95 Staning Box ( 12.5×12.5×5Cm ) 96 Staning Box ( 22.5×22.5×5Cm ) 97 Gel Scoop ( 7.5×10Cm ) 98 Gel Scoop ( 20×20Cm ) 99 Slide Storage Rack 100 / 200 Places 100 Slide Dispencer 50 Places 101 Sharp Container 5Lits 102 Autoclavable Bags ( 12”×24”, ) 103 Autoclavable Bags ( 24”×36” ) 104 Uv Safety Goggles 105 Aerosol Filter Tips, Racked And Pre Sterilized, Dnaase, Rnaase , Endotoxin Free, 100Μl , 200Μl ( Axygen ) 106 Aerosol Filter Tips, Racked And Pre Sterilized, Dnaase, Rnaase , Endotoxin Free, 1000 Μl ( Axygen ) 107 Microcentrifuge Tubes, For Molecular Biology, 1.5Ml, Dnaase, Rnaase, Endotoxin Free, Autoclavable ( Axygen ) 108 Pcr Tubes 0.2Ml, Flat Cap, Clear, For Molecular Biology, Dnaase, Rnaase, Endotoxin Free, Autoclavable ( ( Axygen ) 109 Plastic Coplin Jars Tarson 50Ml 110 Glass Coplin Jars Rivera / Borosil 50Ml 111 Microtip Box 96 Positions 112 I.            0.2-10 Ul 113 Ii.            20-200 Ul 114 Iii.            200-1000 Ul 115 Measuring Cylinder, Material: Tpx Autoclavable, ( Tarson ) 2000 Ml 116 Absolute Alcohol / Ethanol Analytical 117 Acetic Acid Ar 118 Acetone Ar 119 Acid Fuschin 25 Gm 120 Aec Chromogen For Ihc On Paraffin Sections 121 Agarose ) ( Sigma A6138 ) 122 Alcian Blue 123 Aluminium Chloride 124 Ammonia Silver 125 Ammonia Solution 126 Ammonium Aluminium Sulphate R 127 Ammonium Chloride ( Ar ) 128 Ammonium Oxalate 129 Ammonium Sulphate 130 Ammonium Sulphide ( Yellow ) 131 Aniline Blue 132 Aniline Blue 133 Barium Chloride 10% Ar 134 Basic Fuchsin 135 Biebrich Scarlet 136 Boric Acid For Molecular Biology, 137 Bovine Serum Albumin 138 Calcium Chloride Ar 139 Carmine Stain 140 Carrier Tray ( Biochrom ) 141 Catalase Enzyme 142 Charcoal 143 Chlorhexidime Hand Rub 144 Chromotrope 2R 145 Citric Acid 146 Coenyzme Nadh 147 Concentrated Sulphuric Acid 148 Congo Red 149 Coomasie Blue ( G 250 ) : For Electrophoresis ( Sigma Aldrich ) 150 Coplin Jar 151 Cresyl-Fast Violet 152 Crystal Violet / Gentian Violet Powder 153 Cytospin ( Shandon ) Disposable Cards ( Two Hole ) -Per Packet 154 Dab Substrate And Chromogen For Ihc 155 Dapi 1 ( Vysis ) 156 Dapi 2 ( Vysis ) 157 Dextrine / Dextrose Anhydrous 158 Diethyl Ether 159 Dipotassium Hydrogen Phosphate- 160 Disodium Hydrogen Phosphate Anhydrous 161 Dispenser For 25 Liter Solution Container 162 Dispenser For 50 Liter Solution Container 163 Disposable Esr Tube ( Imported ) Westergreen Sample To Be Shown 164 Disposable Esr Tube ( Indian ) Westergreen 165 Dmp-30 ( Imported Em Grade 166 Dmso ( Sigma Aldrich ) 167 Dpx Mounting Ar 200 Unit 168 Egg Albumin 169 Eosin Y ( Ar ) 170 Ethanol 70% 171 Ether 500 Ml 172 Fast Green Fcf 173 Ferric Chloride 174 Fetal Bovine Serum 175 Filter Paper Whatmann No.42 Circular ( Each ) 10 Cm Diameter 176 Formaldehyde Ar 177 Fouchet’S Regent Ar Ortho 178 Gel Loading Solution: For Electrophoresis ( Sigma Aldrich ) 179 Gelatin 180 Giemsa Stain Powder 181 Glass Graduated Centrifuged Test Tubes 15 Ml Vol With Conical Base 182 Glass Tough Staining Jars For 19 Slides 183 Glucose-1 –Phosphate Sigma 184 Glycerine Ar 185 Glycogen 186 Gold Chloride Ar 187 Haematoxylin ( Sigma ) 188 Hexamethylene Tetramine 189 Histopaque ( Sigma 1119-1 ) 190 Hydrochloric Acid Ar 191 Hydroquinone 192 Ice Bucket Suitable For Liquid Nitrogen, Dry Ice And Acetone ( Biochrom ) 193 Iodine Ar Ortho 194 Iron Alum 195 Isopentane 196 Isopropyl Alcohol Feisher 197 Laboratory Cell Counter ( Manual ) 198 Laboratory, Filter Paper 199 Lancets 200 Lead Nitrate 201 Light Green 202 Liquid Nitrogen 203 Liquid Paraffin 204 Lithium Carbonate 205 Luxol Fast Blue 206 Magnesium Chloride 207 Magnesium Chloride ( Ar ) 208 Magnesium Sulphate 209 Martius Yellow ( Acid Yellow 24 ) ( Ci 10315 ) 210 Martius Yellow ( Sigma / Merck ) 211 Mayer’S Haematoxylin 212 Melachite Green Powder 213 Merck Pap Solution 1A 60925301251730 214 Merck Pap Solution 2B 60688701251730 215 Merck Pap Solution 3B 60927201251730 216 Mercuric Oxide 217 Methanol 218 Micro Hematocrit Capillaries ( Plain ) 219 Micro Slide Boxes For 10 Slides 220 Micro Slide Boxes For 100 Slides 221 Micro Slide Boxes For 200 Slides 222 Micro Slide Boxes For 5 Slides 223 Microscopic Glass Slides Size 75 X 25 X 1Mm Deluxe 224 Milli Q Water 225 Multistix For Urine Analysis 226 N, N-Dimethyl-P-Phenylenediamine Dihydrochloride – Sigma 227 Naoh Pellets ( Vysis ) 228 Naphthol Asb1 Phosphate N 2250 Sodium Salt 229 Neubaur’S Chambers With Cover Slip 230 Neutral Red Powder 231 Nitric Acid Ar 232 Nitroblue Tetrazolium ( Sigma N 6876 ) 233 Nuclear Fast Red 234 Oil Immerssion For Microscopy 235 Orange G ( Sigma ) 236 Orcein Sigma / Loba O 7380 237 Ortho Tolidine Powder For Occult Blood 238 Oxalic Acid 239 Paraffin Wax ( Melting ) At 60-62 Deg C ) 240 Pbs Sachets To Make I Litre Buffer 241 Pepsin P7000 242 Pepsin P7012 243 Periodic Acid Ar. 244 Petridish – 5 Cm Corning 245 Petridish 15 Cm Corning 246 Ph Paper With 0.5-1 Ph Increments -Range 4-7 247 Phosphate Buffer Saline: For Western Blot ( Sigma Aldrich ) 248 Phospho Molybidic Acid 249 Phospho Tungstic Acid ( Ar ) 250 Picric Acid 251 Poly Lysine Solution 252 Potassium Dichromate ( Lr ) 253 Potassium Dihydrogen Phosphate 254 Potassium Ferrocyanide 255 Potassium Iodine 256 Potassium Meta Bisulphate 257 Potassium Permanganate Kmno4 258 Proteinase - Sigma 259 Rhodanine Stain – Sigma 260 Rubeanic Acid– Sigma 261 Silver Nitrate Exelar. 262 Sirius Red / Direct Red 80 – Sigma 365548 263 Slide Mailer 264 Sod. Nitroprusside 265 Sodium Acetate ( Ar ) 266 Sodium Beta Glycerophosphate 267 Sodium Bicarbonate 268 Sodium Bisulphate 269 Sodium Carbonate ( Ar ) 270 Sodium Diethyl Barbiturate 271 Sodium Fluoride 272 Sodium Hydrogen Phosphate Monohydrate 273 Sodium Hypochlorite ( Lr ) 274 Sodium Metabisulphite 275 Sodium Phosphate Dibasic 276 Sodium Phosphate Monobasic 277 Sodium Thiosulphate 278 Soluble Blue ( Methyl Blue ) ( Sigma Code M. 6900 ) C.I. 42780 279 Ssc 280 Staining Box P.P. ( Biochrom ) 281 Stainless Steel Embedding Moulds – Medium 282 Stainless Steel Embedding Moulds – Small 283 Sucrose 284 Sulpho Salicylic Acid ( Sigma / Merck ) 285 Sulphur Powder 286 Toludine Blue Loba / E Merck 287 Tourniquet 288 Trichloroacetic Acid 289 Tris 290 Tris Glycine Buffer : For Western Blot ( Biorad ) 291 Tris Powder 292 Triton-X 293 Universal Indicator Paper Ph 1-10 294 Uristix – For 2 Parameters Protein & Sugar 295 Utility Tray Of Size Approx 8”X10’ 296 Victoria Blue Sigma - 234176 297 Wintrobe Tubes 298 Wire Basket 8”X8”X8” 299 Xylene Ar 300 Xylene Feisher 301 Xylene Feisher 302 Yorko’S Disposable Knife For Grossing 303 New Methylene Blue 304 Cryo Embedding Compound 305 Filter Paper Whatmann Sheets No.42 306 Edta Vacutainer 3Ml 307 Esr Vacutainer 308 Immunofluorescence Kit – Mosaic Of Multibiochips For Doing Ana, Anti Sm & Ama ( Multibiochips Of Hep 2 Cells, Stomach, Liver, Kidney ) 309 Conical Flask 250 Ml ( Corning ) 310 Conical Flask Corning / Borosil 5 Lit. 311 Conical Flask ( Borosil ) 500 Ml. 312 Flat Bottom Round Flask 1 Ltr. Capacity 313 Flat Bottom Round Flask 2 Ltr. Capacity 314 Coplin Jar Vertical For Five Slides ( Borosil ) 315 Coplin Jars For 5 Slides ( Plastic ) 316 Eppendrof Tubes ( Imported Autoclaved, Suitable For Molecular Biology Work ) 2Ml - 1000 Pieces 317 Eppendrof Tubes ( Imported Autoclaved, Suitable For Molecular Biology Work ) 1.5Ml 318 Falcontubes ( 15Ml, Imported ) 1000 319 Funnel Glass 100 Mm Diameter 320 Permanent Marker Pens Luxor. Camline 321 Glass Marking Hb Pencils 322 Glass Marking Pens 323 Graduated Cylinders Borosil 10 Ml, 6 324 Graduated Cylinders Borosil 100 Ml, 6 325 Graduated Cylinders Borosil 250 Ml, 326 Graduated Cylinders Borosil 500 Ml, 327 Graduated Cylinders Borosil 1 Lt. 328 Graduated Cylinders Borosil 5 Lt. 329 Imported Coverslips ( English Glass No 1 ) – Size 22 X 22 Mm 10 Gm Pack 330 Imported Coverslips ( English Glass No 1 ) – Size 24 X 24 Mm 10 Gm Pack 331 Imported Coverslips ( English Glass No 1 ) – Size 24 X 40 Mm 10 Gm Pack 332 Imported Coverslips ( English Glass No 1 ) – Size 24 X 50 Mm 10 Gm Pack 333 Imported Coverslips ( English Glass No 1 ) – Size 24 X 60 Mm 10 Gm Pack 334 Pipette ( Pasture ) Dropper With Teat ( Graduate ) 335 Plastic Jet Cassette With Lid 336 Slides 3”X1” Thickness 1.10 Mm 337 Test Tube ( Borosil ) 2 ½” 338 Test Tube ( Borosil ) 4” 339 Test Tube ( Borosil ) 5” 340 Glass Beaker ( Borosil ) 50Ml 341 Glass Beaker ( Borosil ) 100Ml 342 Glass Beaker ( Borosil ) 250 343 Glass Beaker ( Borosil ) 500Ml 344 Glass Beaker ( Borosil ) 1000 Ml 345 Graduated Cylinders Borosil 1Lt. 346 Glass Pipette Tc1ml – Borosil Blow Out 347 Glass Pipette Tc 5Ml – Borosil Blow Out 348 Glass Pipette Tc 10Ml - Borosil 349 Glass Bottles, Schott Duran 100Ml, Graduated, Autoclavable, For Molecular Biology Applications – 350 Glass Bottles, Schott Duran 250Ml Graduated, Autoclavable, For Molecular Biology Applications – 351 Glass Bottles, Schott Duran 500Ml Graduated, Autoclavable, For Molecular Biology Applications – 352 Glass Bottles, Schott Duran 1000Ml Graduated, Autoclavable, For Molecular Biology Applications – 353 Tips For Micropipette 1000 Micro Litre1 Pkt – 1000 Blue Tips 354 Tips For Micropipette 100 Micro Litre1 Pkt – 1000 Yellow Tips 355 Test Tube Racks ( Metal ) 48 Holes 356 Test Tube Racks ( Plastic ) 48 Holes 357 Test Tube Racks ( Plastic ) 100 Holes 358 Sterile Container Disposable 20Ml Vial 359 Steriware Petridishes 10 Cm ( Disposable ) 15 Cm ( Disposable ) 360 Micro Centrifuge Tubes ( Autoclaved ) Conical Bottom1.5 Ml 361 Centrifuged Test Tubes 15 Ml Vol With Conical Base 362 Box For 100 Micro Tips 363 Box For 96 Micro Tips 364 Test Tube Racks Plastic ( 100 Holes ) 365 Test Tube Racks Plastic For Big Tubes 6 Or 12 Holes 366 Test Tube Stand36 Holes / 24 Holes 367 Blue Microtips Stand ( 96 Holes ) 368 Yellow Tip Stand 369 White Tip Stand 370 Micropipette -Variable Volume ( 20Ul-200Ul ) Imported Us Fda Approved Easy Maintence Large Display For Easy Viewing Light Tip Ejection Force ) 371 Micropipette Multichannel 8 Channel Volume 10 – 100 Microlitre Imported Us Fda Approved 372 Micropipette -Variable Volume ( 100Ul-1000Ul Imported Us Fda Approved Large Display For Easy Viewing Light Tip Ejection Force ) 373 Micropipette Multichannel 8 Channel Volume ( -50.0Ul-300Ul ) Imported Us Fda Approved 374 Rubber Teats Which Would Fit On To Pasteur Pipettes And Pipettes And 0.1 & 0.5 Ml Pipette 375 Block Cabinet 20000 376 Centrifuge Tube, Conical Bottom, Sterile, Capacity 15Ml, Material: Pp / Hdpe Autoclavable ( Tarson ) Ten Packs ( 280 Per Pack ) 377 Rack With Cover, Designed For Storage Of 96, 1.5Ml Microcentrifuge Tubes Or 2 Ml Tubes, Material: Pp Autoclavable ( Tarson ) 4 Pieces Per Pack 378 Centrifuge Tube, Conical Bottom, Sterile, Capacity 50Ml, Material: Pp / Hdpe Autoclavable ( Tarson ) ( 280 Per Pack ) 379 Sample Vials With Screw Caps Flat Bottom 2Ml Plastic 380 Acid Proof Gloves ( Pair ) Large Size Upto Elbow 381 Stop Watch For Hour & Second 382 Stainless Steel Embedding Moulds – Large 383 Brush Big 384 Brush Small 385 Filter Paper Sheet No.1, 12.5Mm ( Whatman No. 1 ) 100 Sheets / Pack 386 Aluminium Foil Rolls 1 Kg Roll 387 Parafilm Roll 388 Pestle Morter Big 389 Sterile Scalpel Blades 390 Tissue Paper Roll 391 Cryo Gloves, Mid Arm, Medium ( Tarson ) 392 Cello Tape ( 2 Cm Breadth ) 393 Hand Lens 394 Room Thermometer ( Digital ) 395 Disposable Needle 21G-1 ½ Inch 396 Disposable Needle 22G- 1 ½ Inch 397 White Tips- For Micropipette – Autoclavable 2 - 10 Microliter 398 Filter Paper Whatmann No.42 Circular ( Each ) 8Cm Diameter 399 Filter Paper Sheets Routine ( Blotting Paper ) 400 H2 So4 Con Lab Grade 2.5 Liters 401 Vaccutainer Black Top Citrate 3Ml Capacity 402 Vaccutainer Edta 1.5Ml Capacity 403 Diamond Glass Pencil 404 Disposable Knife For Microtome – High Profile 405 Disposable Knife For Microtome- Low Profile 406 Fine Forceps – Disposable – 407 Laboratory Thermometer ( 0- 100 Degree Centigrade ) 408 Stainless -Steel Tray With Cover 18 X 24 Inches 409 Ph Paper Strips, Range 2-10.5 ( 10Strips / Box ) 410 Ph Paper Strips, Range 3.5-6, ( 10Strips / Box ) 411 Ph Paper Strips, Range 5-7.5, ( 10Strips / Box ) 412 Ph Paper Strips, Range 6.5-9, ( 10Strips / Box ) 413 Ph Paper Strips, Range 8-10.5, ( 10Strips / Box ) 414 Borax 500 Gm / 100 Gm 415 Aluminium Trays Slides For 20 Slides 416 Sodium Hypoclorite For Disinfection 5 Ltr Can 417 Potassium Dichromate 418 Cryo Labels, Able To Withstand Crygenic Storage Conditions And Boiling Waterbaths At 100°C And Dry Heat Upto 150°C, 32.5X12.7Mm ( Tarson ) 419 Teepol 5 Litre 420 Glacial Acetic Acid 500 Ml 421 Sodium Hydroxide 500 Gm 422 Potassium Hydroxide 500 Gm. 423 India Ink 424 Potassium Chloride ( Ar ) 425 Phenol 426 Sodium Chloride 500 Gm 427 Sodium Citrate 500 Gm 428 Hydrochloric Acid Con. Ar Grade 1 Liters 429 Methylene Blue 100Gm 430 Hydrogen Peroxide 1 Ltr. 431 Glucose Ar 500 Gm 432 Calcium Oxide 433 Calcium Chloride 434 Tourniquettes For Drawing Venous Blood 435 Formaldehyde Ar 436 Falcontubes ( 25Ml, Imported ) 1000 437 Falcontubes ( 50Ml, Imported ) 1000 438 Conical Flask Corning / Borosil 100Ml 439 Flat Bottom Flask 500 Ml 440 Flat Bottom Flask 200 Ml 441 Coverslip Indian 20 X 20 Mm 442 Coverslip Indian 18 X 18 Mm 443 Plastic Pipette ( Pasture ) With Self Teat ( Graduate ) 200 Packet 444 Slides 3”X1” Thickness 1.35 Mm 445 Test Tube ( Borosil ) 6” 150 X 18 Mm 446 Glass Beaker ( Borosil ) 2000 Ml 447 Glass Pipette Tc 2Ml – Borosil Blow Out 448 Test Tube Racks ( Plastic ) 36 Holes 449 Brownpacking Tape Brown ( 5 Cm Breadth ) 450 Venepunture Site Seal 451 Brown Paper Thick Per Rim 452 Brown Paper Thin Per Rim 453 Glass Graduated Centrifuged Test Tubes 15 Ml Vol With Conical Base 454 Test Tube Racks ( Plastic ) 6 Holes For / 25 / 50 Ml 455 Stainless Steel Embedding Moulds – Medium 456 Stainless Steel Embedding Moulds – Small 457 3, 3’ Dab ( Sigma ) Powder Tablet. 458 Aec Chromogen For Ihc On Paraffin Sections ( Suitable For Dual Staining ) 459 Antibody To Brachyury For Ihc Conc On Paraffin Sections, Rtu 460 Antibody To Cd1a For Ihc On Paraffin Sections Rtu 461 Antibody To Cd1a For Ihc On Paraffin Sections, Conc 462 Antibody To Desmin For Ihc Conc 463 Antibody To Desmin For Ihc Rtu 464 Antibody To Inhibin1 For Ihc On Paraffin Sections, Rtu 465 Antibody To Merosin ( Laminin Alpha 2 Chain ) 466 Antibody To Napsin For Ihc On Paraffin Sections, Rtu 467 Antibody To N-Myc For Ihc On Paraffin Sections, Concentrated 468 Antibody To Sall4for Ihc On Paraffin Sections, Rtu 469 Antibody To Sox4 For Ihc On Paraffin Sections, Rtu 470 Antibody To Acth For Ihc Rtu 471 Antibody To Actin ( Smooth Muscle ) For Ihc Concentrated 472 Antibody To Actin ( Smooth Muscle ) For Ihc Rtu 473 Antibody To Al Amyloid For Ihc On Paraffin Sections Rtu 474 Antibody To Alfa -7 Integrin For Ihc Conc 475 Antibody To Alfa Feto Protein For Ihc Rtu 476 Antibody To Alfa Synuclein For Ihc Conc 477 Antibody To Alk-1 For Ihc On Paraffin Sections ( Spring; M444 ) Rtu 478 Antibody To Alpha Actinin 4 ( Cd2ap ) For Ihc 479 Antibody To Alpha Dystroglycan 480 Antibody To Alpha Internexin For Ihc On Paraffin Sections, Conc 481 Antibody To Alpha Internexin For Ihc On Paraffin Sections, Rtu 482 Antibody To Alpha Sarcoglycan Ncl-A-Sarc 483 Antibody To Anti Cmv For Ihc Rtu 484 Antibody To Anti Hsv For Ihc Concentrated 485 Antibody To Anti Tgf- Beta1 For Ihc ( Rtu ) 486 Antibody To Anti Tlr-3-For Ihc ( Concentrated ) 487 Antibody To Anticollagenase 4 For Ihc On Paraffin Section 488 Antibody To Anticollagenase 6 For Ihc On Paraffin Section 489 Antibody To Anticollagen-Type-I ( Calbiochem ) 490 Antibody To Antimouse Igg Conjugated With Alexaflor 488 For Ihc Conc 491 Antibody To Bcl-2 For Ihc On Paraffin Sections Rtu 492 Antibody To Beta Sarcoglycan Ncl-B-Sarc 493 Antibody To Beta Spectrin 494 Antibody To Beta-Catenin-1 For Ihc Formalin Fixed Paraffin Embedded Tissue Rtu 495 Antibody To Beta-Catenin-1 For Ihc Formalin Fixed Paraffin Embedded Tissue Concentrated 496 Antibody To Bsep Abcb11 For Ihc On Paraffin Sections Sigma Hpa019035 497 Antibody To Ca 19-9 For Ihc Rtu 498 Antibody To Calcitonin For Ihc ( Rtu ) 499 Antibody To Caldesmon For Ihc Rtu 500 Antibody To Calpain-1Ml Done Calp3c / 12A-2 501 Antibody To Calretinin For Ihc Concentrated 502 Antibody To Calretinin For Ihc Rtu 503 Antibody To Cam 5.2 For Ihc Concentrated 504 Antibody To Cam 5.2 For Ihc Rtu 505 Antibody To Carcino Embryonic Antigen ( Cea ) For Ihc Conc 506 Antibody To Carcino Embryonic Antigen ( Cea ) For Ihc Rtu 507 Antibody To Caspase –1- ( Ihc ) ( Concentrated ) 508 Antibody To Caspase –3- ( Ihc ) ( Concentrated ) 509 Antibody To Caveolin 510 Antibody To Cd – 133: Rabbit-Polyclonal-Antihuman For Ihc On Paraffin Sections Rtu 511 Antibody To Cd – 133: Rabbit-Polyclonal-Antihuman For Ihc On Paraffin Sections Concentrated 512 Antibody To Cd 10 For Ihc Paraffin Rtu 513 Antibody To Cd 23 For Ihc On Paraffin Sections Rtu 514 Antibody To Cd 44 For Paraffin Ihc- Rtu 515 Antibody To Cd 45 – Ro For Ihc Concentrated 516 Antibody To Cd 45 – Ro For Ihc Rtu 517 Antibody To Cd 99 For Ihc On Paraffin Sections Rtu Dako Clone 12E7 / Ir057 518 Antibody To Cd15 Antibody For Ihc On Paraffin Sections Rtu 519 Antibody To Cd20 For Ihc Concentrated 520 Antibody To Cd20 For Immunohistochemistry Rtu 521 Antibody To Cd21 For Ihc On Paraffin Sections Rtu 522 Antibody To Cd3 For Ihc For Paraffin Sections Rtu 523 Antibody To Fsh For Ihc Rtu 524 Antibody To Cd30 For Immunohistochemistry Rtu 525 Antibody To Cd31 Antibody For Ihc ( Concentrated ) 526 Antibody To Cd31 Antibody For Ihc Rtu 527 Antibody To Cd34 Antibody For Ihc ( Concentrated ) 528 Antibody To Cd34 Antibody For Ihc Rtu 529 Antibody To Cd4 For Ihc For Paraffin Sections Rtu 530 Antibody To Cd5 For Ihc On Paraffin Sections Rtu 531 Antibody To Cd56 For Ihc On Paraffin Sections Rtu 532 Antibody To Cd56 For Ihc On Paraffin Sections, Conc 533 Antibody To Cd68 For Immunohistochemistry Conc 534 Antibody To Cd68 For Immunohistochemistry Rtu 535 Antibody To Cd8 For Ihc For Paraffin Sections Rtu 536 Antibody To Soluble Cd 25 For Ihc For Paraffin Sections Rtu 537 Antibody To Cdx – 2 For Ihc Paraffin Concentrated 538 Antibody To Cdx – 2 For Ihc Paraffin Rtu 539 Antibody To Chromogranin For Ihc Concentrated 540 Antibody To Chromogranin For Ihc Rtu 541 Antibody To Ck 7 For Ihc Concentrated 542 Antibody To Ck 7 For Ihc Rtu 543 Antibody To Ck18 M30 Fragment For Paraffin Ihc 544 Antibody To Ck20 Antibody For Ihc ( Concentrated ) 545 Antibody To Ck20 Antibody For Ihc Rtu 546 Antibody To Ckit / Cd117 Ihc* Pab4502 Conc 547 Antibody To Ckit / Cd117 For Ihc* Pab4502 Rtu 548 Antibody To Claudin-1 For Ihc On Paraffin Sections Rtu 549 Antibody To C-Myc For Ihc On Paraffin Sections, Conc 550 Antibody To Collagen Vi For Ihc, Conc 551 Antibody To Complement Mac, For Ihc Concentrated 552 Antibody To Complement Mac, For Ihc Rtu 553 Antibody To Crp ( C-Reactive Protein ) For Ihc On Paraffin Sections, Conc 554 Antibody To Ctnnb1 For Ihc On Paraffin Sections, Conc 555 Antibody To Cyclin-D1 Clone: Rabbit-Polyclonal-Antihuman For Ihc Rtu 556 Antibody To Cyclooxygenase – 2 ( Cox-2 ) For Ihc Rtu 557 Antibody To Cytokeratin ( Pan / Ae1 / Ae3 ) For Ihc Conc 558 Antibody To Cytokeratin ( Pan / Ae1 / Ae3 ) For Ihc Rtu 559 Antibody To Cytokeratin 8 For Ihc ( Low Molecule Wt. ) Rtu 560 Antibody To Cytokeratin Clone Mnf 116 For Ihc Rtu 561 Antibody To Cytokeratin18 For Immunohistochemistry Rtu 562 Antibody To Cytokeratin19 For Ihc Rtu 563 Antibody To Cytokeratin5 / 6 Antibody For Ihc ( Rtu ) 564 Antibody To Cytokeratin5 / 6 Antibody For Ihc Concentrated 565 Antibody To D2-40 Antibody For Ihc Rtu ( Paraffin ) 566 Antibody To Delta Sarcoglycan Ncl-D-Sarc 567 Antibody To Dog-1 Antibody For Ihc Rtu 568 Antibody To Dysferlin ( Hamlet ) 1 Ml Clone Ham 1 / 7B6 569 Antibody To Dysferlin ( Hamlet ) 1 Ml Clone Ham3 / 17B2 570 Antibody To Dystrophin C Terminal 1Ml; Ncc-Dys-2; Clone Dy8 / 6C5 571 Antibody To Dystrophin Clone 13H6-Ncl Dys-A 572 Antibody To Dystrophin Clone 34C5-Ncl Dys-B 573 Antibody To Dystrophin N Terminal 1Ml; Ncl-Dys-3; Clone Dy10 / 12B-2 574 Antibody To Dystrophin Rod Domain 1Ml; Ncl-Dys-1;Clone Dy4 / 6D3 575 Antibody To E–Cadherin Clone: Nch – 38 For Ihc On Paraffin Sections Concentrated 576 Antibody To Egfr ( Type Iii ) For Ihc Rtu 577 Antibody To Ema ( Epithelial Membrane Antigen ) For Ihc Conc 578 Antibody To Ema ( Epithelial Membrane Antigen ) For Ihc Rtu 579 Antibody To Emerin-Clone 4G5 580 Antibody To Ep– Cam: Rabbit-Polyclonal-Antihuman For Ihc On Paraffin Sections Rtu 581 Antibody To Ep– Cam: Rabbit-Polyclonal-Antihuman For Ihc On Paraffin Sections Concentrated ( Bio Sb; 6280 ) 582 Antibody To Factor Viii Related Antigen For Ihc Rtu 583 Antibody To Yap 1 On Paraffin Section Ihc 584 Antibody To Gab1 For Ihc On Paraffin Sections, Conc 585 Antibody To Gamma Sarcoglycan Ncl-G-Sarc 586 Antibody To Gastrin For Ihc Rtu 587 Antibody To Gfap Antibody For Ihc – Monoclonal Conc 588 Antibody To Gfap Antibody For Ihc – Monoclonal Rtu 589 Antibody To Ggt Antibody For Ihc On Paraffin Sections, Conc 590 Antibody To Gli1 For Ihc On Paraffin Sections, Conc 591 Antibody To Glutamine Synthetase - Clone Gs6 For Ihc On Paraffin Sections, Conc 592 Antibody To Glypican 3 Clone1g12: Rabbit-Polyclonal-Antihuman For Ihc ( Rtu ) 593 Antibody To Growth Hormone For Ihc Rtu 594 Antibody To Hbcore For Ihc ( For Paraffin Section ) Rtu 595 Antibody To Hbs Ag For Immunohistochemistry Rtu 596 Antibody To Hepatocyte ( Clone Och1e5 ) For Ihc Concentrated 597 Antibody To Hepatocyte ( Clone Och1e5 ) For Ihc Rtu 598 Antibody To Her2neu For Ihc-Clone K-5204, K5207, 5K001, Rrmabclone 4B5 Rtu 599 Antibody To Her2neu For Ihc-Clone K-5204, K5207, 5K001, Rrmabclone 4B5 Concentrated 600 Antibody To Hla – Class I For Ihc Concentrated 601 Antibody To Hla – Dr For Ihc Concentrated 602 Antibody To Hmb45 For Ihc Rtu 603 Antibody To Hsp70 Heat Shock Protein 70 For Ihc On Paraffin Sections, Concentrated 604 Antibody To Icam – 1: Rabbit-Polyclonal-Antihuman For Ihc On Paraffin Sections Concentrated 605 Antibody To Idh-1 Antibody For Ihc On Paraffin Sections Concentrated 606 Antibody To Iga For Immunohistochemistry Rtu 607 Antibody To Igg - Cd 138 For Ihc, Rtu 608 Antibody To Igg - Cd 79 A For Ihc, Rtu 609 Antibody To Igg For Immunohistochemistry Rtu 610 Antibody To Igg-4 Antibody For Ihc On Paraffin Sections Concentrated 611 Antibody To Igg-4 Antibody For Ihc On Paraffin Sections Rtu 612 Antibody To Igg4 Clone Mrq44 Antibody For Ihc On Paraffin Sections, Rtu 613 Antibody To Igg4 Clone Mrq44 Antibody For Ihc On Paraffin Sections, Concentrated 614 Antibody To Igm For Immunohistochemistry Rtu 615 Antibody To Inhibin1 For Ihc On Paraffin Sections, Conc 616 Antibody To Ini1 For Ihc On Paraffin Sections, Concentrated 617 Antibody To Inos For Ihc Conc 618 Antibody To Insulin For Ihc Rtu 619 Antibody To Jc Virus Antigen Antibody For Ihc On Paraffin Sections Rtu 620 Antibody To Jc Virus Antigen Antibody For Ihc On Paraffin Sections Concentrated 621 Antibody To Kappa Light Chains For Ihc On Paraffin Section 622 Antibody To Kcna1 For Ihc On Paraffin Sections, Conc 623 Antibody To Lambda Light Chains For Ihc On Paraffin Sections 624 Antibody To Lamin A / C For Ihc, Conc 625 Antibody To Lca Antibody For Ihc Concentrated 626 Antibody To Lca Antibody For Immunohoistochemistry Rtu 627 Antibody To L-Fabp ( Liver Fatty Acid Binding Protein ) For Ihc On Paraffin Sections, Concentrated 628 Antibody To Mdr3- Abcb4 For Ihc On Paraffin Sections, Conc 629 Antibody To Melan A Antibody For Ihc Rtu 630 Antibody To Mgmt For Ihc On Paraffin Sections, Conc 631 Antibody To Mib – 1 ( Mab Clone Mib1 / Mm1 / Rmab56 ) For Ihc Rtu 632 Antibody To Mib – 1 ( Mab Clone Mib1 / Mm1 / Rmab56 ) For Ihc Concentrated 633 Antibody To Mic – 2 For Ihc Concentrated Mab Clone Epr3097y / 12E7 634 Antibody To Microtubule Associated Protein 2 For Ihc On Paraffin Sections Rtu 635 Antibody To Microtubule Associated Protein For Ihc Conc 636 Antibody To Microtubule Associated Protein For Ihc Rtu 637 Antibody To Mlh 1 Antibody For Ihc On Paraffin Sections 638 Antibody To Mmp2: Rabbit-Polyclonal-Antihuman For Ihc Formalin Fixed Paraffin Embedded Tissue Conc 639 Antibody To Moc – 31 For Ihc Concentrared 640 Antibody To Moc – 31 For I Ihc Rtu 641 Antibody To Mouse Monoclonal Anti-Human Bk Virus For Ihc 642 Antibody To Msh 2 For Ihc On Paraffin Sections Conc 643 Antibody To Msh 2 For Ihc On Paraffin Sections Rtu 644 Antibody To Msh 6 Antibody For Ihc On Paraffin Sections Rtu 645 Antibody To Msh 6 For Ihc On Paraffin Sections Conc 646 Antibody To Muc - 1 For Ihc Paraffin Rtu 647 Antibody To Muc – 2 For Ihc Paraffin Rtu 648 Antibody To Muc - 5 Ac For Ihc Paraffin Rtu 649 Antibody To Muc – 6 For Ihc Paraffin Rtu 650 Antibody To Muscle Actin For Ihc Rtu 651 Antibody To Myelin Basic Protein For Ihc Rtu 652 Antibody To Myeloperoxidase For Ihc Rtu 653 Antibody To Myogenin For Ihc On Paraffin Sections 654 Antibody To Myosin Heavy Chain Fast Ncl-Mchf 655 Antibody To Myosin Heavy Chain Fast Ncl-Mhcd 656 Antibody To Myosin Heavy Chain Slow Ncl-Mhcs 657 Antibody To Myotilin ( Leica, Novacastra ) For Ihc, Conc 658 Antibody To Napsin For Ihc On Paraffin Sections, Conc 659 Antibody To Ncam For Ihc Concentrated 660 Antibody To Ncam For Ihc Rtu 661 Antibody To Nephrin For Ihc Rtu 662 Antibody To Nephrin For Ihc Concentrated 663 Antibody To Nestin For Ihc On Paraffin Sections Conc 664 Antibody To Nestin For Ihc On Paraffin Sections Rtu 665 Antibody To Neurofilament Protein Antibody For Ihc Conc 666 Antibody To Neurofilament Protein Antibody For Ihc Rtu 667 Antibody To Neuron Specific Beta Iii Tubulin For Ihc On Paraffin Sections, Concentrated 668 Antibody To Neuronal Nuclei ( Neu N ) For Ihc On Paraffin Sections, Conc 669 Antibody To Npr3 For Ihc On Paraffin Sections, Conc 670 Antibody To Nse For Ihc Paraffin Rtu 671 Antibody To Oct4 For Ihc On Paraffin Sections, Rtu 672 Antibody To Olig2 For Ihc On Paraffin Sections, Conc 673 Antibody To Ov 6: Rabbit-Polyclonal-Antihuman For Ihc On Paraffin Sections Concentrated 674 Antibody To P16 Ink 4A For Ihc Rtu 675 Antibody To P-53 Protein ( Do-7 ) For Ihc Concentrated 676 Antibody To P-53 Protein ( Do-7 ) For Ihc Rtu 677 Antibody To Pancreatic Polypeptide For Ihc Conc 678 Antibody To Pcna For Immunohistochemistry Rtu 679 Antibody To Pgdfr Beta Antibody For Ihc Conc 680 Antibody To Phosphohistone-H3 ( Phh3 ) For Ihc On Paraffin Sections, Rtu 681 Antibody To Placental Alkaline Phosphatase For Ihc Rtu 682 Antibody To Pms-2 For Ihc On Paraffin Sections Conc 683 Antibody To Pms-2 For Ihc On Paraffin Sections Rtu 684 Antibody To Podosin ( Nphs-2 ) For Ihc Concentrated 685 Antibody To Podosin ( Nphs-2 ) For Ihc Rtu 686 Antibody To Polyclonal Cea For Ihc Rtu 687 Antibody To Polyclonal Ubiquitin For Ihc Rtu 688 Antibody To Prolactin For Ihc Rtu 689 Antibody To Protein Gene Product Pgp 9.5 For Ihc Rtu 690 Antibody To Pten For Ihc On Paraffin Sections Rtu 691 Antibody To S – 100 For Ihc Concentrated 692 Antibody To S – 100 For Immunohistochemistry Rtu 693 Antibody To S100a4 : Rabbit-Polyclonal-Antihuman For Ihc Formalin Fixed Paraffin Embedded Tissue Conc 694 Antibody To Saa ( Amyloid A ) For Ihc On Paraffin Sections, Rtu 695 Antibody To Sall4 For Ihc On Paraffin Sections, Conc 696 Antibody To Serotonin For Ihc Rtu 697 Antibody To Sfrp1 For Ihc On Paraffin Sections, Conc 698 Antibody To Shh For Ihc On Paraffin Sections, Conc 699 Antibody To Somatostatin For Ihc Rtu 700 Antibody To Synaptophysin For Ihc Concentrated 701 Antibody To Synaptophysin For Ihc Rtu 702 Antibody To Terminal Deoxynucleotidyl Transferase For Ihc Rtu 703 Antibody To Transthyretin Ihc Paraffin Concentrated 704 Antibody To Tsh For Immunohistochemistry Rtu 705 Antibody To Utrophin ( Leica, Novacastra ) For Ihc, Conc 706 Antibody To Vimentin For Ihc Concentrated 707 Antibody To Vimentin For Immunohistochemistry Rtu 708 Antibody To Wnt For Ihc On Paraffin Sections, Conc 709 Antibody To Wt 1 For Ihc Paraffin, Rtu 710 Antibody To A-Inhibin For Ihc On Paraffin Sections, Rtu 711 Dab Substrate And Chromogen For Ihc 712 Lsab For Ihc – Universal ( Mouse & Rabbit ) 713 Lsab For Ihc Universal ( Mouse & Rabbit ) 714 Micro Polymer Detection Kit For Ihc 715 Pepsin P7000 Powder, =250 Units / Mg Solid ( Sigma ) 716 Pepsin P7012 717 Poly -L Lysine Solution 718 Pronase ( Sigma ) 719 Protease Type Xxiv ( Sigma P8038 ) 720 Proteinase - Sigma 721 Secondary Antibody Antimouse-Goat Igg Tagged To Alexa Flour 488 722 Secondary Antibody Antirabbit Goat Igg To Alexa Flour 488 723 Antibody To Arginase-1, Rtu 724 Antibody To Arginase-1, Conc 725 Fitc Conjugated Antihuman Fibrinogen Antibodies Dako ( Conc ) 726 Fitc Conjugated Antihuman C3, ( Conc ) Antibodies 727 Antibody To Rabbit Anti Human C4d Cell Marque ( Rtu ) 728 Antibody To Anti-Pla2r Sigma Hpa012657 ( Conc ) 729 Antibody To Anti Atrx Antibody Sigma Hpa001906 730 Antibody To Anti-Mum1 Antibody –Clone Eau32 Rtu Leica 731 Antibody To Anti-P40-Clone Bc28-Concentrated 732 Antibody To Anti-Hmw-Ck-34Betae12-Dako-Concentrated 733 Antibody To Anti-Er-Clone Ep1-Rtu 734 Antibody To Anti-Pr-Clone-Pgr1294-Rtu 735 Antibody To Anti-Pax8 Clone Mrq50 Concentrated 736 Antibody To Anti-Amacr Clone 13H4 Rtu 737 Antibody To Anti-Nanog-Clone D73g4-Cell Signaling Technology-Concentrated 738 Antibody To Anti-Sox2-Clone-D1c7j-Cell Signaling Technology-Concentrated 739 Antibody To Anti-L1cam ( Sigma ; Uj127 ) Concentrated 740 Antibody To Anti-Filamin A-Filzgerald-Concentrated 741 Antibody To Anti-Satb2-Sigma Aldrich- Concentrated Hpa001042 742 Antibody To Anti-Cdh17-Cell Marque-Concentrated / Hpa023614 Sigma 743 Antibody To Anti-Gcet- Dako-Concentrated 744 Anti-Psa-Clone-35H9-Leica-Cncentrated 745 Antibody To Anti-Ca-125-Clone-Ov185:1-Leica-Rtu 746 Antibody To Anti P63 For Ihc On Ffpe 747 Antibody To Anti Ck5 / 6 Antibody 748 Antibody To Anti Abcc2 ( Mrp2 ) Antibody Produced In Rabbit Hpa004860 Sigma 749 Antibody To Anti-Cdh17-Cell Marque-Concentrated / Hpa023614 Sigma 750 Anti Braf V600e For Ihc ( Ve1 Specific For Braf Pv600e ) 751 Pap Pen For Ihc 752 Anti-Vhl Antibody Produced In Rabbit Ab4503075 Sigma 753 Antibody To Anti Map2 Antibody Rtu 754 Antibodies- Ck-3 755 Antibodies -Ck 19 Rtu 756 Antibodies To Mac- ( C 5-9 ) - Conc 757 Antibody P62 Rtu 758 Antibody Tdp 43 759 Antibody Mhcn 760 Antibody To Show Loss Of H3k 27M Me3 Conc ( 07–449, Millipore ) 761 H3k27 Antibody ( Abcam; Ab6002 ) 762 Antibody To Rabbit Polyclonal Anti-Ezh2 ( 5246, Cell Signaling ) Conc 763 Antibody To C1119mc–Rela Fusions 764 Antibody To Ebp 50 Conc 765 Antibody To P65 Conc 766 Antibody To Fl1 767 Antibody To Sox 10 768 Antibody To Anti-Dnmt1 Antibody ( Clone H-300, Dilution 1:200; Santa Cruz Biotechnology, Santa Cruz, Ca, Usa ) , 769 Antibody To Anti-Dnmt3a Antibody ( Clone 64B1446, Dilution 1:200; Imgenex, 770 Antibody To Dnmt3b ( Clone 52A1018 1:200 ) 771 Bcl 6 Anti Body Conc 772 Cdk 4 Anti Body Conc 773 Gata2 Antibody Conc 774 Mdm2 Antibody Conc 775 Pck1 Conc 776 Sf 1 Conc 777 Bob 1 Conc 778 Pit 1 Conc 779 Antigap43 Antibody 780 Anti-Eber-Associated Protein Antibody, Polyclonal 781 Brilliant Cresyl Blue 782 Phospho. Anti Nf-Kb P65 Antibody- 783 Anti Stat6 Antibody - 784 Anti Cd 19 Antibody 785 Anti Cd 38 Antibody 786 Anti Pten Ab 787 Anti Ck9 Antibody 788 Anti Gh Antibody 789 Anti Lh Beta Antibody 790 Anti Tsh Alpha Antibody 791 Anti Fsh Alpha Antibody 792 Anti Hpv Antibody 793 Anti Ebv Nuclear Antigen Ab 794 Anti Ebv Latent Memb. Protein 795 Anti Cd 163 796 Anti Gap43 Antibody 797 Anti Lin28 Antibody ( Preferably Thermoscientific ) 798 Xl Iso ( 17Q ) 799 Brilliant Cresyl Blue 800 Fecal Occult Blood Test ( Fobt ) , Kit 801 Phospho. Anti Nf-Kb P65 Antibody- 802 Anti Stat6 Antibody - 803 Anti Ck3 Antibody 804 Anti P16 Antibody 805 Anti Ck9 Antibody 806 Anti Cd Kn2a / P14 Antibody 807 Anti Pax-5 Antibody 808 Anti Thyroglobulin Antibody 809 Anti Ck7 For Flow Cytometry 810 Anti Epcam For Flowcytometry 811 Anti Ck8 For Flowcytometry 812 Sstr 2A 813 Calulonin 814 Ca125 815 Ca 19.9 816 Thyropanoxiden 817 Lin 28 818 P14 819 Marlin 820 Epb-1 821 Ebf-50 822 Spectrin 823 Pdl-1 824 Renal Cell Carcinoma 825 Anti Body Cd163 826 Antibody To Ttf-1 Antibody For Ihc Rtu 827 0.5 M Edta ( Ph 8.0 ) Solution 828 10X Sera Lysis Buffer 829 5-5’ Diethyl Barbiturate 830 Absolute Alcohol / Ethanol Analytical 831 Acetic Acid 100% For Molecular Biology, 832 Acetyl Thiocholine Iodide A 5751 Sigma 833 Acrylamide 834 Bisacrylamide: 40% Solution ( Sigma Aldrich ) 835 Adenosine 5 Monophosphate 836 Adenosine 5 Triphosphate Disodium Salt ( Sigma ) A-7699 837 Adenosine Tri Phosphate 838 Agarose For Molecular Biology ( Sigma Aldrich ) ( Sigma A6138 ) 839 Ambion Nuclear Free Water 840 Ammonium Per Sulphate: For Electrophoresis ( Sigma Aldrich ) 841 Bis Acrylamide 842 Blue Tips ( Autoclaved Made Of Ultra High Molecular Weight Polyethelyene Suitable For Molecular Biology Work With Racks ) 843 Boric Acid For Molecular Biology, 844 Bovine Serum Albumin: For Western Blot ( Sigma Aldrich ) 845 Brij 846 Catalase Enzyme 847 Coenyzme Nadh 848 Coomasie Blue ( G 250 ) : For Electrophoresis ( Sigma Aldrich ) 849 Cryogenic Apron 1.5 Meter 850 Dispenser For 25 Liter Solution Container 851 Dispenser For 50 Liter Solution Container 852 Dmso ( Sigma Aldrich ) 853 Dna Extraction Kit ( Qiagen / Invitrogen ) : 250 Samples For 12 X 96 Dna Minipreps: Genomic Spin Columns, Plates, Proteinase K, Digestion Buffer, Lysis / Binding Buffer, Wash Buffers, Elution Buffer, Rnase A, S-Blocks, Airpore Tape Sheets, Collection Microtubes ( 1.2 Ml ) , Elution Microtubes Rs, Caps, 96-Well Plate Registers 854 Dna Isolation Kit ( 50 Preps ) For Isolation Of Genomic Dna From Animal Cells, Animal Tissues, Whole Blood, Buffy Coat, Plasma, Serum, Bacteria, Yeasts, Viruses, Paraffin Embedded Tissues Etc. Using Spin Column Method. Five Kits 855 Dna Molecular Weight Marker 100Bp Ladder, 30Mg 856 Dntp: For Electrophoresis ( Sigma Aldrich ) : Dntp 100A: 857 Dntps ( Datp, Dgtp, Dctp, Dttp ) 858 Dntps 100Mmolar Solution Consisting Of Datp, Dctp, Dgtp And Dttp 859 Ethidium Bromide For Electrophoresis ( Sigma Aldrich ) 860 Ethylene Diamine Tetraacetic Acid, Disodium Salt, Dihydrate For Molecular Biology 861 Gel Loading Solution: For Electrophoresis ( Sigma Aldrich ) 862 Glass Graduated Centrifuged Test Tubes 15 Ml Vol With Conical Base 863 Glass Tough Staining Jars For 19 Slides 864 Glucose-1 –Phosphate Sigma 865 Histopaque ( Sigma 1119-1 ) 866 Ice Bucket Suitable For Liquid Nitrogen, Dry Ice And Acetone ( Biochrom ) ( 4.5Lit. ) 867 Igepal-Ca630 ( Sigma 18896 ) 868 Insulin Plain 28.7 Iu / Mg Sigma 869 Isopropyl Alcohol 100% For Molecular Biology 870 Isopropyl Alcohol Feisher 871 Liquid Nitrogen 872 Mgmt Antibody For Western Blot 873 Milli Q Water 874 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 20 Ml ) For Keeping All Molecular Biology Solutions And Buffers 875 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 50 Ml ) For Keeping All Molecular Biology Solutions And Buffers 876 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 100 Ml ) For Keeping All Molecular Biology Solutions And Buffers 877 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 250 Ml ) For Keeping All Molecular Biology Solutions And Buffers 878 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 500 Ml ) For Keeping All Molecular Biology Solutions And Buffers 879 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 1000 Ml ) For Keeping All Molecular Biology Solutions And Buffers 880 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 2 Ltrs ) For Keeping All Molecular Biology Solutions And Buffers 881 Molecular Biology Reagent Bottles – Wide Mouthed, Autoclavable Plastic Screw Capped Glass Bottles ( 4 Ltrs ) For Keeping All Molecular Biology Solutions And Buffers 882 N Ethyl Maleimide ( Sigma E 3876 ) 883 N, N-Dimethyl-P-Phenylenediamine Dihydrochloride – Sigma 884 Naoh Pellets ( Vysis ) 885 Nitroblue Tetrazolium ( Sigma N 6876 ) 886 Nitrocellulose Membrane Sheet; 0.2Μ; 7.9×10.5Cm ) 887 Pararosaline ( Sigma P 1528 ) 888 Pbs Sachets To Make I Litre Buffer 889 Pcr Buffer ( Sigma Aldrich ) 890 Pcr Purification Kit ( 50 Preps ) For Purification Of Pcr Products Or Dna Fragments From Enzymes, Dntps, Salts And Primers Without Phenol / Chloroform Extraction Using Special Silica Based Columns 891 Pepsin P7000 892 Primers For Pcr 893 Pronase ( Sigma ) ( 10165921001 ) 894 Protease Type Xxiv ( Sigma P8038 ) 895 Proteinase - Sigma 896 Resorcinol 897 Rhodanine Stain – Sigma 898 Rna Later 899 Rubeanic Acid– Sigma 900 Sample Storage Box For Upto 3Ml Vials ( Suitable Up To At –190 C Freezer ( Biochrome ) 901 Soluble Blue ( Methyl Blue ) ( Sigma Code M. 6900 ) C.I. 42780 902 Ssc 903 Sucrose For Molecular Biology 904 Sulpho Salicylic Acid ( Sigma / Merck ) 905 Taq Polymerase ( Sigma / Qiagen ) 5U / Μl With 10X Reaction Buffer And Mgcl2 906 Temed For Electrophoresis ( Sigma Aldrich ) 907 Tris Base For Molecular Biology, Sigma 648310 908 Tris Glycine Buffer: For Western Blot ( Biorad ) 909 Triton-X 910 Trizol Tri Reagent 911 Tween 20 912 Veronal Buffer ( Sodium Acetate & Sodium Barbitone ) 913 Victoria Blue Sigma - 234176 914 Viral Rna Extraction Kit ( 50 Preps ) For Purification Of Viral Rna From Cell Free Samples Such As Plasma, Serum, Body Fluid, Urine, And Cell Culture Supernatant One Kit 915 Kim Wipes ( Delicate ) 916 Pepsin From Porcine Gastric Mucosa Sigma P7012 917 20X Ssc ( Nalgene Abbott Molecular ) 918 Chloroform 919 Thermonitrile Gloves 920 Isoamyl Alcohol 921 Phenol-Chloroform – Isoamyl Alcohol Mixture ( 25:24:1 ) 922 Chloroform – Isoamyl Alcohol Mixture ( 24:1 ) 923 Phenol 924 Mgmt Methylation Kit 925 Verso Cdna Synthesis Kit Thermofischer 926 Tissue Rna Extraction Kit Qiagen 927 Tissue Dna Extraction Kit Qiagen 928 Dna Extraction Kit From Whole Blood 929 Fast Digest Restriction Enzyme Fok1 930 Pcr Master Mix 931 Dna Methylation Kit 932 Dna Bisulphate Modification For Methylation Specific Reactions 933 Serum Micro Rna Isolation Kit 934 Micro Rna Cdna Synthesis Kit 935 Guanidium Thiocynate 936 Random Hexamer For Rtpcr 937 Oligo ( Dt ) 18 Primer For Rtpcr 938 Primers Of 1000 Base Pairs 939 M Mulv Reverse Transcriptase For Rtpcr 940 50 Base Pair Dna Ladder 941 Genomic Dna Purification Kit For Fresh And Frozen Blood / Tissue 942 Qiagen Quick Pcr Purification Kit 943 Qiagen Quick Gel Extraction Kit 944 Epigenetic Dna Methylation Kit 945 Sybr Green Mastermix For Qpcr 946 6X Loading Dye For Dna Agarose Electrophoresis 947 Dna Bisufite Modification Kit For Methylation Specific Pcr Tions ) 948 Hot Start Taq Dna Polymer With 10X Buffer Without Mgcl2 949 Hot Start Pcr Mastermix 950 Sodium Dodecyl Suphate ( Sds ) For Mol. Biology 951 Beta Mercaptoethanol 952 Orthophenylene Diamine Sigma 953 Diethyl Pyrocarbonate ( Depc ) 954 Depc Treated Water 955 Protein Molecular Weight Marker Low Range 6500-66000 Da 956 Protein Molecular Weight Marker Medium Range 36000-200000 Da 957 Protein Molecular Weight Marker Wide Range 6500-2000000 Da 958 Bradford Reagent 959 Dmso For Molecular Biology 960 Glycerol 961 Rpmi – 1640 With L Glutamine For Cell Culture Powdered 962 Rpmi – 1640 For Cell Culture Tested ( Liquid ) 963 Rnase Inhibitor 1000 U 964 10X Tbe Buffer 965 Glacial Acetic Acid Extrapure For Molecular Biology 966 Tris Chloride For Molecular Biology 967 Tris Buffer 968 Bromophenol Blue , Sodium Salt For Molecular Biology 969 Ecl Prime Western Blotting Detection Reagent 970 Ecl Prime Blocking Reagent 971 Full Range Rainbow Molecular Weight 8000-220000 Da Marker 972 Ecl Dualvue Western Blotting Markers 973 Ammonium Persulphate 974 Dl Nor Leucin 975 Hepes Buffer 976 Np 40 977 Nitrocellulose Membrane For Western Blotting 0.45 Micron Pore Size 8.5×13Cm. 978 Albumin Heat Shock Isolation Ph 7.0 979 Glacial Acetic Acid 100% For Molecular Biology, 980 Acetyl Thiocholine Iodide A 5751 Sigma 981 Adenosine 5 Triphosphate Disodium Salt ( Sigma ) A-7699 982 Adenosine Tri Phosphate 983 Ambion Nuclear Free Water 984 Ammonium Per Sulphate: For Electrophoresis ( Sigma Aldrich A 3678 ) 985 Ana Profile Line Blot Assay For Different Nuclear Antigens –Sm, Nrnp / Sm, Ssa, Ssb, Scl70, Jo-I, Dsdna, Nucleosomes, Pm Scl, Histones Ama, Ribosome P Protein, Cenpb, Ku, Mi2 986 Bactericidal, Fungicidal, Toberculocidal, Virucidal Against Enveloped Viruses ( Including Hbv, Hiv, Hcv ) , Sars. Also Effective Against Adeno, Papova And Rota Virus ( Aldehyde Free ) For Surgical Handwash 987 Boats For Making Glass Knives For Electron Microscopy Imported 988 Bone Marrow Aspiration Needle -16G 989 Bone Marrow Aspiration Needle -18G 990 Bone Marrow Trephine Biopsy Needle -12G 991 Brilliant Cresyl Blue ( Sigma ) 992 Brilliant Crystal Scarlet ( Acid Red 44 ) ( Sigma Code C0644 ) C.I. 16250– 993 Carbon Steel Razor Blades Single Edge 0.09”Thick For Trimming –Of Em Blocks 994 Cardboard Boxes Matchbox Style For Labeling And Storage Of Em Blocks Size 50X32x11mm, Strong And Rigid, Covered With White Paper Both Inside And Outside 995 Copper Gilder Grid ( 200Mesh ) ( Imported Em Grade ) 996 Copper Gilder Grid ( 300Mesh ) ( Imported Em Grade ) 997 Cryogenic Apron 1.5 Meter 998 N, N-Dimethyl-P-Phenylenediamine Dihydrochloride – Sigma 999 Ddsa ( Imported Em Grade 1000 Dental Wax 1001 Dibutyl Phthalate ( Imported Em Grade ) 1002 Disodium Hydrogen Phosphate Anhydrous 1003 Disodium Tetraborate 1004 Dumont Tweezer Hp Ss Type 5 / 45 For Em Use ( Imported Em Grade ) 1005 Dumont Tweezer Ss Am Type 7 For Em Use ( Imported Em Grade ) - 1006 Elisa Kit For Alternate Complement Pathway Assay Quantitative With 3 Standards 1007 Elisa Kit For Anti C3 Nephritic Factor Quantitative With 3 Standards 1008 Elisa Kit For Anti Dsdna Quantitative With Alteast Three Standards 1009 Elisa Kit For Anti Factor H For Quantitative With 3 Standards 1010 Elisa Kit For Anti Factor H Variant For Quantitative With 3 Standards 1011 Elisa Kit For Anti Gbm Antibody- Semi Quantitative- Atleast Three Standards Required 1012 Elisa Kit For Anti Lkm Quantitative With Alteast Three Standards 1013 Elisa Kit Anti Pr3 ( Igg ) ( Canca ) Quantitative With Alteast Three Standards 1014 Elisa Kit For Anti Mpo ( Igg ) ( Panca ) Quantitative With Alteast Three Standards 1015 Elisa Kit For Bb Complement Factor Quantitative With Atleast 3 Standards 1016 Elisa Kit For Detection Of Calprotectin ( Monoclonal Antibody ) For Quantitative With Atleast Three Calibrators 1017 Elisa Kit For Estimation Of Human Adiponectin - Quantitative - With Atleast Three Standards 1018 Elisa Kit For Estimation Of Human Interleukin 10 - Quantitative – With Atleast Three Standards 1019 Elisa Kit For Estimation Of Human Interleukin 18 - Quantitative –With Atleast Three Standards 1020 Elisa Kit For Estimation Of Human Interleukin 6 - Quantitative - With Atleast Three Standards 1021 Elisa Kit For Estimation Of Tnf Alpha - Quantitative With Atleast Three Standards 1022 Elisa Kit For Il 15 Quantitative With Atleast Three Standards 1023 Elisa Kit For Kim-1 Quantitative With Atleast Three Standards 1024 Elisa Kit For Mmp9 Quantitative With Alteast Three Standards 1025 Elisa Kit For N-Acetyl-B-D-Glucosaminidase ( Nag ) Assay Atleast Three Standards- Quantitative 1026 Elisa Kit For Ngal ( Neutrophil Gelatinase-Associated Lipocalin ) Quantitative With 3 Standards 1027 Elisa Kit For Quantitative Estimation Of Baff - Atleast Three Standards Required 1028 Elisa Kit For Quantitative Estimation Of Ck18 M30 Fragment- Atleast Three Standards Required 1029 Elisa Kit For Quantitative Estimation Of Mcp-1- Atleast Three Standards Required 1030 Elisa Kit For Quantitative Estimation Of Tweak- Atleast Three Standards Required 1031 Epon 812 ( Imported Em Grade ) 1032 Epoxy Resin Cy212 ( Imported Em Grade ) 1033 Ethanol 100% For Molecular Biology 1034 Ethanol 200 Proof For Em Processing ( Fiescher ) 1035 Ficoll ( Sigma ) 1036 Fish Probe Cdkn2a / Cep9 Fish Probe Kit 1037 Fish Probe 1P36 / 1Q25 And 19P13 / 19Q13q Probe For Fish 1038 Fish Probe Egfr / Cep7 Fish Probe Kit 1039 Fish Probe Her2 / Neu Probe For Fish Analysis 1040 Fish Probe Lsi Tp53 / Cep 17 Fish Probe Kit 1041 Fish Probe Pten. Cep 10 Fish Probe Kit 1042 Fish Probe For Pdgfr 1043 Fish Probe For Ewsr1 Break Apart Dual Colour Probe 1044 Fish Probe For Tert / 5Q31 Dual Colour Probe 1045 Fish Probe For Nmyc 1046 Break Apart Fish Probe For Braf 1047 Break Apart Fish Probe For Rela 1048 Fish Probe For Myc ( 8Q24 ) Break Apart Probe Orange / Green 1049 Fish Probe For C19mc / Tpm4 Fish Probe Kit 1050 Fish / Cish Probe For Bond Eber Probe ( Preferably Leica ) Rtu ) 1051 Fitc Conjugated Anti Albumin Conc 1052 Fitc Conjugated Anti C3 Conc 1053 Fitc Conjugated Anti Igg Conc 1054 Fitc Conjugated Anti Fibrinogen Conc 1055 Fitc Conjugated Anti Iga Conc 1056 Fitc Conjugated Anti Igm Conc 1057 Fitc Conjugated Anti Kappa – Antibody Conc 1058 Fitc Conjugated Anti Lambda Antibody Conc 1059 Fitc Conjugated Clq Conc 1060 Fitc Conjugated Mouse Monoclonal Anti-Human Iggl ( Fc ) 1061 Fitc Labeled Anti-Human Igg3 ( F ( Ab’ ) 2 ) 1062 Fitc Labeled Anti-Human Igg2 ( Fab ) 1063 Fitc Labeled Anti-Human Igg4 ( Pfc’ ) 1064 Fitc Labeled Rabbit Anti Mouse Igg ( Secondary Ab ) 1065 Fluorescence Mounting Medium 1066 Formaldehyde 16% Em Grade 1067 Glass Graduated Centrifuged Test Tubes 15 Ml Vol With Conical Base 1068 Gluraldehyde 25% Em Grade ( Imported Em Grade ) 1069 Humphys Knife Disposable 1070 Ifa For Differentiation Of Antibodies Against Cell Nuclei ( Ana ) Hep2 Cells 1071 Ifa Kit Against Liver Antigens Containing Hep2, Primate Liver, Rat Kidney, Rat Liver, Rat Stomach, Vsm 47-16Tests 1072 Igepal-Ca630 Sigma 1073 Immunofluorescence Kit – Mosaic Profile Three Of Multibiochips For Doing Ana ( Multibiochips Of Hep 2 Cells, Rat Stomach, Primate Liver, Rat Kidney ) 1074 Imported Diatome Diamond Knife For Ultra Thin Sectioning3.5 Mm 45 Degrees Cutting Angle For Electron Microscopy 1075 Ifa Kit For Cns Profile With 12 Antigens 1076 Ifa Kit For Git Profile With 9 Antigens 1077 Kit For Occult Blood In Stool. 1078 Lead Citrate For Em 1079 Line Immunoassay For Anca ( C&P ) And Antigbm Antibody 1080 Line Immunoassay For Detection Of Antibodies Against Neuronal Antigens Including Amphiphysin, Cv2, Pnma2, Ri, Yo, Hu, Recoverin, Sox1, Titin For Detection Of Paraneoplastic Syndromes 1081 Line Immunoassay For Detection Of Igg Antibodies Against Neuronal Antigens Gm1, Gm2, Gm3, Gd1a, Gd1b, Gt1b, Gq1b For Detection Of Inflammatory Peripheral Neuropathies 1082 Line Immunoassay For Detection Of Igm Antibodies Against Neuronal Antigens Gm1, Gm2, Gm3, Gd1a, Gd1b, Gt1b, Gq1b For Detection Of Inflammatory Peripheral Neuropathies 1083 Liver Profile-With 7 Antigens- Line Immunoassay 1084 Mgmt Antibody For Western Blot 1085 Microplate Elisa For Determination Of Autoantibodies Against Cyclic Citrullinated Peptide ( Ccp ) . Igg 1086 Microplate Elisa For Determination Of Autoantibodies Against Cyclic Citrullinated Peptide ( Ccp ) . Iga 1087 Mouse Anti Human Amyloid A Kit For Immunofluorescence On Frozen Tissues 1088 Mouse Monoclonal Anti-Human C4d Antibody Kit For Immunofluorescence On Frozen Tissues 1089 Nma For Em Processing ( Imported Em Grade ) 1090 Fecal Occult Blood Test ( Fobt ) , Preferably Beckman Coulter 1091 Osmium Tetra Oxide ( Imported Em Grade 2% Solution 1092 Poly-Bed Resin ( Epon ) ( Imported Em Grade ) 1093 Proteinase K ( Sigma P2308 ) 1094 Propylene Oxide For Electron Microscopy Imported 1095 Resin Kit For Araldite Em Embedding 1096 Resin Kit For Epon Embedding For Electron Microscopy Imported 1097 Sample Storage Box For Upto 3Ml Vials ( Suitable Up To At –190 C Freezer ( Biochrome ) 1098 Sodium Cacodylate ( Imported Em Grade ) 1099 Soluble Blue ( Methyl Blue ) ( Sigma Code M. 6900 ) C.I. 42780 1100 Ssc 1101 Sucrose ( Imported Em Grade ) 1102 Sulpho Salicylic Acid ( Sigma / Merck ) 1103 Symcollidine Buffer Ampoule ( Imported Em Grade ) 1104 Titre Plane Technology Based On A Biochip Of Primate Liver And Gliadin To Test For Anti Endomysial And Gliadin Antibodies By Indirect Immunofluorescence 1105 Titre Plane Technology Based On A Biochip To Test For Antibody Against Pla2r For Primary Glomerulonephritis By Indirect Immunofluorescence 1106 Titre Plane Technology Based On A Biochip To Test For Neuromyelitis Optica 1107 Uranyl Acetate ( Imported Em Grade ) 1108 Veronal Buffer Saline 1109 Victoria Blue Sigma - 234176 1110 Quantitative Elisa Kit For Kim1 For 96 Well With Minimum 3 Standards 1111 Quantitative Elisa Kit For Human Il-2 Opt Elisa Kit Ii For 96 Wells With Minimum 3 Standards 1112 Osmium Tetraoxide ( Crystal ) Em Grade 1 / 4 Gm Crystal 1113 Fomvar Coated Copper Grids ( Single Slot ) Em Grade 2*1Mm 1114 Flat Embedding Molds Em Grade 20 Numbered Cavities Measures: 14Mm ( L ) X5mm ( W ) X 4-6Mm ( D ) . 1115 Beem Capsule Molds Type A: 10 Cavities, 8Mm Diameter Body, 5Mm Diameter Tip, 11Mm Height, Tapered Tip. 1116 Perfect Loop For Em 1117 Grid Box For Em 1118 Cellulose Filter 0.22Ml ( 3Mm ) For Em 1119 Millipore Syringe Filter 0.22Ml ( 33Mm ) For Em 1120 Glass Knive Holder For Em 1121 Copper Grids ( 100 Mesh ) Em Grade 1122 Glass Strips For Making Glass Knives For Em 400X25x6.4Mm 1123 50% Glutaraldehyde Em Grade Glass Ampoule Of 10Ml 1124 Tris Base Sigma 648310 1125 Quantitative Elisa Kit For Alport Syndrome Kit For 96 Well With Minimum 3 Standard 1126 Fitc Labelled Anti-Eber Antibody Kit For 40 Tests 1127 New Methylene Blue For Reticulin Stain - Sigma 1128 Quenching Solution For Fish 1129 Fish Tissue Kit ( Zytovision ) 1130 Fast Hybridisation Buffer 1131 Fine Brushes For Cryostat ( No 2 ) Leica Animal Hair 1132 Cryoembedding Compound Leica / Thermo Fischer 1133 Elisa Kit For Quantitative Assessment Of Pla2r Antibodies With Minimum 3 Standards 1134 Human Complement System Screen Kit 1135 Human Terminal Complement Complex ( Tcc ) Elisa Kit ( Sc5b-9 ) 1136 Human Complement Factor D Elisa Kit 1137 Human Complement Factor H Elisa Kit 1138 Human Complement Pan-Specific C3 Reagent Kit 1139 Ba Enzyme Immunoassay Elisa Kit 1140 C4a Enzyme Immunoassay Elisa Kit 1141 C4d Enzyme Immunoassay Elisa Kit 1142 C3a Plus Eia Elisa Kit 1143 Ic3b Eia Enzyme Immunoassay Elisa Kit 1144 C5a Enzyme Immunoassay Elisa Kit 1145 Bb Enzyme Immunoassay Elisa Kit 1146 C1 Inhibitor Plus Enzyme Immunoassay Elisa Kit 1147 Ch50 Eq Eia Elisa Kit 1148 Factor H Y402h Variant Detection Elisa Kit 1149 H-Ficolin Human Elisa Kit 1150 L-Ficolin Human Elisa Kit 1151 Masp-2 Human Elisa Kit 1152 Masp-3 Human Elisa Kit 1153 Mbl Human Elisa Kit 1154 Mbl / Masp Human Elisa Kit 1155 Sp Human Elisa Kit 1156 Anti-Hcd3-Pe ( Clone Ucht1 / Or Clone Hit3a ) For Flow Cytometry 1157 Anti-Hcd4-Fitc ( Clone Tt1 ( Drfz ) Or Clone Okt4 For Flow Cytometry 1158 Anti-Hcd8-Pe For Flow Cytometry 1159 Anti-Hcd14 For Flow Cytometry 1160 Anti-Hcd19 For Flow Cytometry 1161 Anti-Hcd25 Treg For Flow Cytometry 1162 Elisa Kit To Measure Cardiolipin ( Igg ) 1163 Elisa Kit To Measure Cardiolipin ( Igm ) 1164 Elisa Kit To Measure B2 Glycoprotein ( Igg ) 1165 Elisa Kit To Measure B2 Glycoprotein ( Igm ) 1166 Elisa Kit To Measure Phosphatidylserine ( Igg ) 1167 Elisa Kit To Measure Phosphatidylserine ( Igm ) 1168 Rubeanic Acid– Sigma 1169 Sirius Red / Direct Red 80 – Sigma 365548 1170 Tris Glycine Buffer : For Western Blot ( Biorad ) 1171 Dewax & Hier Buffer Low 1172 Dewax & Hier Buffer High 1173 Op Quanto Antibody Diluent 1174 Tween 20 1175 Ultravision Quanto Detection 1176 Abx Diluent ( Horiba, Model Pentra Xlr ) 1177 Abx Basolyse ( Horiba, Model Pentra Xlr ) 1178 Abx Cleaner ( Horiba, Model Pentra Xlr ) 1179 Abx Eosinofix ( Horiba, Model Pentra Xlr ) 1180 Abx Lysebio Ii ( Horiba, Model Pentra Xlr ) 1181 Abx Difftrol ( Low, Normal, High ) ( Horiba, Model Pentra Xlr ) 1182 Abx Minoclair ( Horiba, Model Pentra Xlr ) 1183 Cell Pack ( Transasia, Model No Xt2000i ) 1184 Stromatolyser 4Dl ( Transasia, Model No Xt2000i ) 1185 Stromatolyser Fb ( Transasia, Model No Xt2000i ) 1186 Stromatolyser 4Ds ( Transasia, Model No Xt2000i ) 1187 Sulfolyser ( Transasia, Model No Xt2000i ) 1188 Cell Clean ( Transasia, Model No Xt2000i ) 1189 Ret Search Ii ( Transasia, Model No Xt2000i ) 1190 E- Check Control- Low, Normal, High ( Transasia, Model No T2000i ) 1191 Human Beta 2 Microglobulin Antiserum ( Mininephplus, Model Ad-500 ) 1192 Human C3kit ( Mininephplus, Model Ad-500 ) 1193 Human C4 Kit ( Mininephplus, Model Ad-500 ) 1194 Human Caeruloplasmin Antiserum ( Mininephplus, Model Ad-500 ) 1195 Human Iga Kit ( Mininephplus, Model Ad-500 ) 1196 Human Igg1 Kit ( Mininephplus, Model Ad-500 ) 1197 Human Igg2 Kit ( Mininephplus, Model Ad-500 ) 1198 Human Igg3 Latex Kit ( Mininephplus, Model Ad-500 ) 1199 Human Igg4 Latex Kit ( Mininephplus, Model Ad-500 ) 1200 Human Igm Kit ( Mininephplus, Model Ad-500 ) 1201 Human Microalbumin Antiserum ( Mininephplus, Model Ad-500 ) 1202 Human Prealbumin Kit ( Mininephplus, Model Ad-500 ) 1203 Human Rheumatoid Factor Latex Kit ( Mininephplus, Model Ad-500 ) 1204 Human Transferrin Antiserum ( Mininephplus, Model Ad-500 ) 1205 Reagent Accessory Pack ( Mininephplus, Model Ad-500 ) 1206 Sample Diluents Pack ( Mininephplus, Model Ad-500 ) 1207 On- Board Buffer 1208 On- Board Buffer 1209 Scs 1000 Caliberator 1210 Anti Hu ( Anna 1 ) 1211 Anti Yo ( Pca 1 ) 1212 Anti Pca 2 1213 Anti Pca Tr 1214 Anti Ri ( Anna 2 1215 Anna 3 1216 Agna-1 1217 Anti Tr 1218 Anti Cv2 / Crmp5: 1219 Anti Vgcc : 1220 Anti Aquaporin 4 1221 Anti Mog Antibody: 1222 Anti Ganglionic Acetylcholine Receptor Antibody 1223 Dopamine-2 Receptor Antibody 1224 Gaba B Receptor Antibody 1225 Anti - Gm1, Gd1b ( Igm ) : 1226 Anti - Gm2 ( Igm ) 1227 Anti - Gm1a, Gm1b Gd1a, 1228 Galnacgd1a, ( Igg ) 1229 Anti - Gq1b, Gt1a 1230 Anti - Gd3, Gd1b 1231 Anti - Gd1b And Other Disialylated 1232 Anti - Mag ( Igm ) 1233 Fish Probe Ss18 Gene 1234 Xl Ewsr1 Ba: D-6011-100-Og 1235 Pax-6 1236 Nf-H, M ( Non Phosphorylated ) 1237 Cd 133 1238 Nestin 1239 Il6 1240 Tnfx
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 16
4.
Health and Family Welfare #10400320 Price Bid
Tender For Supply Of Chemicals Kits And Glassware - Phenyl Surface Cleaner (10L) Thread Cotton for Stitching 5 Roll Liquid Hand Wash (10L) Methanol (10L) Thymol Crystal (500gm) Cedarwood (100 ml) Sodium Chloride (25kg) Eosin 5 Bottle (100ml) Hematoxylin 5 Bottle (100ml) Xylene (5 ltr) Paraffin Was (5kg) Slide Storage Box, (Plastic Box, capacity of 100 sides) Plastic Try for Reagents, (24 x 12) Spirit Lamp Brass, die pressed, with woven wick in metal holder, screw) Standard L. Mold with plate (Brass), Small (16x16x12 mm), Standard L. Mold with plate (Brass) Big. (32x25x12 mm), Standard Forceps Big Size (5 inch), Standard Base mold for embedding ring (Steel) (38x25x6mm), Standard Glass Jar with lid (Thick borosilicate glass with ground glass lid) Standard Coverslip (22x50 mm) Thickness No 1 (0.13 to 0.16 mm) Tissue Embedding Moulds (Plastics, 2 packs of 500 each) Mounting Media DPX (1,000 ml) Hematoxylin Stain (5 kg) Eosin Stain (5 kg) Acid Alcohol 1% (2L) Paraffin Wax (20 kg) (Melting point 58-62°C)/2.00 kg Alcohol Ethyl Absolute (10 L) Xylene (10 L) Isopropyl Alcohol (25 ltr) Nitric Acid (100 ml) Glass Slides (75 mm, 1.35 thickness) (50 slides per box) Diamond Pencil Coverslip (22mm) 10gm each (20 boxes of 10 gm) in single pkt. Microtome Knife Blades Stainless Steel S35 Feather Disposable Microtome Blade (50 Methanol (500 ml bottle) Benedict Reagent (500 ml) Glacial Acetic Acid (1 L) Acid Hydrochloride (2.5 Lit) Acetone (1 Lit) Plastic Tissue Cassettes 500/pack Base mold for embedding ring / Paraffin Block Holder Spirit lamp batti Color Box (Acrylic) Color Brush (Good Quality)
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 4
Madhya Pradesh View Result →
5.
Housing Urban and Rular Development #10191469 AOC
Furnishing Work Of Classrooms, Library And Laboratory, Equipments And Miscellaneous Work For The New University Campus Of Binod Bihari Mahato Koyalanchal University, Dhanbad- 1 Supplying Metal Exhaust Fan 300 mm Sweep-Supplying, erecting and testing of approved make 300 mm sweep Exhaust Fan heavy duty with mounting frame, blades AC 230-250 complete connection and including frame bolt/ Anchor hole fastners etc, complete finished of a as required. 2 Wall Demolition- Dismantling pucca brick or lime work including stacking serviceable materials in countable stacks within 15M. Lead and disposal of unserviceable materials with all leads all complete as per direction of E/I. 3 Taking down chaukhats in windows including stacking serviceable materials within 15M,. Lead and disposal of unserviceable materials with all leads all complete as per direction of E/I. 4 Taking down chaukhats in doors including stacking serviceable materials within 15M,. Lead and disposal of unserviceable materials with all leads all complete as per direction of E/I. 5 Taking sown chaukhats in windows including stacking serviceable materials within 15M,. Lead and disposal of unserviceable materials with all leads all complete as per direction of E/I. 6 Supplying, fitting and fixing 35mm thick solid core type decorative single leaf flush door shutter with both sides decorative veneered with black board core bended with high quality phenol formal dehydes synthetic resine of standard make with Aluminium fittings such as hinges, towerbolts, handle, cleat and sand blocks and taxes all complete as per building specification and direction of E/I. 7 Door Frame- Providing and fixing pressed steel door frames conforming to IS: 4351, manufactured from commercial mild steel sheet of 1.60 mm thickness, including hinges, jamb, lock jamb, bead and if required angle threshold of mild steel angle of section 50x25 mm, or base ties of 1.60 mm, pressed mild steel welded or rigidly fixed together by mechanical means, including M.S. pressed butt hinges 2.5 mm thick with mortar guards, lock strike-plate and shock absorbers as specified and applying a coat of approved steel primer after pre-treatment of the surface as directed by Engineer-in-charge. Profile C - Fixing with adjustable lugs with split end tail to each jamb 8 Providing designation 125 mm thick reinforced designation 75A brick work in CM (1:4) in superstructure with approved quality of clean coarse sand of F.M. 2 to 25 including the cost of screening, carriage of materials, scaffolding , raking out joints to 15mm depth, curing, taxes and royalty (but excluding the cost of reinforcement) all complete as per building specification and direction of E/I. 9 Extra for providing and placing in position 2 Nos 6mm dia. M.S. barsat every third course of half brick masonry. 10 Providing 12mm cement plaster (1:6) with clean coarse sand of F.M. 1.5 including screening, curing with all leads and lifts of water, scaffolding taxes and royalty all complete as per building specification and direction of E/I. 11 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 12 Providing two coats of plastic emulsion paint of approved shade and make over a coat of cement primer over new surface including preparing plastered surface by rubbing smooth with pumice stone or fine sand paper, applying putty wherever required, scaffolding washing of floor and taxes all complete as per building specification and direction of E/I. 13 Providing and fixing 18 mm thick gang saw cut, mirror polished, premoulded and prepolished, machine cut for kitchen platforms, vanity counters, window sills, facias and similar locations of required size,approved shade, colour and texture laid over 20 mm thick base cement mortar 1:4 (1 cement : 4 coarse sand), joints treated with white cement,mixed with matching pigment, epoxy touch ups, including rubbing, curing,moulding and polishing to edges to give high gloss finish etc. complete at all levels.-Granite stone slab colour black, Cherry/Ruby red-Area of slab over 0.50 sqm 14 Sink- Supplying fitting and fixing white glazed fires clay sink of approved make with overflow arrangements supported on C.I. Or R.S. Painted bracket 40mm. Dia C.P. Brass waste with C.P. Brass chain and rubber plug 40mm dia P.V.C. Waste pipe about 750mm long with brass coupling at one endand 15mm C.I. body brass spindle bib cock of approved quality of weight not less than 450grams including cutting wall and making good the same etc. all complete as per specification and direction of E/I. Size-600 mm x 450 mm x 250 mm ) 15 FULL HEIGHT WOODEN PARTITION WITH PARTLY GLAZING- Providing and fixing partitions made of 50 mm x 50 mm pine wood / 2nd class teak wood @ 600 mm c/c both ways with the help of Fasteners/Screws etc. to achieve desired strength. Providing & fixing Comm. grade 12 mm thick commercial Pty board on the frame on both the faces i/c exposed side edges of Frame & 1.0mm thk Laminate on both outer faces and exposed side edges of ply as per the directions. Partition shall also be provided with 8 mm thick clear float glass of approved size with Polished Edges of approved brands in Wooden Partition Openings as required, fixed from all four sides from both ways inside partition openings with 10mm.tk. T.W. beadings/12 mm thick MDF Board Lipping/D-Buttons of design as per approval and direction at site. Etching / Etching Film (50 Microns) is to be provided as per approved pattern on 8 mm thick clear float glass. All wooden exposed surfaces shall be melamine polished in approved shade and texture finished as per the directions and satisfaction of Engineer In charge, compelete.This work will 16 Frosted glass sheet of nominal thickness 4 mm- Providing and pasting frosted film on glass work including all materials tools, plants and labour complete as per the directions of the Engineer-in-charge. 17 Supply & laying of PVC insulated and sheathed 1.1 kv grade twin twisted 1.5 sqmm cu flexible wire for speaker. 18 Providing & installation 1.5 Tr. 5 Star split A.C (Inverter Type) I91391-part-1 19 Copper refregerant pipe-Providing & installation Copper Tube of size 5/8 for split ac unit 1/1.5/2/3 tr capacity including nitride rubber insulation 20 Providing & installation 5 KVA wall mounted automatic voltage stablizer from range 140 V to 280V 21 Providing & installation Drain Pipe for AC 22 Non Schedule 23 * PROVIDING AND SUPPLYING MODERN DESIGN RECEPTION DESK IN ENGINEERED WOOD MAKE THE PRODUCTS UTILE AND A DELIGHT.TIMELESS DESIGN THAT ELEVATES YOUR OFFICE SPACE STRUCTURE OF SPACIOUS RECEPTION DESK,TABLETOP OFFERS YOU A GENEROUS LOOK FOR WORK SURFACE USE PREMIUM QUALITY MATERIALS OVER ALL SIZE IS 1800 MM(L)X 600 MM(D)X 750 MM(H) WHICH GIVE MORE SURFACE AREA FOR WORK ,TABLE TOP MADE OF25MM THICK ALSO TABLE TOP BASED ON SIDE PANELS MADE 18MM THICK PRELAMINATED PARTICLE BOARD OF GRADE II TYPE III OF IS 12823/LATEST. * COMBINATION CONSTRUCTION OF RECEPTION DESK ABOVE TABLE TOP 18 MM THICK COUNTER TOP TO TABLE TOP HEIGHT IS @ 300MM ,OVERALL RECEPTION DESK HEIGHT IS @ 1050MM WITH COUNTER TOP,TABLE TOP MADE 25 MM THICK PRELAM PARTICLE BOARD WORK SURFACE WITH THE EXPOSED EDGES SHALL BE FINISHED WITH 2MM THICK PVC EDGE BINDING TAPE OF MATCHING COLOUR AND SHADE FIXED WITH HOT MELT GLUE.ALONG WITH 18MM THK ADDITIONAL MODESTY PANEL SIZE IS 1350 MM (L) X 700 MM (H) MADE BY EXCLUSIVE FROSTY WHITE COLOUR WITH EPIC DESIGN & LOOK.1 MOBILEPEDESTAL (2 DRAWERS + 1 FILING CABINET )SIZE IS 450 MM(L)X 450 MM(D)X 725 MM(H) IN PROVIDED WITH CENTRAL LOCKS FOR SECURITY AND HANDLES ARE PROVIDED FOR EASY OF OPENING & PEDESTALS MOVE ON NYLON CASTORS. * THREE LAYER PRELAMINATED PARTICLES BOARD(WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823/LATEST 24 PROVIDING AND SUPPLYING * MEDIUM BACK 360° DEGRE REVOLVING CHAIR * ALL OVER SIZE IS : 580MM(L)X 670MM(D)X1110MM(H) ,*THE CHAIR MADE OF FULL UPHOLSTERY IN BLACK COLOUR .IT WILL COMES IN MATTE FINSIH IN CONTEMPORARY STYLE .DETAILS :* ARMS : AMREST IS HAVING TWO ADJUSTMENT HEIGHTS (UP & DOWN) .* USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT AND BACK) .* SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK : 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK . BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORT* MECHANISM : SINGLE LOCKING MECHANISM. SEAT MAXIMUM HEIGHT IS 580MM & MINIMUM HEIGHT IS 480MM & BACK HEIGHT FROM FLOOR MAXIMUM HEIGHT IS 1110MM & MINIMUM HEIGHT IS1010MM* GAS LIFT 100 MM TELESCOPIC HAUDRAULIC * BASE : 650MM NYLON BASE WITH SMOOTH CASTORS . 25 PROVIDING AND SUPPLYING 3 Seater Public Place Seating Chair of mildsteel with arm and backrest WITHOUT CUSHION,THREE SEATERTYPE WAITING AREA CHAIR - MATERIAL : STAINLESS STEEL SIZE 1820MM(L)X 690MM(D)X 790MM(H) COLOUR : SILVER/WEIGTH OF PRODUCT : 34 KG APPROX,* SUPPLYING AND PLACING IN POSITION OF A STAINLESS STEEL VISITOR BENCH OF SIZE IS 1820MM(L)X 690MM(D)X 790MM(H). THE COMPLETE STAINLESS STEEL BENCH HAS SEAT & BACK SINGLE SECTION. PER SEAT LENGTH IS @ 520 MM &SEATING HEIGHT IS @ 430 MM FROM GROUND . OWING TO THE SMOOTH FINISH, DURABILITY AND TENSILE STRENGTH BEAM STAINLESS STEEL MADE BY 1.6MM THICK.SEAT IS MADE BY 1.2MM THICK STAINLESS STEEL BORDER WITH CHROME PLATING FOR EVERY SEAT & BACK ; STAINLESS STEEL HANDLES CHROME PLATED & DIE PRESSED LEGS AT THE END OF CHAIRS.GROSS WEIGHT OF REGULAR 3-SEATER WILL BE 34 KG.THE STEEL GRADE 202 HIGH YIELD STRENGTH AS PER IS:513 & IS:304 GRADE. 26 Supplying of Portrait/Landscape Not applicable Fabric Pin Up Notice Boards(Fabric Pin Up Notice Boards 3 X 6 FT GREEN),Specification-Width of Board in mm:900 mm,Colour(Front/ Display layer):Green,Height of Board in mm:1800mm,Rear panel material of Board:Laminated sheet,Overall pinability depth ofBoard in mm:9 millimeter,Core material thickness inmm:9 millimeter 27 PROVIDING AND SUPPLYING COLLEGE DESK TOMKINS MATERIAL : PRELAMINATED PARTICLE BOARD WITH M.S BASE UNIT SIZE : 590 MM(L) X 1090 MM(D) X 830 MM(H) PER SEAT SIZE- 590 MM X 375 MM X 450 MM/ONE SEATER DESK SIZE :1090 MM(L) X830 MM(H) COLOUR : AVAILABLE ON REQUEST/FINISH : EPOXY POLYESTER ,* PROVIDING & SUPPLYING TWO SEATER COLLEGE DESK TOMKINS COMBINATION OF THREE ROWS FIRST , MIDDLE AND LAST SCRATCHPROOF EASY WIPE TOP / DURABLE ,STRONG & SAFE,UNDERSTRACTURE MADE OF MAIN FRAME MDE OF CRCA POWDER COATED IS GRAD:304 M.S BLACK POWDER COATED TO THE THICKNESS 50-60 MICRONS(+/-5 MICRON) EPOXY POLYESTER COATING.* TABLE TOP & MODESTY PANNEL MADE IN 18MM THICK PRELAMINATED PARTICAL BOARD OF GRADE II TYPE III OF IS 12823/LATEST WITH MACHINE PRESSED EXPOSED EDGES SHALL BE FINISHED WITH 2MM THICK EDGE BINDING TAPE OF MATCHING COLOUR AND SHADE FIXEDDULY PASTED WITH THE ASSISTANCE OF EDGE BANDING MACHINE AT 200 DEGREE CELSIUS.CHAIR WITH GAS LIFT ,A). BACK FRAME: 1.2MM COLD ROLLED STEEL/B). BACK BOARD: 10MM PLYWOOD, NO CUSHION C). SEAT BOARD: 15MM PLYWOOD, NO CUSHION/D). TIP-UP SYSTEM: SPRING MECHANISM E). 2. LEG: COLD-ROLLED STEEL, FIXING ON THE FLOOR BY SCREWS, 80 X 35 X 1.5MM THICK OVAL TUBE, BLACK POWDER SPRAYING.* THREE LAYER PRELAMINATED PARTICLES BOARD ( WOOD PRODUCT ) OF GRADE II TYPE III OF IS 12823/LATEST 28 Supplying of Material & Subtype Engineered Wood Table Top Material Engineered Wood Finish Matte Colour & Colour Family Brown - Classic Walnut Dimension (W)550mm X (D)550mm X (H)1200mm Size Compact Assembly Type Knock Down (Obelisk), 29 Suppling of Writing Board ( 4x10 Non-Magnetic) of material Top Surface materials (Used for white boardsurface)-Porcelain,Top surface material thickness -0.7 mm to 0.8 mm,Frame material -Anodized extruded aluminum alloy hollow section conforming to IS 733 (With latest amendment),Frame wall thickness-1.2 mm,Frame section front -20 mm,Frame section side -16 mm,Core material-MDF board grade-I conforming to IS 12406 (with latest amendment),Core material thickness -9 mm as per Department incharge 30 Supplying of 14 SEATER U -* PROVIDING & SUPPLYING U - SHAPE MODERN DESIGN CONFERENCE TABLE & IN BETWEEN U SHAPE TABLE TOP LENGTH IS @ 8850 MM, TABLETOP OFFERS YOU A GENEROUS WORKSPACE,DESK PRIMARY WORK SURFACE USE PREMIUM QUALITY MATERIALS OVER ALL SIZE IS 8850 MM(L)X 600MM(D)X 750MM(H) TABLE TOP MADE OF 36MM THICK WHICH GIVE MORE SURFACE AREA FOR WORK ,MACHINE MADE MODULAR FURNITURE MADE PRELAMINATED PARTICLE BOARD OF GRADE II TYPE III OF IS 12823/LATEST, * CONSTRUCTION PROVISION OF CONFERENCE TABLETOP SUPPORTED WITH 18MM THICK SIDE PANNELS IN BROWN-BLACK OAK COLOUR MADE BY PRELAMINATED PARTICLE BOARD AND BELOW THE TOP 18MM THICK PRELAM PARTICLE BOARD MODESTY PANEL.OUR WORK SURFACE FURNITURE IS FINISHED WITH EXPOSED EDGES SHALL BE FINISHED WITH 2MM THICK EDGE BINDING TAPE OF MATCHING COLOUR AND SHADE,FIXED WITH HOT MELT GLUE. * THREE LAYER PRELAMINATED PARTICLES BOARD(WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823/LATEST, 31 Supplying of * HIGH BACK 360° DEGRE REVOLVING CHAIR SKU : MARVEL/HB/ECO ,* ALL OVER SIZE IS : 595MM(L)X 670MM(D)X1380MM(H) ,*THE CHAIR MADE OF FULL MESH IN BLACK COLOUR .IT WILL COMES IN MATTE FINSIH ABOUT STYLE TYPE IS MODREN.DETAILS :* * ARMS : FIXED PP ARMSREST .* USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT).* SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK :FRAME OF DESIGN SHALLBE CURVEDMADE OF TWO PIECES INJECTION MOULDED FRAME COVER WITH MESH .BACKREST SUPPORTADJUSTABLE LUMBAR SUPPORT* MECHANISM : SINGLE LOCKING MECHANISM . * ONLY SEAT SIZE IS 670MM(L)X 595MM(D)X470-570MM(H) , SEAT MAXIMUM HEIGHT IS 570MM & MINIMUM HEIGHT IS 470MM & BACK MAX HEIGHT IS @ 1380MM .* GAS LIFT 100 MM TELESCOPIC HAUDRAULIC * BASE : NYLON BASE IS 620MM PITCH CENTER DIA (660MM WITH CASTORS) . 32 Supplying ofMEDIUM BACK 360° DEGRE REVOLVING CHAIR * ALL OVER SIZE IS : 595MM(L)X 670MM(D)X1125MM(H) ,*THE CHAIR MADE OF FULL MESH IN BLACK COLOUR .IT WILL COMES IN MATTE FINSIH ABOUT STYLE TYPE IS MODREN.DETAILS :* * ARMS : FIXED PP ARMSREST .* USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT).* SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK :FRAME OF DESIGN SHALLBE CURVEDMADE OF TWO PIECES INJECTION MOULDED FRAME COVER WITH MESH .BACKREST SUPPORTADJUSTABLE LUMBAR SUPPORT* MECHANISM : SINGLE LOCKING MECHANISM .* ONLY SEAT SIZE IS 670MM(L)X 595MM(D)X470-570MM(H) ,SEAT MAXIMUM HEIGHT IS 570MM & MINIMUM HEIGHT IS 470MM & BACK MAX HEIGHT IS @ 1125MM .* GAS LIFT 100 MM TELESCOPIC HAUDRAULIC * BASE : NYLON BASE IS 620MM PITCH CENTER DIA (660MM WITH CASTORS) . 33 Supplying of Tte Mild Steel Pipe of diameter 19 mm and wall thickness 16gauge. Classroom Chairs, tte,Thickness-2mm to 45mm,Material-Mild Steel Weight-Depends upon the size,Outside Diameter-0.80 Inch to 36 Inch 34 Supplying of 1-Bay Sprocket Chain Drive Mechanism MobileStorage Compactors,Material-Mild Steel Product Type-1 Bay,Height -7 ft,Storage Capacity-50-80 kg Usage/Application office, Home, Hospital, Store Room, Warehouse 35 Supplying of -- Movable File StorageSystem (Compactor) 1-Bay Mechnized Drive Type(COMPACTOR 2 ( 04 BODY)) 36 Supplying of Methodex MS1-6MCMETHODEX(Methodex MS1-6MC),Accutec Mobile Storage System,Material SS,Usage/Application-Warehouse Height-8-10 Feet,No of Layers-5 37 Supplying of : METAL STORAGE OF SIZE 900MM(L)X 450MM(D)X 1980MM(H) BODY MADE OUT IN 22 GAGUE(0.8MM) & DOOR 19 GAGUE(1 MM) CRCA SHEET. 4 ADJUSTABLE SHELVE IN 22 GAGUE(0.8MM) & PEDESTAL 18 GAGUE 1.2 MM CRCA SHEET. HAVING FOUR SHELVES MAKING FIVE COMPARTMENT, UNIFORMLY DISTRIBUTED LOAD CAPACITY OF EACH SHELF SHALL BE 60 KG MAXIMUM,FITTED WITH MS BODY LOCK & HANDLE. FINISHING WITH EPOXY POLYESTER POWDER COATED TO THE THICKNESS 50-60 MICRONS(+/-5 MICRON)IN COLOR GREY-LIGHT GREY. 38 Supplying of : PREMIUM SUITESDIRECTOR TABLE STRUCTURE OF L-SHAPED DESK . PRIMARY WORK SURFACE OVER ALL SIZE IS 2400MM(L)X 2330MM(D)X 770MM(H) 45MM THICK TABLE TOP MADE OF PRELAMINATED PARTICLE BOARD WORK SURFACE WITH RICH CHERRY FINISH SAME MATCHING EDGE BANDING MADE OF SAME RED CHERRY P.U POLISH.MODESTY IS DESIGNED WITH LEATHER PATCH.SIDE PANNEL IS MADE OF 36MM THICK . * PROVISION OF SIDE UNIT OF SIZE IS 1200MM(L)X 595MM(D)X 770MM(H) ,(COMBINATION CONSTRUCTION ON TABLE TOP WIRE MANAGEMENT 2 HOLE WITH SS GROOMENT & 1 HOLE WITH PVC GROOMENT ON TOP SIDE UNIT. BELOW TABLE TOP ONE KEYBOARD TRAY,IN SIDE UNIT BELOW THE TOP 1 KEY BOARD TRAY,1 OPEN BOX FILE ,1 DRAWER + 1 OPEANABLE DOOR SHELVE. * FIXED PEDESTAL OF SIZE450MM(L)X 400MM(D)X 690MM(H) , HAVING 3 EQUAL DRAWERS IN PROVIDED WITH CETNRAL LOCK FOR SECURITY AND HANDLES ARE PROVIDED FOR EASY OF OPENING. OVERALL CONSTRUCTION OF PEDESTAL IS 18 MM ALONG WITH FECIA OF DRAWERS. * ALL THE MDF BORAD ARE IS-14587-1998 WITH CONFIRM TO DIN 68861.ISO 9001- 2015 QUALITY CERTIFICATION CONFIRMING TO ASTM D 4499 STANDARDS FOR VISCOSITY AND THERMAL STABILITY . 39 Supplying of* HIGH BACK 360° DEGRE REVOLVING CHAIR * ALL OVER SIZE IS : 590MM(L)X 505MM(D)X1280MM(H) , *THE CHAIR MADE OF FULL LEATHERETTE IN BLACK COLOUR . IT WILL COMES IN MATTE BLACK FINISH FINSIH IN CONTEMPORARY STYLE . DETAILS :* ARMS :CHROMEFINISH ARMS WITH PU PADDING . * USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT AND BACK) . * SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK : 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK . BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORT * MECHANISM : KNEE TILT MECHANISM . * ONLY SEAT SIZE IS 505MM(L)X 505MM(D)X610MM(H) & THE BACK SIZE IS 590MM(L)X 710MM(H) SEAT MAXIMUM HEIGHT IS 610MM & MINIMUM HEIGHT IS 510MM & BACK HEIGHT FROM FLOOR MAXIMUM HEIGHT IS 1280MM & MINIMUM HEIGHT IS1180MM * GAS LIFT 100 MM TELESCOPIC HAUDRAULIC * BASE : 650 MM CHROME BASE WITH SMOOTH CASTORS . 40 Supplying of* FIX CANTILEVER CHAIR * ALL OVER SIZE IS : 570MM(L)X 500MM(D)X940MM(H) , *THE CHAIR MADE OF FULL LEATHERETTE IN BLACK COLOUR . IT WILL COMES IN MATTE FINSIH IN CONTEMPORARY STYLE . DETAILS : * ARMS : PADDED ARMREST. * USE OF PLY: SEAT & BACK PLYWOOD MADE OF 12 MM HOT PRESSED. * SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK : 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK . BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORT * ONLY SEAT SIZE IS 570MM(L)X 500MM(D)X475MM(H) SEAT HEIGHT IS @ 940MM & BACK HEIGHT IS @ 475MM . * FIXED CANTILEVER CHAIR . * BASE : CHROME FINISH TUBLAR FRAME OF CANTILEVER TYPE . 41 * SUPPLYING AND PLACING FIVE SEATER (3+1+1) EXCLUSIVE PREMIUM LEATHERETTE MODERNIST CLASSIC DESIGN LOUNGE SEATING SOFA SIZE IS 3 SEATER- 1905MM(L) X890MM(D)X 870MM(H)SOFA SIZE IS 1 SEATER -(W)960mm X (D)890mm X (H)870mm ,WITH KILN-DRIED WOOD FRAMING MAKES IT WARP AND SCRATCH RESISTANT,COMFORTABLE SEAT DEPTH & HEIGHT DESIGNED KEEPING MODERN INDIAN LIFESTYLE IN MIND,WRAPPED IN BUTTERY-SOFT PREMIUM LEATHERETTE, THE PANELLED BACK AND CUSHIONED ARMRESTS ENCOURAGE LOUNGING,DESIGNED WITH MODERNITY & ELEGANCE, CHOOSE THE OPTION THAT SUITS YOUR HOME. * COMBINATION CONSTRUCTION STRUCTURE ARE MADE INMOISTURE CONTENT SHALL BE LESS THAN (10-12)%. THICKNESS OF PLYWOOD USED (MM) SHALL BE 12 MM GRADE IS 303 INDIAN STANDARD FOR COMMERCIAL (COMMON) AND MOISTURE PROOF PLYWOOD (TENTATIVE).UNDERSTRUCTURE FRAME SHALL BE CONSTRUCTED FROM 18 MM THICK KILN-DRIED GERMAN BEECH WOOD FRAMING IS HIGHLY DURABLE. THE COMPLETE STRUCTURE SHALL BE COVERED BY P.U.FOAM FIXED WITH ADHESIVE GLUE ,THE FRAME SHALL BE PADDED WITH HIGH RESILIENCE POLYURETHANE FOAM HAVING 28 +/- 5 DENSITY IN SEAT IT SHALL BE STACK FOAM OF 50MM THIK,40MM THICK BACK FOAM HAVING 20 +/- 5 DENSITY FOAM USED ,THERE SHALL BE CUSHION ARM 40MM THICK PROVIDED PADDED WITH HIGH RESILIENCE POLYURETHANE FOAM HAVING DENSITY 20 +/- 5. THE COMPLETE STACK FOAM STRUCTURE SHALL BE COVERED WITH PREMIUM LEATHERETTE IN BLACK-EERIE BLACK-COFFEE BROWN,BROWN-BURNT UMBER COLOUR, IT COMPLEMENTS THE MODISH LEGS ARE MADE BY ROUND SHAPE IN PVC MATERIAL. 42 Supplying of Material & Subtype Solid Wood - Beech Wood Table Top Material Clear Glass,Frame Material Solid Wood Leg Material Solid Wood,Finish Matte Colour & Colour Family Brown - Walnut,Dimension (W)1130mm X (D)630mm X (H)410mm,Number Of Recliners 1 Number Of Reclining Positions 3,Size Standard (HOPPER/CT), 43 Supplying of6 SEATER Rectangular MEETING TABLE DURIAN MODEL SMART/CON/6FT MADE OF PRELAMINATED PARTICLE BOARD WITHSLANTLEGS50X50 MM MS UNDERSTRUCTURE IN POWDER COATING 2TOP MADE OF25MMTHICK PRELAMINATED PARTICLE BOARD IN FROSTY WHITE COLOR WITH MAIN TABLE SIZE1800MM(L)X 1050MM(D)X 750MM(H) (SMART/CON/6FT/A), 44 SUPPLYING & PROVIDING CAFETERIA CHAIR SIZE IS 381MM(L)X 419MM(D)X839MM(H) A COMBINATION OF SYNTHETIC FIBER WITH STAINLESS STEEL MAKE THE PRODUCTS UTILE AND A DELIGHT, THE COMPLETE STRUCTURE SHALL BE MADE UP OF 20% GLASS FILLED BLOW MOLDED HIGH-DENSITY POLYETHYLENE ANDIS,THE FRAME STRUCTURE SHALL BE SUPPORTED BY ( 2 STRAIGHT + 2 SLANT ) FOUR LEGS.THE TUBULAR WELDED FRAME IS MADE FROM DIA2.22 +/- 0.03CMX 0.12+/- 0.0128 CM AND 3.5+/- 0.03 CM X 0.12+/- 0.0128 AM STAINLESS STEEL 202 GRADE TUBE & THE TUBE ARE BUFF POLISHED TO GIVE SHINY FINISH.SEAT AND IN BACK GIVEN HANDLE TO HOLDARE MADE OF INJECTION MOULDED HIGH IMPACT STRENGTH POLYPROPYLENE POLYMER COMPOUND WITH INDOOR GRADE UV RESISTANCE AND PRESSED FITTED WITH LEGS.THE CHAIR IS EASY TO STORE WHEN NOT IN USE, SINCE YOU CAN STACK UP TO 6 CHAIRS ON TOP OF EACH OTHER. (COCO/SUR). 45 SUPPLING OF METAL STORAGE OF SIZE 900MM(L)X 450MM(D)X 1830MM(H) BODY MADE OUT IN 22 GAGUE(0.8MM) & DOOR 19 GAGUE(1 MM) CRCA SHEET. 4 ADJUSTABLE SHELVE IN 22 GAGUE(0.8MM) & PEDESTAL 18 GAGUE 1.2 MM CRCA SHEET.HAVING FOUR SHELVES MAKING FIVE COMPARTMENT, FITTED WITH MS BODY LOCK & HANDLE. WITH 2 NUMBERS OF GLASS DOOR SHUTTERS , THE GLASS USED SHALL BE 4MM THICK CLEAR. UNIFORMLY DISTRIBUTED LOAD CAPACITY OF EACH SHELF SHALL BE 30 KG MAXIMUM.EACHRACKSHALLBEPROVIDEDWITHSTIFFENERATBOTTOMFOR STRENGTH.THE ENTIREBODYPANELAND SHELF SHALLBEMADEOF HIGHYIELD STRENGTH,THE COMPLETE STEEL STRUCTURE SHALL BE CONSTRUCTED BY WELDING AND PROVIDE FINISHING WITH EPOXY POLYESTER POWDER COATED TO THE THICKNESS 50-60 MICRONS(+/-5 MICRON)IN COLOR GREY-LIGHT GREY 46 SUPPLING OF DIRECTOR DESKDIRECTOR TABLE STRUCTURE OF L SHAPED DESK .PRIMARY WORK SURFACE OVER ALL SIZE IS 1500MM(L)X 750MM(D)X 750MM(H) 36MM THICK TABLE TOP MADE OF PRELAMINATED PARTICLE BOARD WORK SURFACE WITHWENGE FINISH, USING HOT MELT GLUE TO FIXING 2MM THICK PVC EDGE BANDING MADE OF SAME MATTE FINISH. SIDE PANNEL IS MADE OF 25MM THICK.*PROVISION OF SIDE RUNNER OF SIZE IS 750MM(L)X 450MM(D)X 760MM(H) ,( CONSTRUCTION IS FROM RIGHT SIDE OF SIDE UNIT TOP BASED ON FIXED PEDESTAL WITH SS STUD OF GRADE 304, ON TABLE TOP PVC GROMENT HOLEFOR WIRE MANAGEMENT .*FIXED PEDESTAL OF SIZE450MM(L)X 450MM(D)X 650MM(H) PER DRAWER HEIGHT IS @ 136MM, FILLING DRAWER HEIGHT IS @ 300MM HAVING (2 EQUAL DRAWERS + 1 FILLING DRAWER) IN PROVIDED WITH CETNRAL LOCK FOR SECURITY AND HANDLES ARE PROVIDED FOR EASY OF OPENING.OVERALL CONSTRUCTION OF PEDESTAL IS 18 MM ALONG WITH FECIA OF DRAWERS. *THREE LAYER PRELAMINATED PARTICLES BOARD(WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823/LATEST , 47 SUPPLING OF* CANTILEVER CHAIR SKU : 70011/CN/A, * ALL OVER SIZE IS : 590MM(L)X 490MM(D)X980MM(H) , *THE CHAIR MADE OF FULL FABRIC INBLACK COLOUR . IT WILL COMES INFINSIH IN CONTEMPORARY STYLE . DETAILS :* ARMS : FIXED ARMS P.P. CONNECTED WITH SEAT AND BACK .* USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT AND BACK) .* SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32(±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK : 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK . BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORT* BASE : M.S POWDER COATED TUBLAR FRAME OF CATILEVER TYPE . THE SELLER / COMPANY SHOULD BE ISO 9001:2015, ISO 50001:2018, ISO 14001:2015, ISO 45001:2018 CERTIFICATES OF THE MANUFACTURER CERTIFIED BY NATIONAL ACCREDITATION BOARD OF CERTIFYING BODIES, IGBC, SEDEX, GREEN PRO, AIOTA, INDIAN DESIGN MARK, FSC CERTIFICATE. 48 SUPPLING OF OFFICE DESKDESK STRUCTURE OF L SHAPED DESK . PRIMARY WORK SURFACE OVER ALL SIZE IS 1500MM(L)X 600MM(D)X 750MM(H) 25MM THICK TABLE TOP MADE OF PRELAMINATED PARTICLE BOARD WORK SURFACE WITH THE EXPOSED EDGES SHALL BE FINISHED WITH 2MM THICK EDGE BINDING TAPE OF MATCHING COLOUR AND SHADE WITH THE HOT MELT GLUE . MODESTY PANNEL 18MADE OF MM THICK . *PROVISION OF SIDE UNIT OF SIZE IS 900MM(L)X 450MM(D)X 750MM(H) ,(COMBINATION CONSTRUCTION WIRE MANAGEMENT HOLE WITH PVC GROOMENT ON TABLE TOP, LEFT SIDE TABLE TOP BASED ON A 18MM THICK SIDE PANNEL ENGINEERED WOOD & FROM RIGHT SIDE UNIT HAVE 2 SLIDING DOOR + 1 FIXED SHELVE . *SIDE UNIT SIZE900MM(L)X 450MM(D)X 750MM(H), IN PROVIDED WITH LOCK FOR SECURITY AND HANDLES ARE PROVIDED FOR EASY OF OPENING. OVERALL CONSTRUCTION OF SIDE UNIT IS 18MM THICK ALONG WITH FECIA OF SLIDDING SHUTTERS. *THREE LAYER PRELAMINATED PARTICLES BOARD(WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823/LATEST . 49 SUPPLING OF * FIX CANTILEVER ,* ALL OVER SIZE IS : 595MM(L)X 510MM(D)X875MM(H) ,*THE CHAIR MADE OF FULL LEATHERETTE IN BLACK COLOUR .IT WILL COMES IN MATTE FINSIH IN CONTEMPORARY STYLE .DETAILS :* ARMS : PADDED ARMREST.* USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT AND BACK) .* SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK : 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK . BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORT* ONLY SEAT SIZE IS 500MM(L)X 510MM(D)X455 MM(H) & THE BACK SIZE IS 440MM(L)X 595MM(H) , BACK HEIGHT IS @ 440MM .* BASE : 4 LEGS METAL POWDER COATED* THE SELLER / COMPANY SHOULD BE ISO 9001:2015, ISO 50001:2018, ISO 14001:2015, ISO 45001:2018 CERTIFICATES OF THE MANUFACTURER CERTIFIED BY NATIONAL ACCREDITATION BOARD OF CERTIFYING BODIES, IGBC, SEDEX, GREEN PRO, AIOTA, INDIAN DESIGN MARK, FSC CERTIFICATE. THE BIDDER SHOULD BE A MEMBER OF BIFMA AND AT LEAST TWO PRODUCTS OF THE OEM SHOULD BE CERTIFIED AS BIFMA COMPLIANT AND AN OFFICIAL PRODUCT OFFICIAL LINK/SCREENSHOT OF THE PRODUCT LISTING MUST BE PROVIDED FROM WWW.BIFMA.ORG WARRANTY-5 YEARS MAKE-DURIAN /GODREJ/FEATHERLITE 50 * PROVIDING AND SUPPLYING PENTA WORKSTATIONLSHAPE SINGLE SEATER UNIT NON SHARING IN COMPLETELY KNOCK DOWN CONDITIONS WITH AN OVERALL SIZE 1500MM(L)X 600MM(D)X 1200MM(H) THAT IS TO BE ASSEMBLED AT SITE. THE WORKTOPSHALLHAVETHESIZE1490MM-1490MM (L) x 592(D) MADEUPOF25MMTHICKPRE- LAMINATED PARTICLE BOARD OF GRADE II TYPE III OF IS 12823/LATEST . OF IS LEVEL WITH APPROVED LAMINATE AND FINISH AS PER APPROVED SHADE. * THE PROFILE OF THE TOP SHALL BE IN RECTANGLE SHAPE AND THE EDGES SHALL BE SEALEDWITH 2MM THICK THIN STRIP OF IMPERMEABLEPVCTHAT IS CUT TO FIT THE SIZE OF BOARD PANEL AND DULY PASTED WITH THE ASSISTANCE OF EDGE BANDING MACHINE AT 200 DEGREE CELSIUS. * THE TOP TRIM, TOP BAR, MID BAR, VERTICAL BAR, RACEWAY, SKIRTING SHALL BE MADE UP OF ALUMINIUM EXTRUSIONS (PRE-TREATED)AND DULY POWDER COATED WITH POLYESTER POWDER COATING 40P-60PTHICK . THE TRIMS SHALL HAVE THE SIZE 67MM X 19MM WITH 1.5MMTHICKCOVERED WITH DIE CAST END CAPS ON JOINTS 2 WAYS,3 WAYS& 4 WAYS(L-COVERFORCORNER,T-COVERFORMIDDLESECTIONWHEREVER REQUIRED).THEALUMINIUMRACEWAYSHALLBESITUATEDBELOWTHEWORKTOPWITHAN OVERALLSIZE149MM(H)X60MM(D)WITH1.4MMCOVERTHICKNESSAND2MMBACK THICKNESS AS PER REQUIREMENT OF INLAYING THE ELECTRICAL MANAGEMENT AND CARRYING THE WIRE HORIZONTALLY. *THE EXPOSED VERTICAL AND HORIZONTALFACES OF THE FRAMES SHALL BE SNAPFITTEDWITHTRIMS.THERESHALLBESOFT-BOARD(WITHFABRIC)ANDMARKERBOARD PROVIDED AT FRONT OF THE USER. LAMINATED TOP TILE AND BOTTOM TILE SHALL BE SITUATED AT BOTH SIDES OF THE USER AND BELOW THE WORK TOP RESPECTIVELY. THE PARTITION SHALL HAVE CONCEALED WIRE MANAGEMENT CAPABILITIES AND SHOULD BE ENGAGED FOR RESPONSIVE AND SAFE OPERATIONSOF POWER,TELECOMMUNICATIONSANDDATA(LAN)AND HASSEPARATE COMPONENTS FOR ELECTRICAL, DATA AND TELEPHONE CABLES HAVING ADEQUATE CAPABILITY OF BOTH THE VERTICAL AND HORIZONTAL WIRE MOVEMENTS.SLOTS/CUT-OUTS SHOULD BE GIVEN ON RACEWAYSTOFIXALLELECTRICALANDDATAPOINTS.SINGLESIDEDPVCWIRE MANAGER SHOULDBE ENCLOSEDATTABLETOP.ADJUSTABLE LEVELLERSHOE SHALL BE PROVIDED AT BOTTOM OF THE PARTITION TO AVOID SCRATCHESON THE FLOOR.PARTICLE BOARD OF GRADE II OFISLEVEL. * THREE LAYER PRELAMINATED PARTICLES BOARD (WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823/LATEST .* THE SELLER / COMPANY SHOULD BE ISO 9001:2015, ISO 50001:2018, ISO 14001:2015, ISO 45001:2018 CERTIFICATES OF THE MANUFACTURER CERTIFIED BY NATIONAL ACCREDITATION BOARD OF CERTIFYING BODIES, IGBC, SEDEX, GREEN PRO, AIOTA, INDIAN DESIGN MARK, FSC CERTIFICATE. THE BIDDER SHOULD BE A MEMBER OF BIFMA AND AT LEAST TWO PRODUCTS OF THE OEM SHOULD BE CERTIFIED AS BIFMA COMPLIANT AND AN OFFICIAL PRODUCT OFFICIAL LINK/SCREENSHOT OF THE PRODUCT LISTING MUST BE PROVIDED FROM WWW.BIFMA.ORG WARRANTY-5 YEARS MAKE-DURIAN /GODREJ/FEATHERLITE 51 PROVIDING & SUPPLYINGFIXING OF TWO SEATER SCHOOL DESK WITH SHELF/STORAGE UNDER DESK WHICH ONE MADE BY CAST IRON,DESK TOP MADE BY 18MM THICK PRELAMINATED PARTICAL BOARD OF GRADE II TYPE III OF IS 12823/LATEST,TWO SEATER CLASSROOM DESK CUM BENCH, TOTAL SIZE OF BENCH : 1050MM(L)X 950MM(D)X 760MM(H) DESK SIZE : 1050MM (W) X 400MM (D) X 760MM (H) BENCH SIZE : 1050MM (W) X 310MM (D) X 390 / 760MM (H) BACK SIZE : 1050MM (W) X 150 MM (H),TABLE TOP SHALL BE POLYPROPYLENE CO POLYMER (PPCP).BANDING UNDER STRUCTURE-BLACK 9005 ERW PIPE (AS PER IS:7138) : 25X25X1.2MM SQUARE MS PIPE, OF THICKNESS 1.2MM IN BLACK EPOXY POLYESTER POWDER COATED TO THE THICKNESS 50-60 MICRONS(+/-5 MICRON) AT BASE WITH PLASTIC CAPS MADE OF PP COPOLYMER (3530 GRADE) ARE ALSO PROVIDED ON THE REAR FRAMES ADDING MORE AESTHETIC VALUE TO THE PRODUCT. * ADDITIONAL HORIZONTAL SUPPORTS OF M.S. C SECTIONS OF 1.5MM THICK ARE PROVIDED BELOW THE DESK & SEAT.SHELF: 0.8MM THICK POWDER COATED M.S. SHEET BELOW THE DESK & HOOKS ON EITHER SIDE OF DESK IN M.S. ROD OF DIA 6MM.TOP,SEAT AND BACK PANEL: 18MM THICK PRE LAMINATED BOARD WITH MACHINE PRESSED EXPOSED EDGES SHALL BE FINISHED WITH 2MM THICK EDGE BINDING TAPE OF MATCHING COLOUR AND SHADE FIXEDDULY PASTED WITH THE ASSISTANCE OF EDGE BANDING MACHINE AT 200 DEGREE CELSIUS. * THREE LAYER PRELAMINATED PARTICLES BOARD ( WOOD PRODUCT ) OF GRADE II TYPE III OF IS 12823/LATEST.* 52 Suplying of Laboratory Steel Furniture Sidebench with rack and table top of specification,Size of side benches/Island benches (LxWxH):1800 mm X 1800 mm X 900 mm,Type of Frame for installation of bench:C type frame,C Type Fixed Under Bench Cabinet size:500 mm x 500 mm x 540 mm (having one door, one drawer and one adjustable/removable shelf) 53 Supplying of Laboratory Steel Furniture Island bench with table top Size of side benches/Island benches (LxWxH):900 mm X 1500 mm X 900 mm,Type of Frame for installation of bench:C type frame,C Type Fixed Under Bench Cabinet size:500 mm x 500 mm x 540 mm (having one door, one drawer and one adjustable/removable shelf) 54 Supplying ofPowder coated Round Classroom Stools Load of 50 Kg of stool of specification:Height Adjustment: Without Hydraulic,Frame and support made of CHROME PLATED MS TUBES,Chair Type:Non Revolving,Type of seating:Only seat,Pedestal base :Aluminium Die Cast 55 Suppling of Over Head Storage delite hi-tech of specification Material of Construction:ISI Marked, three layer Prelaminated particle Board conforming to Grade II Type III of IS 12823/2013 laminated with 0.6-0.8 mm thick lamination conforming to IS 2046/1995 and balancing lamination of 0.5 mm thick on the back side,Number of Shelves (Nos):2 Number of Doors (Nos) -2 ,Height in mm (±10 mm)-750,Depth in mm (±5 mm)-450 56 Suppling ofStainless Steel Name Plates, Monograms, Labels, As per BHEL ,Specifications :Stainless Steel Name Plates, Monograms, Labels, 57 Suppling of Aquaguard RO & UV both SS304 Drinking Water Coolers With Built In Water Purifiction System AquaguardR 58 Suppling ofStainless Steel External Branding Signage Boards, Size 22X6 Feet,Signage Printing-Single size vinyl print ,Material -Stainless steel ,Coating: Gloss or matte,Fabrication Specs-framing with one coat of red oxide & 2 coats of oil paint to avoid rusting 59 PROVIDING & SUPPLYING DIRECTOR DESKDIRECTOR TABLE STRUCTURE OF L SHAPED DESK .PRIMARY WORK SURFACE OVER ALL SIZE IS 2100MM(L)X 900MM(D)X 750MM(H) 50MM THICK TABLE TOP MADE OF PRELAMINATED PARTICLE BOARD WORK SURFACE WITH CLASSIC WENGE BROWN FINISH 2MM THICK PVC EDGE BANDING MADE OF SAME MATTE FINISH. SIDE PANNEL IS MADE OF 50MM THICK* PROVISION OF SIDE RUNNER OF SIZE IS 1200MM(L)X 400MM(D)X 760MM(H) ,(CCOMBINATION ONSTRUCTION BELOW TABLE TOP 1 KEY BOARD TRAY IN PVC WITH TELESCOPIC CHANNEL ON RIGHT SIDE IS MOVABLESIDE RUNNERHAVING 1 OPENABLE DOOR WITH 1 FIXED SHELVE, 1 OPEN BOX WITH 1 FIXED SHELVE UPPER SHELVE HEIGHT IS @ 320MM BELOW SHELVE HEIGHT IS @324@ + 3 DRAWERS (2 EQUAL DRAWERS + 1 FILLING DRAWER)PER DRAWER HEIGHT IS @ 184MM, FILLING DRAWER HEIGHT IS @ 303MM HAVE CENTRAL LOCKAND HANDLES WITH CASTORS .* MOBILE PEDESTAL OF SIZE400MM(L)X 530MM(D)X 671MM(H) ,PER DRAWER HEIGHT IS @ 186MM, FILLING DRAWER HEIGHT IS @ 195MM HAVING (2 EQUAL DRAWERS + 1 FILLING DRAWER) IN PROVIDED WITH CETNRAL LOCK FOR SECURITY AND HANDLES ARE PROVIDED FOR EASY OF OPENING.OVERALL CONSTRUCTION OF PEDESTAL IS 18 MM ALONG WITH FECIA OF DRAWERS. * THREE LAYER PRELAMINATED PARTICLES BOARD(WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823/LATEST , 60 PROVIDING & SUPPLYING* FIX CANTILEVER CHAIR * ALL OVER SIZE IS : 610MM(L)X 505MM(D)X990MM(H) , *THE CHAIR MADE OF FULL LEATHERETTE IN BLACK COLOUR . IT WILL COMES IN MATTE BLACK FINISH FINSIH IN CONTEMPORARY STYLE .DETAILS :* ARMS :CHROMEFINISH ARMS WITH PU PADDING .* USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT AND BACK) . * SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK : 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK . BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORTbackrest support* ONLY SEAT SIZE IS 610MM(L)X 505MM(D)X485MM(H) & THE BACK SIZE IS 610MM(L)X 540MM(H) ,* BASE : CHROME FINISH TUBLAR FRAME OF CANTILEVER TYPE . 61 PROVIDING & SUPPLYING OFFICE DESK STRUCTURE OF RECTANGULAR SHAPE .PRIMARY WORK SURFACE OVER ALL SIZE IS 1200MM(L)X 600MM(D)X 750MM(H) 25MM THICK TABLE TOP MADE OF 25MM THICK PRELAMINATED PARTICLE BOARD WORK SURFACE WITH THE EXPOSED EDGES SHALL BE FINISHED WITH 2MM THICK EDGE BINDING TAPE OF MATCHING COLOUR AND SHADE WITH THE HOT MELT GLUE . MODESTY PANNEL MADE OF 18MM THICK, WIRE MANAGEMENT HOLE WITH PVC GROOMENT ON TABLE TOP.*CONSTRUCTION RIGHT SIDE OF TABLE TOP IS BASED ON A FIXED PEDESTAL3 DRAWERS & FROM LEFT SIDE OF TABLE TOP IS BASED ON 18MM THK ENGINEERED WOOD PVC EDGE BANDING PEDESTAL BACK,TOP,BOTTOM & DRAWERS ARE MADE OF 18MM THICK WITH 1 CPU TROLLY MADE IN BLACK METAL POWDER COATED.*FIXED PEDESTAL:L:410MM(L)X 580MM(D)X 750MM(H) ,IN PROVIDED WITH CETNRAL LOCK FOR SECURITY AND HANDLES ARE PROVIDED FOR EASY OF OPENING. OVERALL CONSTRUCTION OF PEDESTAL IS 18 MM ALONG WITH FECIA OF DRAWERS. *THREE LAYER PRELAMINATED PARTICLES BOARD(WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823. 62 Suppling of Material & Subtype Solid Wood - Beech Wood Table Top Material Solid Wood,Leg Material Solid Wood Finish Glossy Colour & Colour Family Brown - Walnut Dimension (W)680mm X (D)530mm X (H)450mm Table Top Thickness 8mm,Size Compact, 63 PROVIDING & SUPPLYING ANGLE RACKOF SIZE 838MM(L)X 305MM(D)X 1676MM(H) STEEL BOOKCASE HAVING 4 DOORS AND K. TYPE OF LOCK: THREE WAYBOLTING DEVICE CONTROLLED BY LOCK, THICKNESS OF MS SHEET USED FOR SHUTTER: 0.7 MM, THICKNESS OF MS SHEET USED FOR SHELF: 0.7 MM, THICKNESS OF MS SHEET USED FOR TOP,BOTTOM, BACK AND SIDES: 0.7 MM, MATERIAL OF HANDLE: CAST BRASS, THICKNESS OF TRANSPARENT GLASS IN SHUTTERS: 4.0 MM, THE COMPLETE STEEL STRUCTURE SHALL BE CONSTRUCTED BY WELDING AND PROVIDE FINISHING WITH EPOXY POLYESTER POWDER COATED TO THE THICKNESS 60-80 MICRONIN COLOR GREY-LIGHT GREY. 64 Suppling of 3 Seater Public Place Seating Chair of mildsteel with arm and backrest WITHOUT CUSHION DURIAN,THREE SEATERTYPE WAITING AREA CHAIR -NIXON/SS/3 MATERIAL : STAINLESS STEEL,SIZE 1820MM(L)X 690MM(D)X 790MM(H)COLOUR : SILVER/WEIGTH OF PRODUCT : 34 KG APPROX,* SUPPLYING AND PLACING IN POSITION OF A STAINLESS STEEL VISITOR BENCH OF SIZE IS 1820MM(L)X 690MM(D)X 790MM(H). THE COMPLETE STAINLESS STEEL BENCH HAS SEAT & BACK SINGLE SECTION. PER SEAT LENGTH IS @ 520 MM &SEATING HEIGHT IS @ 430 MM FROM GROUND . OWING TO THE SMOOTH FINISH, DURABILITY AND TENSILE STRENGTH BEAM STAINLESS STEEL MADE BY 1.6MM THICK.SEAT IS MADE BY 1.2MM THICK STAINLESS STEEL BORDER WITH CHROME PLATING FOR EVERY SEAT & BACK ; STAINLESS STEEL HANDLES CHROME PLATED & DIE PRESSED LEGS AT THE END OF CHAIRS.GROSS WEIGHT OF REGULAR 3-SEATER WILL BE 34 KG.THE STEEL GRADE 202 HIGH YIELD STRENGTH AS PER IS:513 & IS:304 GRADE. 65 PROVIDING & SUPPLYING ANGLE RACKOF SIZE 900MM(L)X 450MM(D)X 1800MM(H) SLOTTED ANGLE RACK (OPEN TYPE) 6 SHELVES INCLUDING TOP & BOTTOM,ANGLES : 40MM X 40MM X 2MM(THICK).,SHELF : 36X15X1MM CRCA SHEET.IN COLOR GREY. 66 PROVIDING & SUPPLYING * FIX CANTILEVER CHAIR PROVIDING & SUPPLYING* ALL OVER SIZE IS : 590MM(L)X 490MM(D)X940MM(H) ,*THE CHAIR MADE OF FULL LEATHERETTE IN BLACK COLOUR .IT WILL COMES IN MATTE FINSIH IN CONTEMPORARY STYLE .DETAILS :* ARMS : PADDED ARMREST.* USE OF PLY: SEAT & BACK PLYWOOD MADE OF 12 MM HOT PRESSED.* SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT , * BACK : 35 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK . BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORT* ONLY SEAT SIZE IS 590MM(L)X 490MM(D)X450MM(H) SEAT HEIGHT IS @ 450MM .* BASE : 2 CHROME LEGS + BACK SIDE BOTTOM CHROME IN METAL . 67 * SUPPLYING AND PLACING THREE SEATER EXCLUSIVE PREMIUM LEATHERETTE MODERNIST CLASSIC DESIGN LOUNGE SEATING SOFA SIZE IS 1650MM(L) X750MM(D)X 710MM(H) WITH KILN-DRIED WOOD FRAMING MAKES IT WARP AND SCRATCH RESISTANT,COMFORTABLE SEAT DEPTH & HEIGHT DESIGNED KEEPING MODERN INDIAN LIFESTYLE IN MIND,WRAPPED IN BUTTERY-SOFT PREMIUM LEATHERETTE, THE PANELLED BACK AND CUSHIONED ARMRESTS ENCOURAGE LOUNGING,DESIGNED WITH MODERNITY & ELEGANCE, CHOOSE THE OPTION THAT SUITS YOUR HOME.* COMBINATION CONSTRUCTION STRUCTURE ARE MADE INMOISTURE CONTENT SHALL BE LESS THAN (10-12)%. THICKNESS OF PLYWOOD USED (MM) SHALL BE 12 MM GRADE IS 303 INDIAN STANDARD FOR COMMERCIAL (COMMON) AND MOISTURE PROOF PLYWOOD (TENTATIVE).UNDERSTRUCTURE FRAME SHALL BE CONSTRUCTED FROM 18 MM THICK KILN-DRIED GERMAN BEECH WOOD FRAMING IS HIGHLY DURABLE. THE COMPLETE STRUCTURE SHALL BE COVERED BY P.U.FOAM FIXED WITH ADHESIVE GLUE ,THE FRAME SHALL BE PADDED WITH HIGH RESILIENCE POLYURETHANE FOAM HAVING 25 +/- 5 DENSITY IN SEAT IT SHALL BE STACK FOAM OF 40MM THIK,40MM THICK BACK FOAM HAVING 25 +/- 5 DENSITY FOAM USED ,THERE SHALL BE CUSHION ARM 40MM THICK PROVIDED PADDED WITH HIGH RESILIENCE POLYURETHANE FOAM HAVING DENSITY 25 +/- 5. THE COMPLETE STACK FOAM STRUCTURE SHALL BE COVERED WITH PREMIUM LEATHERETTE IN BROWN-CAMEL BROWN COLOUR, IT COMPLEMENTS THE MODISH SLEEK STEEL . ( SEAT : 545 MM(D) X 410MM(H) , ARMS HEIGHT @ 610 MM /BACK HEIGHT @ 290 MM). 68 SUPPLYING AND PLACING30 SEATER U - shape MEETING TABLE with table top of Three Layer Prelaminated ParticleBoards Of Grade-II Type-II Of IS:12823/Latest (for 14 seater rate devided by 30X24} 69 SUPPLYING AND PLACING PREMIUM SUITESDIRECTOR TABLE STRUCTURE OF L-SHAPED DESK .PRIMARY WORK SURFACE OVER ALL SIZE IS 2400MM(L)X 2330MM(D)X 770MM(H) 45MM THICK TABLE TOP MADE OFSUPPLYING AND PLACING PRELAMINATED PARTICLE BOARD WORK SURFACE WITH RICH CHERRY FINISH SAME MATCHING EDGE BANDING MADE OF SAME RED CHERRY P.U POLISH.MODESTY IS DESIGNED WITH LEATHER PATCH.SIDE PANNEL IS MADE OF 36MM THICK .* PROVISION OF SIDE UNIT OF SIZE IS 1200MM(L)X 595MM(D)X 770MM(H) ,(COMBINATION CONSTRUCTION ON TABLE TOP WIRE MANAGEMENT 2 HOLE WITH SS GROOMENT & 1 HOLE WITH PVC GROOMENT ON TOP SIDE UNIT. BELOW TABLE TOP ONE KEYBOARD TRAY,IN SIDE UNIT BELOW THE TOP 1 KEY BOARD TRAY,1 OPEN BOX FILE ,1 DRAWER + 1 OPEANABLE DOOR SHELVE. * FIXED PEDESTAL OF SIZE450MM(L)X 400MM(D)X 690MM(H) , HAVING 3 EQUAL DRAWERS IN PROVIDED WITH CETNRAL LOCK FOR SECURITY AND HANDLES ARE PROVIDED FOR EASY OF OPENING. OVERALL CONSTRUCTION OF PEDESTAL IS 18 MM ALONG WITH FECIA OF DRAWERS. * ALL THE MDF BORAD ARE IS-14587-1998 WITH CONFIRM TO DIN 68861.ISO 9001- 2015 QUALITY CERTIFICATION CONFIRMING TO ASTM D 4499 STANDARDS FOR VISCOSITY AND THERMAL STABILITY . 70 SUPPLYING AND PLACING* HIGH BACK 360° DEGRE REVOLVINGCHAIR * ALL OVER SIZE IS : 673MM(L)X 508MM(D)X1270MM(H) , *THE CHAIR MADE OF FULL NATURAL LEATHER IN BROWN COLOUR . IT WILL COMES IN MATTE FINSIH EXTRA PADDED DESIGNED FOR MORE CONFIRMT AT WORKPLACE IN CONTEMPORARY STYLE . DETAILS :* ARMS : WOODEN ARMS WITH LETHER PADDING ARM REST ARE FITTED TO THE SEAT & BACK.* USE OF PLY: 12 MM THICK HOT PRESSED BWR PLYWOOD(IS GRADE - 303 FOR SEAT AND BACK) .* SEAT: 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN SEAT . * BACK : 40 ± 2 MM THICK POLYURETHANE FOAM WITH DENSITY 32 (±3) KG PER CU METER FOR BEST QUALITY CUSHIONING IN BACK .BACKREST SUPPORT FOAM DESIGN BASED ON SYMMETRICAL LUMBAR SUPPORT* MECHANISM : MULTI-LOCKING KNEE TILT MECHANISM .SEAT MAXIMUM HEIGHT IS 580MM & MINIMUM HEIGHT IS 500MM & BACK HEIGHT FROM FLOOR MAXIMUM HEIGHT IS 1270MM & MINIMUM HEIGHT IS 1219MM* GAS LIFT 80MM TELESCOPIC HAUDRAULIC * BASE : THE PRONG (BASE) IS MADE OF SOILD WOOD WITH POLISHEDAND FITTED WITH 5 NUMBERS. TWIN WHEEL CASTORS (CASTOR WHEEL DIA. 50MM) & 700MM PITCH CENTER DIA (740MM WITH CASTORS) . 71 SUPPLYING AND PLACING Material & Subtype Leather - Semi Aniline Leather,Metal - Stainless Steel,Frame Material Solid Wood Upholstery Material Leather,Seat Material Leather Leg Material Metal,Finish Matte,Colour & Colour Family Beige - Mushroom,Dimension (W)1140mm X (D)1000mm X (H)940mm Mechanism Click Clack Mechanism,Seating Capacity 1 Seater Seating Height 430mm,Function Adjustable Headrest Size Grand. 72 SUPPLYING AND PLACING Material & Subtype Leather - Semi Aniline Leather,Metal - Stainless Steel,Frame Material Solid Wood,Upholstery Material Leather,Seat Material Leather,Leg Material Metal,Finish Matte,Colour & Colour Family Beige - Mushroom,Dimension (W)2130mm X (D)1000mm X (H)940mm Mechanism Click Clack Mechanism,Seating Capacity 3 Seater Seating Height 430mm,Function Adjustable Headrest Size Grand. 73 SUPPLYING AND PLACING Rectangular CENTRE TABLE with Marble Top of 1219mmX711mm,(DAISY/CT (W)1300mm X (D)650mm X (H)450mm),Specifications:Number of storage under top No storage,Top material,Tempered glass,Frame material No frames,Dimension of Top (Length X Breadth, or Diameter) ±20mm,762mmX457mm,Height of centre table ±10mm,410,millimeter,Thickness of top material (+/-2 mm)- 8 millimeterThickness of frame material (+/- 1 mm)-10 millimeter 74 SUPPLYING AND PLACING 14 SEATER oval MEETING TABLE with table top of Three Layer Prelaminated Particle Boards Of Grade-II 75 SUPPLYING AND PLACING 6 Seater Sofa Material & Subtype-Premium Leatherette,Frame Material Solid Wood,Upholstery Material Premium Leatherette,Filling Material Foam,Silicone Fiber,Seat Material Premium Leatherette-Leg Material Solid Wood,Finish Matte,Colour & Colour Family Brown -Coffee Brown Dimension (W)4865mm X (D)960mm X (H)820mm,Seating -Capacity 3 Seater,seating Height 475mm,Size Standard 76 SUPPLYING AND PLACING9 SEATER U -* PROVIDING & SUPPLYING U - SHAPE MODERN DESIGN CONFERENCE TABLE & IN BETWEEN U SHAPE TABLE TOP LENGTH IS @ 4650 MM, TABLETOP OFFERS YOU A GENEROUS WORKSPACE,DESK PRIMARY WORK SURFACE USE PREMIUM QUALITY MATERIALS OVER ALL SIZE IS 4650 MM(L)X 600MM(D)X 750MM(H) TABLE TOP MADE OF 36MM THICK WHICH GIVE MORE SURFACE AREA FOR WORK ,MACHINE MADE MODULAR FURNITURE MADE PRELAMINATED PARTICLE BOARD OF GRADE II TYPE III OF IS 12823/LATEST,* CONSTRUCTION PROVISION OF CONFERENCE TABLETOP SUPPORTED WITH 18MM THICK SIDE PANNELS IN BROWN-BLACK OAK COLOUR MADE BY PRELAMINATED PARTICLE BOARD AND BELOW THE TOP 18MM THICK PRELAM PARTICLE BOARD MODESTY PANEL.OUR WORK SURFACE FURNITURE IS FINISHED WITH EXPOSED EDGES SHALL BE FINISHED WITH 2MM THICK EDGE BINDING TAPE OF MATCHING COLOUR AND SHADE,FIXED WITH HOT MELT GLUE. * THREE LAYER PRELAMINATED PARTICLES BOARD(WOOD PRODUCT) OF GRADE II TYPE III OF IS 12823/LATESt. 77 * SUPPLYING AND PLACING THREE SEATER EXCLUSIVE PREMIUM LEATHERETTE MODERNIST CLASSIC DESIGN LOUNGE SEATING SOFA SIZE IS 1650MM(L) X750MM(D)X 710MM(H) WITH KILN-DRIED WOOD FRAMING MAKES IT WARP AND SCRATCH RESISTANT,COMFORTABLE SEAT DEPTH & HEIGHT DESIGNED KEEPING MODERN INDIAN LIFESTYLE IN MIND,WRAPPED IN BUTTERY-SOFT PREMIUM LEATHERETTE, THE PANELLED BACK AND CUSHIONED ARMRESTS ENCOURAGE LOUNGING,DESIGNED WITH MODERNITY & ELEGANCE, CHOOSE THE OPTION THAT SUITS YOUR HOME.* COMBINATION CONSTRUCTION STRUCTURE ARE MADE INMOISTURE CONTENT SHALL BE LESS THAN (10-12)%. THICKNESS OF PLYWOOD USED (MM) SHALL BE 12 MM GRADE IS 303 INDIAN STANDARD FOR COMMERCIAL (COMMON) AND MOISTURE PROOF PLYWOOD (TENTATIVE).UNDERSTRUCTURE FRAME SHALL BE CONSTRUCTED FROM 18 MM THICK KILN-DRIED GERMAN BEECH WOOD FRAMING IS HIGHLY DURABLE. THE COMPLETE STRUCTURE SHALL BE COVERED BY P.U.FOAM FIXED WITH ADHESIVE GLUE ,THE FRAME SHALL BE PADDED WITH HIGH RESILIENCE POLYURETHANE FOAM HAVING 25 +/- 5 DENSITY IN SEAT IT SHALL BE STACK FOAM OF 40MM THIK,40MM THICK BACK FOAM HAVING 25 +/- 5 DENSITY FOAM USED ,THERE SHALL BE CUSHION ARM 40MM THICK PROVIDED PADDED WITH HIGH RESILIENCE POLYURETHANE FOAM HAVING DENSITY 25 +/- 5. THE COMPLETE STACK FOAM STRUCTURE SHALL BE COVERED WITH PREMIUM LEATHERETTE IN BROWN-CAMEL BROWN COLOUR, IT COMPLEMENTS THE MODISH SLEEK STEEL . ( SEAT : 545 MM(D) X 410MM(H) , ARMS HEIGHT @ 610 MM /BACK HEIGHT @ 290 MM) 78 SUPPLYING AND PLACING Wooden Acoustic Wall Cladding/Panelling- Providing and fixing in position wood wall paneling of width 128mm, thickness of 16mm and length 2440 mm made up of high density fiber board with minimum density of 800 Kg/m3 substrate with a laminated facing/wood veneer as per the approved shade/species & finish with melamine balancing layer on the reverse side. The boards shall have a special perforation pattern of 2mm groove & 14mm pitch. The panels shall have fire resistance of Class 1, BS 476 part 7. The edges of the panels shall be tongued-and-grooved to receive special clips for installation. The back of the perforated panel shall have sound absorbing non-woven acoustical fleece and backed with 50mm thick glass wool layer as directed by the Engineer-in-Charge. The panel shall be mounted on special channels using clips as approved by the Engineer -in-charge. Install Gel stud of section 48X34X36 mm or as approved by the Engineer -in- Charge on the solid wall horizontalty using screws and plugs at spacing of 600mm centre-to-centre, Screw the aluminium channel (keel) vertically on channeled G.I stud 600mm 79 SUPPLYING AND PLACINGBlackout roller blind,Specifications-Mounting arrangement profile systems – clicked on hidden mounting clipsTypes of roller blind,Blackout roller blind-Shading solutionSingle roller blind – utilise one layer of fabric (called outer layer Operating mechanism-Side winders (that lock the manually adjustable blinds at different levels with the internal ratchet and tension adjusted by spring inside the tube) 80 Providing and Fixingof Drawers in Brown Finish ,Specification-Material : High QualityParticle board Dimensions (In Centimeters)-H 91 x W 90 x D 44 Dimensions (in Inches)-H 36 x W 35.5 x D 17.5 Primary Material-Engineered Wood as per Engineer incharge 81 Providing and FixingSTAGE - Providing & fixing raised stepped floor (Stage) Consisting ofMS Tabular frame work ofPipe Section (HOT ROLLED/COLD ROLLED) size 50mmx 50mmx2.0mm.tk. duly Painted with one coat of Red Oxide steel Primer, fabricated in module of 600 x 600 mm frame gid (as per Design or as instructed) with support of same section Legs /frame fixed on existing floor from base and raised at height minimum 150mm to max 200mm as required, from Existing floor. Vc providing and fixing 18mm thick heavy duty high density (1450 kg/cum) cement fiber Board fixed by SS. Screw on Horizontal & Vertical Surface on Existing Framework with one coated cement primer on Board and covering Board from top and sides by 2mm thick Vinyl flooring of approved make,colour and texture to be layed and fixed on sub floor smoothly finished and levelled by recommended adhesive cutting fixing and including covered raised portion of Board from all sides etc. complete,suitable for use up to the satisfaction of Engineer- in-charge.Design as approved by Engineer-In-charge. Base ofthe Vertical Legs of M.S. Frame (COLD ROLLED/HOT ROLLED) 82 Providing, fixing & installation MICROPHONE:-Flat frequency response across the vocal range for uncolored sound interchangeable cardioid, supercardioid, and omnidirec- tional cartridges that provide choices for applications Sleek, low-profile design for unobtrusive appearance Balanced transformerless output for increased immunity to noise over long cable runs-Compact Cinema Surround Speaker for Digital Applications:- Frequency range: 50 Hz to 20 kHz • High sensitivity: 91 dB SPL, IW @ 1m (3.3 ft) High power handling capability: 150 watts, continuous pink noise Internal Thermomaster• technology allows for unprecedented high frequency power in a compact, molded enclosure Convenient mounting design supports JBL QuickMountre, OmniMount• or APC multimount brackets Special cabinet shape incorporates 20• angled front baffle SMPTE/lS02969 Curve X high frequency de-emphasisMixer 8 input mono mixer XLR input switchable between mic and line level +/- 15dB gain trim control per input Input 1 is switchable to be pre/post master 24VDC or mains power operation Optional remote VCA/Tone generator/ Muting boards available • Whisper quiet operation 83 Supply, Installation, Testing and commissioning of microphone Delegate unit. 84 Supply, Installation, Testing and commissioning of microphone Chaiman unit, 85 Supply , Installation , testing and commissioning of Factory made 1.4HDMl Cable along with connector (15mtr length) 86 Supply , Installation , testing and commissioning of Factory made VGA along with Connectors.(15mtr length) 87 Supply , Installation , testing and commissioning of Factory made RCA along with Connectors.(15mtr length) 88 Supply , Installation , testing and commissioning 40W power Amplifier of following features:- Rated output wattage - 240W, amplifier output IOOV, 70V and 4-16 ohms transformer isolated speaker outputs, Supply input 0.775 v (OdB) unbalanced, 10k ohms, XLR and phone jack frequency 89 Supply , Installation , testing and commissioning10W wall mount speaker- Supplying, installation, testing and commissioning of 240W power amplifier with following features:- Rated output wattage- 240W, amplifier output 100V, 70V and 4-16 ohms transformer isolated speaker output, Supply input 0.775 v (0 db) unbalanced, 10k ohms, ZLR and phone jack frequency response 50 - 18000 Hz, +/- 1.5 dB, S/N ratio > 105 dB. 90 Supply , Installation , testing and commissioningCONFERENCE CONTROL UNIT, line Output 1 17.5V DC/3a Max.; -34dBV (20mV), line Output 2 17.5V DC/3a Max.; -34dBV (20mV), power Output 50w rMS at 2% THD, 90w Max. inputs 3xMic 0.65mV/4.7kQ Ixaux IOOmV/470kQ Frequency response 60-14,000Hz (± 3dB) 91 Supplying of Material & Subtype Engineered Wood Finish Matte,Colour & Colour Family Brown - Wenge Dimension (W)800mm X (D)384mm X (H)1970mm Size Standard,Style Contemporary,Assembly Type Knock Down 92 Supplying of Powder Coated Extruded Aluminium Sections Hybrid panel based system (combination of sliding & snap fit tiles) Modular Work Stations 93 Supplying of11 SEATER U - shape MEETING TABLE with table top of Three Layer Prelaminated Particle Boards Of Grade-II Type-II Of IS:12823 94 SUPPLYING AND PLACINGSLOTED ANGLE RACKOF SIZE 900MM(L)X 450MM(D)X 1800MM(H) SLOTTED ANGLE RACK (OPEN TYPE)6 SHELVES INCLUDING TOP & BOTTOM,ANGLES : 40MM X 40MM X 2MM(THICK).,SHELF : 36X15X1MM CRCA SHEET.IN COLOR GREY, 95 SUPPLYING AND PLACING : METAL STORAGE OF SIZE 900MM(L)X 450MM(D)X 1980MM(H) BODY MADE OUT IN 22 GAGUE(0.8MM) & DOOR 19 GAGUE(1 MM) CRCA SHEET. 4 ADJUSTABLE SHELVE IN 22 GAGUE(0.8MM) & PEDESTAL 18 GAGUE 1.2 MM CRCA SHEET. HAVING FOUR SHELVES MAKING FIVE COMPARTMENT, UNIFORMLY DISTRIBUTED LOAD CAPACITY OF EACH SHELF SHALL BE 60 KG MAXIMUM,FITTED WITH MS BODY LOCK & HANDLE. FINISHING WITH EPOXY POLYESTER POWDER COATED TO THE THICKNESS 50-60 MICRONS(+/-5 MICRON)IN COLOR GREY-LIGHT GREY. 96 Providing and fixing e Slimline Tower AC (2 Ton White),Availability of BIS/ISI Mark Certification for Split AC Floor type-Yes,Technology of air conditioner,Non Inverter AC-Nominal Marketing capacity as per BEE Star Rating Label (hint: 1 Ton = 3000 Kcal/Hr, Tolerance +/- 10%) (in Ton)-3 BEE Star rating of the product (Central Ministries/Departments while procuring shall ensure that the items carry 5 star (under normal conditions where annual usages is expected to be more than 1000 hrs),3 Star (where usage is Limited)or higher Star R NA- Star rating for the capacity of >10,465 Watts (>9,000 kcal/hour) 97 Providing & Fixing 2.0 mm thick homogenous single layered vinyl flooring. The flooring shall be laid in manner to provide comfortable and jerk free surfaces including material, adhesive, scaffloding and lead and lift at all floor level etc. complete as per direction and approval of Engineer-in-charge. 98 Providing & Fixing Wiring for Primary Raw Power point 2 sets of 6 Amp Switch-Socket Outlet with 2.5 sq.mm FR PVC insuate copperconductor wire in surface / recessed 25mm medium class PVC conduit, earthing the third point With 2.5 sq.mm FR PVC insulated copper conductor Wire. Including Providing and fixing 2 nos 6A Switch with Front plate and metal Box with all Accessroies for users. 99 Providing & Fixing Wiring for Secondry Raw Power point 2 sets of 6 Amp Switch-Socket Outlet with 2.5 sq.mm FR PVC insulated copper conductor wire in surface / recessed 25mm medium class PVC conduit, earthing the third point with 2.5 sq.mm FR PVC insulated copper conductor Wire. Including Providing and fixing 2 nos 6A Socket controlled by 1 nos 6A Switch with Front plate and metal Box with all Accessories. 100 Providing & Fixing Wiring for Primary Raw Power point 1 sets of 6 Amp Switch-Socket Outlet with 2.5 sq.mm FR PVC insulated copper conductor wire in surface / recessed 25mm medium class PVC conduit, earthing the third point with 2.5 sq.mm FR PVC insulated copper conductor Wire. Including Providing and fixing 1 nos 6A Socket controlled by 1 nos 6A Switch with Front plate and metal Box with allAccessories. 101 Providing & Fixing Wiring for Secondry Raw Power point 1 sets of 6 Amp Switch-Socket Outlet with 2.5 sq.mm FR PVC insulated copper conductor wire in surface / recessed 25mm medium class PVC conduit, earthing the third point with 2.5 sq.mm FR PVC insulated copper conductor Wire. Including Providing and fixing 1 nos 6A Socket controlled by 1 nos 6A Switch with Front plate and metal Box with allAccessories. 102 Wiring for Primary Power point 6/16 Amp Switch-Socket Outlet with 4 sq.mm FR PVC insulated copper conductor wire in surface / recessed 25mm medium class PVC conduit, earthing the third point with 2.5 sq-mm FR PVC insulated copper conductor Wire. Providing and fixing 1 nos 6/16A Socket controlled by 1 nos 16A switch with front plate and metal box with allAccessories. 103 Providing & Fixing Standing Bathtubs Specifications:Size:1690x800x445/565mm Free Standing Bath Tub with Over Flow & Drain 104 Providing & Fixing Corazzin Garden Patio Seating Chair and Table Set Outdoor Balcony Garden Coffee Table Set Furniture with 1 Table and 4 Chairs Set (Black) 105 Providing & Fixing Reliable Drapes Cotton Plain Door Curtains Reliable Drapes,Cotton GSM Quality-220,Lining included-No, Pack of-1,Length (Ft)-8.5-9,Width (Ft)-3-3.5 106 Providing MattressDimension 1981 mm X 1829 mm,Thickness of Core Layer (Height of Spring) 200 mm,Thickness of Felt (±1 mm) for Bonnell Spring 12 mm,Thickness of Top Layer (±2 mm)-50 mm Thickness of Bottom Layer (±2 mm)50 mm,Type of Spring in Core Layer Bonnell Spring (with cotton felt),Material of Top Layer Visco Elastic PU Foam (Memory Foam) 107 ProvidingCotton Pillow 33 cm x 56 cm (COTTON PILLOW)of Specification-BIS Marking ( For Body Casing fabric )-No Logo Marking-No,type of Logo,Stitched ( Patch Logo ),Agree to provide 108 Providing240 centimeter x C1112M 135 centimeter (L x W) Printed Bed Sheets(BED SHEET ):Technical Specification of the Product-Sheeting, Tickings and Bedsheets (V2) as per IS 175 BIS Certifcation-No,VarietyVariety - 2,Process of colouring Dyed,Matching Pillow cover 109 Providing 25 liter 3 Star Water Heater,25 Ltr 5 Star Water HeaterCapacity litres (Litres),BEE Star Rating (Central Ministries/ Departments while procuring shall ensure that the items carry 5 star or higher Star Rating of BEE)-3,Availability of Type Test Report from Central Govt/NABL/ILAC accredited lab to prove conformity to specification-No,Material of Inner Container Vitreous enamelled inner tank conforming to IS-13273 110 Providing Wall Mount Mesh Filter T-Shapped Kitchen-Chimney Material of Blower Body-Aluminium,Material of Blower Blade Aluminium,Material of Exhaust pipe-pvc,Filter Material,Stainless Steel,ShapeT-Shapped,Filter Type,Mesh Filter,Control Panel Type Soft Touch,Mount Type,Wall Mount 111 Providing Potable Water Purification System With Inbuilt Water Cooler. RO UV Aquaguard(Hot & Cold uv+ ro) Specifications-Flow rate (Litres/hr.)-12,Cold water storage capacity (Litres)-11 liter,Cooling capacity (litres/hr.)-4,Hot water storage capacity (Litres)-1.5 liter,Heating capacity (litres/hr.)-1.5,Cooling power consumption (Watts)-230,Heating power consumption (Watts)-550. 112 Providing300 L 3 Star Frost Free Double Door Refrigerator, of specification Cooling type:Frost free,Exterior body built:steel,Shelf material -Toughened glass,Voltage Range-160-300V,frequency-50 Hz 113 Providing900 mm wide 2000 mm high Metal Shelving Racks,Specifications :Type-OPEN TYPE Number of Shelves/Compartments (Top / Ceiling Shelf - not to be counted)-4,Shelves Material-0.8 mm Thick MS Sheet Conforming to Commercial Quality CR-1, Grade 340 of IS 513,Depth in mm (±5 mm)-400,Width in mm (±5 mm)-900,Height in mm (±5 mm) 2000 114 Providing and fixing Drawers of Specification of Dimension (in cm)-H91 X W90 X D44in Brown Finish,primary material-Engineered wood,Weight 49.45kg 115 Providing and fixingDressing Table With cupboard and open shelves-Design of Dressing table With drawers,cupboard and open shelvesBase of dressing table Rectangular wooden frame Number of side mirror-1 number, Material specification-Prelaminated particle board of grade II type III of IS 12823/Latest.both side laminated. outer side laminated with shade matching with top shade and fascia shade and having balancing laminate of 0.5mm thick on other side Material thickness of complete body, Fascia and drawer/cupboard-19 millimeter,Material thickness for back, partition and drawer /cupboard bottom ± 2mm,19 millimeter 116 Providing and fixing Material & Subtype Solid Wood - Rubber Wood Table Top Material Solid Wood-Frame Material Solid Wood,Finish Glossy,Colour & Colour Family Brown - Walnut Dimension Of Table (W) 600mm X (D) 600 X (H) 610mm Dimension Of Chair (W)640mm X (D)530mm X (H)560mm Size Standard 117 Providing and fixing Wooden Double Bed Storage Box Opening From Material of Mattresses Panel-Other wood, Material of Bottom Panel of Storage Box-Three layer prelaminated particles board (Wood product) of grade II type II of IS 12823/Latest Material of Front, Back and side Panels Three layer prelaminated particles board (Wood product) of grade II type II of IS 12823/Latest Material of Headrest Three layer prelaminated particles board (Wood product) of grade II type II of IS 12823/Latest Material of Legrest-Three layer prelaminated particles board (Wood product) of grade II type II of IS 12823/Latest,Type of Bed-Wooden Double Bed Material of Bed Frame-Three layer prelaminated particles board (Wood product) of grade II type II of IS 12823/Latest 118 Providing and fixing 1 Seater Sofa With Leatherite Cover Sofa Set is Foldable to use as bed-No Backrest Cushion Material-Foam,density of Cushion of Backrest Material (Kg/Cubic M)-40 Covering Material for Seat and Backrest Fabric Frame Structure Material and size (±1 mm) Any other wood of minimum 25 mm thickness Seat Cushion MaterialFoam 119 Providing and fixing 8 SEATER Rectangular MEETING TABLE with table top of Three Layer Prelaminated Particle Boards Of Grade-II Type-II Of IS:12823/(Elanor Marble 8 Seater Dining Set) 120 Providing and fixing MODULAR TABLE L X D & H 2000 millimeter X 450 millimeter 700 millimeter (Alice TV Unit marble),Sprcification-Mode of Supply of modular table Knocked Down to be assembled at consignee site by the Seller Storage Provided one side,Number of storage unit-triple storage,Table Top material and thickness ±3mm-25mm thickness three layer pre-laminated Particle boards (Wood Product) of grade II Type II of IS 12823 Latest Gable end and modesty panel material and thickness-18 mm thickness three layers pre-laminated Particle boards (Wood Product) of grade II Type III of IS 12823 Latest 121 Supplying of Library Management Department. and NDL Softwares,Server Machines, Air-Condition Systems,Xerox Machines,Lamination Machines, CONNECTION)Binding Machines,Furniture/Furnishing. Computers, Printers,Computer System(with Internet Connection) 122 Supplying of Printer of Specification A Printing Technology Laser-Cartridge Technology,Composite Cartridge,Type of Printing Mono,Paper Size-A4 Print Speed per minutes per Department Incharge 123 Supplying of XEROX Machine(standard company) Type of MachineMultifunction Machine,Print Technology-Laser Type of Printing-Mono,Cartridge Technology Separate Drum and Toner (Dual Component) Platen/Flatbed Size-A3/A4,Paper Size (Original/Image)A3/A3 RAM size (MB)-4096as per Department incharge 124 Supplying of Determination of wavelength of He-Ne Laser light using Grating(Specification- Output Power: up to 15mW, CW - Wavelength: 632.8nm,* Mode Structure: TEM00 (>95%)* Beam size: <= 1mm* Beam Divergence: <= 1.5 mrad* Polarisation: Unpolarised, Vertical Polarisation. complete set up as per Department incharge 125 Supplying of Brewsters Law using spectrometer(Brewsters angle apparatus differ goniometer digital research bench polarizer analyser with rail type bench abron). complete set up as per Department incharge 126 Supplying of Determination of wavelength of Sodium light using Michelson interferometer(Power-3 kW,Usage-Physics Lab,Material-Mild Steel,Power Source,Electric Voltage 240 V). complete set upas per Department incharge 127 Supplying of Determination of wavelength of Sodium light using FabryPerot interferometer complete set up of Specification Flatness of Reflective Mirrors-λ/20 Diameter of Reflective Mirrors-30 mm Reflectance of Mirrors-95% Effective Travel of Preset Micrometer~ 3 mm Min Division Value of Preset Micrometer-0.01 mm Travel of Fine Adjustment of Movable Mirror-1.25 mm Resolution of Fine Adjustment-0.0005 mm Low-Pressure Sodium Lamp-20 W as per Department incharge 128 Supplying of Resolving Power of Telescope complete set up (specification Color-BlackMaterial-Plastic as per Department incharge) 129 Supplying of Resolving Power of Prism(Resolving power of telescope assists the user to know the basic principle of telescope. Fabricated using excellent quality metals, glass and plastic material, it is widely used instrument in scientific lab of colleges and research centers. It is known for accurate calculation and longer service life) complete set up as per Department incharge 130 Supplying of Production and analysis of Polarised light using half and quarter wave plate(Usage/Application Laboratory Voltage-230 V,Color-Black,Material-SS). Complete set up as per Department incharge 131 Supplying ofLogarithmic Amplifier(Built in power supply : +15V & -15V DC,Mains : 230V AC,Dimension : 27CMS X 17CMS [metal cabinet,Weight : 2KGS APPX) complete set up as per Department incharge as per Department incharge 132 Supplying of Zener diode characteristics & voltage stabilizer. Complete-Specification:(Voltage-240 V Frequency-60 Hz,Display Type -Analog)in all respect as per Department incharge 133 Supplying of FET characteristics complete up(Technical specifications-Inbuilt variable, overload & short circuit protected DC regulated power supplies of 0- 5 volt & 0- 15 volt.Voltmeter & ammeter are mounted on the front panel.One FET.Highly insulated front panel .Trainer helps to demonstrate the working principle of FET.Set of required number of patch cords.Multi - colored sockets are used.Housed in an elegant powder coated metal cabinet.Strongly supported by a comprehensive instruction manual complete with theory and operating details.LED indication for supply “ON” to work on 220V AC Mains.) as per Department incharge 134 Supplying of MOSFET characteristics complete set up(Specificaion:Power-AC Mains,Usage/Application-Laboratory Type-Analog,Material-plastic,Power Supply-ac mains, as per Department incharge 135 Supplying of UJT characteristics complete set up(Specification-Usage/Application-laboratory,Type-Analog,Display Type-Analog meters,Power Supply-ac mains)as per Department incharge 136 Supplying of Transistor biasing (CE mode)(Specificaion-Operating Power Supply-220VAC On Board Power Supply 0-1VDC & 0-10VDC Experiment Input & Output Char In CB & CE Mode OF PNP Tr.Meter Type Analog / Digital)set up as per Department incharge 137 Supplying of Characteristics of SCR(SpecificationUsage/Application-laboratory Type-Analog Automation Grade-Manual ,Power Supply-ac mainscomplete set up as per Department incharge 138 Supplying of Basic Logicgates and Universal gates. Operating Supply Voltage 230V,Logic Family-DIGITAL,Number of Inputs per Gate-2,Usage Laboratory,Material-ELECTRONIC Complete set up in all respect as per Department incharge 139 Supplying of Op-amp Integrator &Differentiator. Complete set up in all respect :Product Specification:Type-Analog Material-Metal,Automation Grade=-Manual,Color-black with multicolour PVC front panel,Power Supply-230,Capacity--5,connector Type-patch cord sas per Department incharge 140 Supplying of Half Adder, Full Adder and 4-bit binary Adder. Complete set up in all respect (Product Specification:Type-Digital,Display Type-Digital Interface--NO Material-ABS,Display-Digital,Pulse Generator-50Hz Variable Dc Output-no)as per Department incharge 141 Supplying of G. M. Counter for 6 digits GM counter with built in power supply complete set up(G.M.COUNTER: COMPLETE WITH INBUILT POWER SUPPLY EHT 250-1200v Workable on 220v. 50Hz., Power consumption 8W approx. STOP, START, RESET switches. Counts Capacity : 6 DIGIT COUNTING SYSTEM, Preset time : 3 DIGIT PROGRAMABLE TIMER WITH DIGITAL DISPLAY. 3 ½ Inbuilt Digital Volt Meter for GM TUBE Voltage. G.M.TUBE: END WINDOW G.M.TUBE MOUNTED IN ACRYLIC STAND. WITH ‘LEAD’ AND ‘ALUMINIMUM’ ABSORBENTS, Radioactive Source: ONE RADIOACTIVE SOURCE BETA or GAMMA (in Lead Container and wooden Box) SOURCE, . Dimensions : 460X370X230mm.(Complete instrument is HOUSED in corrugate box with Export Packaging) Wight : Total weight of the Instrument is 5.5kg.) as per Department incharge 142 Supplying of Measurement of Dielectric constants of solid and liquid samples complete set up(It Consists of following partsRF Generator (9-10MHz Approx) Micro Ammeter (Range 0-50mA) Potentiometer for Sensitvity Selection Fixed Capacity (Metal) Variable Gang Capacitor Socket for test Capacitor & Variable Capacitor brought out at front panel One Solid bakelite plate to be insert in gap of test capacitors)as per Department incharge 143 Supplying of Study of Dielectric constants and Curie temperature of ferroelectric ceramics Complete in all respect(Specifications Temperature Range : Ambient to 200°C,Display : 31/2 digit, 7 segment LED with autopolarity & decimal indicationResolution : 0.1°C,Accuracy : ±0.5°C (typical),Stability : ±0.1°C Power : 150W,(ii) Digital Capacitance MeterThis a compact direct reading Instrument for the measurement of capacitance of the sample. Specifications,Range : 50-6000 pf,Resolution : 1pf Display : 3½ digit, 7 segment LED, Typical results obtained with the above set-up are as shown in the graph) as per Department incharge 144 Supplying of Determining Optical constants of a metal by reflection of light Complete in all respect (Specification-Power-AC Mains,Usage/Application-Laboratory,Type-Digital Material-Metal,Automation Grade Manual,Color-White Power Supply-AC Mains,Display Type-Digital) as per Department incharge 145 Supplying of Lattice dynamics kit with frequency meter (Technical Specifications: Audio Oscillator 100 khz,Built in Power Supply and Output Stage to match the Impedance of Simulated Lattice,Lattice DynamicKit consists of Transmission line, which Simulates One-Dimensional Mono-AtomicandDi-atomicLattices,. LCD Based Frequency Counter is Provided on panel to Measure Frequencycomplete set up as per Department incharge 146 Supplying of BCD to seven segments complete set up(Specification:Built in power supply : +5V DC Mains : 230V AC Dimension : 27CMS X 17CMS [metal cabinet] Weight : 2KGS APPX) as per Department incharge 147 Supplying of Monostable Multivibrator using Oscilloscope (CRO) complete set up (Specification:Usage/Application Laboratory Packaging Type-Corrugated Box,Connector-2mm sockets Frequency Range -50Hz) as per Department incharge 148 Supplying of Bistable multivibrator using Oscilloscope(CRO))Technical Specification:(Built in power supply : +12V & -12V DC Mains : 230V AC,Dimension : 27CMS X 17CMS [metal cabinet] Weight : 2KGS APPX)complete set up as per Department incharge 149 Supplying of Pulse code modulation and demodulation complete setup (Product Specification,Type Laboratory Trainer Kit Usage/Application-Laboratory,Accuracy-+/- 10%,Frequency-50 Hz Input Voltage-220V,Packaging Type-Corrugated Box,Power Source-ElectricShape-Rectangular,Material-ABS or Metal Cabinet)as per Department incharge 150 Supplying of Addition, Subtraction, Multiplication using 8086 microprocessor(Product Specification,Usage/Application-LaboratoryType-Fully Automatic,Automation Grade-Semi-AutomaticClock Frequency-Yes,Color-Green,Display-Digital Packaging Type-Corrugated Box, Power-200-400 Weight 2 Kg) as per Department incharge 151 Supplying of Thevenin theorem, (THEVENIN’S AND NORTON’S THEOREM APPARATUS,Technical specifications Inbuilt fixed DC regulated power supply of 12 volt. Voltmeter & ammeter are mounted on the front panel. Resistive network is used in the circuit. Circuit diagram is printed on highly insulated front panel . Trainer helps to demonstrate the working principle & verification of Thevenin’s & Norton’s Theorem based on resistive circuit. Student can calculate & measure the value of current & voltage for different load circuits. Calculation of power consumed by the circuit. Facility for connecting external Power Supply. Set of required number of patch cords. Multi - colored test points are provided in the circuit to observe voltages at different points. Housed in an elegant powder coated metal cabinet. Strongly supported by a comprehensive instruction manual complete with theory and operating details. LED indication for supply “ON” to work on 220V AC Mains. Circuit protection through glass fuse)Complete set up as per Department incharge as per Department incharge 152 Supplying of Active filter set up(Product Specification Operating Temperature-0-50,Frequency (Hz) 50,Condition-New Temperature (deg. Celsius)-50,Usage/Application Industrial, Educational, Residential, Commercial) as per Department incharge 153 Supplying of A to D counter type complete set up (Product Description-M-32 AD M-16 AD,Input AD: 1/4 TRS jack and 25 pin D-sub, servo balanced, completely symmetrical audio path, Output AD: 4 x ADAT optical, 1 x MADI optical/coaxial,Dynamic Range AD: 113 dB RMS unweighted, 116 dBA,THD AD: < -110 dB (< 0.00032 %),THD+N AD: < -104 dB (< 0.00063 %) Crosstalk AD: > 130 dB,Input level for 0 dBFS: +24 dBu, +19 dBu, +13 dBu,Frequency response AD, -0.1 dB: 10 Hz - 23.2 kHz (sf 48 kHz),Frequency response AD, -0.5 dB: < 5 Hz - 45 kHz (sf 96 kHz) Frequency response AD, -1 dB: < 5 Hz - 80 kHz (sf 192 kHz) Sample rates: 44.1, 48, 88.2, 96, 176.4, 192 kHz, variable (Sync/WC),Jitter: Typical < 1 ns for internal, Word Clock, ADAT and MADI input Jitter sensitivity: all PLLs operate error-free even at 100 ns,Jitter suppression: > 30 dB (2.4 kHz),Power supply: Internal switching mode PS, 100V - 240V AC, 60 Watt Dimensions: (WxHxD) 483 x 88 x 200 mm)as per Department incharge 154 Supplying of Determination of Plancks constant(1. 1 0-2V D.C. at 20mA Variable Power Supply. 1.2 Digital Panel meter 3½ digits range 2mA. 1.3 Digital Panel meter 3½ digits range 2 volt 02 Lamp House: 100W Bulb with stand 03 Vacuum Type Photo Cell : Mounted in a Iron box. 04 Three different colour optical filters 05 Adequate no. of patch cords stackable 4mm spring loaded plug length 50cm. 06 Strongly supported by detailed Operating Instructions, giving details of Object, Theory, Design procedures, Report Suggestions and Book References.) as per Department incharge 155 Supplying of Determination of Energy Band Gap using Four Probe method(Product Specification:Type-Energy Band Gap Usage/Application-Laboratory,Connector-4mm Banana Socket Frequency-50Hz) as per Department incharge 156 Supplying of Determination of Hall coefficient and Hall angle in Hall-effect(Product Specification,Display Type-0-20V DC, 0-5 A, digit LED, Primary safety socket,4mm Electro Magnet Coils 500 T, Voltage resolution -0.1V,Current Resolution 0.1 A) as per Department incharge 157 Supplying of Determination of magnetic susceptibility using Guoys method(Usage/Application Physics Laboratory Type Of Instruments-Magnetic Susceptibility Gouys Balance Method Experiment Setup,Power-230V , 50Hz, +-10% Display Type-LED Type) as per Department incharge 158 Supplying of Study of absorption pattern of a given sample using FTIR spectrometer(Product Specification,Detector-High performance pyroelectric infrared detector,Weight-15 kg Software-1,Voltage-100-240V AC,Electronic System-24bit A/D converter at 500KHz, USB 2.0,Wavenumber Range-7800~350 cm-1Power-100-240V AC,50/60Hz,Signal Noise Ratio-30000:1 (resolution@4cm-1 , sample and background scan for 1 min@2100cm-1 ),Light source-Long life, steady state infrared emitter Beam splitter-coated KBr,Resolution-1 cm-1,Dimension-430mm x 360 x200) as per Department incharge 159 Supplying of LCD Projector and smart board (Product Specification,Projection Distance-<1 m Resolution-WXGA,Lamp Life-5000/9000/10000 HOURS Screen Size-100,Display Type-LCD,Dimensions-400X367X149MM Connectivity Type-Dual HDMI, HDMI,Brightness-2000-4000 Lumens Color-White) as per Department incharge 160 Supplying of Desktop(ntel Core I3/ 10th Gen/ 4GB RAM/ 1TB HDD/ DOS/ NO DVD/ 19.5 Inch Monitor/ 1 Year Warranty) as per Department incharge 161 Supplying of Printer(Product Specification,Printer Type-Ink Tank Color Output-Color,Print Speed-22 ppm,Paper Size-A4,Dimension-403 x 369 x 150 mm,Weight -6,Warranty-One Year or 50,000 pages which ever is earlier) as per Department incharge 162 Supplying of Printer (Product Specification Printer Type-Inkjet Color Output-Color | B&W,Print Speed-10,Paper Size-A4,Connectivity-USB,Dimension-377 x348 x179,Weight-3.9 Print Volume-any)as per Department incharge 163 Supplying of XEROX Machine (Product Specification,Functions-Photocopy,Supported Paper Size-A3,Supported OS-Windows 10 Color Output-Black & White,Number Of Trays-1,Item Color-Black & WhitePrint Speed-22 PPM,Weight-40 kg,Print Technology-Laser Input Tray Capacity-350 sheets,Warm-Up Time-5.6 Sec,Duty Cycle-80000 / Month,Resolution-600 x 600 dpi Connectivity-Ethernet & USB,Duplexing-Yes)as per Department incharge 164 Supplying of computer system with internet connection,PC Specifications to be followed :Processor Intel Core i5(10th Gereneration or newer ),RAM-8 GB or Higher HDD:512 GB,SSD,Monitor 24 LCD Monitor .OS:Windows 10 Professional ,Anti virus:User Licence for one year as per Department incharge 165 Supplying of Laptop (with Internet connection),Processor intel Core i5(11th Generation or newer),RAM 8 GB or higher HDD:512 GB,SSD Monitor 14 screen ,OS Windows 10 Professional ,Antivirus :User Licence for one year 166 Supplying of LCD Projector (Specification-Brightness:2000-4000 Lumens,Resolution-FULL HD 1080P,Connectivity Type-Dual HDMI, HDMI Display Type-DLP,Power Supply-100-240V Portable-Yes) as per Department incharge 167 Supplying of Smart Board (Frame Material-Aluminium Usage/Application-School, Education, etc,Effective Touch Area-72 x 48 inch Material-Ceramic Input Method-USB Power Consumption-150 - 220 W,Shape-Rectangular) as per Department incharge 168 Supplying of MS Suite Software(Specification-Microsoft Office Software,Operating System:For Windows,Brand:Microsoft )as per Department incharge 169 Supplying of Adobe Photoshop Software(Specification -Graphic Design and Photo editing,Licence-1 yea) as per Department incharge 170 Supplying of windows10 OS Software(Specification-License Duration-Life Time,Architecture-32/64 Bits,Operating System For WindowsAlso Provides,Windows Operating System,Provide Installation Service-Yes Support 24/7 (Live Rep)) as per Department incharge 171 Supplying of Laptop of 11th Generation intel core i3,1115G4 processor (6 MB Cache up to 4.1GHZ)windows 10 Home Single language English,intel UHD Graphics with shared graphics memory 8GB ,8 GBX1,DDR4,3200 MHZ,512 MB,2 PCLeNVMe Solid state drive pebble (Top colour is pebble colour,Base and palmrest are black colour as per department incharge 172 Supplying of Desktop of 10th Generation intel core i5-10500T (6 CORE,12MB Cache 2.3GHZ to 3.8GHz,35W ),Windows 10 Pro (64 Bit )English,intel integrated graphics),8GB ,1X8 GB,DDR4 non-EC0C Memory,2.5 inch TB 7200 RPM ,SATA Hatd disk drive 5480AJO 23.8 FHD 1920X10080 ips non touch,Antiglare camera,integrated graphics,Bronze 1505w PSU as per department incharge 173 Supplying of Printer (Specification:Item Weight-12 Kg,Package Dimensions-60 x 56.5 x 38 cm,Connectivity Type-Wi-Fi Operating System-Windows)as per department incharge 174 Supplying of Fumehood(Specification:Type-exhaust,LED-Tube fitting,Power-230 volt,Working Top-Granite ,MOC-GI with PU coated Storage includedas per department incharge 175 Supplying of electronic balance(Specification -Usage/Application-Laboratory,Accuracy-0.01%,Calibration-Fully Automatic,Type Of Weighing Scale-Digital,Voltage-110-220 V Mounting Type Desktop) as per department incharge 176 Supplying of Magnetic stirrer Magnetic stirrer Hot plate (Specification-Weight-2.3 kg,Timer -999 minutes,Temp. Accuracy-+-1 Deg.C(<100 Deg.C)+-3 Deg.C(<300 Deg.C),Dimensions LxWxH (mm)-230 x 180 x 120,Max.Temp. (Plate Surface) 300 Deg.C,Power supply-AC 220V / 50 Hz,Top Plate Size 135 x 135 mm,Display-LCD,Max. Volume (ml) 2000 ml,Speed (RPM)-1250 RPM Plate Material Steel per department incharge 177 Supplying of HOT Air oven of made inner material-stainless steel,Outer material -mild steel ,Surface treatement -Powered coated ,Sizes-Different sizes,Gravity conviction type-Double wall.Mechnical conviction -Triple wall as per department incharge 178 Supplying of colourimetry , Ery colour colorimeter industrial and research purpose stability( Product Specification:Material-Aluminium Alloy,Automation Type Automatic,Brand -DD-LAB ,Dimension-210 x 160 x 80 mm,Display Type-Dual Digital DisplayLight Source-Highly Accurate Laser Source,Stability- + 0.02 O.D. Per Hour Volume 1 ml. minimum,Filters layer-Built in 9 Digital filters 30,000 hours Life,Weight-1.5 Kg,Battery Backup-6 V Ni CD Re-chargeable Battery,Detector Silicon Photo-diode,Display Model Absorbance & Wavelength,Filter Wavelength 680 NM Country of Origin Made in India) as per department incharge 179 Supplying UV-Vis Spectrophotometer Fully touch screen portable UV Spectrophotometer shimadzu model name:UV 1900,Brand :shimadzu,Display =fully touch screen,Type-portable,size 450x501x244 as per department incharge 180 Supplying of potentiometer ,Range-0 to 1999.9mv,Resolution-1 mv,Repeatability -1mV,Accuracy +1 mv+ digit,Input impedency-10ohms,operating temperature 10 to 50 degree Celsius,Display 1/2 digit 0.5 seven segment LED Display indication,Power-230V+10,50hZ,Dimensions 76x275x170 mm,weihjt 2 kh as per department incharge 181 Supplying of Conductivity meter,LT 26 Deluxe conductivity meter,Product details:Model no-LT-26,Brand -Labtronics,Usage-Laborataty,Display type 3.5 Digit LEDas per department incharge 182 Supplying of Online COD/BOD Detector analyzer warer quality monitoring probe,Measure range-0-200/0-1000mg/l,Resolution -1 mg/l ,Accuracy +5%F.s ,Under pressure-1 bar,Power supply -12-24V DC ,Temperature range 0-45 degree ,Production leve;-IP68 as per department incharge 183 Supplying of melting point appratus,Temperature renge -2 degree above ,Readability 1 degree ,Display -3 Digit LED,Heating rate control-Electronic,Temperatre sensor PT-100as per department incharge 184 Supplying of Ph meter Labrtonics,Range:0-14pH,Resolution:0.01pH,Accuracy:0.01pH(Relative),Temp comp:Automatic wvith temp probe,Buffer:Manuals with keys as per department incharge 185 Supplying of Spectrum 3 FT-IR Spectrometer,Model no.-LI280127,Wave length -11000-30 cm-1 as per department incharge 186 Supplying of Stopwatch NIVIA 600 plastic(Product Specification:Color-Black,Usage/Application-Sports,Time Display 12/24 hour display for user option,Material-Plastic,Dial Shape-OvalMaximum Counting-23 hours 59 minutes 59 secondsas per department incharge 187 Supplying of Digital Bomb Calometer(Specification-Auto Off Automatic,Frequency-50 Hz,Voltage-230-280 V,Operating Time Per Test 10 minutes,Power Source Electric(Automatic) as per department incharge 188 Supplying of Microprocessor viscometer ,Product details: Measuring range-101x105mpa,,Spindles-4 Spildles,Rotor speed(rpm)-6/12/30/60 rotor speed rpm as per department incharge 189 Supplying of Flame photometer,Product details:Application-Laboratory use,industialuse,,weight 705kg ,Curve fit accuracy,Resolution-0.1ppm/meq as per department incharge 190 Supplying ofwater purification system,Resolution-18.2 M ohm cm at 25 degree C,Weight-19.5kg,Frequency-50-60Hz as per department incharge 191 Supplying of Refrigerator of 7.5kg fully Automatic Top Load washing machine (Hard water wash,Grey,5 star,10 years warranty as per department incharge 192 Supplying of water bath ,unstirred water bath s ,Digital info Water bathdigital,18L amb+5 tp 99 degree C includes clear lid and base trayas per department incharge 193 Supplying ofmini rotary shakers 50to 400RPM,features-220/230 V ac,Power supply-50-60Hzas per department incharge 194 Supplying of Magnetic stirrer- capacity 5 litre Spinit Digital Magnetic Stirrer Features-Type of Product-Magnetic stirreras per department incharge 195 Supplying of Digital ultrasonic cleaners (Specification: tank capacity 4 L, ultrasonic power 100W, Heating, Power-100W, time setting 1-99 min, heating temp up to 80 degree, in and out both in ss, with digital timer auto stop of sonication. 230V AC +-10% 50HZ. Tank size 300x150x100mm, overall size 330x180x240mm.supplied with basket and Lid.) as per department incharge 196 Supplying of Calomel electrode (Product Specification:Packaging Type-Box.,Length-120 mmUsage-Electrochemical Study(Laboratory))as per department incharge 197 Supplying of Pt-wire counter electrode (Product Specification Electrode Diameter-0.5 mm,Power Source-10A) as per department incharge 198 Supplying of UV-LAMP Cabinet(Product SpecificationSize/Dimension-15 X 12 X 10 (H) Light Source-3 NOS , SHORT WAVE -254nm-1no, LONG WAVE-365nm, VISIBLE LIGHT,Material-MILD STEEL,Voltage 230 V AC) as per department incharge 199 Supplying of Magnet (Magnet Grade-N48 Shape-Cup & Pot,Material Neodymium,Dimensional Tolerance+-0.05 mm,Plating / Coating-Ni-Cu-Ni Colour-red,Surface Gauss 3000 Gauss,Maximum Working Temperature (Deg. C)-230 Deg. C as per department incharge 200 Supplying of Micro Centrifuge tube(Specification: Usage/ApplicationLaboratory Analyzers,Material,Polypropylene Color-White,Pack Contains--20 Packet / carton & 500 pcs / packet,Shape-Conical,Length-4.1 cm,Inlet Diameter-1.3 cm Capacity2 ml)as per department incharge 201 Supplying of Micropiprtte(10-100uL),(Product Specification Capacity-10 ml,Volume Increment -0.1 microlitre Material-Glass,Autoclavable-Yes)as per department incharge 202 Supplying of Micropiprtte(10-1000uL),( Product Specification Material-Plastic,Capacity-Up to 1000ul,Color-Transparent Usage/application-Chemical Laboratory) as per department incharge 203 Supplying of printer-Black and white print ,scan,copy all in one printer Product Specification Print Speed-Up to 18ppm / 19ppmLaser Printer,Color Output-Black & White,Print Technology LaserjetUsage/Application-Printing,Supported Paper Size-A4 Compatible Operating Systems1,Windows 8,Windows 7,Windows Vista,Windows XP,Windows 2000,Mac OS X 10.4 - 10.8,Linux*3 Print Resolution-Up to 600 x 600DPI,1 200 (Equivalent) x 600DPI,Print Language-UFR II LT Dimension-372 x 371 x 254mm (With the Cassette Opened)Weight(W/O CRG)-7.6kg,Monthly Duty Cycle-8000 Pages Power Consumption 960W(Maximum),First Printout Time7.8s / 7.7s (A4 / LTR),Zoom 50 - 200% in 10% Increments Refill Type Toner Cartridge,Internal Memory 64 MB Printer Language UFR II LT (Host Based),Paper Weight 60 to 163g/m2 (Cassette),Copy Speed Up to 18 / 19Cpm (A4 / LTR) Halftones 256 levels,Copy Resolution 600 x 400 DPI Display 7 - Segment,1 - Digit LED as per department incharge 204 Supplying of printer-colour print ,scan,copy all in one printer (Specification :Functions-Print | Scan | Copy,Technology-Inkjet Color output-Color | B&W,Connectivity-Wireless(Wi-Fi) Usage-For Office ,Paper size-A4,Print speed upto 40 pages/min)as per department incharge 205 Supplying of photocopier branded fast print 50ppm high image resolution superior print quality,fast scan up to 50ppm A4 Monocolouras per department incharge 206 Supplying of LAN.Networking,cabling,switches,Wi-Fi points(10 points in each department) as per department incharge 207 Supplying of installation of Printer (Black and white),Printer( colour),Photocopier and LAN,Networking,Cabling,Switches,Wifi Points as per department incharge 208 Supplying of RS+ TT7519RS,RS75+ comes with 75 diagonal length with 3 GB RAM and 48 GB ROM,Slim Glare ,H7 touch surface hardness,Light weight for easy installation,Media suits for Annotation software Bundled with education apps,Office suits ,Great writing experience,Object recognition-First /palm /fine pen ,Touch points -20 points under andriod ,178 degree viewing angle ,IR Touch 15000 14-01-20241 contrast ratio as per department incharge 209 Supplying of Freightof RS+ TT7519RS,RS75+ comes with 75 diagonal length with 3 GB RAM and 48 GB ROM,Slim Glare ,H7 touch surface hardness,Light weight for easy installation,Media suits for Annotation software Bundled with education apps,Office suits ,Great writing experience,Object recognition-First /palm /fine pen ,Touch points -20 points under andriod ,178 degree viewing angle ,IR Touch 15000 14-01-20241 contrast ratio) as per department incharge 210 Supplying of wall mount (Dimension long:Telescopic Adjustable CCTV camera mounting bracket -Color: Beige Universal Camera Bracket, Heavyduty weatherproof iron bracket fits mostbrands of outdoor camera housing,Iron stand Platsic APPLICATION: Ideal for indoor outdoor dome cameras, Security Camera Mount Bracket, high quality with professional design,more stable and reliable.Hidden hole: Cable can feed thru L bracket tothe housing thus provide cable protection Outdoor and Indoor Use.)as per department incharge 211 Supplying of Camcorder Compact full HD ENG Camera with 20X zoom and 5 axis image stabilization. 20X optical zoom (26.8mm, F/1.8-576MM, F/2.;28.8MM, f/1.-576mm). 5 axis image stabilization. Support formats: full HD50P/60P, AVCHD/MP4;SD card slots 2 35mm film camera equivalent when dynamic IS is turned on with Tripod as per Department Incharge 212 Supplying of Video capture and video capture card (Product Specification:Converter type-USB,Material:Metal,Audio Jack:3.5 mm,HDMI Version:Hdmi-1.4,Audio:44100 AU,Video:Full HD Frame:48000 Resolutions)as per department incharge 213 Supplying of UPS(1KVa)(Product Specification: Type-Online UPS,Capacity-1 kVA,Configuration-1 Phase IN - 1 Phase OUT,Protection-OverVoltage,Form Factor-Tower Model Back Up Time-20- 30 Mins,Frequency-40 ~ 70 Hz (auto-sense) Usage/Application All) as per department incharge 214 Supplying of Studio light-125watt,5 LED BULBS consisting of 25watt bulb(Colour Temperature:5500 kelvin)as per department incharge 215 Supplying of Live streaming software for live streaming or live telecast as per department incharge 216 Supplying of Cables,installation,SSD Card(SAMSUNG VNAND SSD 850 EVO 2.5 250GB SATA III 3-D Vertical Internal Solid State Drive (SSD) MZ-75E250B/AM) as per department incharge 217 Supplying of complete making soundproof class(20*20 feet Room) as per department incharge 218 Supplying of RFID Tags RFID Book Lables(specification: Language ‏ : ‎ English,Simultaneous device usage ‏ : ‎ Unlimited Text-to-Speech ‏ : ‎ Enabled,Screen Reader ‏ : ‎ Supported Enhanced typesetting ‏ : ‎ Enabled,X-Ray ‏ : ‎ Not Enabled,Word Wise ‏ : ‎ Not Enabled) as per department incharge 219 Supplying of Anti theft stickers with the university logo(Polycarbonate 175 Microns Matt Finish) as per department incharge 220 Supplying of Middleware Application Desktop(writing and read tags) as per department incharge 221 Supplying of RFID Staff station or desktop reader (used for Tagging of books and circulation) operations through RFID as per department incharge 222 Supplying of Integration with software and Training of complete RFID System as per department incharge 223 Supplying of Data Encoding,Booking Tagging and Registration per book as per department incharge 224 Supplying of RFID Secuity Gates (2 pedestals - 1 gate),RFID Secuity Gate(Provide Installation Service-Yes,Support-24/7 (Live Reporting Language Support-English) as per department incharge 225 Supplying of Automated book drop box (ntegrated RFID Reader • Approx. 250 Books Receiving Cart (Movable) • Client Software for Checking-in Facility and communicating with LMS with provision for E-mail/SMS confirmation • Has automatic hutch which should open only on valid RFID tags and close once the book has been accepted to prevent the patrons from removing checked in books. • Communication with any LMS Software through SIP2/NCIP protocols • Compliant with internationally recognized standards for RFID based library self-services systems. • Book Drop can display item ID once item is returned. • Enabled with necessary items i.e.: Branded CPU etc. • 15” or higher LCD/LED Touch Screen Monitor. • Ethernet High Speed Receipt Printer (Reputed/Branded) • Customizable Design matching the library aesthetics; Contemporary and attractive. • Design is such that there is not damage to the dropped books. • Library Ethernet network and wireless network compliant. • Optional Features: Fingerprint Scanner, Smart Card Readers etc) as per department incharge 226 Supplying of 5KVA Invertor -online UPS with battery back up 100Mah battery (8 units)(Product Specification,Capacity-1100 Voltage-130V ,Rated Input Power-5 KVA,Display-Digital Type-Square Wave Inverter Country of Origin) as per department incharge 227 Supplying of LAN,Switches,Necessary cabling,casing,power supply port including cables as per department incharge 228 Supplying of Installation charges of RFID Tags,Anti-theft sticker,Middleware Application Desktop,RFID Staff statio,Integration of software,Data incoding books,RFID Secuirty Gates,Automated Book Drop Box,Cabling,Casing,Wiring,Switches,LAN as per department incharge 229 Supplying of Air conditioning 1.8Ton heavy duty AC (minimum 3 star rating,Coil material -copper,Power consumption-1950W,Power Requirement -AC 130-285V, 50Hz) as per department incharge 230 Supplying of Desktop,i5 processor ,7th Generation,500GB HDD,4GB RAM,23.8 INCH LED Backlit Monitor,Full HD IPS Panel(Brand-HP,Dell,Acer) as per department incharge 231 Supplying of Headphone with built in microphone,(Communication-Wired) as per department incharge 232 Supplying of 75 diagonal length with 3 GB RAM and 48 GB ROM ,Slim frame anti glare glass.3M Antiglare ,H7 Touch surface hardness,Light weight for easy installation as per department incharge 233 Supplying of Dedicated server-HPE Proliant DL 380,Gen 10 5218.2.3GHz 16core ,1P-32GB-R P408ianNC 8SFF 800WPS Server,Intel xeon G5218 Kit for DL 380,Gen 10 as per department incharge 234 Supplying of 5.5KVA Inverter with battery backup,Microtek inverter,online UPS ,65Mah battery(16 unit )-Exide as per department incharge 235 Supplying of Freight Transportation Charges of Desktop,Headphone,LAN Switches,4K-OPS,Dedicated server,5.5 KVA Inverter with battery back up and Air conditioner as per department incharge 236 Supplying of 86 Diagonal interactive display,3 GB RAM,48 GB ROM,4K Display Android model,Slim framenAnti glare Glass,H7 Touch Surface hardness ,Light weight for easy installation ,Media Suits for Annotation softwatr bundled with education Apps as per department incharge 237 Supplying of 4k OPS i5,7th Gen,8GB RAM,128 GB SSD as per department incharge 238 Supplying of play mounting including white board & Green board,Material post formed ply,Size 15ft(length)x7ft(ht) with green board for chalk,whiteboard for marker and cupboard as per department incharge 239 Supplying of UPS (1KVa,Phase-Single phase.Back up Time 10-20 min,Frequency-50Hz) as per department incharge 240 Supplying ofTraining and installation of 86 diagonal interactive display,4k-OPS,Play mounting including white board & Green board and UPS of 1KVA as per department incharge 241 Supplying of Digital Podium PTGN 500 Windows 8.1 LCD ,Electronic Lectern,On site OEM Warranty in 3 yearsas per department incharge 242 Supplying of PA System sound system with amplifier 350 watt ,30 watt speaker (4 nos) as per department incharge 243 Supplying of wireless mic Dual channel cordless microphone as per department incharge 244 Supplying ofTraining and installation of Digital Podium,86 Diagonal interactive display (4k display),4K-OPS,Play mounting including white board and green board,5KVA invertor,PA System and wireless mic as per department incharge 245 Supplying of Desktop :- 1).i5 Processor, 7th Generation, 500GB HDD, 4GB RAM, 2).23.8 inch. LED backlit Monitor Full HD IPS Panelas per Department Incharge 246 Supplying of 55 LED Display for CCTV Branded LED Display as per department incharge 247 Supplying of CCTV Camera IP based CCTV camera,2 TB Space with NVR with necessary accessories as per department incharge 248 Supplying of Stagmometer as per Department Incharge 249 Supplying ofViscometer as per Department Incharge 250 Supplying of Beaker-50ml as per Department Incharge 251 Supplying of Beaker-100ml as per Department Incharge 252 Supplying of Beaker-250ml as per Department Incharge 253 Supplying of Beaker-500ml as per Department Incharge 254 Supplying of Beaker-1000ml as per Department Incharge 255 Supplying of Buchner Funnel 3 as per Department Incharge 256 Supplying of Buchner Funnel 6as per Department Incharge 257 Supplying of Burette-50ml as per Department Incharge 258 Supplying of Chromatography column 1x18 with stop cock as per Department Incharge 259 Supplying of Conical flask-100ml as per Department Incharge 260 Supplying of Conical flask-250ml as per Department Incharge 261 Supplying of Conical flask-500ml as per Department Incharge 262 Supplying of Conical flask-1000ml as per Department Incharge 263 Supplying of Flat Bottomflask-500ml(Round) B-24 socket as per Department Incharge 264 Supplying of Round bottom flask-50ml Joint B-24 as per Department Incharge 265 Supplying of Round bottom flask-100ml Joint B-24 as per Department Incharge 266 Supplying of 3 neck RB flask B-29,B-19.as per Department Incharge 267 Supplying of Condenser Spiral B-24 and, B-19 as per Department Incharge 268 Supplying of Condenser Spiral B-24 and, B-24 as per Department Incharge 269 Supplying of T-type tube as per Department Incharge 270 Supplying of Rubber Cock No. 10 as per Department Incharge 271 Supplying of Specific Gravity hydrometer 800-1000 as per Department Incharge 272 Supplying of Specific Gravity hydrometer 100-1200 as per Department Incharge 273 Supplying of Universal hydrometer 1000-2000 as per Department Incharge 274 Supplying of Measuring Cylinder-10ml as per Department Incharge 275 Supplying of Measuring Cylinder-50ml as per Department Incharge 276 Supplying of Measuring Cylinder-100ml as per Department Incharge 277 Supplying of Measuring Cylinder-500ml as per Department Incharge 278 Supplying of Measuring Cylinder-1000ml as per Department Incharge 279 Supplying of Measuring Cylinder-2000ml as per Department Incharge 280 Supplying of Measuring flask-100ml as per Department Incharge 281 Supplying of Measuring flask-500ml as per Department Incharge 282 Supplying of Measuring flask-1000ml as per Department Incharge 283 Supplying of Pipette-0.5ml as per Department Incharge 284 Supplying of Pipette-2ml as per Department Incharge 285 Supplying of Pipette-5ml as per Department Incharge 286 Supplying of Pipette-10ml as per Department Incharge 287 Supplying of Pipette-25ml as per Department Incharge 288 Supplying of Separating Funnel-250ml B-24/B-24 as per Department Incharge 289 Supplying of Spatula Flat Spoon 6as per Department Incharge 290 Supplying of Spatula Flat Spoon 5as per Department Incharge 291 Supplying of Stop Cork 2wayas per Department Incharge 292 Supplying of Silica crucible-15ml without Lid as per Department Incharge 293 Supplying of Silica crucible-25ml without Lid as per Department Incharge 294 Supplying of Stalagmometer Straight Graduated as per Department Incharge 295 Supplying of Chemical thermometer 10c-110c as per Department Incharge 296 Supplying of Chemical thermometer 0c-250c as per Department Incharge 297 Supplying of Tiration flask-100ml as per Department Incharge 298 Supplying of Tiration flask-250ml as per Department Incharge 299 Supplying of Tongs crucible S.S.8 as per Department Incharge 300 Supplying of Test tube holder as per Department Incharge 301 Supplying of Filter Flask-500ml as per Department Incharge 302 Supplying of Filter Flask-1000ml as per Department Incharge 303 Supplying of Watch glass 3 as per Department Incharge 304 Supplying of Watch glass 4 as per Department Incharge 305 Supplying of Watch glass 6 as per Department Incharge 306 Supplying of Wire gauge150x150mm as per Department Incharge 307 Supplying of Tripod stand 8 as per Department Incharge 308 Supplying of boiling Test tube 1x8as per Department Incharge 309 Supplying of boiling Test tube 2x8as per Department Incharge 310 Supplying of Reagent Stickers 2x1 as per Department Incharge 311 Supplying of Ordinary Filter paper as per Department Incharge 312 Supplying of Reagent bottles-250mlas per Department Incharge 313 Supplying of Rubber cork as per Department Incharge 314 Supplying of Rubber tube 6mm as per Department Incharge 315 Supplying of Solid Reagent bottle-125mlas per Department Incharge 316 Supplying of Stopwatch plastic body as per Department Incharge 317 Supplying of Test tube stand 12 holes as per Department Incharge 318 Supplying of Thermometer 360 as per Department Incharge 319 Supplying of Test Tube 6mmx15cmas per Department Incharge 320 Supplying of Test Tube 10mmx10cm as per Department Incharge 321 Supplying of China dish 3 as per Department Incharge 322 Supplying of China dish 4 as per Department Incharge 323 Supplying of Brushes for Test Tube as per Department Incharge 324 Supplying of Brushes for Burette as per Department Incharge 325 Supplying of Brushes for Conical flask as per Department Incharge 326 Supplying of LPG gas burner as per Department Incharge 327 Supplying of Condenser Coil 12 as per Department Incharge 328 Supplying of Receiving adopter with vacuum outlet as per Department Incharge 329 Supplying of Plastic Wash bottle-500mlas per Department Incharge 330 Supplying of Pastel and Mortar 3 as per Department Incharge 331 Supplying of Pastel and Mortar 4 as per Department Incharge 332 Supplying of Pastel and Mortar 6 as per Department Incharge 333 Supplying of China Clay 2 as per Department Incharge 334 Supplying of China Clay 3 as per Department Incharge 335 Supplying of China Clay 4 as per Department Incharge 336 Supplying of Petri Dish 3(Borosil) as per Department Incharge 337 Supplying of Petri Dish 4(Borosil) as per Department Incharge 338 Supplying of Distillation Set-Complete flask-500ml as per Department Incharge 339 Supplying of Distillation Set-Complete flask-1000ml as per Department Incharge 340 Supplying of Thermometer Pocket B-14 as per Department Incharge 341 Supplying of Sintered Glass Funnel-25ml as per Department Incharge 342 Supplying of Air Condenser 12 as per Department Incharge 343 Supplying of Burette Stand with Clamp as per Department Incharge 344 Supplying of Cork borer as per Department Incharge 345 Supplying of Capillary Tube for melting point as per Department Incharge 346 Supplying of Dessicators 6 as per Department Incharge 347 Supplying of Dessicators 8 as per Department Incharge 348 Supplying of Dropper with Rubber teats 6 as per Department Incharge 349 Supplying of Dropper 4(Borosilicate glass) as per Department Incharge 350 Supplying of Dropping bottle-125ml as per Department Incharge 351 Supplying of Funnel Stand as per Department Incharge 352 Supplying of Fusion Tubeas per Department Incharge 353 Supplying of Glass Rod as per Department Incharge 354 Supplying of Glass Tube as per Department Incharge 355 Supplying of Stopwatch Steel body as per Department Incharge 356 Supplying of Magnetic Stirrer as per Department Incharge 357 Supplying of Rubber Gloves as per Department Incharge 358 Supplying of Reagent as per Department Incharge 359 Supplying of Sandbath as per Department Incharge 360 Supplying of Tissue Paper(Local made) as per Department Incharge 361 Supplying of Double Beam PC Microprocessor UV-VIS Spectrophotomet erMake:Systroni cs Model: 2202 PC Based Double Beam Automatic source optimization ,Base line calibration & Cell optimization 200 - 1100 nm Range2. 0 nm Bandwidth%T. Abs. Conc . (K factor. Multi standard ). Multi component measuring modesSingle Wave length, Multi Wave length Scan (with multi scan facility). Time Scan. Kinetic scan operating modes Automatic 5 position sample changer Single Position 50 /100 mm Cuvette Holder (Optional) as per Department incharge 362 Supplying of Refrigerated Centrifuge,(Specification:Speed:- 20000 Max.,RCF:- 37570 Max.,Lowest Temp:- -8,Noise:- <-60db)as per Department incharge 363 Supplying of Refrigerated Centrifuge Essential accessories Required:. With angle Heads (with polypropylene tubes)Model- R-248M 24xl.5 ml as per Department incharge 364 Supplying of Refrigerated Centrifuge 2. Voltage stabilizer:- 03 KW Servo controlled Voltage Stabilizer, input 170 volts to 260 volts, output 220 volts to 240volts as per Department incharge 365 Supplying of PCR machine(Specification- Well block, Gradient, temp. range 4° - 99-irC, memory capacity 10000 protocols , display 7inch,volume capacity I 0- 100 μL , preloaded protocol, temperature accuracy ±0.2°C@99°C, with PCR wizard as per Department incharge 366 Supplying of SOS PAGE unit and Western Blot apparatus along with power bank -Mini-TBC electroph_oretic transfer cell, includes: Mini 01P-4 cell tank and lid with cables, buffer, Mini transfer module, gel holder cassettes, 4 fiber pads, cooling units, instructions, Western blot unit, compatible power bank as per Department incharge 367 Supplying of pH Meter With electrode(Type of PH Mater - Portable,Ph Range:0-14,Resolution-0.01pH,compensation-0 to 80 degree celsius) as per Department incharge 368 Supplying of Deep fridge(It is used to store chemicals and preserve samples at very low sub-zero temperatures or below)as per Department incharge 369 Supplying of Autoclave (Vertical)Size- 400 x 600mm ,;Capacity- 75Ltr as per Department incharge 370 Supplying of Hot air oven (Sterilization) as per Department incharge 371 Supplying of Incubator Shaker-Growth and enumeration of microbes (Broth cultures) as per Department incharge 372 Supplying of Horizontal Laminar air flow(Sterile environment Size 4X2)as per Department incharge 373 Supplying of Horizontal Agarose gel electrophoresis unit with gel caster and Power pack Separation of macromoleculeas per Department incharge 374 Supplying of Vortex mixture-To mix content of test tubes and microfuge tubes. as per Department incharge 375 Supplying of Ultrapure Water Purification System:MiliQ Water For distill wateras per Department incharge 376 Supplying of Micropipets - 0.1μL-2.5μL 0.5μL-10.0μL 10.0μL-l00μL 20.0μL-200μL l00μL-l000μL as per Department incharge 377 Supplying of Quebec Colony Counter -Count the microbial colonies as per Department incharge 378 Supplying of Light Microscope (General) 10X,20x, 45x, l00x Visualize microorganisms as per Department incharge 379 Supplying of Bifocal microscope with illuminators, Camera attachment and computer Visualize microorganisms and microgrphy as per Department incharge 380 Supplying of Magnetic stirwith Hotplate and magnetic beads To stir the liquids , preparation of solution as per Department incharge 381 Supplying of Heating mantle For heating round bottomed flask/distillation flask as per Department incharge 382 Supplying of Microwave oven To heat liquids instead of flaming. Samsung/ LG 20 Ltrs as per Department incharge 383 Supplying of Glass Dessicators Used for dessication as per Department incharge 384 Supplying of Fluorescence microscope A fluorescence microscope is an optical Microscope that uses fluorescence and phosphore scence instead of,or in addition to, reflection and absorption to study properties of organic or inorganic substances as per Department incharge 385 Supplying of Electronic Analytical Balance It is used to weigh small quantities of chemicals and samples precisely and quickly. Readability- 1 mg (0.001 g) Cap.- 420gm as per Department incharge 386 Supplying of Electronic Top pan Balance- Readability- 0.1 g Cap.- 2 kg.as per Department incharge 387 Supplying of Double Distillation Unit ,.Approx output: 2 Lit/hrs Wattage:3.3 .KW With safety Cutoff Device Water Stills are carefully designed to produce high purity pyrogen free distiiied water. The water still comprises ofborosilicates glass horizontal typeboiler, coil condenser, constant level device, silica sheathed heaters, along with stand and clamps. All parts are replaceable. pH/conductivity:6-7 / 1-2 μSiem forsingle, 6-7/0.8-lμS/cm for double distilled water as per department incharge 388 Supplying of Microtome-5286(Product Specification Minimum Setting Value-0.5 um,Object Feed-28 mm,Vertical Stroke-60 mm,Specimen Orientation X and Y Axis Universal 8 Degree Trimming Thickness Range-1 um-100 um Operation-Automatic. (Motorized Feed & sectioning and Emergency Stop Provided),Sectioning Speed-0-400 mm/sec.,Specimen-Orientation Z Axis-Upto 360 Degree,Retraction Value-Adjustable Max Specimen Size-50 x 50 mm,Section Thickness Range-0.5 um-60 um)Senior rotary microtome as per Department incharge 389 Supplying of Cryostat -(Product Specification Section Thickness Range-0.5 Micron to 100 Micron (with the increment of 0.5 Micron, 1 Micron, 2 Micron, 5 Micron) Power Supply-220v,Dimension-750mm x 750mm x 950mm (approx) Weight -123 kg (approx),Remote Control-Optional,Sectioning Mode-Single step mode/ Continuous mode Hand Wheel Control-Feather Touch Keypad/ Foot Switch/ Remote Control (optional),Sterilization-U.V-C Sterilization,Cooling down time Up to -30 DegreeC-2 Hour 30 Min Specimen Retraction setting Range-5 Micron to 100 Micron (with increment of 5 Micron),Compressor-Dual Compressor,Cryo Chamber Temp. Adjustable -1 DegreeC to -30 DegreeC Block Holder Head Temperature-Adjustable -1 DegreeC to -35 DegreeC Illumination-LED Lamp)Ultimate usico fully automatic cryostat as per Department incharge 390 Supplying of ELISA -Vet scientific(Specification-Product Specification Automation-Semi Automatic,Assays Performed-ELISAs, Immuno Assays Plate Format-96 well,Optical System Filter-based Detection Method-Absorbance,Number Of User Programs 42 Storage-100000 Results,Filter Positions-8 Display Type-Touch Screen Packaging Type-EXPORT QUALITY,Testing Speed-3 second Type Of Filter 405,450,492, 630,Power Source-115/230 V AC, 50Hz,Weight-9 Kg,Is It Portable-Non Portable, sample Type-Serum, Plasma, Urine, CSF, Whole Blood,sample Volume Range-10-100 Interface-RS232/ USB) as per Department incharge 391 Supplying of Calorimeter -A VI Digital (A VI Scientific,Frequrcy:50Hz,Voltage:230-280V,operating time per test-10 min) as per Department incharge 392 Supplying of HaemometerSahli type-Microsidd (Specification:Amber coloured glass bottle -1 No.,Glass Stirrer-1 No.,Dropper with teat -1 No.,Cleaning Brush -1 No.,Spare latex tubing one meter -1 No.Round tube haemoglobinometer) as per Department incharge 393 Supplying of Anti - theft Sticker with the University logo as per Department incharge 394 Supplying of Middleware Application Desktop(Write and Read Tags) as per Department incharge 395 Supplying of RFID Staff Station or desktop reader (Used for tagging of books and circulation {lssue/Return) operations through RFID) as per Department incharge 396 Supplying of Integration with Software and Training of Complete RFID System as per Department incharge 397 Supplying of RFIDSecurityGates (2 pedestals-1 gate) RFID Security Gate (Single Lane) as per Department incharge 398 Supplying of Automated Book drop Box as per Department incharge 399 Supplying ofCabling. Casing. Wiring , Switches as per Department incharge 400 Supplying of Freight Transportation of Miidle ware Application Desktop,RFID STAFF Station,Integration with software training,Automated Drop box ,Cabling,Casing,Wiring,Switches as per Department incharge 401 Supplying of LAN . Switches, Necessary Cabling, Casing , Power Supply port including cables as per Department incharge 402 Supplying of Dedicated serverGHZ 16 core 1P-32GB -RP408ia -NC8SFF800WPS Serverintel Xeon -G5218 Kit for DL 380 GEN-10-HPE 32GB 2RX4 PC-4 2933YR Smart kit ,HPE DL38x Gen 10-12 Gb SAS Expande,HPE DL 380Gen 10 Box 1/2 Cage Bkpin kit ,HPE 24TB SAS 12G 10K SFF SC 512eDS HDD .HPE 800 WFS Ht Plg LHPwr Sply kit,HPE 3 Year Fiundation care 24x7 DL 380 Gen 10 Serviceas per Department incharge 403 Supplying of RS 86+_TB619RS, 3GB RAM and 48 GB ROM,4K Display Android model,3 GB RAM And 48 GB ROM,slim frame,Anti Glare Glass,3M Anti glare H7 Anti touch surface hardness lightweight for easy installation,Media suits for Annotation,Software bundled with education apps,Office suits,Great writing experience,Object recognition -First pal,/Fine pen ,Touch Points-20 points under window and 10 points under android,178 degree viewing angle IR ,Touch 15000,1 contrast ratio,4 MS Response time 50000 hours life,Reduce clutter and bring efficiency for the faculty,Remote control,15 wattX2 speaker,Android 8.0,Newline cast,Display management,Newline broadcast including installation and Trainingas per Department incharge 404 Supplying of Deep Fridgeas(2 in 1 Converti Freezer & Cooler Corrosion Resistant Cooling Coil & PPGI for inner & outer body Heavy Duty Compressor & Tropicalised Design Approximately 14% Higher Net Capacity compared to competition Sleek Design with heavy duty performance) per Department Incharge 405 Supplying of Autoclave (Horizontal,Height X Dia: 450mm x 250mm Height x Dia: 18Inch x 10Inch,Capacity: 22 Ltr,Load: 2.0 KW) as per Department Incharge 406 Supplying of Autoclave (Vertical): size- 400x600mm, Capacity- 75Ltr as per Department Incharge 407 Supplying of Hot air oven(Standard double wall fabrication. Inner chamber made of highly polished stainless steel sheet. Exterior fabricated out of thick mild steel sheet duly finished in stove enamel off-white paint or paste mat finish colour combinations.Nichrome wire heating elements -provided on three sides attain quick and uniform heating in range of 50c to 250c + 1c controlled by capillary type thermostat.Inner Chamber Size 18x18x18 inch. made of Stainless Steel) : any Standard make as per Department Incharge 408 Supplying of Bacteriological incubator(Item Weight ‎10 kg Product Dimensions-30 x 30 x 30 cm; 10 Kilograms,Item model number-12X12,Item Height-30 Centimeters Item Width-30 Centimeters) as per Department Incharge 409 Supplying of Bacteriological shaking incubator as per Department Incharge 410 Supplying of BOD incubator as per Department Incharge 411 Supplying of Laminar air flow any Standard company as per Department Incharge 412 Supplying of Micropipettes with microtips :(1.0uL-10.0uL, 10.0uL-100uL, 100uL-1000uL, 20uL-200uL): A. Prime Variable Pipette, B. Fully Autoclaveable Variable Vol. Pipetteas per Department Incharge 413 Supplying of Colorimeters with cuvettes any Standard company as per Department Incharge 414 Supplying of Western Blot apparatus, as per Department Incharge 415 Supplying of Powerpack with wiresas per Department Incharge 416 Supplying of Homogeniser as per Department Incharge 417 Supplying of PCR machine Block Formats 96x0.2ml(A),54x0.5ml(B), 96x0.2ml +77x05ml©, 384well(D) Size(WxDxH,mm)-380x270x250 as per Department Incharge 418 Supplying of UV Transilluminator/UV chamber UV source: 365nm Wave Length Viewing area: 24x14cm Anti Slip rubber foot provided for base as per Department Incharge 419 Supplying of CO2 incubator as per Department Incharge 420 Supplying of pH meter and buffers: A.pH meter B. pH buffers as per Department Incharge 421 Supplying of Water bath (any Standard company ) as per Department Incharge 422 Supplying of Fume Hood: size- 3x3x2 wooden with Granite working area as per Department Incharge 423 Supplying of Soxlet apparatus with heating mantle and distillation set up as per Department Incharge 424 Supplying of Kjeldahl Apparatus as per Department Incharge 425 Supplying of Ultrapure Water Purification System: MiliQ water as per Department Incharge 426 Supplying of Quebee Colony Counter as per Department Incharge 427 Supplying of Light Microscope (general) 25x, 45x, 100x s as per Department Incharge 428 Supplying of Bifocal microscope with illuminators as per Department Incharge 429 Supplying of Magnetic stirrer with magnetic beads(any Standard company )as per Department Incharge 430 Supplying of Magnetic stirrer with hot plate (Remi) as per Department Incharge 431 Supplying of Heating mantleas per Department Incharge 432 Supplying of Microwave oven ((20Ltr) as per Department Incharge 433 Supplying of Glass Dessicators as per Department Incharge 434 Supplying of Computer : Core i9, 7th Gen. 20 LED Monitor, 4GB DDV, 1TB HDD, DV writer HP/Dell as per Department Incharge 435 Supplying of Culture room: Tissue culture Rack fitted with 16 tubes, 8 bulbs, 4UV & Timer as per Department Incharge 436 Supplying of Electronic Analytical Balance:- Readability- 1mg(0.001g) Cap.-420gm as per Department Incharge 437 Supplying of ElectronicTop-pan Balance:-Readability- 0.1g Cap- 2kgas per Department Incharge 438 Supplying of Electroporator:- as per Department Incharge 439 Supplying of Fermenter(7.5L)(any Standard company )as per Department Incharge 440 Supplying of Fluorescence Microscopeas per Department Incharge 441 Supplying of Hot air oven universalas per Department Incharge 442 Supplying of Distillation Unit as per Department Incharge 443 Supplying of Membrane filter assembly 5000 mlas per Department Incharge 444 Supplying of Fluorimeter as per Department Incharge 445 Supplying of Homogeniser: Remi model- RQT-127 A/D High speed homogenizer, with 1/8 HP Motor, Homogenizer Working Volume [H2O] 0.1-50ml (Dispersing shaft DS-160/5) WEIGHT 0.6KG Dimension[LxWxH] 46mmx55mmx230 operating environment 0-40degre, 85% rel. humidity as per Department Incharge 446 Supplying of ELISA reader and Microtitre plates: ELISA Wavelength range 400nm-800nm Accuracy- +-1% at 1.0OD, 450nm Dimension 450x350x197mm as per Department Incharge 447 Supplying of Liminar air flow : 4x2x2 feet, stainless steel as per Department Incharge 448 Supplying of Gel Documentationd system as per Department Incharge 449 Supplying of 5 KVA Inverter with Battery Backup. Microtek inverter, online UPS 65Mah Battery (16 units) -Exide as per Department Incharge 450 Supplying of 12V/26AH- Batteryas per Department Incharge 451 Supplying of Headphone with built in microphone (Brand) as per Department Incharge 452 Supplying of Furniture:- Computer Table & Chairs & Table- Chair for lab. Instructor and student (50 students per batch) as per Department Incharge 453 Supplying of Network:- LAN, Switches, Cabling, Casing Power Supply Port including Cables as per Department Incharge 454 Supplying of 5.5 KVA Inverter with Battery Backup. Microtek inverter, online UPS 65Mah Battery (16 units) -Exide as per Department Incharge 455 Supplying of RS86+ TT8619RS 3 GB RAM, 48 GB ROM 4K Display, Android Model Slim Frame, Anti-Glare Glass, 3M Anti-Glare, H7 touch surface hardness, Light weight for easy installation. Media Suits for Annotation Software. Bundle with Education Apps. Office Suits. Great Writing Experience. Object Recognition- Fist/Palm/Fine Pen, Touch Points-20 points under Android. 178 Degree viewing Angle, IR Touch. 15000:1 contrast ratio, 4MS Response Time, 50000 Hours life. Reduce cluster and bring efficiency for the faculty. Remote control, 15 watts x 2 speaker. Android 8.0, Newline Cast, Display Managemen, Newline Broadcast Including Installation and Training. as per Department Incharge 456 Supplying ofpH meter(Digital) :- pH range: 0-14, Temperature Range: 0.0 to 100 C (Manual Compensation) as per Department Incharge 457 Supplying ofNoise Level meter:- Auto/Manual ranging from 30 to 130dB in 6 ranges as per Department Incharge 458 Supplying ofWater analysis Kit:- They include; alkalinity, chloride, hardness, iron, and sulphate as per Department Incharge 459 Supplying ofHigh volume sampler:- 1)PM-2.5- Designed to meet International Standards for High volume air Sampling of PM2.5 particulates. 2)PM-10-U.S EPA FRM Designed for the determination of suspended of PM-10 particulates concentrations. (RFPS-1287-063) 3)TSP- Designed to meet U.S EPA reference method for determination of total suspended particulates(TSP) concentration as perDepartment Incharge 460 Supplying ofSoil testing kit (mrinda parikshan kit) : Use for micro and macro nutrients as per Department Incharge 461 Supplying ofSeive plate with shaker : 5mm,1mm,2mm) as per Department Incharge 462 Supplying ofUV/Visible spectrophotometer:- Spectral bandwidth 1 nm (190 to1100nm , Lamp Type 20-W halogen lamp and deuterium lamp as per Department Incharge 463 Supplying ofAutoclave : 10-15 litre Steam Sterilizer as per Department Incharge 464 Supplying ofLaminar hood (Horizantal) : Horizontal air flow cabinet, filter air blow across the work zone in horizontal direction. This constant flow of air provides material and product protection as per Department Incharge 465 Supplying ofHot plate(pic):-Temperature range: 350 C as per Department Incharge 466 Supplying ofShakeer incubator Compact Bench top shaker with temperature control range from Ambient +50C to 600C. Tray dimension : 420x420 , Speed 50-350 rpm with accuracy of +/- 2rpm as per Department Incharge 467 Supplying ofMuffle Furnaces (15x125x250)cm: Temperature upto 35C to 1400C as per Department Incharge 468 Supplying of Analytical Balances:Capacity 220gram as per Department Incharge 469 Supplying ofDigester : 1) vessel size : Dia 39 mm (Aprox.); Volume 160ml 2)Temperature : upto 200degC as per Department Incharge 470 Supplying ofDouble distilled water plant: Model- Vertical:- Distlled Water Output Capacity-2.5 Litres/Hours, Distillate water quality as per Department Incharge 471 Supplying ofOven:- Dry ovens- 30 to 1000 litre capacity. as per Department Incharge 472 Supplying of B.O.D Incubator: Volume 68 Litre as per Department Incharge 473 Supplying ofMagnus Microscope:- Magnification 4x,10x,40x, and 100x as per Department Incharge 474 Supplying ofDesiccators:- Contain: Silica Gel dimension;12x12 in (30.5x30.5 cm),Material Glass as per Department Incharge 475 Supplying ofRichter scale hardness tester Portable Rockwell/brinell vickers Hardness Testing Instrument Mold metal hardness meter display:-parameter- HRC Display Type, Digital Model Name/Number- ATedigiHR, Accuracy- 0.1 HRC Dimensions of Machine base (approx.) 150x425 mm as per Department Incharge 476 Supplying ofProctor Penetrometer: Proctor Penetrometer- Complete with set of needle points Weight, 2 kg as per Department Incharge 477 Supplying ofGas Chromatography Retention time repeatability-< 0.008% or 0.0008 min Area rpeatability -<1% RSD, using 2ng tetradecane as per Department Incharge 478 Supplying of Atomic Absorption Spectrometry(AAS):- aa-7000 SERIES OF Atomic Absorption Spectrophotometers features high- sensitivity analysis as per Department Incharge 479 Supplying ofWavelength range; 400 to710nm Wavelength selection: 8 in-built gelatin filters: 430,470,490,520,540,580,600 and 710 nm Measurement ranges; 0-100%T, 0-1.50Abs, 0.1 to 1000 Concentration. Resolution: 1%T, 0.01Abs, 0.1 to 1 Concentration as per Department Incharge 480 Supplying of Laptops(of Specification:Processor Corei5,RAM:4GB,Hard drive:500GB ,Screen size:12 inch):as per Department Incharge 481 Supplying of Desktops: i7 3rd Gen, 1TB HDD, 4GB RAM, Windos 10, MS office, Graphics card as per Department Incharge 482 Supplying of Xerox Machine(Product Specification:Functions Multi-Function:Supported Paper Size-A3,Supported OS-all,Color Output-Black & White,Number Of Trays-4,Item Color-white and blue Print Speed-up to 35 ppm,Weight 129 kg,Print Technology-Laser Warm-Up Time, As fast as 11 seconds (black and white) Duty Cycle-WorkCentre 5335: Up to 150,000 pages / month Resolution-200 x 1200 dpi) as per Department Incharge 483 Supplying of Air Conditioning:-1.5 Ton heavy duty AC (mimimum 3 Star rating) as per Department Incharge 484 Supplying of Luminous Cruze 3.5KVA Inverter with RC 18000 Battery (4 Batteries) as per Department Incharge 485 Supplying of Projector(Special Feature-portable,Connectivity Technology,Bluetooth, Wi-Fi, USB, HDMI,Display resolution 1920 x 1080,Display Type-LED) as per Department Incharge 486 Supplying of Godrej Lecture Hall Furniture as per Department Incharge 487 Supplying of Electronic Podium(Speaker type-Tweeter,Auxillary,wireless,floor standing) as per Department Incharge 488 Supplying of Smart board (Screen size-11 inches,Connecting technology-Wifi,Multimedia)as per Department Incharge 489 Supplying of Black board( Melamine Writing Surface (Chalk), Paper Honeycomb Core, 6063-T6 Alloy Aluminium Frame & Virgin ABS CornersMelamine Writing Surface (Chalk), Paper Honeycomb Core, 6063-T6 Alloy Aluminium Frame & Virgin ABS Corners) as per Department Incharge 490 Supplying of Glassware rack as per Department Incharge 491 Supplying of installation of Air conditioner,Luminous Cruze,Projector,Lecture Hall Furniture,Electronic podium,Smart board and black board as per Department Incharge 492 Supplying of Inductively coupled Plasma - Optical Emission Spectrometer with CID detector technology for multi-element analysis of geological petrogical etc. samples in ppb level as per Department Incharge 493 Supplying of Suppressed ion analysis system for anion and cation analysis in water, wastewater, environmental samples and also upgradable to combustion for determination of corrosive halogens and sulfur in Petrochemicals, gaseous samples, solid samples, and complex samples as per Department Incharge 494 Supplying of CHNS/O for the analysis of Carbon, Hydrogen, Nitrogen, Sulfur and Carbon in organic matrices, soil, feed , plant samples, petroleum products, Coal, Coke, Biomass & Liquid Fuels as per Department Incharge 495 Supplying of Gas Analyzers for hydrocarbon and permanent gas analysis as per Department Incharge 496 Supplying of Benchotop XRD as per Department Incharge 497 Supplying of XRF Spectrometer as per Department Incharge 498 Supplying of Refrigereted Centifuge MakE-REMI, Model-C24 PLUS :- Max. Speed:20000, Max. RCF:3757, Max. Lowest Temp.:8, Noise:60db. Essential accessories Required: 01. Withangle Heads (with polypropulene tubes) Model-R-248M24x1.5ml 2)Voltage stabilizer:-03KW Servocontrolled Voltage Stabilizer, input 170volts to 260volts, output 220 to 240volts as per Department Incharge 499 Supplying of pH Meter compatible poer bank Make: REMI :- With eletrode as per Department Incharge 500 Supplying of Bench top Centrifuge Make: Tarson, : - SPINWIN MC-001 6 places Rotor for 1.5 ml tubeas per Department Incharge 501 Supplying of Deep Fridge: It is used to store chemicals and preserve samples at very low sub-zero tempertures or below as per Department Incharge 502 Supplying of Autoclave(Vertical) : size- 400x600mm capacity- 75Ltr as per Department Incharge 503 Supplying of Hot air oven : Sterilization as per Department Incharge 504 Supplying of Incubator Shaker: Growth and enumeration of microbes(Broth Cultures) as per Department Incharge 505 Supplying of Horizontal Laminar air flow:- Sterile environment size 4x2as per Department Incharge 506 Supplying of Ultrapure Water Purification System: MiliQ Water : for distil water as per Department Incharge 507 Supplying of Micropipets (Ependroff): 0.1uL-2.5uL, 0.5uL-10uL, 10.0uL-100uL, 100uL-1000uL each oo these 1pcs as per Department Incharge 508 Supplying of Light Microscope (general)10X, 20X, 45X, 100X, : Visualize microorganisms as per Department Incharge 509 Supplying of Bifocalcal Microscope with illuminators, Camera Attachment and comput: Visuallize microorganisms and micrography as per Department Incharge 510 Supplying of Magnetic stir with Hotplate and magnetic bead as per Department Incharge 511 Supplying of Heatingmant; for heatinground bottomed flask/distillation flask as per Department Incharge 512 Supplying of Microwave oven: To heat liquids instead of flaming. 20Ltrs as per Department Incharge 513 Supplying of kydroPro 100 handeld multiparameter water quality analiser: Turbedityas per Department Incharge 514 Supplying of Petrological Microscope: Study of Optical minrology as per Department Incharge 515 Supplying of Ore petrological microscope: Study of ore petrology as per Department Incharge 516 Supplying of Miscellaneous instruments as per Department Incharge 517 Supplying of glassware as per Department Incharge 518 Supplying of chemical as per Department Incharge 519 Supplying of Arc GIS(Latest) as per Department Incharge 520 Supplying of GCD Toolkits as per Department Incharge 521 Supplying of SURPAC Software as per Department Incharge 522 Supplying of Intergraph Edu Kit [GIS+RS] Version 2020 or latest(Software content as per list), 5 users for Erdas imagine Professional and 5 users for Geomedia professional Software as per Department Incharge 523 Supplying of Interactive Flat Panel as per Department Incharge 524 Supplying of 2 Virtual Class Room including capture, recording and streaming online, 1 Servers one per 05 classrooms per Department Incharge 525 Supplying of N-computing for smart classrooms including servers and clients as per Department Incharge 526 Supplying of Tagging of documents(books/hard-bound journals/CDs/technical films etc)in RFID Technology as per Department Incharge 527 Supplying of Sofwares, Server Machines, Air-Conditioning Systems,Xerox Machines, Lamination Machines, Binding Machines, Furniture/Furnishing, Computers, Printers etc as per Department Incharge 528 Supplying of Digital Podium, PTGN 500, Window & 1 LCD, Elecronic Lectern, on site OEM. Warranty 3years, 3GB RAM,4GB ROM as per Department Incharge 529 Supplying of Air Conditioning:-1.8 Ton heavy duty AC (mimimum 3 Star rating) as per Department Incharge 530 Supplying of Black/ White,Printer:- scan-copy all in printer- Branded as per Department Incharge 531 Supplying of CCTV set for floor: 55 LRD display for CCTV. CCTV Camera-1 P based CCTV camera 2TB space with NVR with necessary accessories as per Department Incharge 532 Supplying of 5KVA Inverter online UPS with battery backup 100Mah battery(8 units) as per Department Incharge 533 Supplying of Electrophoresis Apparatus as per Department Incharge 534 Supplying of Bacteriological Incubator as per Department Incharge 535 Supplying of Autoclave as per Department Incharge 536 Supplying of Centrifuge as per Department Incharge 537 Supplying of Rotar Head as per Department Incharge 538 Supplying of Rotar Head 25 as per Department Incharge 539 Supplying of Gel documentation system as per Department Incharge 540 Supplying of Spectrophotometers as per Department Incharge 541 Supplying of compoud Microscope as per Department Incharge 542 Supplying of Trinocular Microscope with camera as per Department Incharge 543 Supplying of Semi-Automated Microtonne as per Department Incharge 544 Supplying of DNA Sequencer as per Department Incharge 545 Supplying of Spectrophotometer as per Department Incharge 546 Supplying of Laminar air flow chamber as per Department Incharge 547 Supplying of Tissue culture rack as per Department Incharge 548 Supplying of PCR Apparatus as per Department Incharge 549 Supplying of Liquid nitrogen cylinder as per Department Incharge 550 Supplying of TLC apparatus kit as per Department Incharge 551 Supplying of TLC Visualizer/documentation as per Department Incharge 552 Supplying of HPLC System as per Department Incharge 553 Supplying of Scientific vortex mixer as per Department Incharge 554 Supplying of Soil Thermometer as per Department Incharge 555 Supplying of Scientific Digital Balance as per Department Incharge 556 Supplying Equipments for workshop,Seminar & Excrusion as per Department Incharge 557 Supplying Equipments for Non-Recurring(Research Equipment) as per Department Incharge 558 Supplying Equipments for Recurring(Chemical & Glassware) as per Department Incharge 559 Supplying of Furniture Bookshelves, Study Tables and Chairs for Readers as per Department Incharge 560 Supplying of Desktop i5 Processor, 7th Generations, 500GB HDD, 4GB RAM, 23.8 inch, LED backlit Monitor Full HD IPS Panel (Brand: HP/DELL) as per Department Incharge 561 Supplying of Headphone with built in microphoneas per Department Incharge 562 Supplying of Printer with scanner (Laser,Colour/B/W)as per Department Incharge 563 Supplying of Scanner(USB,25.2D x 36.8W x 4.3H Centimeters,Slide) as per Department Incharge 564 Supplying of Xerox Machine:- (,Platen cover & Toner, Resolution (DPI):1200 X 1200dpi, Duty Cycle:1.3 Sec) as per Department Incharge 565 Supplying of Lamination Machine(Paper size-A4,A3,FS,max laminating width-500mm,Laminating speed-1200mm)as per Department Incharge 566 Supplying of CCTV Camera(Full HD Picture,AI Powered Motion Detection,Infrared Night Vision; 360° Panorama,Talk Back Feature (2-Way Audio)Material Type: Plastic; Included Components: Camera, Power Adapter, Charging Cable, Wall Mounting Kit, User Manual; Specific Uses For Product: Surveillance) as per Department Incharge 567 Supplying of 75 inch diagonal length with 3 GB RAM, 48 GB ROM 4K Display, Slim Frame, Anti-Glare Glass, 3M Anti-Glare, H7 touch surface hardness, Light weight for easy installation. Media Suits for Annotation Software. Bundle with Education Apps. Office Suits. Great Writing Experience. Object Recognition- Fist/Palm/Fine Pen, Touch Points-20 points under Android. 178 Degree viewing Angle, IR Touch. 15000:1 contrast ratio, 4MS Response Time, 50000 Hours life. Reduce cluster and bring efficiency for the faculty. Remote control, 15 watts x 2 speaker. Android 8.0 Newline Cast Display Management including wall mount and installation. as per Department Incharge 568 Supplying of RS75+ TT7519RS RS 75+ comes with 75 inch diagonal length with 3 GB RAM, 48 GB ROM 4K Display, Android Model Slim Frame, Anti-Glare Glass, 3M Anti-Glare, H7 touch surface hardness, Light weight for easy installation. Media Suits for Annotation Software. Bundle with Education Apps. Office Suits. Great Writing Experience. Object Recognition- Fist/Palm/Fine Pen, Touch Points-20 points under Android. 178 Degree viewing Angle, IR Touch. 15000:1 contrast ratio, 4MS Response Time, 50000 Hours life. Reduce cluster and bring efficiency for the faculty. Remote control, 15 watts x 2 speaker. Android 8.0 Newline Cast Display Management. as per Department Incharge 569 Supplying of Wall Mount Kit(Material: SS,Max loading capacity-60 to 100kg) as per Department Incharge 570 Supplying of Live streaming software Software Software for Live Streaming or Live telecast as per Department Incharge 571 Supplying of 75 inch diagonal length with 3 GB RAM, 48 GB ROM 4K Display, Slim Frame, Anti-Glare Glass, 3M Anti-Glare, H7 touch surface hardness, Light weight for easy installation. Media Suits for Annotation Software. Bundle with Education Apps. Office Suits. Great Writing Experience. Object Recognition- Fist/Palm/Fine Pen, Touch Points-20 points under Android. 178 Degree viewing Angle, IR Touch. 15000:1 contrast ratio, 4MS Response Time, 50000 Hours life. Reduce cluster and bring efficiency for the faculty. Remote control, 15 watts x 2 speaker. Android 8.0 Newline Cast Display Management including wall mount and installation. as per Department Incharge 572 Supplying of Frieght Transportation of 4K Display,Wall mount kit,Live Streaming software as per Department Incharge 573 Supplying of cctv solutions for Department with 20 cameras(Image Sensor Type-CMOS,Image Sensor Size-0.357 inch,Camera Image Sensing capacity (Picture Mode)-2MP,Resolution-Full HD (1920 x 1080 Pixel)-Day/Night Capable-Yes,IR illumination Range(mtr) 200 Type of Camera HousingDOME CAMERA,IP Camera Yes) as per Department Incharge 574 Supplying of installation and commisioning of CCTV and other computer equipment as per Department Incharge 575 Supplying of 55 Tv for seeing all cctv in HOD room as per Department Incharge 576 Supplying of8 PORT EPBX as per Department Incharge 577 Supplying ofTELEPHONE as per Department Incharge 578 Supplying ofWIRE as per Department Incharge 579 Supplying of CRON BOX as per Department Incharge 580 Supplying ofSWITCHES FOR PORTS as per Department Incharge 581 Supplying of Workststion Table, Chairs, Desktop, UPS as per Department Incharge 582 Supplying of LAN, Switches, Necessary Cabling, Casing Power Supply Port including Cables as per Department Incharge 583 Supplying of Refrigerator(Storage & Interior Description : | Cooling Type ; Frost Free | Display Type ; Thermostat | Shelf Material ; Toughened Glass | Compressor Type ; Reciprocatory)as per Department Incharge 584 Supplying of Microwave(Special Features: Quartz Heater - Concealed Heating. Safer Cooking, Stainless Steel Cavity - More Hygienic. More Durable, Child Lock - Ensures complete safety especially for homes with young children, Interior light)as per Department Incharge 585 Supplying of Washing Machine( Fully automatic 6 kg) as per Department Incharge 586 Supplying of Sewing Machine(Motorised)as per Department Incharge 587 Supplying of Weighting Machineas per Department Incharge 588 Supplying of Blood Pressure Monitor as per Department Incharge 589 Supplying of Oximeter as per Department Incharge 590 Supplying of Gluco Meter as per Department Incharge 591 Supplying of Test Tube & Breakers as per Department Incharge 592 Supplying of RO Water Purifier as per Department Incharge 593 Supplying of Microscope(Student) as per Department Incharge 594 Supplying of Crockery Set as per Department Incharge 595 Supplying of Cocking Utensils set as per Department Incharge 596 Supplying of Cutlery Set as per Department Incharge 597 Supplying of Sofa Set + Centre Table as per Department Incharge 598 Supplying of A.C (Split 2 Ton,3 Star,Twin invertor HD Compressor)as per Department Incharge 599 Supplying of Stabilizer(Automatic Voltage Stabilizer,37.4 x 27.1 x 19.8 Centimeters,5 kg 700 g)as per Department Incharge 600 Supplying of Inveter with battery(Capacity -100AH,Battery Type-Tubular Battery,Warranty-1 years,Protection From Short Circuit, Over Temperature, Battery Deep -Discharge,Backup Time 8 Hrs Backup- 1 FAN ,28 Light , 8 Hrs Backup - 1FAN ,1 Light Battery Condition-New) as per Department Incharge 601 Supplying of Desktop Computer with UPS and Computer Tableas per Department Incharge 602 Supplying of Original operating system software window 10 with Antivirus as per Department Incharge 603 Supplying of Printer with scanner (inkjet,Colour/B/W)as per Department Incharge 604 Supplying of Dining Table Set as per Department Incharge 605 Supplying of Camera as per Department Incharge 606 Supplying of Mixer Grinder as per Department Incharge 607 Supplying of Iron as per Department Incharge 608 Supplying of Wall Clockas per Department Incharge 609 Supplying of Whole tailoring Equipments (Local) as per Department Incharge 610 Supplying of Knitting Equipments(Local) as per Department Incharge 611 Supplying of Flower Arrangement Equipments) (local) as per Department Incharge 612 Supplying of Aluminium Set as per Department Incharge 613 Supplying of Plastic Tub as per Department Incharge 614 Supplying of Dustbin(Big) as per Department Incharge 615 Supplying of Basket &Mug as per Department Incharge 616 Supplying of White Table Cloth(Big size)as per Department Incharge 617 Supplying of Wash Basin(Local)as per Department Incharge 618 Supplying of Gas Stove +Cylinderas per Department Incharge 619 Supplying of Curtains(Local) as per Department Incharge 620 Supplying of Floor Mats (Local) as per Department Incharge 621 Supplying of Tube Lightas per Department Incharge 622 Supplying of Fan as per Department Incharge 623 Supplying of Led Projector(New Edition)as per Department Incharge 624 Supplying of Smart Board(specification:white,power consumption<150w ,usage-school,Effective touch-65x46) as per Department Incharge 625 Supplying of Decorative Items(Local) as per Department Incharge 626 Supplying of Xerox Machine (Specification-Functions:Print | Scan | Copy,Technology -Laser,Print speed-upto 60 pages/min,Paper size-A4,Connectivity-Wireless(Wi-Fi),Color output-Color | B&W, Print Volume(per month) -above 15000 ppm,Features-Two-sided printing,Weight-25kg,Dimension-451 x 460 x 360mm,Scanner type Flatbed scanner multi as per Department Incharge 627 Supplying of Ceiling Fanas per Department Incharge 628 Supplying of Exhaust Fan as per Department Incharge 629 Supplying of Pedestal Fan as per Department Incharge 630 Supplying of Inveter with battery(Capacity -200AH,Battery Type-Tubular Battery,Warranty-3 years,Protection From Short Circuit, Over Temperature, Battery Deep -Discharge,Backup Time 14 Hrs Backup- 4 FAN , 8 Light , 14 Hrs Backup - 1FAN ,1 Light Battery Condition-New) as per Department Incharge 631 Supplying of Wooden Stool(Local) as per Department Incharge 632 Supplying of Wash Basin (Local) as per Department Incharge 633 Supplying of Register (Local) as per Department Incharge 634 Supplying of Stabilizer for ACas per Department Incharge 635 Supplying of Tubelightas per Department Incharge 636 Supplying of Dustbin (Local) as per Department Incharge 637 Supplying of Curtains (Window and Door) (Local)as per Department Incharge 638 Supplying of Door Mat(Local) as per Department Incharge 639 Supplying of Broadband(Wifi)as per Department Incharge 640 Supplying of Furniture Bookshelves, Study Tables and Chairs for attendant and students (30 students at a time) as per Department Incharge 641 Supplying of Wireless mic as per Department Incharge 642 Supplying of Weight Box(100g std.) :- Containing 10 cynlinders of the same size and shape but different in weight as per Department Incharge 643 Supplying of Weight Box(50g std.) :- Containing 10 cynlinders of the same size and shape but different in weight as per Department Incharge 644 Supplying of Kymograph :-with smoked paper, smoked Drum, Time marker as per Department Incharge 645 Supplying of Memory Drum :- Electrical operated as per Department Incharge 646 Supplying of Memory Drum :- Hand operated as per Department Incharge 647 Supplying of Metronome :- Mechanical as per Department Incharge 648 Supplying of Porteuz Maze Test as per Department Incharge 649 Supplying of Techisto-scope :- Fall Drop type as per Department Incharge 650 Supplying of Techisto-scope :-Electronic as per Department Incharge 651 Supplying of Verniers chronoscope :- Pendulum Type as per Department Incharge 652 Supplying of Ergograph/Smoke drum /smoke paper varshing tray and varnish :- Hand grip model as per Department Incharge 653 Supplying of Weight 6Kg as per Department Incharge 654 Supplying of Multiplication sheets(100sheet) as per Department Incharge 655 Supplying of Screen:- Wooden as per Department Incharge 656 Supplying of Ravens Progressive Matrices as per Department Incharge 657 Supplying of Weschlers Intelligence scale (Adult) as per Department Incharge 658 Supplying of Cattles 16 PF Questionnaire as per Department Incharge 659 Supplying of Jungs Word Association Test as per Department Incharge 660 Supplying of Thematics Apperception Test as per Department Incharge 661 Supplying of Zeigarnik Effect Test as per Department Incharge 662 Supplying of The Occupational Stress Index(OSI) Scale by A.K Shrivastawa and A.P. Singh as per Department Incharge 663 Supplying of Rorschach Test as per Department Incharge 664 Supplying of Coping Strategies Test by A.K. Shrivastava as per Department Incharge 665 Supplying of Job Satisfaction scale(JSS) by Amar Singh and T.R. Sharma as per Department Incharge 666 Supplying of Job Involvement Scale by A.K. Singh and R. Kapoor as per Department Incharge. 667 Supplying ofOrganizational Climate Scale by Somnath Chatopadhya and K.G. Agarwal as per Department Incharge 668 Supplying of Managerial Aptitude Scale(MAS) by Santosh Dhar, Upinder Dhar and Priyanka Sharma as per Department Incharge 669 Supplying of Employees Motivational Scale by A.K. Shrivastava as per Department Incharge 670 Supplying of Employees Mental Health Inventory (EMHI) by Jagdish as per Department Incharge 671 Supplying of Beck Depression Inventory by Arron Beck as per Department Incharge 672 Supplying of Aggration Scale (AS) by G.P. Mathur and Rajkumar Bhatnagar as per Department Incharge 673 Supplying of Ego Strength Scale by Q. Hassan as per Department Incharge 674 Supplying of Bells Adjustment Iventory by S.M. Mohsin and Shamshad as per Department Incharge 675 Supplying of Marital Adjustment Questionnaire by P. Kumar and kanchan Rohtagi as per Department Incharge 676 Supplying of Sacks Sentence Completion Test as per Department Incharge 677 Supplying of PGI Health Questionnaire N-1 (PGIHQN) by S.K. Verma, N.N. Wig and D. Prasad as per Department Incharge 678 Supplying of Rotters Locus of Control Scal by Anand Kumar and S.N Srivastava as per Department Incharge 679 Supplying of Self Concept Inventory by O.N Srivastava as per Department Incharge 680 Supplying of PGI Social Support Scale by S.K. Verma, P. Kulhara and Ritu Nehraas per Department Incharge 681 Supplying of Emotiobnal Maturity Scale(EMS) by R.R. Trtipathi as per Department Incharge 682 Supplying of Life satisfaction Scale(LSS) by Q.G. Alam and R. Srivastava as per Department Incharge 683 Supplying of PGI Quality of Life Scale by S.K Verma and A.C. Moudgil as per Department Incharge 684 Supplying of Environmental Awareness Scale (EAS) by Haseen Taj as per Department Incharge 685 Supplying of Jatota Test of Group Mental ability as per Department Incharge 686 Supplying of Weinsteins Noise Sensitivy Scale (WNSS)(Shore Samvedi Mapak) by P. Bhatia, S. Mohar and I.S Mohar as per Department Incharge 687 Supplying of State Traight Anxiety Test (STAT) as per Department Incharge 688 Supplying of Xerox Machines (Digital)(Product Specification:Copy | Print | Scan | Fax,Number Of Trays-2,Item Color-Black,Duty Cycle-20000,Print Technology-LaserPrint Speed-25 Paper Per Minute ) as per Department Incharge 689 Supplying of Binding Machine (Product Specification:Capacity-12-15 Sheets,Binding Style-Manual ,Max Binding Thickness<20 mm Max Binding Sheet Width 200-300 mm,Automatic Grade-Semi-Automatic,Weight-5.8Kgs Approx.,Dimension-375x230x150mm Approx.Automation Grade,Hole Size-3x8mm,Paper Size-A4 /Letter /A5 etc,Packaging Weight-375 mm,Handle Type-metal,Packaging Size-375x230x150mm Approx.Adjustable Margin-2.5/4.5/6.5mm,Usage/Application-Comb Binding Method Of Operation-Manual,No Of Punch Holes-21 holes Number Of Punch Slots-21 holes,Size-A4,Number Of Punch Holes-21 holes,Machine Dimension-375x230x150mm Approx.Is It Padded)as per Department Incharge 690 Supplying of Printers(Ink End Sensor-yes,paper storage capacity-100 sheets Paper Input, 50 sheets Paper Output-printing technology ink tank,connecter type-Wi-Fi, USB,special feature-Cost per print - 9 paise (Black & White), 33 paise (Colour) as per Department Incharge 691 Supplying of Furnishing (Book shelves:Study table and chair)as per Department Incharge 692 Supplying of Book Case(for Psychological Tests) as per Department Incharge 693 Supplying of Open Racks as per Department Incharge 694 Supplying of Inveter with battery(Capacity -150AH,Battery Type-Tubular Battery,Warranty-3 years,Protection From Short Circuit, Over Temperature, Battery Deep -Discharge,Backup Time 8 Hrs Backup- 2 FAN , 2 Light , 12 Hrs Backup - 1FAN ,1 Light Battery Condition-New) as per Department Incharge 695 Supplying of Inverter with Battery(Capacity-150,Battery Type-Tubular Battery,Warranty-3 years,Protection From Short Circuit Backup Time-5hrs,Battery Condition-New)as per Department Incharge 696 Supplying of Desktop(Product Specification:Hard Drive Capacity-320GB,Operating System-Window,Screen Size-17 inch Processor-i5,Display Type LCD Processor) as per Department Incharge 697 Supplying of Tally sofware (Multi User) as per Department Incharge 698 Supplying of Barcode Machine(Product Specification:Type-Thermal Printers,Max Printing Size-10 IPS,Resolution (dpi)-203dpi Model/Type-Citizen CLS-700,Automatic Grade-Fully Automatic Print Line-1~3 Lines) as per Department Incharge 699 Supplying of Server Machines(Product Specification:Memory-1x16 GB RAM/ Open Bay- 2.5 Hot Swap SAS/ SATA,Power Supply 220 V,Networking Type-LAN,Number Of Ports/Channels-8 USB Port-Yes Processor Speed Intel Xeon Silver 4114 (Deca Core) 2.2GHz Power Consumption 750 W) as per Department Incharge 700 Supplying of LAN connection between 7 computers as per Department Incharge 701 Supplying of Xerox Machine (Specification-Functions:Print | Scan | Copy,Technology -Laser,Print speed-upto 30 pages/min,Paper size-A4,Connectivity-Wireless(Wi-Fi),Color output-Color | B&W, Print Volume(per month) -above 10000 ppm,Features-Two-sided printing,Weight-16.8kg,Dimension-451 x 460 x 360mm,Scanner type Flatbed scannercannon image Class MF641CW multi as per Department Incharge 702 Supplying of Lamination Machine(Paper size-A4,A3,FS,max laminating width-330mm,Laminating speed-600mm)as per Department Incharge 703 Supplying of Binding Machine (Punches-43 holes,Hole distance-43 holes in A 11 SHEET,Binding sizes:Max 11) as per Department Incharge 704 Supplying of Computers (Processor -AMD Ryzen 3,RAM-8GB,HDD-512 GB,screen size-19.5 inches,Operating system:Windows 11 )as per Department Incharge 705 Supplying of Office Computer (Processor:i5 10th,HDD:1 TB,RAM-4 GB,GT730 4GB Graphics) as per Department Incharge 706 Supplying oflaser printer(Product Specification:Color Output-Black & White,Function-Print | Scan | Copy,Max. Print Speed (Black)-18 ppm Max. Print Speed (Color)-17 ppm,Connectivity-Ethernet,Paper Size-A4,Print Volume-Up to 500 pages/month) as per Department Incharge 707 Supplying of Smart class Board(Power consumption:220-300V,size/Dimension-65,Input type-finger Touch) per Department Incharge 708 Supplying of Double battery(capacity-250Ah,Over current protection) Inverter(Back up time-5 hrs) as per Department Incharge 709 Supplying of Desktop Computers :- HP 23.8-inch FHD All in One Desktop with Alexa Built-in(10th Gen Intel Core i3- 1005G1/8GB/512 GB SSD/Windows 10/MS Office 2019/Natural Silver), 24-dp0816in as per Department Incharge 710 Supplying of Printer, ScannerMulti-Function Direct Wireless Network Laser Printer (Print, copy, scan, Black) as per Department Incharge 711 Supplying of Networking (LAN, leased lines, wi-fi, switches etc.) TP-Link Archer C6 Gigabit MU-MIMO Wireless Router, Dual Band 1200Mbps Wi-Fi Speed, 5 Gigabit Ports, 4 External Antennas and 1 Internal Antenna WiFi Coverage with Access as per Department Incharge 712 Supplying of Back up support(UPS, Generator, Transformer):-600VA UPS for Desktop/PC/Computers(not for Routers) with Automatic Voltage Regulation as per Department Incharge 713 Supplying of Xerox Machine:- (IR2004 With Duplex, Platen cover & Toner, Resolution (DPI):600 X 600dpi, Duty Cycle:4.3 Sec) as per Department Incharge 714 Supplying of IBM SPSS(Statistics Package Latest Version) as per Department Incharge 715 Supplying of Nvovo(Package) as per Department Incharge 716 Supplying of LCD Projector:- 1)Project movies,images or data from your devices,most effective in dark settings 2)Projector, Lens Cover/Stand, Carrying Pounch, USB Cable 3) Connect via Wi-Fi to Android smartphones and tables or connect HDMI to iPhone or iPad as per Department Incharge 717 Supplying of Projector Screen:- 1)10 Feet x 6 Feet, 133 Dia, 16:9 Format, UHD-3D-4K 2)Comes with FULL HD 1080P 3D and 4K Viewing Technology, Anti UV coating as per Department Incharge 718 Supplying of DTH connection:- 1)HD Set Top Box 2)Recording facility as per Department Incharge 719 Supplying of Television Set:- 1) Smart LED TV-42 inches 2)4K UHD (Resolution:3840x2160) 3)Connectivity-Input:3*HDMI,3*USB 4)Audio:20W output 5) 4K HDR provides exceptional clarity 6)Smartphone connectivity : Photo sharing plus, screen mirroring as per Department Incharge 720 Supplying of as per Desktop:- Intel i7, 8th Gen, 4GB N-Vidia Geforce Graphics card, 16 GB RAM, Monitor, CPU, Mouse, key board partment Incharge 721 Supplying of Multifunction Laser Printer,Scanner, and Copier :- Functionality: Print, Scan,Copy Print Technology : Monochrome Laser Connectivity: Hi-speed USB, Compatible with USB 2.0 Specifications4as per Department Incharge 722 Supplying of Speaker 7.1 surround stereo(Power -100W,Play tme-11 hours,Voice Range-9m) as per Department Incharge 723 Supplying of Digital SLR Camera: 1)EOS full HD movie mode with movie service 2)18 megapixel CMOS)APS-(sensor 3)14-bit A/D conversion 4)ISO 100-12800)EXPANDABLE TO h:25600(5)Dual Lens camera 55-250mm IS II lens 6) Camera battery charger and bag 7)Wide strap USB cable, software CD. as per Department Incharge 724 Supplying of 24.2MP DigitalSLR Camera:- 1)100% Viewfinder Coverage 2)CMOS sensor with impressive high-resolution result 3)Camera battery, charger, and bag 4)Wide strap USB cable, software CD, manual as per Department Incharge 725 Supplying of Quark express as per Department Incharge 726 Supplying of Adobe Suite(CS6 Master Collection) as per Department Incharge 727 Supplying of Cool Edit Pro as per Department Incharge 728 Supplying of Turnitin as per Department Incharge 729 Supplying of Sound Forge as per Department Incharge 730 Supplying of 18-55mm normal lens as per Department Incharge 731 Supplying of 55-250mm Zoom lens as per Department Incharge 732 Supplying of 18-135mm lens as per Department Incharge 733 Supplying of 35mm prime lens as per Department Incharge 734 Supplying of 80mm macro lensas per Department Incharge 735 Supplying of Tripods as per Department Incharge 736 Supplying of DSLR:- 1)Powered by NP-F570 InfoLithium rechargeble battery pack 2)Records to MiniDV tape stock 3)16:9 widescreen recording 4)3CCD video camera 5)12x optical zoom lens 6)Records to MiniDV tape stock as per Department Incharge 737 Supplying of:- 1)3CCD video camera 2) Crystal Engine 3)Shoulder -Type Design 3)One Touch Navigation 4)Manual Focus Ring 5) 0 lux colour light view 6)10x optical zoom 6)500x digital zoom 7)Super image stabilizer 8) DV IN/OUT Terminal 8)5-mode programme AE: sports, portrait, low light, spot light, and surf &snow 9)SP/I.P recording 10)Back light compensation 11) Cinema mode )16:9 aspect ratio( 12)Infra-red remote controller as per Department Incharge 738 Supplying of Tripods:- 1)3-way head with adjustable pan 2)Steady rubberized legs 3)Multipurpose head with quick release 4)Multipupose head for DV cameras 5)Made from High Grade Aliminium Alloy 6)Quik flip leg locks 7)Fluid pan&tilt movement 8)Quik release plate& Bubble Level as per Department Incharge 739 Supplying of i-Mac(Product Specification,Storage Capacity-256 GB Display-24 inch,Memory Size-256gb ssd,assembled Product Dimensions L X W X H,461 mm x 547 mm x 130 mm, 4.48 kg Color-Silver & Blue,Graphics-8_core GPU,Video Support And Camera 4.5K,Bluetooth-Bluetooth 5.0,Weight-4.48kg,Operating System-macOS Big Sur,Processor- M1Echip,Line Voltage-100-240V AC) for Video Editing as per Department Incharge 740 Supplying of Photographic Design Flash Bender-Small Reflector:- 1) Make a bounce flash reflector, gobo, or snoot 2)Packs flat/great for travel 3)Attaches quickly & securely 4)Adjustable to fit all popular brands of accessory flash 5)For on-camera or off-camera flash as per Department Incharge 741 Supplying of Rim Collapsible softbox Diffuser with Rim :-1)Softbox 36 inches/90 Centimeters with Grey Rim and Bowens Mount, Portable and Quick Folding Softbox Diffuser for Photography Speedlites Flash Monolight 2)for 660 LED Panel-Outer 16.3x6.5 inches,Inner 9.8x8.7 inches Collapsible Light Reflector 3)with Stap Attachment and Carrying Bag for Photo Studio Portrait Video Shooting as per Department Incharge 742 Supplying of Handheld Camera Stabilizer with Quik Release for DSLR:- 1)Light weight, handheld video image stabilization 2)FlyCam 3000 video cam stabilizer accepts camera upto 3.5kg/7.7Ibs. 3)Easy attach a small LCD monitor with Flycam 3000 cam stabilizer when needed. 4)Precision Aluminum made 5)23 tall and just 207 Ibs without counter balance disc. as per Department Incharge 743 Supplying of Green/Blue matte screen )Chroma key( :- 1)8x12 ft Blackboard, perfect for television, video production and digital photography. 2)Rod pocket on each top edge allows to be draped or hung. 3)Finishing along all edges to prevent tears. 4)Made of 100 %pure cotton, good vertical sense and durable as per Department Incharge 744 Supplying of Professional Grade Backdrop Cum Light Stand of 8 Feet Height:- 1)Photography Backdrop Stand Kit. 2)Stand of 8 Feet Height 3)8x12 ft Blackboard, perfect for television, video production and digital photography. 4) Package Contents; 1Pcs White Backdrop , 1Pcs Black Backdrop and Set of Black Backdrop stand. 5)Bag to carry as per Department Incharge 745 Supplying of Video Mixer (Four Channel Digital Video Mixer With Effects, including installation and training):- 1) four channel video mixer by incorportating HDMI inputs/outputs, USB streaming, HDCP support, built-in touch multi-viewer, and audio embedding . 2)(3Input)SD HDMI/Composite +(1Input) Up to1080p HDMI/RGB/Component/Composite. 3) PGM Output) Up to 1080p HDMI + RGB/Component +Composite +(PVW Output)PVW/Multiviewer(. 4)480p/576p Progressive internal processing 5.) Built-in multi-viewer ith touch control 6). Built-in frame synchronizers on all inputs 7). Scalers on CH 4 and Output 8). 259 Transitions 148 Effects 9). HDCP Compliant 10) Audio Embedding 11) Audio Mixer & Delay -up to 4 Fframes 12) USB Streaming Out for web-streaming 13) Video Processing:4:2:2 )Y/b/Pr(8 bits)Internal Processing :480/59.94p when set to NTSC, 576/50p when set to PAL( 14) Input Formats :HDMIVideo: INPUT 1 to3 : reqyires 720x480/59.94p )when set to NTSC( 576/50p ) When set to PAL(15) Input Formats : HDMI and Component Video : INPUT 4:480/59.94p, 720/59.94p, 1080/59.94i, 1080/59.94p )when set to NTSC (576/50i, 576/50p, 720/50p, 1080/50i, 1080/50p )when set PAL( as per Department Incharge 746 Supplying of Studio Condenser Microphone :- 1)Professional, large-diaphragm condenser microphone for unsurpassed audio quality 2) Idea as Mian and support microphone for studio and live applications. 3) Cardioid pickup pattern for outstanding sound source separation and feedback rejection 4)Pressure-gradient transducer with shock-mounted capsule. 5)Ultra-low noise, transformerless FET inputeliminates low-frequency distortion. 6) LED indicates phantom power operation. 7)Swivel stand mount and transport case included. 8)Ultra-rugged construction with metal die-cast body 8)Gold-plated 3-pin XLR output connector for highest signal integrityas per Department Incharge 747 Supplying of Digital Monitor/Speaker System(in Pair) :- 1)Two-way active monitor system for multimedia workstations and keyboard monitoring 2)High-power woofers and tweeters powered provided a linear frequency response 3)optical and coaxial inputs to directly connect digital audio sources via S/PDIF interface 4)Two stereo analogue inputs featuring 1/8 TRS and stereo RCA connectors can be used simultaneously or mixed with a digital stereo source 5)Features 1/4 TRS headphone connector with auto-mute function easily accessible from the front panel 6)2x Stereo Anaog Inputs )TRS and Stereo RCA Connectors( 7) 1/4-inch TRS headphone connector with Auto-mute Loudspeaker Function 8)1/8-inch TRS and Stereo RCA connectors as per Department Incharge 748 Supplying of Lapel Clip-on Microphone for DSLRs Camcorders Video Cameras and Iphone Smart Phone :- 1)Omni directional lavalier microphone, designed for Smartphones, DSLR, Camcorders, Audio recorders PC etc, perfect for video use. 2) With Omni pickup pattern, for full 360A coverage, 3) minimum 6-meter )20(cable with 3.5mm 4-pole gold plug for smarty phone connection as per Department Incharge 749 Supplying of Micophone Stand:- Steel stands for hand held microphones in studio with a base supporting system as per Department Incharge 750 Supplying of MP3 Digital Voice IC Recorder LCD :- 1)Digital Voice IC Recorder 2)LCD Screen 3) 23hrs life with 4GB Memory as per Department Incharge
Contract Date: Jun 17, 2026 Contract Value : 78.07 Crore
Government Departments No of Bidders 9
6.
Educational and Research Institute #9931754 Price Bid
Supply For Reagents, Kits, Consumables And Cssd Consumables Items Supply For Reagents, Kits, Consumables And Cssd Consumables Items In Dr Lnp Gmc Ratlam , Reagents , Benedict Reagent (Solution 100% ) (1X500ml) , Ehrlich’S Reagent (1X500ml) , Esbech’S Reagent (1X500ml) , Fouchet Reagent (1X500ml) , Dextrose(1X500gm) , Benedict Reagent (1X500ml) , Acetic Acid (1X500ml) , Ammonium Sulphate Crystal (1X500gm) , Acetone For Analysis (1X500ml) , Sulphur Powder (1X500gm) , Liquor Ammonia (1X500ml) , Egg Albumin (1X500gm) , Sodium Taurocholate (1X250gm) , Ethyl Alcohol/Ethanol (1X500ml) , Spirit (1X500ml) , Bilirubin Extra Pure Ar 99% (1X100 Gm) , Magnesium Sulphate (1X500gm) , 10% Bacl2 (1X500ml) , Fouchet’S Reagent (1X100ml) , Anti D Antisera (Polyclonal) (1X6) , Anti-Ab , Anti-Human Globulin (Ahg) , 22% Bovine Albumine , Anti-A1 , Anti-H , Leishman Stain(1X500ml) , Nacl(1X500ml) , Platelet Reagents(1X100ml) , Chemical , 2,3,5 Tri Phenyl Tetrazoloium Chloride (Ttc)(1X1000gm) , Acetone Solution(1X500ml) , Agar Powder(1X500gm) , Alcohol 70% (Laboratory Grade) (1X5 Ltr.) , Alkaline Peptone Water(1X500ml) , Alpha-Naphthylamine (0.3%)(1X100ml) , Amikacin 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Amoxycillin 30 Ug (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Amoxyclav (Amoxycillin/Clavulanic Acid) 20/10 Mcg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Amphotericin B (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ampicillin 10 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ampicillin-Sulbactam(10/10 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Azithromycin 15 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Aztreonam(30 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Bacitracin(0.4 U) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefazoline 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefepime 5Ug (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefoparazone Sulbactum (75/30 Ug) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefoperazone 75 Mcg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefotaxime (30 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefotaxime+Clavulanate (30/10 Ug) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefoxitin 30Ug (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefpodoxime (10 Ug) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ceftazidime 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ceftazidime+Clavulanate (30/10 Ug) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ceftriaxone 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ceftriaxone-Sulbactum 30/15Ug (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Cefuroxime 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Chloramphenicol 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) , Ciprofloxacin 5Mcg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Clarithromycin(15 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Clindamycin 2 Mcg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Co Trimoxazole(Sulpha/Trimethoprim) 25 Mcg (23.75/1.25)(1 Packet Of 5 Vial (Each Vial Of 100 Disc) , Colistin 10 Mcg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Daptopmycin (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Doripenem(10 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Doxycycline Hydrochloride 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ertapenem(10 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Erythromycin 15 Mcg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Fluconazole Disc 25 Ug (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Fosfomycin(200 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Furazolidone Disc (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Gatifloxacin(5?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Gemifloxacin(5 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Gentamicin 10 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Imipenem 10 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Imipenem-Edta Disc (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Itraconazole 30Microgram (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ketoconazole 30 Microgram (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Levofloxacin 5 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Linezolid(30 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Lomefloxacin(10 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Meropenam 10Ug (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Minocycline(30 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Moxifloxacin(5 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Mupirocin (50 Disc/Pack) , Nalidixic Acid 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Nitrofurantion 300 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Norfloxacin 10 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Novobiocin(5 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ofloxacin(5 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Onpg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Optochin(5 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Oxacillin(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Oxidase Disc (50 Disc/Pack) , Penicillin 10 Units (100 Disc Per Pack),Consumable , Piperacillin 100 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Piperacillin/Tazobactam 100/10 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Polymyxin B(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Quinopristin-Dalfopristin(15 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Rifampicin(5 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Streptomycin (300 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Teicoplanin 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Tetracycline 30 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Ticarcillin-Clavulanate(75/10 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Tobramycin 10 Mcg(1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Trimenthoprim(5 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Vancomycin 30 Mcg (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Voriconazole Disc (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Edta Disc (750 Mcg/Disc) 50 Disc/Pack , Fosfomycin (50 ?G) (1 Packet Of 5 Vial (Each Vial Of 100 Disc) For Ast Testing In Microbiology , Andrade’S Indicator (1X500 Ml) , Anhydrous Barium Chloride (1X100 Gram) , Aniline Blue (1X100 Gram) , Arabinose (1X100 Gram) , Arginine Dihydrolase Broth (1X100 Gram) , Barium Chloride (1X500ml) , Bile Esculin Agar(100 Gm),Consumable , Bile Salt Agar(100 Gm),Consumable , Bile Salt Sodium Taurocholate 100 Gm , Biological Indicator For Autoclave (Indicator Vial) , Bird Seed Agar 100 Gm , Blood Agar Powder(500 Grm) , Brain Heart Infusion Broth(500 Gm) , Bromothymol Blue Indicator (1X100 Gm) , Campy Bap Medium (1X500 Gm) , Candida Chrom Agar (1X500 Gm) , Cary Blair Medium Base (1X100 Gm) , Cinnamaldehyde (1X500ml) , Cled Agar(500 Gm),Consumable , Clostridium Difficile Agar Base (1X100gm) , Clostridium Difficile Agar Base Supplement (1X100gm) , Conc Hcl (1X500 Ml) , Corn Meal Agar (1X100gm) , Cristensens Urea Agar Base(100 Gm) , Crystal Violet Agar (1X500gm) , Cyclothosphamide (1X50gm) , Decarboxylase Broth Moeller (1X100gm) , Dermatophyte Test Medium (1X100gm) , Dextrose (1X500gm) , Di Phenyl Alanine (1X25gm) , Di Potassium Hydrogen Phosphate (K2hpo4) (1X500gm) , Di Sodium Hydrogen Phosphate (Na2hpo4) (1X500gm) , Diluent For Dna Extraction/ Ethanol, Molecular(Biology Grade) (1X500ml) , Dimethyl Sulfoxide (Dmso) (1X500ml) , Dulcitol (1X100gm) , Ethyl Alcohol 100% (1X1000ml) , Ferric Chloride 10% (1X500gm) , Fructose (1X100gm) , Fusidic Acid (1X1000 Strips) , Galactose (1X100gm) , Gentian Violet (Gram Stain) 100Ml Bottle , Giemsa Stain (Merck / Span) (125 Ml) , Glacial Acetic Acid (2.5 Liter) , Glucose (1X500gm) , Glucose Phosphate Broth(100 Gm), Consumable , Glyerol (1X500 Ml) , Gram Iodine (1X100 Ml) , H2so4 (Sulphuric Acid) 25% 1X500 Ml , Hippurate Hydrolysis (100Disc/Pkt) , Hugh Leifson Medium (1X500 Gm) , Hydrogen Peroxide 6% Solution (1X400 Ml) , India Ink (1X100 Ml) , Inositol(1X25gm) , Inulin (1X25gm) , Iodine (1X100gm) , Kovac’S Reagent (Indole) (1X100ml) , Lacto Phenol Cottons Blue Stain (1X100ml) , Lactose (1X500gm) , Leishmen Stain (1X500ml) , Liquid Paraffin (1X400ml) , Lowenstein Jansens Medium(Ready Prepared)(1X100gm) , Lysine Decarboxylase Broth (1X100gm) , Macconckeys Agar With Crystal Violet(1X100gm) , Macconckeys Agar(500Grm) , Macconkey Agar Without Crystal Violet(1X500gm) , Macconkey Broth Double Strenght(For Water Testing)(1X500gm) , Macconkey Broth Single Strength (For Water Testing)(1X500gm) , Malachite Green(1X25gm) , Malt Extract Agar(1X100gm) , Maltose(1X500gm) , Manitolmotility Test-Medium(1X100gm) , Mannitol(1X500gm) , Mannitol Salt Agar(1X500gm) , Manual Blood Culture Bottle With Sds (Adult)- 70Ml , Methyl Alcohol (1X1 Ltr.) , Methyl Red Indicator (1X100gm) , Methyl Violet Powder (1X100gm) , Methylene Blue Powder (1X25gm) , Muller Hinton Agar(500 Gm) , N Acetyl L Cysteine (1X25gm) , Nalidixic Acid Supplement (1X100gm) , Nigrosin Stain 10%W/V (1X100ml) , Nitrate Reagent A & B (1X100ml) , Nutrient Agar(500 Grm) , Nutrient Broth(500 Gm) , Nutrient Gelatin (1X100gm) , Ornithine Decarboxylase Broth (1X100gm) , Oxidase Reagent (Tetra Methyl Para Phenylene Di Amine Di Hydro Chloride) (1X25gm) , Pas Stain (Long Expiray) (1X100gm) , Peptone Powder (1X500gm) , Phenol Crystals (1X500gm) , Phenol Red Indicator (1X25gm) , Phenyl Ethyl Alcohol Agar (1X100gm) , Picric Acid (1X500ml) , Potassium Hydroxide Pellets(1X500gm) , Potassium Iodide(1X100gm) , Potassium Tellurite Agar (1X500gm) , Ppa Agar (1X500gm) , Pyr Agar (1X100gm) , Pyr Reagent (1X10ml) , Raffinose (1X100gm) , Rhamnose (1X100gm) , Rnase/ Dnase Away Solution (For Complete Removal Of Rnase/ Dnase Contamination From Work Surfaces, Pipettes And Equipments(Should Be Stable At Room Temperature)) , Robertson Cooked Meat Medium Base (1X500 Gm) , Sabouraud Dextrose Agar With Chloramphenicol With Cycloheximide (1X500 Gm) , Sabourauds Dextrose Agar Powder(100Gms) , Sabroud Dextrose Agar With Chlorophenicol(100 Gm) , Safranine (Gram Stain) (1X500 Ml) , Salmonella Shigella Agar(100 Gm) , Selenite F Broth(100Gm Pack) , Simmons Citrate Agar(100 Gm) , Sodium Chloride (Nacl) (1X500 Gm) , Sodium Deoxycholate (1X100 Gm) , Sodium Hypochloride (1X500 Ml) , Sorbitol (1X500 Gm) , Soyabean Casein Digest Broth (1X500 Gm) , Sprit 100% (Flammable) (1X1000 Ml) , Sucrose (1X500 Gm) , Tcbs Agar(100 Gm) , Triple Sugar Iron Agar(100Gm Pack) , Trypticase Soy Agar (1X500 Gm) , Trypticase Soy Broth (1X500 Gm) , Tween 20 (1X100 Gm) , Urea 40% Supplement (For Urea Agar Base) (1X200 Ml) , Voges Proskauer Reagent-A (1X100 Ml) , Voges Proskauer Reagent-B (1X100 Ml) , Wilson & Blair Media (1X500 Gm) , X Factor (1X50 Pack) , X+V Factor (1X50 Pack) , Xld Agar (1X500 Gm) , Xylene (1X400 Ml) , Yeast Nitrogen Base Medium (1X500 Gm) , Zinc Dust (1X50 Gm) , Ceftazidime/Avibactam Mics Strip In The Range Of 0.016 Mcg/Ml To 256 Mcg/Ml , Lia (Lysine Iron Agar) (1X100 Gm) , High Level Gentamicin 120 Ug (1X250 Disc) , Vancomycin Powder (1X1gm) , Meropenam/ Vaborbactam , Meropenem Powder , Edta Powder (1X100 Gm) , Muller Hinton Broth Powder (1X500 Gm) , Sugar Identification Kit For Fungus , Sugar Fermentation Kit (Glucose, Sucrose, Lactose, Maltose) , Acetamide Agar(1X100 Gm) , Acetone (1X2.5 Ltr.) Solution , Glycerin(1X20 Ml) Solution , Distyrene Plasticizer Xylene (Dpx Mountant)(1X500 Ml) Neutral , Glacial Acetic Acid (1X500 Ml) 100% , Oil Immersion (1X100 Ml) Solution , N/10 Hcl (1X500 Ml) 100% , Sodium Metabisulphate (1X500gm) , Sodium Nitroprusside (1X500 Gm) , Liquor Ammonia (1X500 Ml) , Ammonium Sulphate (1X500 Gm) , Sulphosaylicsic Acid Solution (1X500 Ml) , Leishmen Stain With Buffer(1X500 Ml) , Wbc Diluting Fluid Pink(1X500 Ml) , Rbc Diluting Fluid(1X500 Ml) , Methanol(1X500 Ml) , Perls Stain (1X100 Ml) Long Expiray , Pas Stain (1X100 Ml) Long Expiray , Mpo Sstain (1X100 Ml) Long Expiray , Egg Albumin Powder (1X500 Gm) , Handwash(1X500 Ml) , Sanitizer(1X500 Ml) , Macro Tip , Micro Tip , Ph Paper Strip Range (1-10) (1X100 Strip) , Kits , Acid Fast Staining Kit , Albert’S Metachromatic Stain Kit , Anti Hav Igm (Elisa Kit) (96 Rxn/Pkt) , Anti Hav Igm (Rapid Test) (50/Pkt) , Anti Hcv Antibody Kits (Elisa Kit) (96 Rxn/Pkt) , Chikungunya Card Test 1 Gg + 1 Gm (25 Test/Kit) , Crp Test Kit (100 Test/Kit) , Dengue Card Test 100 Test Kit , Dengue Ns-1 Elisa (96 Rxn/Pkt) , Elisa Torch Kit , Esbl Detection Kit , Field Stain A , Field Stain B , Gram Staining Kit , Hbsag Rapid Cards (50 Card/Pkt) , Hbv Elisa Test Kit Pack Size : 96 Wells Per Kit(Rate Should Be Quoted For 1Kit Containing 96 Wells) , Hiv (Rapid)(Whole Blood Finger Prick Test Kit) (50 Card/Pkt) , Hiv Elisa Test Kit(96 Rxn/Pkt) , Malaria Bivalent Antigen-Detecting Rapid Diagonstic Tests(Rdts) (50 Card/Pkt) , Occult Blood Test Kit (Haem Test Kit) (1 X 100 Strips) , Ra Factor Rapid Kit (100 Test/Kit) , Rpr Test Kit (100 Test/Kit) , Widal Slide Test(4X5ml With Control)(100 Test/Kit) , Rapid Pap Stain Kit (1X500ml) Stain Solution , Giemsa Stain Kit (1X500ml) Stain Solution , Antisera A (1X10ml) Solution , Antisera B (1X10ml) Solution , Antisera D (1X10ml) Solution , Sahalis Hemoglobinometer (Hb Estimation Kit) , Hbsag Rapid Test (1X10 Test) Sd Biosensor , Hiv Rapid Test (1X50 Test) , Hcv Rapid Test (1X50 Test) , Vdrl (Syphilis) Card Test (1X50 Test) , Malaria Rapid Test (1X50 Test) , Hbaag Elisa Kit (1X96) , Blood Grouping Kit (Abd) (1X96) , Hcv Elisa Kit (1X96) , Other Consumables , Fluoride Tube (1X100) , Disposable Plastic Test Tube (1X100) , Clot Activater Tube (Plan Tube) (1X100) , Acinetobacter Baumannii Nctc 13304 , Autoclavable Petri Plate (100Mm) Plastic , Autoclavable Petri Plate (150Mm) Plastic , Autoclavable Petri Plate (90Mm) Plastic , Autoclavable Transparent Disposable Bag-Size 14” , Autoclavable Transparent Disposable Bag-Size 34” , Bio Medical Waste Bins Red (15 Ltr) , Bio Medical Waste Bins Red (25 Ltr , Bio Medical Waste Bins Red (40 Ltr) , Bio Medical Waste Bins Yellow (15 Ltr) , Bio Medical Waste Bins Yellow (25 Ltr) , Bio Medical Waste Bins Yellow (40 Ltr) , Bmw Polybags Red Colour (18 Kg Capacity) (100 Bag/Pkt) , Bmw Polybags Red Colour (28 Kg Capacity)(100 Bag/Pkt) , Bmw Polybags Red Colour (45 Kg Capacity)(100 Bag/Pkt) , Bmw Polybags Yellow Colour (28 Kg Capacity)(100 Bag/Pkt) , Bmw Polybags Yellow Colour (45 Kg Capacity)(100 Bag/Pkt) , Bmw Polybags Black Colour (28 Kg Capacity)(100 Bag/Pkt) , Bmw Polybags Black Colour (45 Kg Capacity)(100 Bag/Pkt) , Burning Sprit (1X500ml) , Cedar Wood Oil (1X125ml) , Cryotags / Freezer Labels, For 1.5- 2.0 Ml Cryovials {Ability To Withstand Cryogenic Temperatures Upto Minus 80 Degree C For A Wide Variety Of Plastic And Glass Vials, Test Tubes, Cryogenic Boxes And Plates} , Cryotubes Graduated Screw Capped 10 Ml (Autoclavable) , Cryotubes Graduated Screw Capped 15Ml (Autoclavable) , Cryotubes Graduated Screw Capped 5Ml (Autoclavable) , Discard Jar Glass 500Ml , Disposable Mops , Disposable Plastic Loop - 2 , Disposable Plastic Loop - 4 , Disposable Sharp Collection Containers(5 Ltr) , Distilled Water (1X5 Ltr.) , Dropping Bottle 250 Ml , Dropping Bottle Plastic 100- 120 Ml Capacity , Enterococcus Faecalis Atcc 29212 , Escherichia Coli Antisera 0157 , Escherichia Coli Antisera Polyvalent 1 , Escherichia Coli Antisera Polyvalent 6 , Escherichia Coli Antisera Polyvalent 7 , Escherichia Coli Atcc 25922 , Filter Barrier Tips 20 Ul (In Box Packing, Sterile Dnase Rnase Pyrogen Free Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 10 Ul (Sterile Dnase Rnase Pyrogen Free Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 1000 Ul (Sterile Dnase Rnase Pyrogen Free Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 200 Ul (Sterile Dnase Rnase Pyrogen Free Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Paper Sheet((Whatmann No 01) Sheets) , Filter Paper(12.5 Cm, 0.1 Micron) , Forceps Small , Gaspak (3.5 Liter) , Glass Marking Pen (Diamond ) , Haemophilus Influenza Type B Antisera , K3 Edta Vial , Klebsiella Pneumoniae Atcc 700603 , Klebsiella Pneumoniae Atcc 1706 , Klebsiella Pneumoniae Atcc 1705 , Candida Albicans Atcc 90028 , Labolene , Lead Acetate Strip , Lens Cleaner Kit , Magnetic Stirring Bars , Metal Loop Holder , Micor-Pipette Tips (01 To10µl) , Micro Centrifuge Tube 1.5 Ml(Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Micro Centrifuge Tube 2 Ml(Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Microcentrifuge Tube Rack (20 Tube/24 Tube Capacity)(For 1.5/2Ml Tube) , Microcentrifuge Tube Rack (80 Tube/96 Tube Capacity) Reversible One Side For 1.5Ml Tube And Other( Side With 0.2 Ml Pcr Tubes) , Non-Latex Purple Nitrile Gloves (Large) (Sterile Dnase Rnase Pyrogen Free , Non-Latex Purple Nitrile Gloves (Medium) (Sterile Dnase Rnase Pyrogen Free ) , Optical Adhesive Covers For Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Biorad Cfx 97 Dx Opm) , Optical Adhesive Covers For Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Thermo Fisher A28574 Quant Studio Rt-Pcr Machine) , Para Film Sealing Film , Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Biorad Cfx 97 Dx Opm) , Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Thermo Fisher A28574 Quant Studio Rt-Pcr Machine) , Pcr Strips 0.1 Ml (Strip Of 4) (Compatible With Qiagen 5Plex Rotorgene Rt-Pcr Machine) , Pcr Strips 0.2 Ml With Attached Cap (Strip Of 8) (Compatible With Biorad Cfx 97 Dx Opm) , Pcr Strips 0.2 Ml With Attached Cap (Strip Of 8) (Compatible With Thermo Fisher A28574 Quant Studio Rt-Pcr Machine) , Ph Paper Roll(Ph 2 -10) , Ph Paper Strip Range (6.5-10) , Pippette 1 Ml (Borosilicate) , Pippette 5 Ml (Borosilicate) , Plain Vial With Screw Cap (12X75),Consumable , Pseudomonas Aeruginosa Atcc 27853 , Salmonella Group O 2 Antisera , Salmonella Group O 4 Antisera , Salmonella Group O 7 Antisera , Salmonella Group O 9 Antisera , Salmonella H- Polyvalent Phase 1&2 Antisera , Salmonella H-A Antisera , Salmonella H-B Antisera , Salmonella H-D Antisera , Salmonella Polyvalent O Antisera , Shigella Boydii Polyvalent C Antisera , Shigella Dysentriae Polyvalent A Antisera , Shigella Flexneri Polyvalent B Antisera , Shigella Sonnei Polyvalent D Antisera , Soap , Spirit Lamp , Staphylococcus Aureus Atcc 25923 , Staphylococcus Aureus Atcc 43300 (Mrsa) , Sterile Cotton Swab (Individually Packed) , Sterile Pasteurppipettes 3Ml , Sterile Swab With Screw Capped Container , Test Tube Conical With Screw Cap 50Ml (Autoclavable) , Test Tube Stand (Aluminum) 10X10 Holes For 12Mm Diameter Test Tube , Test Tube Stand 10X10 Holesfor 18Mm Diameter Test Tube , Tissue Paper Roll(Each) , Toluene Ar (1X500 Ml) , Urine Culture Container (Sterile) 50 Ml Disposable , Utility Gloves (Medium) , V Factor (1X50 Disc) , Vibrio Cholerae Inaba Antisera 2 Ml , Vibrio Cholerae Ogawa Antisera 2Ml , Vibrio Cholerae Polyvalent Inaba & Ogawa Antisera 2Ml , Viral Transport Media With Swabs (3Ml Vial With 2 Regular Swabs I.E. One Nasal Swab And One Throat Swab (1.Viral Transport Medium (Vtm) With Swab With Complete Directions For Collection, Storage, Transport And Carrying. 2.Sterile Dacron, Polyester Or Rayon Sterile Swabs With Plastic Shafts)) , Widal Rack Steel , 0.2 Ml Pcr Tube (Sterile, Flat-Cap Shaped) Dnase/Rnase Fre , 15 Ml Polypropylene Centrifuge Tubes, Sterile, {Certified Nonpyrogenic And Dnase-/Rnase-Free, Disposable Conical Bottom With Seal Caps(The Tubes Should Have Printed Graduations And A Large White Marking Spots)} , Aluminium Foil (9 Meters Length) Thickness - 11 Microns, Width - 30 Cm , Bloting Paper(Paper) , Chemical Indicator For Autoclave (Indicator Tape) , Gauze Cutting Blade (1X12) , Gauze Cutting Machine Oil (1X12) , Microwave Gloves , Pop Bandage (15Cm,Fast Setting Time) , Pop Bandage (10Cm, Fast Setting Time) , Copying Pencil (Marking Pencil Used Over Pop) , Ethaflex Sheet-12Mm (Eva Sheet 1.5*3Meter) , Ethaflex Sheet-6Mm (Eva Sheet 1.5*3Meter) , Ethaflex Sheet-2Mm (Eva Sheet 1.5*3Meter) , Rubber Adhesive & Dendrite , Rubber Sole (3Mm*1Mtr*1/2 Mtr) , D-Ring (Metal Dring With Plastic Buckle 1Inch) , D-Ring (Metal Dring With Plastic Buckle 1.5 Inch) , D-Ring (Metal Dring With Plastic Buckle 2.0 Inch) , Velcro (Hook & Loop) (1 Inch-25 Mtr Roll) , Velcro (Hook & Loop) (1.5 Inch-25 Mtr Roll) , Velcro (Hook & Loop) (2 Inch-25 Mtr Roll) , Leather (Soft Lining Purpose) , Press Button (9Mm) (1000Pcs/Pkt) , Press Button (12Mm) (1000Pcs/Pkt) , Nylon Strap (Softgrade 1Inch) , Nylon Strap (Softgrade 1.5Inch) , Nylon Strap (Softgrade 2Inch) , Polypropylene Sheet (4Mm *2Mtr*1Mtr) , Polypropylene Sheet (3Mm 2 Mtr 1 Mtr) , Polypropylene Sheet (6Mm*2Mtr*1 Mtr) , Polypropylene Sheet (12 Mm) , Polypropylene Sheet (14Mm) , Lttp Sheet 2 Mm (600Mm*900Mm) , Lttp Sheet 3 Mm (600Mm*900Mm) , Lttp Sheet 4 Mm (600Mm*900Mm) , Good Quality Rubber Band , Pvc Sheet (Black & Grey) (2 Mm) , Foam (1 Inch) , Rubber Sole - 10Mm , Cupper Rivet (3Mm Width,1Inch Length) , Aluminium Rivet (3Mm Width,1Inch Length) , Aluminum Strip ( 1Inch, 2Mm Thick) , Alluminium Sheet (8 Ft 8* 4 Ft) , Mcr Rubber (10Mm*1Mtr*1Mtr) , Copper Washer (5Mm Width ,3Mm Hole) , Copper Washer (5Mm Width ,4Mm Hole) , Drill Bit (3,4,5,6,7,8,9,10,50) (Complete Set) , Drill Bit (4Mm) , Drill Bit (3Mm) , Plastic Bucket , Microscopic Glass Slide(75X25 Mm) (50Pcs/Pack) , Jam Microscopic Cover Slip Glass (22X50mm) (20Pkt/Box) , Slide Box (100Slide/Box (Plastic) , Tissue Paper Roll , Plastic Dropper 2 Ml (100Pcs/Pack) , Plastic Dropper 5 Ml (100Pcs/Pack) , Coupling Jar (Plastic) , Slide Carrying Tray (Aluminium) , Aluminium Slide Tray (Aluminium) , Slide Staining Stand/Rack (Aluminium) , Forceps (Steel) , Test Tube Holder , Test Tube Stand(Aluminium) , Glass Tube Brush , Bubbler (Rubber) , Filter Paper (12.5 Diameter) , Diamond Pencil , Capillary Tube For Bt Ct (Glass) , Kidney Tray (Big) , Kidney Tray (Small) , Knife (Small) , Slide Staining Rack , Slide Holder Steel , Application Plastic Stick (100Pcs/Pack) , Sprit Lamp Steel 100 Ml , Tube Holder , Wester Green Stand , Wintrobe Stand , Tissue Embedding Mold (Steel (Medium Size) 2X2) , Tissue Embedding Mold (Steel (Large Size) 3X3 Cm.) , Tissue Embedding Mold (Steel (Small Size) 1X1 Cm.) , Embedding O Ring (Steel) , Bone Marrow Needle Aspiration Adult (Size 16) , Bone Marrow Needleaspirationadult (Size 18) , Bone Marrow Biopsy Needle Adult , Bone Marrow Needle Aspiration Child(Size 16) , Bone Marrow Needleaspirationchild (Size 18) , Bone Marrow Biopsy Needle Child , Fnac Handle 10 Ml , Slide Cabinet (5000 Slide/Cabinet) (Steel) , Slide Cabinet (10000 Slide/ Cabinet) (Steel) , Liver Biospy Needle(Steel) , Block Cabinet (1000 Slide/Cabinet)(Steel) , Glass Stainingjar (500 Ml) , Tongs(Steel) , Aluminium Foil , Sterilization Box (Aluminium) Medium Size , Lumberpunctere Needle(Steel) , Formaline Moniter For Lab , Sleeper (06 Number) , Sleeper (07 Number) , Sleeper (08 Number) , Sleeper (09 Number) , Sleeper (10 Number) , Smile Boll , Tissue Paper Pkt , Tips (200Ul) (1X1000) , Tips (1000Ul) (1X500) , Circular Chart Temperature Graph Paper (-10 To 30) , Circular Chart Temperature Graph Paper (40 To -10) , Circular Chart Temperature Graph Paper (+50 To -50) , Circular Chart Temperature Graph Paper (+50 To -100) , Fiber Tip Pen (Red-6Mm) , Pencil Cell (Small) , Pencil Cell (Medium) , Plastic Droper 2Ml (100Pcs/Pack) , Plastic Droper 3Ml (100Pcs/Pack) , Plastic Droper 5Ml (100Pcs/Pack) , Test Tube Stand (48 Holes) (Plastic) , Bandad , Dropping Bottle (Plastic) , Dropper (Plastic) , Mouth Piece(Pft) , Electrode (Ncv) , Thermometer Cell , Measurement Scale , Tourch , Inch Tape , Glassware Items , Autoclavable Glass Bottle With Screw Cap For Culture Media (1 Liter) , Autoclavable Glass Bottle With Screw Cap For Culture Media(500 Ml) , Beaker - 1000 Ml (Borosilicate Glass) , Beaker - 100 Ml (Borosilicate Glass) , Beaker - 250 Ml (Borosilicate Glass) , Beaker - 500 Ml (Borosilicate Glass) , Concavity Slide , Conical Flask (Glass)-1000Ml , Conical Flask (Glass)-100Ml , Conical Flask (Glass)-2000Ml , Conical Flask (Glass)-500Ml , Conical Flask (Glass)-50Ml , Cover Slip With Isi Marked Size:18X18mm(+/- 1.00Mm),Thikness 0.13.. To 0.17Mm(Pkt Of 50 Pieces),Consumable , Dreyer’S Tube , Durham’S Tube , Falcon Tube Sterile, (Conical Bottom) (50Ml Each Plastic Containers With Air Tight Screw Cap Printed Graduation) , Felix Tube , Glass Petri Plate (100Mm) , Glass Petri Plate (150Mm) , Glass Reagent Bottle (1 Litre) , Glass Reagent Bottle (500Ml) , Glass Reagent Bottle (5 Litre) , Glass Test Tube 12 X 100 (Medium Size) Heavy Quality 100/Pkt , Glass Test Tube 12 X 50 Borocilicate Glass Autoclavable (100/Pkt) , Glass Test Tube 12 X 75(Small Size) Heavy Quality 100/Pkt , Glass Test Tube 15 X 125 Borocilicate Glass Autoclavable(100/Pkt) , Graduate Pipette (Borosilicate ) 10Ml , Measuing Cylinder Plastic 1000Ml , Measuing Cylinder Plastic 2000Ml , Measuring Cylinder Plastic (100 Ml) , Measuring Cylinder Plastic (500 Ml) , Reagent Bottel (Large ) , Reagent Bottel (Small) , Test Tube 10Ml (100/Pkt) , Test Tube 15X150ml , Plastic Reagent Bottle (5 Litre) , Coupling Jar (Glass) , Test Tube 5Ml (100Pcs/Pack) , Glass Dish Staining Jar 500 Ml , Measuring Cylinder 10Ml (Borosilicate) , Volumetric Flask100ml , Speciman Jar With Lid (200X200x70 Mm) - Glass , Speciman Jar With Lid (150X150x60mm) - Glass , Museum Jar With Lid (220X150x100mm) - Glass , Museum Jar With Lid (220X195x80mm) - Glass , Museum Jar With Lid (250X165x140mm) - Glass , Museum Jar With Lid (360X150x100mm) - Glass , Museum Jar With Lid (150X150x80mm) - Glass , Museum Jar With Lid (250X250x120mm) - Glass , Glass Rod (Solid) (Size 300X6mm) (Per Kg) , Glass Rod (Solid) (Size 200X6mm) (Per Kg) , Glass Rod (Solid) (Size 400X8mm) (Per Kg) , Esr Tube (Wintrobe) - Glass , Esr Western Green Tube - Glass , Rbc Pipette , Wbc Pipette , Pasture Pipette , Test Tube 15 Ml (Borosilicate Glass) , Test Tube 20 Ml (Borosilicate Glass) , Test Tube 10 Ml (Borosilicate) , Test Tube 5 Ml (Borosilicate) , Centrifuge Tube 15Ml (Borosilicate Glass) , Centrifugr Graduated Tube 15 Ml (Borosilicate Glass) , Reagent Bottle 100 Ml Glass (Borosilicate Glass) , Reagent Bottle 250Ml Glass (Borosilicate Glass) , Reagent Bottle 500 Ml Glass (Borosilicate Glass) , Measuring Cylinder 100 Ml (Borosilicate Glass) , Measuring Cylinder 5 Ml (Borosilicate Glass) , Dropping Bottle 250 Ml Glass (Borosilicate Glass) , Measuring Cylinder10 Ml (Borosilicate Glass) , Conical Flask 10 Ml (Borosilicate Glass) , Conical Flask 500 Ml (Borosilicate Glass) , Graduate Pipette 10Ml (Borosilicate Glass) , Volumetric Flask 100Ml (Borosilicate Glass) , Dropping Bottle 100 Ml (Borosilicate Glass) , Reagent Bottle With Stopper 100 Ml (Borosilicate Glass) , Burner , Test Tube Washing Brushes (Normal) , Graduated Cylinder 100Ml , Erlenmeyer Flask 1000Ml , Glass Bulb Pipette 10 Ml , Dropper5ml , Laboratory Trays Big , Laboratory Trays Medium , Laboratory Trays Small , Beaker 250Ml , Test Tube (12X75mm) , Test Tube (12X100mm) , Measuring Cylinder (1000Ml) (Borosilicate) , Measuring Cylinder (500Ml)(Borosilicate) , Neubauer’S Chamber , Hb Tube , Hb Pipette , Watch Glass (1X100) , Washer Kf 155 Item Compertable Withcica Washer 12 Din , Liquidalkalinedetergent (4Ltr/Nos) 1.057 Gallon , Liquid Neutralizing Agent (4Ltr/Nos) , Lubrication Spray (4Ltr/Nos) 1.057 Gallon , Enzamatic Detergent (4Ltr/Nos) 1 Gallon , Ro Plant Consumables For Cssd , Anti Scaling Chemical (1X1ltr) , Cip Chemical (1X1ltr) , Chemical For Flushing (1X1ltr) , Jumbo Cartridge Filter(1Nos) , R.O.Membrane 8040 (1Nos) , Water Softener Consumable For Cssd , Resin (Kg) , Ultrasonic Washeritemcompertable Withcicaultrasonic Washer30ltr , Cleaning Agentfor Ultrasonic Cleaner (4Ltr/Nos) , Washer Kf 155 Itemcompertable Withcica Washer 12 Din , Cleaning Indicator For Washer (Level-4) Nos , Print Ink Ribbon For Washer (12Nos/Box) , Printer Paper (50Nos/Box) , Consumable For Operation For Cssd Equipment Item Compatible With Cisa Cssd Machine’S , 3 Line Label Steam Indicator (750 Label’S/Roll) , Bowie Dick Strip (Nos) , Process Indicator (Nos) , Batch Monitoring Strip (Nos) , Chemical Indicator Class 4 (Nos) , Autoclave Tap 18X50mtr (50 Roll/Box) , Sterilization Reel50x200mtr(16 Roll/Box) , Sterilization Reel75x200mtr (12 Roll/Box) , Sterilization Reel100x200mtr (08 Roll/Box) , Sterilization Reel120x200mtr(08 Roll/Box) , Sterilization Reel150x200mtr(04 Roll/Box) , Sterilization Reel200x200mtr(04 Roll/Box) , Sterilization Reel250x200mtr(04 Roll/Box) , Sterilization Reel300x200mtr(02 Roll/Box) , Heat Sealer Item Comfortable With Cisa Heat Sealer , Print Ink Ribbon For Heat Sealer (10 Nos/Box) , Consumables For Dialysis Unit , Dialyzer (Dora 16P Surface Area 1.6) , Tubing , Fmc Diasafe (Diasafe Dilter) , Part A Concentration 10 Ltr. , Part B Bicarbonate , Heamodialysis Citrosteril Care 5 Ltr. , Machine Transducer Protector , Surnaline Solution 5 Ltr. , Avf Needle 16 G , Compatible With Gel Technology For Blood Group, Cross Matching Centrifuge, Cross Matching Incubator,Make & Model -Tulip (Close System Machine) , Ahg (Combs) Test Card (1X24) , Complete Grouping Card (1X24) , Diluent-2 Liss (1X500 Ml) , Compatible With Sterile Connecting Device, Make & Model - Fresenius Kabi Compodock - (Close System Machine) , Scd Wafers (1X1000) , Compatible With Platelet Aphaeresis Machine (Ngl),Make & Model - Nigale 7907856331 (Close System Machine) , Sichuan Nigale (Disposable Bag Component Apheresis Set) P-20001 , Compatible With Blood Cell Counter, Make & Model - Swalab (Close System Machine) , Swalab Alfa Diluent (1X20ltr.) , Alfalyse Rfid (1X05ltr.) , Compatible With Hemocue, Make & Model-Hb-201 (Close System Machine) , Hb-201 (Microcuvettes) (1X50) , Compatible With Automated Blood Culture System, Model Bact/Alert 3D 480 Bio Merieux (Close System Machine) , Blood Culture Media Aerobic For Adult (Bact/Alert Fa Plus) , Blood Culture Media Aerobic For Pediatric (Bact/Alert Pf Plus) , Blood Culture Media Anaerobic For Pediatric (Bact/Alert Pf Plus) , Blood Culture Media Mycobacterium Spp (Bact/Alert Mp) , Compatible With Automated Rna Extraction Machine, Model - Nextractor Nx-48S, Make - Genolution (Close System Machine) , Viral Rna Extraction Kit (Pack Of 96/Pkt) , Compatible With Eto Sterilizer, Make – Steri Equip Solution Pvt.Ltd., Model - Prueto + 100Ltr (Close System Machine) , Cartridge Eo Aluminium (D=45) (1X100gm) , Eto Sterilization Roll’S (75X200mtr) , Eto Sterilization Roll’S (100X200mtr) , Eto Sterilization Roll’S (150X200mtr) , Eto Sterilization Roll’S (200X200mtr) , Eto Sterilization Roll’S (250X200mtr) , Eto Sterilization Roll’S (300X200mtr) , Eto Indicator Tap (19X50mtr) , Eo Chemical Indicator Strip (Type-4) (500Nos/Pkt) , Biological Indicator Eto(50Nos/Pkt) , Compatible With Eiligplaz 100Ltr, Plasma Sterilizer, Make – Decent Medical , Model - Eiligplaz 100Ltr (Close System Machine) , Cartridge Eo Aluminium (Hyd. Peroxide 50%) 10Ml , Plasma Indicator Tap (19X50mtr) , Plasma Chemical Indicator (500 Nos/Pkt) , Plasma Sterilization Roll’S (100X200mtr) , Plasma Sterilization Roll’S (150X200mtr) , Plasma Sterilization Roll’S (200X200mtr) , Plasma Sterilization Roll’S (250X200mtr) , Plasma Sterilization Roll’S (300X200mtr) , Plasma Sterilization Roll’S (350X200mtr) , Biological Indicator (50 Nos/Pkt)
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 11
Madhya Pradesh View Result →
7.
Housing Urban and Rular Development #9443233 Technical Bid
Tender For Tourism Development Of Karmaha Math Tahsil Hata District Khushinagar, 1 CONSERVARTION AND RENOVATION OF HERITAGE BUILDING COMPLEX 2 Manually removal of vegetation (major trees, climbing plants, creepers) from walls, columns, arches, floor etc in a skilled and careful manner, using appropriate tools and means and without causing any damage to the adjoining parts, including carrying and stacking the dismantled materials including lift/lower upto 11mtrs and lead upto 50 mtrs as directed by the engineer or architect in charge. The exposed surfaces will be coated with a paste made from ammonium sulphamate crystals or with Tree killer available in market. In this condition the root system may be left to absorb and die. Large sections of dead wood must not be left within the core. As they decay they will remove support and create voids and weaknesses in the wall. But pull off a well - established mat of vegetation must be resisted. Tamping, grouting, pointing and resetting of brick / stones especially on wall top, must all be anticipated as remedial work. 3 Careful uprooting of vegetation growth, bushes, shrubs and rank vegetation from the walls upto a height 10mbamboo ladders, scafolding etc.) with the help of Specialised tools including injecting chemicals or natural mediums like buttermilk for drying roots so that they losen up and taken out invery carefull mannerto avoid any damage to the heritage structure Note:-This job involves high risk and requires working at a height of 10.00m (aprox. 30.00 ft), hence employing of skilled labour is necessary (30% extra charges) alongwith execution under the supervision of a conservation engineer/Architect. 4 Providing and fixing double scaffolding system (cup lock type) on the exterior side, up to seven story height made with 40 mm dia M.S. tube 1.5 m centre to centre, horizontal & vertical tubes joining with cup & lock system with M.S. tubes, M.S. tube challies, M.S. clamps and M.S. staircase system in the scaffolding for working platform etc. and maintaining it in a serviceable condition for the required duration as approved and removing it there after .The scaffolding system shall be stiffened with bracings, runners, connection with the building etc wherever required for inspection of work at required locations with essential safety features for the workmen etc. complete as per directions and approval of Engineerin-charge .The elevational area of the scaffolding shall be measured for payment purpose .The payment will be made once irrespective of duration of scaffolding.Note: - This item to be used for maintenance work judicially, necessary deduction for scaffolding in the existing item to be done. 5 Removing Cracked & bulged lime concrete Very Carefully using specialised tools by the means of manual labour Without use any mechanical means Including Stacking Of Dead Material & Throwing Malba Beyond Monument upto 150 mm including disposal of Malba within 50 m lead. Based on DSR 15.1 (Labour Rates as perA.S.IL.K.O CurrentRate.) 6 Very carefull removal and scrapping of existing pulverised plaster from traditional brick surface, including raking out the joints andscrapping out dead and decayed mortar very-very carefully including washing and preparing the surface good for replastering. Note:it is to be noted that tradional plaster that is intact shall not be taken out or damaged and shall remain intact.(Labour Rates as perA.S.IL.K.O CurrentRate.) 7 Taking out and removal of out of plumb, bulged and dislocated traditonal brick masonryin lime mortar very - very carefully without using drill or any other machine avoiding any jerks and vibrations to the adjoining part of the ancient structure. It also includes strutting and proping to the bottom of the overhanging brick masonry wherever necessary,including stacking of dead material & throughing malwa beyond monument. (Labour Rates as perA.S.IL.K.O CurrentRate.) 8 Strengthening and stablization of brick massonary with underpinning technique in traditional foundation done intraditional Lime mortar ratio of1:1:1:1 (1Lime Putty,1 U/s Lime,1 Coarse Sand & 1 first class brick surkhi)mixed with other traditional material for more strength of mortar mixing withWood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P required for proper completion in all respectas per original pattern, matching with original colour and texture.(Labour Rates as perA.S.IL.K.O CurrentRate.) 9 Filling of minor cracks, hair cracks, fissures & minor cavaities after proper cleaning of surface with soft brush and presurised air, with Lime putty ,sand & Surkhi matching the colour final finishing with lime punning very-2 carefully.(Labour Rates as perA.S.IL.K.O CurrentRate.) 10 Stitching of wide cracks carefully by taking out all loose materials, cleaning with pressure water pumps & air blower and filling 1/3 depth with lime mortar with cross masonry stitching using Brass/SS clamps and chiken mesh with matching bricks in lime mortar 1:1:1 (1 lime putty : 1 coarse sand: 1surkhi) matching the courses and features of existing masonry under the supervision of the conservation architect.(Labour Rates as perA.S.IL.K.O CurrentRate.) 11 Raking out the joints of traditional brick masonrysurface to the required width and depth, with due care and precaution, by mechanical/manual means including preparing & cleaning the surface re-filling of joints, including disposal of rubbish within headlead of 50 metres. (Labour Rates as perA.S.IL.K.O CurrentRate.) 12 Base layer Rough mortar as base of plaster & filling the core masonry voids very carefully and pushing the mortarin joints upto8-10 mm thick in (1:1:1) 1 Lime putty: 1 Surkhi: 1 Coarse sand on the traditional underpinning(brick masonry),mixed with oraganic additivesWood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P(Labour Rates as perA.S.IL.K.O CurrentRate.) 13 Restoration of damaged & Pulverized simple plaster of thickness 20-40 mm in combination mortarusing 1:1:1 (1 Lime putty: 1 Surkhi: 1 Coarse sand) mixed with other traditional material for more strength of mortar mixing withWood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P required for proper completion in all respect as per original pattern, matching with original colour and texture.(Labour Rates as perA.S.IL.K.O CurrentRate.) 14 Restoration and reproduction of damaged and pulverised lime plasterwith grooves/curved plaster as per original geometrical pattern with thickness of upto 20-40 mm with traditional lime mortar in ratio (1 lime putty: 1 surkhi: 1 sand) mixed with gur/sheera & belgiri, including final finishing of surface. 15 Providing & laying lime concrete in the ratio of 1:1:1:4 (1 Lime: 1 Surkhi: 1 coarse sand: 4 Brick ballast 25mm nominal size) mixed with Gur/ sheera and Belgiri etc. including ramming with wooden dhurmut. (Labour Rates as perA.S.IL.K.O CurrentRate.) 16 Providing and fixing45-50mm thick Mirzapur sand stone flooring size as per of E/ Ifine dressed of all edges & exposed side laid in mortar 1:1:1 (1 lime,1 surkhi & 1 coarse sand) mixing withWood Apple,Gum, Black Gram,Molasses & Fenugreek seeds & pointing of joints which should not exceed 3mm in lime mortar 1:1( 1 lime putty, 1 surkhi) mixing with colour pigment ,complete in all respect including supply of all material ,labour & T&P.(Labour Rates as perA.S.IL.K.O CurrentRate.) 17 Providing and fixing 45-50mm thick Red sand stone flooring size as per of E/I fine dressed o all edges & exposed side laid in mortar 1:1:1 (1 lime, 1 surkhi & 1 coarse sand) mixing with Wood Apple, Gum, Black Gram, Molasses & Fenugreek seeds & pointing of joints which should not exceed 3mm in lime mortar 1:1 (1 lime putty, 1 surkhi) mixiing with colour pigment, complete in all respect including supply of all material, labour & T&P. (Labour Rates as per A.S.I L.K.O Currnt Rate). 18 Demolishing Modern brick work manually/ by mechanical means including stacking of serviceable material and disposal of unserviceable material within 50 metres lead as per direction of Engineer-in-charge. 19 Removing/demolishing R C C work slabs, cutting of reinforcement bars manually/mechanical means including stacking of steel bars & disposal of cement concrete chunks and unserviceable material within 50 metres lead.(Labour Rates as perA.S.IL.K.O CurrentRate.) 20 Underpinning of damaged, disturbed and missing traditional brick masonry in courses teething with existing old masonry as per original pattern with mortar of ratio (1:1:1) 1 Lime putty: 1 Surkhi: 1 Coarse sand mixed with Wood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P required for proper completion in all respect. Matching with original colour and texture. It also includes core-treating with liquid mortar after very-2 carefully scooping out the dead mortar.(Labour Rates as perA.S.IL.K.O CurrentRate.) 21 Providing & laying Ornamental Round traditional Brick masonry as per original pattern with required dia. & thickness in circular shape on plan for a mean radius including centering and shuttering (strutting, propping & formwork for proper shape inside and outside)complete. It also includes cutting & rubbing of bricks required size and shape in super structure with Lime mortar 1:1:1 ( 1 Lime putty: 1 Coarse sand: 1 surkhi) mixing with Wood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P required for proper completion in all respect. (Labour Rates as perA.S.IL.K.O CurrentRate.) 22 Restoration of damaged & pulverized Ornamental Round plaster of thickness 32-35 mm thick in combination mortar using1:1:1 (1 lime putty; 1 1st class brick surkhi; 1 Coarse Sand) mixing with Wood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P required for proper completion in all respectfilling the core masonry voids very-2 carefully and pushingincluding creating all the details as per existing design pattern available at site over under layer plaster. 23 Renovation and repair of damaged and crushed plaster molding, adhering to existing design dimensions ranging from 100 to 300 mm, while preserving the intricate contours and curves using molds, in conjunction with a combination mortar composed of 1 part lime putty, 1 part surkhi, and 1 part coarse sand, augmented with additional traditional strengthening agents such as wood apple, gum, black gram, molasses, and fenugreek seeds. The scope includes all necessary labor, materials, and tools to ensure a thorough restoration in accordance with the original pattern, while achieving a seamless match in color and texture, for areas reaching heights of 5-8 meters above ground level. (Labour Rates as perA.S.IL.K.O CurrentRate.) 24 Replication of ornamental cornice (crafted lime plaster) to match the original architectural design of the heritage structure, extending up to 6-8 meters above ground level while preserving the authentic contours and curves. This entails employing a combination mortar mixture in a 1:1:1 ratio (1 part lime putty, 1 part surkhi, 1 part coarse sand), enhanced with ingredients such as jaggery, molasses, gum, sunn/jute fibers, and urad dal paste, along with belgiri. Additionally, the process includes the application of a final lime putty coat for the surface finishing. 25 Decorative lime plaster application with a 1:1:1 mortar mix, encompassing meticulous replication of all intricate design elements present on-site, atop a base layer plaster adhering to traditional techniques, while ensuring the preservation of all curves and contours. The preparation of mortar strictly involves grinding mill procedures. Given the intricate nature of this task, it necessitates meticulous execution under the vigilant oversight of a Conservation Architect. (Labour Rates as perA.S.IL.K.O CurrentRate.) 26 Traditional stucco works using lime putty mortar in accordance with established conventions and design specifications, ensuring the preservation of contours and curves through pattern molds. The mortar preparation exclusively involves grinding mill procedures. Thickness ranges from 10mm to 100mm, tailored to the specific design requirements. 27 Preparation & Layingof Traditional lime Mortar as final top layer also used as water-proofing layer over base concrete on the terrace/ domes of the structure including prepration of mortar by traditional practice by grinding for base course (lime mortar - 1 Lime putty: 1 Surkhi: 1 Marble Dust, Microfiber) and organic additives along withtamping& proper curing. Final finishing of the surface with fine coat of lime putty mixed with fine sand, organic additives like gur sheera and beligirito match the orignal materials. It also includes maintaining original beetles and curves matching with original. (Labour Rates as perA.S.IL.K.O CurrentRate.) 28 Providing wood work in frames of doors, windows, clerestory windows and other frames, wrought framed and fixed in position with hold fast lugs or with dash fasteners of required dia & length ( hold fast lugs or dash fastener shall be paid for separately).(Labour Rates as perA.S.IL.K.O CurrentRate.) 29 Removing white or color wash by scrapping and sand paperingwithout causing damage to the below stone/brick/plastered surface.and preparing the surface smooth including necessary repairs to scratches etc. complete. 30 Disposal of building rubbish / malba / similar unserviceable, dismantled or waste materials by mechanical means, including loading, transporting,unloading to approved municipal dumping ground or as approved by Engineer-in-charge, beyond 50 m initial lead, for all leads including all lifts involved. 31 Traditional brick masonry in custom madebricks of (L=,B=,H=) as found on site in lime mortar in proportion similar to the existing traditional lime mortar 1:1:1 (lime :1 sand : 1surkhi)Note: The cost may change from region to region due to change in rate of customized bricks. 32 Same as above item but for ornamental work ie column and arches 33 Providing & Fixing of Spout for rain water 34 Painting on wood as per PWD Specifcation 35 Lime punning with lime putty mixed with Gur,Bilgri,Urd and other ingredients followed by grinding to fine paste for smooth finish 36 Protective MS Box for covering of Dietyfor any physical damages Steel work welded in built up sections/ framed work, including cutting, hoisting, fixing in position and applying a priming coat of approved steelprimer using structural steel etc. as required. In gratings, frames, guard bar, ladder, railings, brackets, gates and similar works 37 SANDSTONE POLISHING ON FLOORING 38 MIRZAPUR SAND STONE 39 RED SAND STONE 40 Scientific Investigation ,Documentaion and conservation expert consultaion for all the materials on the site, for eg. Lime, surkhi, i.e of the existing builfing and new material used simultaneously additive material used, soil testing, complete photographic documentation of each and every element of the building considering both internally & externally done under a superviision of a Conservation Architect before starting of any work. Along with condition assessment and material report of further analysis, research & documentaion. 41 Dismantling steel work in single section(MS Girder) very-2 carefully and slowly to avoid any damage to the adjoining portion/members of the heritage structure after inspecting and re-strengtening to provided propping system to avoid any untoward incident during execution of work, including dismembering and stacking 50 mtrs. away from the site. 42 Provision of support during dismantling in place of removed girders to avoid damage to heritage structure and make the site safe for workers during execution of work. 43 MS Channel 175 mm box vertically placed(as shaft) over base plate of 10 mm and at top with a base plate of 10 mm for pressure jack 44 Pressure jack required to support the roof during dismantling and fixing MS girder(Galvanised) to carry and transfer the load uniformily to the ground without failure. 45 Providing and fixing Structural steel work in single section(MS Girder (galvanised)) fixed with or without connecting plate, including cutting, hoisting & fixing in position as per original pattern after galvanising of the (MS Girder)all complete. 46 Reproduction of plaster of Shahjahani Arch & Semi- Circular Arch as per original pattern with traditional lime putty mortar of ratio (1:1:1) 1 Lime putty: 1 Surkhi: 1 Coarse sand mixed with Belgiri, Gur and Gum matching with original colour and texture by maintaining existing curve & beetles. 47 Providing and laying integral cement based water proofing treatment including preparation of surface as required for treatment of roofs,balconies, terraces etc consisting of following operations: (a) Applying a slurry coat of neat cement using 2.75 kg/sqm of cement admixed with water proofing compound conforming to IS. 2645 and approved by Engineer-in-charge over the RCC slab including adjoining walls upto 300 mm height including cleaning the surface before treatment. (b) Laying brick bats with mortar using broken bricks/brick bats 25 mm to 115 mm size with 50% of cement mortar 1:5 (1 cement : 5 coarse sand) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge over 20 mm thick layer of cement mortar of mix 1:5 (1 cement :5 coarse sand) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge to required slope and treating similarly the adjoining walls upto 300 mm height including rounding of junctions of walls and slabs. (c) After two days of proper curing applying a second coat of cement slurry using 2.75 kg/ sqm of cement admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge. (d) Finishing the surface with 20 mm thick jointless cement mortar of mix 1:4 (1 cement :4 coarse sand) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge including laying glass fibre cloth of approved quality in top layer of plaster and finally finishing the surface with trowel with neat cement slurry and making pattern of 300x300 mm square 3 mm deep. 48 (e) The whole terrace so finished shall be flooded with water for a minimum period of two weeks for curing and for final test. “All above operations to be done in order and as directed and specified by the Engineer-in-Charge”:With average thickness of 120 mm and minimum thickness at khurra as 65 mm. 49 Providing and Fixing of sand stone water spouts of size 900x300x125 with adhesive including the cost of all necessary fittings, accessories as per Design and drawing received from Architect in charge 50 Providing wood work in frames of doors, windows, clerestory windows and other frames, wrought framed and fixed in position with hold fast lugs or with dash fasteners of required dia & length (hold fast lugs or dash fastener shall be paid for separately).Second class teak wood 51 Providing and fixing panelled or panelled and glazed shutters for doors, windows and clerestory windows, fixing with butt hinges of required size with necessary screws, excluding panelling which will be paid for separately, all complete as per direction of Engineer-in-charge.(Note: Butt hinges and necessary screws shall be paid separately)Second class teak wood35 mm thick shutters 52 Providing and fixing panelling or panelling and glazing in panelled or panelled and glazed shutters for doors, windows and clerestory windows (Area of opening for panel inserts excluding portion inside grooves or rebates to be measured). Panelling for panelled or panelled and glazed shutters 25 mm to 40 mm thick. 53 Float glass panes:4 mm thick glass pane (weight not less than 10 kg/sqm). 54 APRON DRAIN 55 Renovation Works 56 Clearing jungle including uprooting of rank vegetation, grass, brush wood, trees and saplings of girth up to 30 cm measured at a height of 1m above ground level and removal of rubbish up to a distance of 50 m outside the periphery of the area cleared. 57 Demolishing brick work manually by mechanical means including stacking of serviceable material and disposal of unserviceable material within 50 mtrs leads as per direction of Engineer-in-charge in cement mortar. 58 Dismantling old plaster or skirting raking out joints and cleaning the surface for plaster including disposal of rubbish to the dumping ground within 50 metres lead. 59 Demolishing brick tile covering in terracing including stacking of serviceable material and disposal of unserviceable material within 50 metres lead. 60 Disposal of building rubbish / malba / similar unserviceable, dismantled or waste materials by mechanical means, including loading, transporting, unloading to approved municipal dumping ground or as approved by Engineer-in-charge, beyond 50 m initial lead, for all leads including all lifts involved upto 8 Km 61 Providing and laying in cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) and curing complete,including cost of form- work, in foundation and floors. 62 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extra cement 63 All works above plinth level upto floor V level 64 Concrete of M25 grade with minimum cement content of 330 kg /cum 65 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in foundation and plinth in:Cement mortar 1:6 (1 cement : 6 coarse sand) 66 GROUND FLOOR 67 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete upto plinth level.Thermo-Mechanically Treated bars of grade Fe-500D or more. 68 Providing and fixing bright /matt finished Stainless Steel sliding door bolts of approved quality & make with necessary screws etc all complete. 250mm x 16mm . 69 Providing and fixing bright /matt finished Stainless Steel tower bolts of approved quality & make with necessary screws etc all complete. 250mm x 10mm . 70 Providing and fixing bright /matt finished Stainless Steel tower bolts of approved quality & make with necessary screws etc all complete. 150mm x 10mm . 71 Providing and fixing bright /matt finished Stainless Steel handles of approved quality & make with necessary screws etc all complete. 125 mm 72 Providing and fixing bright /matt finished Stainless Steel handles of approved quality & make with necessary screws etc all complete. 100 mm 73 15mm Cement plaster with cement mortar in proportion of 1:6 cement & coarse sand of single coat for interior plastering upto floor two level including internal rounded angles chamfers, and rounded angles not exceeding 80mm in girth and finished even and smooth. 74 Centering and shuttering including strutting, propping etc. and removal of form for 75 Lintels, beams, plinth beams, girders, bressumers and cantilevers with water proof ply 12 mm thick 76 Providing and fixing parallel threaded couplers conforming to IS code on “Reinforcement Couplers for Mechanical Splices of Bars for Concrete Reinforcement - Specification”, to reinforcement bars including threading, enlargement at connection by forging, protecting the prepared reinforcement bars and related operations as required to complete the works per direction of Engineer- in-Charge. Coupler for 25 mm diameter reinforcement bar 77 Drilling suitable holes in reinforced or plain cement concrete with power driven drill machine to a minimum depth of 100mm upto 200mm in RCC beams, lintels, columns and slabs to introduce steel bars for sunshades/balconies including fixing the steel bars in position using epoxy resin anchor grout of approved make but excluding the cost of reinforcement, all complete as per direction of Engineer-In-Charge. 78 Providing and injecting HM-500 Epoxy Anchoring Type: HM-500 : Red or Black Density: 1.5±0.1g/cm³ in proportion Mix Ratio: 3:1 Color/ or recommended by the manufacturer into drills cracks/honey-comb area of concrete/masonry by suitable gun/pump at required pressure including cutting of nipples after curing etc. complete as per directions of Engineer-in-Charge. (make Hilti/HM or equivalent) 79 TOILET BLOCK (Civil Works) 80 Excavation in foundation in ordinary soil (loam clay or sand) including lift upto 1.50 meter and lead upto 30 meter and including filling, watering and ramming of excavated earth into the trenches or into the space between the building and sides of foundation trenches or into the plinth and removal and disposal of sur-plus earth as directed by the Engineer incharge up to a distance of 30 meters from the foundation trenches. 81 Excavating, supplying and filling of local earth (including royalty) by mechanical transport upto a lead of 5km also including ramming and watering of the earth in layers not exceeding 20 cm in trenches, plinth, sides of foundation etc. complete. 82 Supplying and filling in plinth with sand under floors, including watering, ramming, consolidating and dressing complete. 83 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 84 Providing and laying in position specified grade of reinforced cement concrete, excluding the cost of centering, shuttering, finishing and reinforcement - All work up to plinth level :1:1.5:3 (1 cement : 1.5 coarse sand (zone-lll) derived from natural sources : 3 graded stone aggregate 20 mm nominal size derived from natural sources) 85 Reinforced cement concrete work in walls (any thickness), including attached pilasters, buttresses, plinth and string courses, fillets, columns, pillars, piers, abutments, posts and struts etc. above plinth level up to floor five level, excluding cost of centering, shuttering, finishing and reinforcement :1:1.5:3 (1 cement : 1.5 coarse sand(zone-lll) derived from natural sources : 3 graded stone aggregate 20 mm nominal size derived from natural sources) 86 Reinforced cement concrete work in beams, suspended floors, roofs having slope up to 15° landings, balconies, shelves, chaijjas, lintels, bands, plain window sills, staircases and spiral stair cases above plinth level up to floor five level, excluding the cost of centering, shuttering, finishing and reinforcement with 1:1.5:3 (1 cement : 1.5 coarse sand(zone-lll) derived from natural sources : 3 graded stone aggregate 20 mm nominal sizederived from natural sources). 87 Centering and shuttering including strutting, propping etc. and removal of form for 88 Foundations, footings, bases of columns, etc. for mass concrete 89 Suspended floors, roofs, landings, balconies and access platform 90 Lintels, beams, plinth beams, girders, bressumers and cantilevers 91 Columns, Pillars, Piers, Abutments, Posts and Struts 92 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in foundation and plinth in: Cement mortar 1:6 (1 cement : 6 coarse sand) 93 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level in all shapes and sizes in :Cement mortar 1:6 (1 cement : 6 coarse sand) 94 Half brick masonry with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level.Cement mortar 1:4 (1 cement :4 coarse sand) 95 Applying a coat of residual petroleum bitumen of grade of VG-10 of approved quality using 1.7 kg per square metre on damp proof course after cleaning the surface with brushes and finally with a piece of cloth lightly soaked in kerosene oil. 96 Diluting and injecting chemical emulsion for POST-CONSTRUCTIONAL anti-termite treatment (excluding the cost of chemical emulsion) : 97 Along external wall where the apron is not provided using chemical emulsion @ 7.5 litres / sqm of the vertical surface ofthe substructure to a depth of 300mm including excavation channel along the wall & rodding etc. complete: 98 With Chlorpyriphos E.C. 20% with 1% concentration 99 Treatment of soil under existing floors using chemical emulsion@ one litre per hole, 300 mm apart including drilling 12 mm diameter holes and plugging with cement mortar 1 :2 (1 cement : 2 Coarse sand) to match the existing floor: 100 With Chlorpyriphos E.C. 20% with 1% concentration 101 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete upto plinth level.Thermo-Mechanically Treated bars of grade Fe-500D or more. 102 Providing and fixing aluminium sliding door bolts, ISI marked anodised (anodic coating not less than grade AC 10 as per IS : 1868), transparent or dyed to required colour or shade, with nuts and screws etc. complete :. 250mm x 16mm . 103 Providing and fixing aluminium tower bolts, ISI marked, anodised (anodic coating not less than grade AC 10 as per IS : 1868 ) transparent or dyed to required colour or shade, with necessary screws etc. complete : 250mm x 10mm . 104 Providing and fixing aluminium tower bolts, ISI marked, anodised (anodic coating not less than grade AC 10 as per IS : 1868 ) transparent or dyed to required colour or shade, with necessary screws etc. complete : 150mm x 10mm . 105 Providing and fixing aluminium handles, ISI marked, anodised (anodic coating not less than grade AC 10 as per IS : 1868) transparent or dyed to required colour or shade, with necessary screws etc. complete : 125 mm 106 Providing and fixing aluminium handles, ISI marked, anodised (anodic coating not less than grade AC 10 as per IS : 1868) transparent or dyed to required colour or shade, with necessary screws etc. complete : 100 mm 107 Providing and fixing M.S. Tubular frames for doors, windows, ventilators and cupboard with rectangular/ L-Type sections, made of 1.60 mm thick M.S. Sheet, joints mitred, welded and grinded finish, with profiles of required size, including fixing of necessary butt hinges and screws and applying a priming coat of approved steel primer.Fixing with 15x3 mm lugs 10 cm long embedded in cement concrete block 15x10x10 cm of C.C. 1:3:6 (1 Cement : 3 coarse sand : 6 graded stone aggregate 20 mm nominal size) 108 Providing & fixing glass panes with putty and glazing clips in steel doors, windows, clerestory windows, all complete with 4.0 mm thick glass panes 109 Providing and fixing ISI marked flush door shutters conforming to IS : 2202 (Part I) non-decorative type, core of block board construction with frame of 1st class hard wood and well matched commercial 3 ply veneering with vertical grains or cross bands and face veneers on both faces of shutters:35 mm thick single leaf shutters 110 Steel work welded in built up sections/ framed work, including cutting, hoisting, fixing in position and applying a priming coat of approved steel primer using structural steel etc. as required.In gratings, frames, guard bar, ladder, railings, brackets, gates and similar works 111 Providing and laying integral cement based water proofing treatment including preparation of surface as required for treatment of roofs, balconies, terraces etc consisting of following operations: a) Applying a slurry coat of neat cement using 2.75 kg/sqm. of cement admixed with water proofing compound conforming to IS. 2645 and approved by Engineer-in-charge over the RCC slab including adjoining walls upto 300mm height including cleaning the surface before treatment.b) Laying brick bats with mortar using broken bricks/brick bats 25 mm to 115mm size with 50% of cement mortar 1:5 (1 cement : 5 coarse sand) 112 admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge over 20 mm thick layer of cement mortar of mix 1:5 (1 cement :5 coarse sand ) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge to required slope and treating similarly the adjoining walls upto 300 mm height including rounding of junctions of walls and slabs c) After two days of proper curing applying a second coat of cement slurry using 2.75kg/ sqm of cement admixed with water proofing compound conforming to IS : 2645 and approved by 113 Engineer-in-charge. d) Finishing the surface with 20 mm thick jointless cement mortar of mix 1:4 (1 cement :4 coarse sand) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge including laying glass fibre cloth of approved quality in top layer of plaster and finally finishing the surface with trowel with neat cement slurry and making pattern of 300x300 mm square 3mm deep. e) The whole terrace so finished shall be flooded with water for a minimum period of two weeks for curing and for final test. All above operations to be done in order and as directed and specified by the Engineer-in-Charge : With average thickness of 120mm and minimum thickness at khurra as 65 mm. 114 15mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 115 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 116 12 mm cement plaster of mix 1:3 (1 cement: 3 coarse sand) in Ceiling 117 15mm thick plaster with cement mortar in proportion of 1:4 cement & coarse sand of 2.25 F.M. 118 Making groove 10 to 12 mm wide x 8 mm deep in plaster of the wall or in ceiling vertically or horizontally as required. 119 Providing and laying Ceramic glazed floor tiles of size 300x300 mm (thickness to be specified by the manufacturer) of 1st quality conformingto IS : 15622 of approved make in colours such as White, Ivory, Grey, Fume Red Brown, laid on 20 mm thick cement mortar 1:4 (1 Cement : 4Coarse sand), Jointing with grey cement slurry @ 3.3 kg/sqm including pointing the joints with white cement and matching pigment etc., complete. 120 Providing and fixing Ist quality ceramic glazed wall tiles conforming to IS: 15622 (thickness to be specified by the manufacturer), of approved make, in all colours, shades except burgundy, bottle green, black of any size as approved by Engineer-in-Charge, in skirting, risers of steps and dados, over 12 mm thick bed of cement mortar 1:3 (1 cement : 3 coarse sand) and jointing with grey cement slurry @ 3.3kg per sqm, including pointing in white cement mixed with pigment of matching shade complete. 121 Providing and laying vitrified floor tiles in different sizes (thickness to be specified by the manufacturer) with water absorption less than 0.08% and conforming to IS: 15622, of approved make, in all colours and shades, laid on 20 mm thick cement mortar 1:4 (1 cement : 4 coarse sand), jointing with grey cement slurry @ 3.3 kg/ sqm including grouting the joints with white cement and matching pigments etc., complete. 122 Kota stone slab flooring over 20 mm (average) thick base laid over and jointed with grey cement slurry mixed with pigment to match the shade of the slab, including rubbing and polishing complete with base of cementmortar 1 : 4 (1 cement : 4 coarse sand) : 123 Distempering with oil bound washable distemper of approved brand and manufacture to give an even shade :New work (two or more coats) over and including water thinnable priming coat with cement primer 124 Finishing walls with Acrylic smooth exterior paint of required shade: - New work (Two or more coat applied @ 1.67 Ltr./10 Sqm over and including base coat of water proofing cement paint applied @ 2.20 kg/10 Sqm. 125 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 126 Painting with synthetic enamel paint of approved brand and manufacture to give an even shade :Two or more coats on new work 127 Painting with synthetic enamel paint of approved brand and manufacture to give an even shade :Two or more coats on new work 128 Stone work (machine cut edges) for wall lining etc. (veneer work) upto 10 metre height, backing filled with a grout of average 12 mm thick cement mortar 1:3 (1 cement : 3 coarse sand) including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade : (To be secured to the backing and the sides by means of cramps and pins which shall be paid for separately) : 129 Red sand stone - Exposed face machine cut and table rubbed with rough backing.40 mm thick 130 Providing and fixing stainless steel cramps of required size and shape for anchoring stone wall lining to the backing or securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases in stone and holes in walls wherever required. 131 Providing and fixing copper pins 7.5 cm long 6 mm diameter for securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases. 132 Providing and fixing stone jali 40 mm thick throughout in cement mortar 1:3 (1 cement : 3 coarse sand), including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment, matching the stone shade, jali slab without any chamfers etc.Red sand stone 133 Stone work, plain in copings, cornices, string courses and plinth courses, upto 75 mm thick in Cement mortar 1:6 (1 cement : 6 coarse sand), including pointing with white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade. Red sand stone 134 Stone work plain ashlar in arches in super structure upto floor V level in cement mortar 1:3 (1 cement : 3 coarse sand) including centering, shuttering and pointing with white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade.Both face dressedRed sand stone 135 Making khurras 45x45 cm with average minimum thickness of 5 cm cement concrete 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate of 20 mm nominal size) over P.V.C. sheet 1 m x1 m x 400 micron, finished with 12 mm cement plaster 1:3 (1 cement : 3 coarse sand) and a coat of neat cement, rounding the edges and making and finishing the outlet complete. 136 Providing and fixing on wall face unplasticised Rigid PVC rain water pipes conforming to IS : 13592 Type A, including jointing with seal ring conforming to IS : 5382, leaving 10 mm gap for thermal expansion, (i) Single socketed pipes. 110 mm diameter 137 Providing and fixing unplasticised -PVC pipe clips of approved design to unplasticised - PVC rain water pipes by means of 50x50x50 mm hard wood plugs, screwed with M.S. screws of required length, including cutting brick work and fixing in cement mortar 1:4 (1 cement : 4 coarse sand) and making good the wall etc. complete. 110 mm 138 Providing and fixing on wall face unplasticised - PVC moulded fittings/ accessories for unplasticised Rigid PVC rain water pipes conforming to IS : 13592 Type A, including jointing with seal ring conforming to IS : 5382, leaving 10 mm gap for thermal expansion. 139 Coupler 140 110 mm 141 Bend 87.5° 142 110 mm bend 143 Shoe (Plain) 144 110 mm Shoe 145 Providing and fixing to the inlet mouth of rain water pipe cast iron grating 15 cm diameter and weighing not less than 440 grams. 146 Making plinth protection 50mm thick of cement concrete 1:3:6 (1 cement : 3 coarse sand (zone-III) derived from natural sources : 6 graded stone aggregate 20 mm nominal size derived from natural sources) over 75mm thick bed of dry brick ballast 40 mm nominal size, well rammed and consolidated and grouted with fine sand, including necessary excavation, levelling & dressing & finishing the top smooth. 147 PLUMBING WORK 148 Providing and fixing water closet squatting pan (Indian type W.C. pan) with 100 mm Sand Cast Iron P or S trap, 10 litre low level white P.V.C. flushing cistern, including flush pipe, manually controlled device (handle lever) conforming to IS : 7231, with all fittings and fixtures complete, including cutting and making good the walls and floors wherever required: 149 White Vitreous china Orissa pattern W.C. pan of size 580x440 mm with integral type foot rests. 150 Providing and fixing white vitreous china pedestal type water closet (European type W.C. pan) with seat and lid, 10 litre low level white P.V.C. flushing cistern, including flush pipe, with manually controlled device (handle lever), conforming to IS : 7231, with all fittings and fixtures complete, including cutting and making good the walls and floors wherever required : 151 W.C. pan with ISI marked white solid plastic seat and lid 152 Providing and fixing wash basin with C.I. brackets, 15 mm C.P. brass pillar taps,32 mm C.P. brass waste of standard pattern, including painting of fittings and brackets, cutting and making good the walls wherever require: 153 White Vitreous China Flat back wash basin size 550x 400 mm with single 15 mm C.P. brass pillar tap 154 Providing and fixing white vitreous china flat back or wall corner type lipped front urinal basin of 430x260x350 mm and 340x410x265 mm sizes respectively with automatic flushing cistern with standard flush pipe and C.P. brass spreaders with brass unions and G.I clamps complete, including painting of fittings and brackets, cutting and making good the walls and floors wherever required : 155 Range of three urinal basins with 10litre white P.V.C. automatic flushing cistern 156 Providing & fixing stone slab table rubbed, edges rounded and polished of size 75 X 50cm deep and 1.8 cm thick fixed in urinal patitions by cutting chase of appropriate width with chase cutter and embedding the stone in chase with epoxy grout or with cement concrete 1:2:4 ( 1 cement : 2 coarse sand : 4 graded stone aggregste 6mm nominal size) as per Engineer-in-charge and finished smooth 157 Granite stone of approved shade 158 Extra for providing opening of required size & shape for wash basin/ kitchen sink in kitchen platform, vanity counter and similar location in marble/ Granite/ stone work, including necessary holes for pillar taps etc. including moulding, rubbing and polishing of cut edges etc. complete. 159 Providing and fixing flexible P.V.C. waste pipe for sink or wash basin including PVC waste fittings complete. 160 Flexible pipe 161 i) 32 mm dia 162 Providing and fixing PTMT Bottle Trap for Wash basin and sink. 163 Bottle trap 31 mm single piece moulded with height of 270 mm, effective length of tail pipe 260 mm from the centre of the waste coupling 77 mm breadth with 25 mm minimum water seal, weighing not less than 260 gms. 164 Providing and fixing 600x450 mm beveled edge mirror of superior glass (of approved quality) complete with 6 mm thick hard board ground fixed to wooden cleats with C.P. brass screws and washers complete. 165 Circular shape 450 mm dia 166 Providing and fixing 600x120x5 mm glass shelf with edges round off, supported on anodised aluminium angle frame with C.P. brass brackets and guard rail complete fixed with 40 mm long screws, rawl plugs etc., complete. 167 Providing and fixing toilet paper holder : 168 C.P. brass 169 Providing and fixing soil, waste and vent pipes : 100 mm dia Centrifugally cast (spun) iron socket &spigot (S&S) pipe as per IS: 3989 170 75 mm O.D. 171 100 mm O.D. 172 Providing and fixing unplasticised -PVC pipe clips of approved design to unplasticised - PVC rain water pipes by means of 50x50x50 mm hard wood plugs, screwed with M.S. screws of required length, including cutting brick work and fixing in cement mortar 1:4 (1 cement : 4 coarse sand) and making good the wall etc. complete. 173 75 mm 174 110 mm 175 Providing and filling the joints with spun yarn, cement slurry and cement mortar 1:2 ( 1 cement : 2 fine sand) in S.C.I./ C.I. Pipes : 176 75 mm O.D. 177 110 mm O.D. 178 Providing and fixing M.S. holder-bat clamps of approved design to Sand Cast iron/cast iron (spun) pipe embedded in and including cement concrete blocks 10x10x10 cm of 1:2:4 mix (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size), including cost of cutting holes and making good the walls etc. : 179 75 mm 180 110 mm 181 Providing and fixing on wall face unplasticised - PVC moulded fittings/ accessories for unplasticised Rigid PVC rain water pipes conforming to IS : 13592 Type A, including jointing with seal ring conforming to IS : 5382, leaving 10 mm gap for thermal expansion. 182 Shoe (Plain) 183 75 mm Shoe 184 110 mm Shoe 185 Providing and fixing plain bend of required degree. Sand cast iron S&S as per IS - 3989 186 75 mm size 187 110 mm size 188 Providing and fixing heel rest sanitary bend Sand cast iron S&S as per IS - 3989 189 75 mm size 190 110 mm size 191 Providing and fixing bend of required degree with access door, insertion rubber washer 3 mm thick, bolts and nuts complete. Sand cast iron S&S as per IS - 3989 192 75 mm size 193 100 mm size 194 Providing and fixing terminal guard : Sand cast iron S&S as per IS - 3989 195 75 mm 196 100 mm 197 Providing and fixing trap of self cleansing design with screwed down or hinged grating with or without vent arm complete, including cost of cutting and making good the walls and floors : 198 Providing and fixing G.I. pipes complete with G.I. fittings and clamps, i/c cutting and making good the walls etc.Internal work - Exposed on wall 199 20 mm nominal outer dia pipes 200 25 mm nominal outer dia pipes 201 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings, including fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings with one step CPVC solvent cement and testing of joints complete as per direction of Engineer in Charge. 202 Internal work - Exposed on wall 203 20 mm nominal outer dia Pipes 204 25 mm nominal outer dia Pipes 205 32 mm nominal outer dia Pipes 206 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings i/c fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings, with one step CPVC solvent cement and the cost of cutting chases and making good the same including testing of joints complete as per direction of Engineer-in-Charge. Concealed work, including cutting chases and making good the wall etc. 207 15 mm nominal outer dia pipes 208 20 mm nominal outer dia pipes 209 Providing and fixing G.I. pipes complete with GI fittings and clamps including cutting and making good the walls etc. External work 210 40 mm dia, nominal bore 211 50 mm dia, nominal bore 212 Providing and fixing of gun metal gate valve with CI wheel of approved quality (screwed ends) 213 25mm dia, nominal bore 214 Providing and fixing uplasticised PVC connection pipe with brass unions : 215 45 cm length 216 15 mm nominal bore 217 Painting G.I. pipes and fittings with synthetic enamel white paint with two coats over a ready mixed priming coat, both of approved quality for new work (internal work -exposed on walls) 218 20 mm nominal outer dia pipes 219 25 mm nominal outer dia pipes 220 Providing and fixing ball valve (brass) of approved quality, High or low pressure, with plastic floats complete : 221 20 mm nominal bore 222 Providing and fixingG.I. union in G.I. pipe including cutting and threading the pipe and making long screws etc. complete (new work) 223 15mm nominal bore 224 20mm nominal bore 225 25mm nominal bore 226 32mm nominal bore 227 Providing and fixing C.P. brass bib cock of approved quality confirming to IS:8931 228 15mm nominal bore 229 Providing and fixing C.P. brass long body bib cock of approved quality conforming to IS standards and weighing not less than 690 gms. 230 15mm nominal bore 231 Providing and fixing C.P.brass angle valve for basin mixer and geyser points of approved quality conforming to IS 8931 a) 15 mm nominal bore. 232 15 mm nominal bore 233 Providing and fixing Jaquar Make Hand Shower (Health Faucet) with 8mm Dia,1.2 Meter Long Flexible Tube & Wall Hook of quality and make as approved by Engineer - in - charge. 234 Providing and fixing PTMT soap Dish Holder having length of 138mm, breadth 102mm, height of 75mm with concealed fitting arrangements, weighing not less than 106 gms. 235 Providing and placing on terrace (at all floor levels) polyethylene water storage tank, IS : 12701 marked, with cover and suitable lockingarrangement and making necessary holes for inlet, outlet and overflow pipes but without fittings and the base support for tank. 236 Excavating trenches of required width for pipes, cables, etc, including excavation for sockets, depth upto 1.5 m including getting out the excavated materials, returning the soil as required in layers not exceeding 20 cm in depth including consolidating each deposited layers by ramming, watering etc. stacking serviceable material for measurements and disposal of unserviceable material as directed, within a lead of 50m : 237 Pipes, cables etc. exceeding 80 mm dia but not exceeding 300 mm dia. 238 Providing and laying non-pressure NP2 class (light duty) R.C.C. pipes with collars jointed with stiff mixture of cement mortar in the proportion of 1:2 (1 cement : 2 fine sand) including testing of joints etc. complete : 239 100 mm O.D. 240 150 mm O.D. 241 Providing and laying cement concrete 1:5:10 (1 cement : 5 coarse sand : 10 graded stone aggregate 40 mm nominal size) all-round S.W. pipes including bed concrete as per standard design : 242 110/100 mm diameter pipe 243 160/150 mm diameter pipe 244 Providing and fixing square-mouth S.W. gully trap class SP-1 complete with C.I. grating brick masonry chamber with water tight C.I. cover with frame of 300 x300 mm size (inside) the weight of cover to be not less than 4.50 kg and frame to be not less than 2.70 kg as per standard design: 180x150 mm size P type With common burnt clay F.P.S. (non modular) bricks of class designation 7.5 245 Constructing brick masonry manhole in cement mortar 1:4 ( 1 cement : 4 coarse sand ) with R.C.C. top slab with 1:2:4 mix (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size), foundation concrete 1:4:8 mix (1 cement : 4 coarse sand : 8 graded stone aggregate 40 mm nominal size), inside plastering 12 mm thick with cement mortar 1:3 (1 cement : 3 coarse sand) finished with floating coat of neat cement and making channels in cement concrete 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size) Fisnihed with a floating coat of neat cement complete as per standard design : 246 Inside size 90x80 cm and 45 cm deep including C.I. coverwith frame (light duty) 455x610 mm internal dimensions, total weight of cover and frame to be not less than 38 kg (weight of cover 23 kg and weight of frame 15 kg) :With common burnt clay F.P.S. (non modular) bricks of class designation 7.5 247 ELECTRICAL WORK 248 Wiring for light point/ fan point/ exhaust fan point/ call bell point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable in surface / recessed medium class PVC conduit, with modular switch, modular plate, suitable GI box and earthing the point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable etc. as required. 249 Group - C 250 Wiring for light/ power plug with 2X4 sq. mm FRLS PVC insulated copper conductor single core cable in surface/ recessed steel conduit alongwith 1 No. 4 sq. mm FRLS PVC insulated copper conductor single core cable for loop earthing as required. 251 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required. 252 2 X 1.5 sq. mm + 1 X 1.5 sq. mm earth wire 253 2 X 2.5 sq. mm + 1 X 2.5 sq. mm earth wire 254 2 X 4 sq. mm + 1 X 4 sq. mm earth wire 255 4 X 4 sq. mm + 2 X 4 sq. mm earth wire 256 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providing and fixing 3 pin 5/6 A modular socket outlet and 5/6 amps modular switch, connection etc. as required. 257 Supplying and fixing two module stepped type electronic fan regulator on the existing modular plate switch box including connections but excluding modular plate etc. as required 258 Supplying and fixing modular blanking plate on the existing modular plate & switch box excluding modular plate as required 259 Lighting Fixtures (Lights/Fans) : 260 Supply & fixing of recess mounting round 15 to 18 watt LED down Lighter having Powder coated die cast aluminium housing with heat sink , diffuser /reflector and driver set complete in all respect. 261 Supply and fixing of LED Tube Light with Metal heavy duty Box type batten Light fitting 1X22 watt suitable for upto 1X22 watt LED Polycarbonate tube light complete Including tube suitable for both surface & suspended complete in all respect. 262 Supply and fixing of 3 watt to 6 watt LED(spot light) fitting Confirming to IP 65 and above protection Complete in all respect. CAT. - AAA (Use as a Decorative Mirror Light) 263 Supply & fixing of 12 Watt LED Bulb - B22 / E27 (Colour Temp.- 6500K / Lumens - 900 lm) cool day light, Input Volts (AC 90V-260V), 3-Star rating suitable for Batten/Angle holder including making connection.Complete in all respect. 264 Supply & fixing of 225/230mm sweep ventilating (Light Duty) exhaust fan complete with Metallic Blade (Steel bird guard protector /Copper motor for high air suction performance /Capacitor etc.), Noise level : (45 - 50) dB, Power consumption : 45 W, Rated voltage : 230 V, Rated frequency : 50 Hz, Motor type : Normal Speed. Complete in all respect. 265 Armoured Cables (Cable/Gland/Lug) : 266 Supplying and laying ofaluminium conductor PVC insulated armoured served sheathed cable 1100 volts grade at the depth of 750 mm bellow ground level over a cushion of 75 mm thick sand all around and protected with burnt bricks on side and on top .On surface the cable run shall be fixed on MS clamps etc.of suitable size or as directed bythe Engineer-Incharge ,complete in all respect.The armouring of the cable shall be properly connected with the earth conductor by clamps etc. Following size 267 size 6 sq mm x 2 core 268 Supplying and making end termination with brass compressiongland and aluminium lugs for following size of PVC insulatedand PVC sheathed / XLPE aluminium conductor cable of 1.1 KV grade as required. 269 3½ X 25 sq. mm (28mm) 270 Earthing Work : 271 Earthing with copper earth plate 600 mm X 600 mm X 3 mmthick including accessories, and providing masonry enclosurewith cover plate having locking arrangement and watering pipeof 2.7 metre long etc. with charcoal/ coke and salt as required. 272 Supplying and laying 25 mm X 5 mm G.I strip at 0.50 metre below ground as strip earth electrode, including connection/ terminating with G.I. nut, bolt, spring, washer etc. as required. (Jointing shall be done by overlapping and with 2 sets of G.I. nut bolt & spring washer spaced at 50mm) 273 DBs & MCBs : 274 Supplying and fixing 5 amps to 32 amps rating, 240/415 volts, C curve, miniature circuit breaker suitable for inductive load of following poles in the existing MCB DB complete with connections, testing and commissioning etc. as required. 275 Supplying and fixing single pole blanking plate in the existing MCB DB complete etc. as required. 276 Supplying and fixing following rating, double pole, (single phase and neutral), 240 V, residual current circuit breaker (RCCB),having a sensitivity current 30 mA in the existing MCB DB complete with connections, testing and commissioning etc. As required.40 A 277 Supplying and fixing following way, horizontal type three poleand neutral, sheet steel, MCB distribution board, 415 V, onsurface/ recess, complete with tinned copper bus bar, neutralbus bar, earth bar, din bar, interconnections, powder paintedincluding earthing etc. as required. (But withoutMCB/RCCB/Isolator)4 way (4 + 12), Double door 278 Miscellaneous Items : 279 Providing and fixing M.V. danger notice plate of 200 mm X 150mm, made of mild steel, at least 2 mm thick, and vitreous enameled white on both sides, and with inscription in single redcolour on front side as required. 280 Supplying and fixing following Modular base & cover plate on existing modular metal/GP boxes etc. as required. 281 3 Module 282 4 Module 283 6 Module 284 12 Module 285 INTERLOCKING PATHWAY (295.94 Sqm 286 Earth work in exacavation in trenches for foundations pipes cables etc. in ordinary soil (loam clay or sand) including lift upto 1.5 m and dressing of sides and ramming of bottom and disposal of surplus excavated earth as directed by the Engineer i/c with in a lead of 50m. (DSR 2.8.1) 287 Construction of dry lean cement concrete sub base over a prepared subgrade with coarse and fine aggregate conforming to IS:383, the size of coarse aggregate not exceeding 25 mm, aggregate cement ratio not to exceed 15:1, aggregate gradation after blending to be as per specifications, cement content not to be less than 150 Kg/cum, optimum moisture content to be determined during trial length construction, concrete strength not to be less than 10 Mpa at 7 days, mixed in a batching plant, transported to site, for all leads & lifts, laid with a mechanical paver, compacting with 8-10 tonne vibratory roller, finishing and curing etc. complete as per direction ofEngineer-in- charge. (DSR-16.80) 288 Construction of granular sub-base by providing close graded Material conforming to specifications, mixing in a mechanical mix plant at OMC, carriage of mixed material by tippers to work site, for all leads & lifts, spreading in uniform layers of specified thickness with motor grader on prepared surface and compacting with vibratory power roller to achieve the desired density, complete as per specifications and directions of Engineer-in-Charge.With material conforming to Grade-I (size range 75 mm to 0.075 mm) having CBR Value-30 (DSR-16.78.1) 289 Providing and laying at or near ground level factory made kerb stone of M-25 grade cement concrete in position to the required line, level and curvature, jointed with cement mortar 1:3 (1 cement: 3 coarse sand), including making joints with or without grooves (thickness of joints except at sharp curve shall not to more than 5mm), including making drainage opening wherever required complete etc. as per direction of Engineer-in-charge (length of finished kerb edging shall be measured for payment). (Precast C.C. kerb stone shall be approved by Engineer-in-charge). (DSR-16.69) 290 Providing and laying 60 mm thick faciory made cement concrete interlocking paver block of M -30 grade made by block making machine with strong vibratory compaction, of approved size, design & shape, laid in required colour and pattern over and including 50 mm thick compacted bed of coarse sand, filling the joints with line sand etc. all complete as per the direction of Engineer-in-charge. 291 Septic Tank With Soakpit 292 Excavation in Foundation in ordinary soil (with moorum/shingle kankar requiring the use) including lift upto 1.5 metre (5 fts.) and lead upto 30m (100 fts) & including filling, watering and ramming of excavated earth into the trenches or into the space between the building and the sides of foundation trenches or into the plinth and removal and disposal of surplus earth as directed by the Engineer-in-charge upto a distance of 30 m. (100 fts) from the foundation trenches. (Rate is including Royality). 293 From 0.00 mt to 1.50 mt 294 1.50mt to 3.0 mt 295 3.0 mt to 4.50 mt 296 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 stone ballast 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 297 R.C.C. work with cement approved coarse sand and 20 mm. guage approved stone grit im the proportion of 1:1.5:3 excluding supply of reinforcement and its fixing and binding the same with 24 BWG binding wire and including necessary centering and shuttering etc.and also including supply of all materials, labour and tools and plants etc, required for proper completion of the works. strength of the concrete shall not beless than M-25. R.C.C. Work Slab 298 Class-150 brick work in 1:4 cementand Coarse sandmortar in foundation and plinth including supply of all materials, labour tools and plants, etc. Required for proper completetion of the work. 299 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete above plinth level.Thermo-Mechanically Treated bars of grade Fe-500D or more 300 Cement concrete flooring 1:2:4 (1 cement :2 coarse sand :4 graded stone aggregate 12-20mm nominal size laid in one layer neat cement (40 mm thick floor). 301 15 mm cement plaster in single coat on rough side of single or half brick wall for interior plastering up to floor two level including internal rounded angles not exceeding 80 mm in girth and finshed even and smooth. (1) 1 cement : 4 Coarse sand 302 Providing and fixing soil, waste and vent pipes : 75mm diameter : Sand cast iron S&S pipe as per IS: 1729 303 Providing M.S. foot rests including fixing in manoholes with 20x20x10 cm cement concrete blocks 1:3:6 (1cement : 3 coarse sand : 6 graded stone aggregate 20mm nominal size) as per standard design:(With 20x20mm square bar) 304 Making soak pit 2.5 m diameter 3.0 metre deep with 45 x 45 cm dry brick honey comb shaft with bricks and S.W. drain pipe 100 mm diameter, 1.8 m long complete as per standard design With common burnt clay F.P.S. (non modular) bricks of class designation 7.5 305 BORING AND WATER SUPPLY 306 Boring/drilling bore well of required dia for casing/ strainer pipe, by suitable method prescribed in IS: 2800 (part I), including collecting samples from different strata, preparing and submitting strata chart/ bore log, including hire & running charges of all equipments, tools, plants & machineries required for the job, all complete as per direction of Engineer -in-charge, beyond 90 metre below ground level. 300 mm dia 307 Supplying, assembling, lowering and fixing in vertical position in bore well, unplasticized PVC medium well casing (CM) pipe of requireddia, conforming to IS: 12818, including required hire and labour charges, fittings & accesDSRies etc. all complete, for all depths, as per direction of Engineer -in-charge. 150 mm nominal size dia 308 Supplying, assembling, lowering and fixing in vertical position in bore well unplasticized PVC medium well screen (RMS) pipes with ribs, conforming to IS: 12818, including hire & labour charges, fittings & accesDSRies etc. all complete, for all depths, as per direction of Engineer-in-charge.150 mm Nominal Size dia 309 Gravel packing in tubewell construction in accordance with IS: 4097, including providing gravel fine/ medium/ coarse, in required grading& sizes as per actual requirement, all complete as per direction of Engineer-in-charge. 310 Development of tube well in accordance with IS : 2800 (part I) and IS: 11189, to establish maximum rate of usable water yield without sand content (beyond permissible limit), with required capacity air compresDSR, running the compresDSR for required time till well is fully developed, measuring yield of well by V notch method or any other approved method, measuring static level & draw down etc. by step draw down method, collecting water samples & getting tested in approved laboratory, i/c disinfection of tubewell, all complete, including hire & labour charges of air compresDSR, tools & accesDSRies etc., all as per requirement and direction of Engineer-in-charge. 311 Providing and fixing suitable size threaded mild steel cap or spot welded plate to the top of bore well housing/ casing pipe, removable as per requirement, all complete for borewell of: 150 mm Dia 312 Providing and fixing M.S. clamp of required dia to the top of casing/ housing pipe of tubewell as per IS: 2800 (part I), including necessary bolts & nuts of required size complete.150 mm clamp 313 Providing and fixing Bail plug/ Bottom plug of required dia to the bottom of pipe assembly of tubewell as per IS:2800 (part I).150 mm Dia 314 Providing and fixing G.I. pipes complete with G.I. fittings includingtrenching and refilling etc. 315 50 mm nominal size dia 316 Electric logging of bore hole 317 Supply and Installation of 1.5 HP Submersible pump set complete 318 EXTERNAL ELECTRIFICATION 319 Wiring for light point/ fan point/ exhaust fan point/ call bell point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable in surface / recessed medium class PVC conduit, with modular switch, modular plate, suitable GI box and earthing the point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable etc. as required. 320 Group - C 321 Wiring for twin control light point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable in surface / recessed medium class PVC conduit, 2 way modular switch, modular plate, suitable GI box and earthing the point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable etc. as required. 322 Wiring for group controlled (looped) light point/fan point/exhaust fan point/ call bell point (without independent switch etc.) with 1.5 sq. mm FRLS PVC insulated copper conductor single core cable in surface/ recessed medium class PVC conduit, and earthing the point with 1.5 sq. mm FRLS PVC insulated copper conductor single core cable etc. as required 323 Group -A 324 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required. 325 2 X 1.5 sq. mm + 1 X 1.5 sq. mm earth wire 326 2 X 2.5 sq. mm + 1 X 2.5 sq. mm earth wire 327 2 X 4 sq. mm + 1 X 4 sq. mm earth wire 328 2 X 6 sq. mm + 1 X 4 sq. mm earth wire 329 2 x 10 sq.mm + 1 x 6sq.mm. earth wire 330 2 x 16 sq.mm + 1 x 6sq.mm. earth wire 331 4 x 6 sq.mm + 2 x 6 sq.mm. earth wire 332 4 x 10 sq.mm + 2 x 6 sq.mm. earth wire 333 4 x 16 sq.mm + 2 x 6sq.mm. earth wire 334 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providing and fixing 3 pin 5/6 A modular socket outlet and 5/6 amps modular switch, connection etc. as required. 335 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providing and fixing 6 pin 5/6 & 15/16 amps modular socket outlet and 15/16 amps modular switch, connection etc. as required. 336 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providng and fixing 2 nos. 3 pin 5/6 A modular socket outlet and 2 nos. 5/6 A modular switch, connections etc. as required. (For light plugs to be used in non residential buildings). 337 Supplying & fixing suitable size GI box wih modular plate and cover in front on surface or in recess including providing and fixing 25 A modular socket outlet and 25 A modular SP MCB, C curve including connections, painting etc. as required. 338 Supplying and fixing two module stepped type electronic fan regulator on the existing modular plate switch box including connections but excluding modular plate etc. as required 339 Supplying and fixing modular blanking plate on the existing modular plate & switch box excluding modular plate as required 340 Supplying and fixing following modular switch/ socket on the existing modular plate & switch box including connections but excluding modular plate etc. as required 341 5/6 A switch 342 3 pin 5/6 A socket outlet 343 Supplying and fixing 3 pin, 5 A ceiling rose on the existing junction box/ wooden block including connections etc. as required. 344 Installation ,Testing, Commissioning of wall bracket /ceiling fittings of all sizes and shapes containing upto two GLS/CFL/LED lamps per fitting, complete with all accessories including connections etc. as required. 345 Providing and fixing circular/ Hexagonal cast iron or M.S. sheet box for ceiling fan clamp, of internal dia 140 mm, 73 mm height, top lid of 1.5 mm thick M.S. sheet with its top surface hacked for proper bonding, top lid shall be screwed into the cast iron/ M.S. sheet box by means of 3.3 mm dia round headed screws, one lock at the corners. Clamp shall be made of 12 mm dia M.S. bar bent to shape as per standard drawing. 346 Supplying and fixing extra down rod of 10 cm length G.I. pipe, 15 mm dia, heavy gauge including painting etc. as required. (Note : More than 5 cm length shall be rounded to the nearest 10 cm and 5 cm or less shall be ignored) 347 Installation of exhaust fan in the existing opening, including making good the damage, connection, testing, commissioning etc. as required 348 Upto 450 mm sweep 349 Extra for fixing the Louvers/ shutters complete with frame for exhaust fans of all sizes. 350 Supply of Recessed mounting 2x2 feet 36W LED , suitable for 24Hr Continuous Operation, 3000-6000 system lumens, 110lm/W,PF>0.95, THD <10% at full load, CRI>80, Avg Life Class 50000Hrs @L70,complete in all respect. 351 Supply of Recess/Surface mounting 2x2 feet 24 to 30W LED , suitable for 24Hr Continuous Operation, 3000-6000 system lumens, 110lm/W,PF>0.95, THD <10% at full load, CRI>80, Avg Life Class 50000Hrs @L70,complete in all respect. 352 Supply of LED 4ft 40W LED Tube light with a nominal system lumen output of 4000 lumens and a minimum system efficacy of 100 lm/W. The luminaire shall have a rated system lifetime of 25,000 burning hours at L70. The luminaire should have a color temperature of 3000K and CRI>80. The luminaire shall meet IP20 rating with THD < 10% and PF > 0.9. The luminaire housing should made of extrusion Al with a PCdiffuser. The total power consumption should not exceed 42W (including driver). 353 Supply of Suspended mounting 36W LED Liner Batten Light, suitable for 24Hr Continuous Operation, 3000-6000 system lumens, 110lm/W,PF>0.95, THD <10% at full load, CRI>80, Avg Life Class 50000Hrs @L70,complete in all respect. 354 Supply of LED 4ft Batten with a nominal system lumen output of 2000 lumens and a minimum system efficacy of 100 lm/W. The luminaire shall have a rated system lifetime of 25,000 burning hours at L70. The luminaire should have a color temperature of 4000K and CRI>80. The luminaire shall meet IP20 rating with THD < 10% and PF > 0.9. The luminaire housing should made of extrusion Al with a PCdiffuser. The total power consumption should not exceed 21W (including driver). 355 Supply of Recess mounting round 6 Watt 10 Watt , LED Down Lighter, suitable for 24Hr Continuous Operation, 660-1100 system lumens, 110lm/W,PF>0.95, THD <10% at full load, CRI>80, Avg Life Class 50000Hrs @L70,complete in all respect. 356 Supply of Recess mounting round 12 Watt 15 Watt ,suitable for 24Hr Continuous Operation, 100lm/W,PF>0.95, THD <10% at full load, CRI>80, Avg Life Class 50000Hrs @L70,complete in all respect 357 Supply of Recess mounting square 20 Watt , suitable for 24Hr Continuous Operation, 100lm/W,PF>0.95, THD <10% at full load, CRI>80, Avg Life Class 50000Hrs @L70,complete in all respect. 358 Supplying of Bead Head light 31W fitting complete including connections etc. 359 Supplying of Bulkhead type light fitting complete with, wire guard, holder, electronic ballast 1 x 10 W lamp including connections etc.complete in all respect 360 Supplying of LED mirror light luminaire with 10Wwatt complete with electronic ballast, lamp including connection etc. complete as required. 361 Supply of LED Flood light 50 Watt , suitable for 24Hr Continuous Operation, 110lm/W,PF>0.95, THD <10% at full load, CRI>80, Avg Life Class 50000Hrs @L70, CCT 3000K, complete in all respect, 362 Supplying and fixing brass batten/ angle holder including connection etc. as required. 363 Supplying of 9 Watt 4 Star LED Wall Light Blub complete in all respect. 364 Supplying of 9 Watt Decorative LED Wall Light complete in all respect. 365 Supply and fixing of 6 Watt LED Inground UpLight luminaire Confirming to IP 66 Protection complete in all respect. 366 Supply, Installation, Testing and Commissioning of 1200 mm sweep, BEE 5 star rated, ceiling fan with Brush Less Direct Current (BLDC) Motor, class of insulation: B, 3 nos. blades, 30 cm long down rod, 2 nos. canopies, shackle kit, safety rope, copper winding, Power Factor not less than 0.9, Service Value (CMM/W) minimum 6.85, Air delivery minimum 215 CMM, 350 RPM (tolerance as per IS : 374- 2019), THD less than 10%, remote or electronic regulator unit for speed control and all remaining accessories including safety pin, nut bolts, washers, temperature rise=75 degree C (max.), insulation resistance more than 2 mega ohm, suitable for 230 V, 50 Hz, single phase AC Supply, earthing etc. complete as required. 1200 mm sweep ceiling fan 367 Supplying, erection, connecting, testing and commissioning of 400 mm Wall Fancomplete in all respect. 368 Supplying of following size exhaust fan complete with gravity louver and connection with 3 core flexible wire as required. 369 300mm EXHAUST FAN 370 Providing and fixing following rating and breaking capacity and pole MCCB with thermomagnetic release and terminal spreaders in existing cubicle panel board including drilling holes in cubicle panel, making connections, etc. as required 371 40 A,25KA,FP MCCB 372 63 A,25KA,FP MCCB 373 100 A,30KA,FPMCCB 374 125 A,36KA,FPMCCB 375 160 A,25KA,FP MCCB 376 200 A, 36KA,FPMCCB 377 250 A, 36KA,FPMCCB 378 320 A, 36KA,FPMCCB 379 Supplying and fixing following way ,single pole and neutral,sheet steel, MCB distribution board, 240 V, on surface/ recess, complete with tinned copper bus bar, earth bar, din bar, interconnections, powder painted including earthing etc. as required. (But without MCB/RCCB/Isolator) 380 6 Way Double Door 381 8 way, Double door 382 12 way, Double Door 383 16 way, Double Door 384 Supplying and fixing following way, horizontal type three pole and neutral, sheet steel, MCB distribution board, 415 V, on surface/ recess, complete with tinned copper bus bar, neutral bus bar, earth bar, din bar, interconnections, powder painted including earthing etc. as required. (But without MCB/RCCB/Isolator) 385 4 Way Double door 386 6 way Double door 387 8 way Double door 388 12 way Double door 389 Supplying and fixing following way surface/ recess mounting, vertical type, 415 V, TPN MCB distribution board of sheet steel, dust protected, duly powder painted, inclusive of 200 A, tinned copper bus bar, common neutral link, earth bar, din bar for mounting MCBs (but without MCBs and incomer) as required.(Note : Vertical type MCB TP DB is normally used where 3 phase outlet are required.) 390 4 way (4 + 12), Double door 391 8 way (4 + 24), Double door 392 Supplying and fixing TP/FP sheet steel enclosure on surface/ recess. Suitable for upto 125 A 415 V MCCB complete with connections, testing and commissioning etc. as required. 393 Supplying and fixing following rating, four pole, 415 V, MCB in the existing MCB DB complete with connections, testing and commissioning etc. as required 394 40 amps SP MCB 395 40 amps DP MCB 396 63 amps DP MCB 397 40 amps TP MCB 398 63 amps TP MCB 399 40 amps 4P MCB 400 63 amps 4P MCB 401 100 amps 4P MCB 402 Supplying and fixing following rating, double pole, 240 V, isolator in the existing MCB DB complete with connections, testing and commissioning etc. as required 403 40 amps 404 63 amps 405 Supplying and fixing following rating, four pole, 415 V, isolator in the existing MCB DB complete with connections, testing and commissioning etc. as required 406 40 amps 407 63 amps 408 Supplying and fixing following rating, double pole, (single phase and neutral), 240 V, residual current circuit breaker (RCCB),having a sensitivity current 30 mA in the existing MCB DB complete with connections, testing and commissioning etc. As required. 409 25 amps 410 40 amps 411 63 amps 412 Supplying and fixing 5 amps to 32 amps rating, 240/415 volts, C curve, miniature circuit breaker suitable for inductive load of following poles in the existing MCB DB complete with connections, testing and commissioning etc. as required. 413 Single pole 414 Double pole 415 Triple pole 416 Triple pole and neutral 417 Supplying and fixing single pole blanking plate in the existing MCB DB complete etc. as required. 418 Supplying and fixing 1P LCD Energy Meter 5-30A with BOX 419 Supplying and fixing 3Ph 4 W kWh Dir base mtg 240V 10- 60 A Energy Meter 420 Supplying and fixing 20 A, 240 V, SPN Industrial type socket outlet, with 2 pole and earth, metal enclosed plug top alongwith 20 A C curve, SP, MCB, in sheet steel enclosure, on surface or in recess, with chained metal cover for the socket out let and complete with connections, testing and commissioning etc. as required. 421 Supplying and fixing DP sheet steel enclosure on surface/ recessalong with 25/32 A 240 V C curve DP MCB complete withconnections, testing and commissioning etc. as required. 422 Supplying and fixing 4P sheet steel enclosure on surface/ recess complete with connections, testing and commissioning etc. as required. 423 Supplying and fixing TP/FP sheet steel enclosure on surface/ recess. Suitable for upto 125 A 415 V MCCB complete with connections, testing and commissioning etc. as required. 424 Supplying and laying of following size DWC HDPE pipe ISI marked along with all accessories like socket, bend, couplers etc. conforming to IS 14930, Part II complete with fitting and cutting, jointing etc. in the existing trench, complete as required. 425 90 mm dia (OD-90 mm & ID-76 mm nominal) 426 Supply, installation, testing and commissioning of electrical panel, modular type, front accessible only, free floor standing confirming to Minimum IP:43 degree of protection.The panel sheet structure shall undergo seven tank pre-treatment process before painting.The sheet steel shall be all of 2.0mm thick CRCA sheet.All the openable compartments of the panel shall be completely shrouded and provided with padlocking arrangement on all compartments including bus bar and cable alley chambers.The panel height shall not exceed 2200mm and the maximum operating height for any switchgear shall not be more than 1700mm.The panel shall be provided with minimum 75mm base channel frame fabricated from ISMC sections.All bus bar links in the panel shall be solid bus bars with coloured PVC shrinkable sleeves, no wires will be acceptable.Continuous earth bus shall run alround the panel with earthing studs provided at minimum 2 places.The control wiring shall be carried out with minimum 1.5/2.5 sqmm copper wires and adequate number of NO/NC, potential free contacts incorporated for remote operation of the starters.Proper sized cable termination gland plates shall be provided oncable alleys and knockouts for same shall be provided during fabrication stage itself.The panel shall be provided with a thermostatically controlled heating arrangement (200 W) to take care of high humidity conditions.A 5A socket service outlet (single phase) shall be provided in one of the compartments as ervice outlet in the panel.Panel shall be so designed at to have minimum 20% spare feeders/space.Panel shall undergo epoxy powder coated paint, colour as per IS:5 requirement.All cable terminations shall be from top.The complete panel shall be fuse less type, for control circuits 2A/6A MCBs to be used.All bus bars shall be of aluminium, electrolytic grade only.Maximum design density shall not exceed 1 Amps/Sqmm.All bus bars shall be insulated with coloured heat shrinkable PVC sleeved.All bus bar supports shall be non hygroscopic DMC/SMC supports. 427 The panel shall be manufactured in conformance to requirements of local electrical inspector and it shall be contractors responsibility to get initial approval of drawings and also final approval of complete electrical works related to this section. 428 The minimum clearances between bus bars shall be as follows : 429 Phase to phase - minimum 20mm 430 Phase to neutral-minimum 15mm 431 Feeder Pillar 432 Incoming : 433 1 No 100 Amp. 4P MCCB of 35KA (Ics=Icu)Breaking Capacity 434 Metering : 435 1 Set of CTs one of 100/ 5Amp ratio for Multifunction Meter 436 Bus Bar : 437 1 No. 100 Amp. FP aluminimum bus bar of suitable length. 438 Outgoing : 439 Phase indication lamps on each outgoing to be provided. 440 63 Amps FP MCB of 35KA - 1 No 441 16 Amps DP MCB of 35KA - 3 No 442 2 No. SPACE & SPARE 443 Panel described as above 444 Providing and fixing M.V. danger notice plate of 200 mm X 150 mm, made of mild steel, at least 2 mm thick, and vitreous enameled white on both sides, and with inscription in single red colour on front side as required. Details of cost for one each 445 Earthing with G.I. earth plate 600 mm x 600 mm x 6 mm thick including accessories , and providing masonry enclosure with cover plate having locking arrangement and watering pipe etc. (but with charcoal or coke and salt) as required. 446 Earthing with copper earth plate 600 mm X 600 mm X 3 mm thick including accessories, and providing masonry enclosure with cover plate having locking arrangement and watering pipe of 2.7 metre long etc. with charcoal/ coke and salt as required 447 Supplying and laying 25 mm X 5 mm copper strip at 0.50 metre below ground as strip earth electrode, including connection/ terminating with nut, bolt, spring, washer etc. as required. (Jointing shall be done by overlapping and with 2 sets of brass nut bolt & spring washer spaced at 50mm) 448 Supplying and laying 25 mm X 5 mm G.I strip at 0.50 metre below ground as strip earth electrode, including connection/ terminating with G.I. nut, bolt, spring, washer etc. as required. (Jointing shall be done by overlapping and with 2 sets of G.I. nut bolt & spring washer spaced at 50mm) 449 Providing and laying earth connection from earth electrodewith 6 SWG dia G.I. Wire in 15 mm dia G.I. pipe from earthelectrode including connection with G.I. thimble excavation andre-filling as required. 450 Providing and fixing 25 mm X 5 mm copper strip on surface or in recess for connections etc. as required. 451 Providing and fixing 25 mm x 5 mm G.I. strip on surface or in recess for connections etc. as required. 452 Laying of one number PVC insulated and PVC sheathed / XLPE powerCable of 1.1 KV grade of following size direct in ground including excavation, sand cushioning, protective covering and refilling the trench etc as required. 453 Up to 35 sq.mm. 454 Above 35 sq.mm. and up to 95 sq.mm. 455 Above 95 sq.mm. and upto 185 sq.mm. 456 Above 185 sq.mm. and up to 400 sq.mm. 457 Laying of one number additional PVC insulated and PVC sheathed / XLPE power cable of 1.1 KV grade of following size direct in ground in the same trench in one tier horizontal formation including excavation, sand cushioning, rotective covering and refilling the trench etc as required 458 Up to 35 sq.mm. 459 Above 35 sq.mm. and up to 95 sq.mm. 460 Above 95 sq.mm. and upto 185 sq.mm. 461 Above 185 sq.mm. and up to 400 sq.mm. 462 Laying of one number PVC insulated and PVC sheathed / XLPE power cable of 1.1 KV grade of following size direct in ground including excavation and refilling the trench etc as required, but excluding sand cushioning and protective covering. 463 Up to 35 sq.mm. 464 Above 35 sq.mm. and up to 95 sq.mm. 465 Above 95 sq.mm. and upto 185 sq.mm. 466 Above 185 sq.mm. and up to 400 sq.mm. 467 Laying of one number additional PVC insulated and PVC sheathed / XLPE power cable of 1.1 KV grade of following size direct in ground in the same trench in one tier horizontal formation including excavation and refilling the trench etc as required, but excluding sand cushioning and protective covering. 468 Up to 35 sq.mm. 469 Above 35 sq.mm. and up to 95 sq.mm. 470 Above 95 sq.mm. and upto 185 sq.mm. 471 Above 185 sq.mm. and up to 400 sq.mm. 472 Laying of one number PVC insulated and PVC sheathed / XLPE power cable of 1.1 KV grade of following size in the existing RCC/ HUME/ METAL pipe as required 473 Up to 35 sq.mm. 474 Above 35 sq.mm. and up to 95 sq.mm. 475 Above 95 sq.mm. and upto 185 sq.mm. 476 Above 185 sq.mm. and up to 400 sq.mm. 477 Laying and fixing of one number PVC insulated and PVC sheathed / XLPE power cable of 1.1 KV grade of following size on wall surface as required 478 Upto 35 sq. mm (clamped with 1mm thick saddle 479 Above 35 sq. mm and upto 95 sq. mm (clamped with 25x3mm MS flat clamp 480 Above 95 sq. mm and upto 185 sq. mm (clamped with 25/40x3mm MS flat clamp 481 Above 185 sq. mm and upto 400 sq. mm (clamped with 40x3mm MS flat clamp) 482 Laying and fixing of one number PVC insulated and PVC sheathed / XLPE power cable of 1.1 KV grade of following size on cable tray as required. 483 Upto 35 sq. mm (clamped with 1mm thick saddle) 484 Above 35 sq. mm and upto 95 sq. mm (clamped with 25x3mm MS flat clamp) 485 Above 95 sq. mm and upto 185 sq. mm (clamped with 25/40x3mm MS flat clamp) 486 Above 185 sq. mm and upto 400 sq. mm (clamped with 40x3mm MS flat clamp) 487 Supply of following siz of 1.1KV grade multicorealuminium conductor XLPE insulated and PVC shethed armoured cable as per IS 7098:1988 with up to date amendment 488 3.5 x 400 sq.mm. 489 3.5 x 300 sq.mm. 490 3.5 x 240 sq.mm. 491 3.5 x 185 sq.mm 492 3.5 x 150 sq.mm 493 3.5 x 120 sq.mm 494 3.5 x 95 sq.mm 495 3.5 x 70 sq.mm 496 3.5 x 50 sq.mm 497 3.5 x 35 sq.mm 498 3.5 x 25 sq.mm. 499 4 x 25 sq.mm 500 4 x 16 sq.mm 501 4 x 10 sq.mm 502 4 x 6 sq.mm 503 2 x 16 sq.mm, 504 2 x 10 sq.mm, 505 2 x 6 sq.mm, 506 Supplying and making cable end terminations with brasscompression gland and aluminium lugs for following size of PVC insulated PVC sheathed/XLPE aluminium conductor cable of 1.1 KV grade, completeas required. 507 2 X 6 sq. mm (19mm) 508 2 X 10 sq. mm (19mm) 509 2 X 16 sq. mm (22mm) 510 3½ X 25 sq. mm (28mm) 511 3½ X 35 sq. mm (32mm) 512 3½ X 50 sq. mm (35mm) 513 3½ X 70 sq. mm (38mm) 514 3½ X 95 sq. mm (45mm) 515 3½ X 120 sq. mm (45mm) 516 3½ X 150 sq. mm (50mm) 517 3½ X 185 sq. mm (57mm) 518 3½ X 225 sq. mm (62mm) 519 3½ X 240 sq. mm (62mm) 520 3½ X 300 sq. mm (70mm) 521 3½ X 400 sq. mm (82mm) 522 4 X 10 sq. mm (25mm) 523 4 X 16 sq. mm (28mm) 524 Providing, laying and fixing following dia G.I. pipe (mediumclass) in ground complete with G.I. fittings including trenching(75 cm deep)and re-filling etc as required 525 100 mm dia 526 Providing, laying and fixing following dia RCC pipe NP2 class (light duty) in ground complete with RCC collars, jointing with cement mortar 1:2 (1 cement : 2 fine sand) including trenching (75 cm deep) and refilling etc as required. 527 100mm dia 528 150 mm dia 529 250 mm dia 530 300 mm dia 531 Supplying and laying of following size DWC HDPE pipe ISI markedalong with all accessories like socket, bend, couplers etc.conforming to IS 14930, Part II complete with fitting and cutting,jointing etc.direct in ground (75 cm below ground level) includingexcavation and refilling the trench but excluding sand cushioningand protective covering etc., complete as required. 532 90 mm dia (OD-90 mm & ID-76 mm nominal) 533 Supplying, installation & testing of 7.0 m high octagonal GI pole with single arm as per approved sample made from 3 mm sheet steel (Grade S 355 J0) with top diameter as 75mm and bottom dia as 150mm and base plate of 240x240x16 mm with suitable slot shaped holes for mounting the same on a shallow foundation, GI weather proof junction box with 16A SP MCB, loop-in-loop out terminals for 2nos. 2Cx6 sq.mm YWY cables and 2x2.5 sq.mm copper conductor from junction box to fitting and connected accessories as required etc. 534 Supplying, installation & testing of 9.0 m high octagonal GI pole with double arm as per approved sample. Contractor to include the cost ofRCC foundation for pole as per structural detail. 535 Supply and fixing of LED Street light Fitting with mandatory driver set having die cast aluminium body and lenses suitable for 45Watt. to 50 Watt andConfirming to IP66 protectionhaving Company LOGO Engravedcomplete in all respect with 4000-5000 system lumens High Power LED with lenses, >110lm/W, PF>0.95, THD <10% at full load, CRI>70, Avg Life Class 50000Hrs@L70,fitting itself suitable for 60-65mm OD pipe 536 Supplying and fixing 5 amps to 32 amps rating, 240/415 volts, C curve, miniature circuit breaker suitable for inductive load of following poles in the existing MCB DB complete with connections, testing and commissioning etc. as required. 537 Double pole 538 POLE LIGHTS Supply ,Installation ,Testing And Commissining OfTwinkle Lites Make 4000Mm Long Hybrid Decorative Pole With CastedAluminium Base And Ripped Gi Pole PipeWith Decorative Post Top Lantern Concord 1270Mm Long With Polycarbonate Diffuser In 60W Led Having Lumn Output Not Less Than 110Lmns/Watt With 10Kva Surge Prtector Designed As Per Architect In-Charge( Make- Twinkle Lite-/-Havells/Neri/Juvaas/Orient/ Thor) 539 Supply and fixing of decorative 8 to 16 Watt LED bollard luminaire with driver set confirming to IP 65 protection complete in all respect 540 Supply and fixing of 3 Watt to 10 Watt LED Step light luminaire having powder cotated die cast aluminium body with drive set . Confirming to IP 66 Protection complete in all respect. 541 Resting Areas for Tourist (Benches) {MR} 542 Providing & fixing of red Sandstone/MS bench with Ornamentation (size 1500mm length and 450mm and height 600 mm) including foundation & support with all necessary T&P etc. all complete as per design of direction in engineer/ Architect in charge. 543 Urban Litter Bins(MR) 544 Providing & fixing of SS Dustbin size 487 x 399 x 1138 fixing on a foundation with base plate and wrapped with red sandstone from all sides of 75mm with all complete as per design of direction in engineer/ Architect in charge 545 Directional & Informative Signages (MR) 546 Providing and fixing StandAlone Signage in Marble of approved thickness with powder coated 10-12mm MS letters and illustration at desired locations with letters (in english, hindi and Braille)- etched, through cut, infilled or painted, also including the cost of design, fabrication and onsite installation with all the necessary accessories and equipments for fixing on any surface as per drawing and design approved from Architect in charge Helvetica Font with min. 36 sizeHindi: Krutidev Fontwith min. 36 size 547 Signage-A 548 Signage-C 549 Water Cooler - Receiving, storing, handling, shifting, installation, testing & commissioning of Voltas water cooler, including all accessories complete in all respect etc. (Make - Voltas or Equivalent) 550 GST Extra As per Applicable
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 4
Uttar Pradesh View Result →
8.
Educational and Research Institute #9420967 Technical Bid
Supply Of Consumables/Non-Consumables For The Department Of Anatomy , Sample Of Consumables For Evaluation And Demostration Of Instrumentsand Non- Consumables Should Be Madefailing Which The Bid Will Not Be Considerednote: Sample Of Consumables For Evaluation And Demostration Of Instrumentsand Non- Consumables Should Be Madefailing Which The Bid Will Not Be Considered , 1 Ml Micro Tip Box , 20 Ul Micro Tip Box , 200 ?L Micro Tip Box , 5 Ml Micro Tip Box , Aluminium Foil , Blotting Paper - Regular (Filter Paper) 60 X 60 Cm , Centrifuge Tubes 15 Ml Sterile, Conical Bottom,Individual Flow Pack - Pack Of25 Nos. , Centrifuge Tubes 50 Ml Sterile, Conical Bottom, Individual Flow Pack- Pack Of25 Nos. , Diamond Pencil - Glass Marking For Laboratory Use , Indicator Tape For Steam Autoclave , Laboratory Film (Parafilm) Rolls 4 Inch Width X 125 Ft , Micro Centrifuge Tubes Pp Material Autoclavable 1.8 Ml Capacity -Pack Of 1000 Nos , Micropipette Tips 1000-5000?L - Pp Autoclavable - Pack Of100 Nos. , Micropipette Tips 200-1000?L - Pp Autoclavable - Pack Of 500 Nos. , Micropipette Tips 2-20?L - Pp Autoclavable - Pack Of 100 Nos. , Micropipette Tips 2-200?L - Pp Autoclavable -Pack Of 1000 Nos , Microscopic Lens Cleaning Paper (20 X 30 Cm)- Pack Of100 Nos. , Non Mercury Glass Thermometer , Slide Labels (25Mm *10Mm) (Pack Of 100 Nos) , Sodium Heparin Vaccutainers (Green Top) 4Ml- Pack Of 100 Nos. , Laboratory Spirit Lamp , Tissue Cassette4x3 Cm Plastic 100/Pack , Tissue Cassette (Steel ) 4X3 Cm 100 /Pack , Tissue Embedding Mold 37X24x9 Mm , Tissue Embedding Ring Standard Size 500/Pack , Tissue Paper Roll , Minimum 60 Meter Long, 100% Pure Cellulose , Chemicals , Absolute Methanol 2.5 Litre , Aceto Orcein 100 Ml , Acid Fuchsin 25 Gm , Alcian Blue 10 Gms , Aluminium Pottasium(500 Gm Pack) , Ammonia 500 Ml , Amniomax Media, Sterile For Cell Culture(100 Ml Pack) , Antibioticsfor Culture (Penicillin,Streptomycin) -(100 Ml Pack) , Bacillol, Disinfectant(500 Ml Pack) With Sprayer , Basic Fuchsin 25 Gm , Celestine Blue B 25 Gm , Chromotrope 2R 25 Gm , Colcemid In Pbs, Sterile For Cell Culture(100 Ml Pack) , Concentrated Hydrochloric Acid (Ar Grade)(500 Ml Pack) , Cresyl Violet 1 Gm , Diamidino-Phenylindole (Pack Of 1 Ml) (Dapi) , Eosin Yellow (25 Gm Pack) , Ethanol Absolute 99.9% (500 Ml Pack) , Eucalyptus Oil (500 Ml Pack) , Fast Green 25 Gm , Ferric Ammonium Sulphate 500 Gm , Ferric Chloride 500 Gm , Fetal Bovine Serum, Sterile For Cell Culture(500 Ml Pack) , Formalin Lr Grade(30 Ltrs Can) , Giemsa Stain(25 Gm Pack) , Glacial Acetic Acid Ar(2.5 Ltrs Pack) , Glycerine(2.5 Ltrs Pack) , Glycerol Gr Grade (500 Ml Pack) , Gold Chloride 250 Mg , Grade 1 Filter Paper100 Sheets/Box , Hematoxylin Monohydrate 25 Gm , Hydrogen Peroxide (500 Ml Pack) , Immersion Oil (Refractive Index 1.515-1.526) Microscopy Grade, Optically Clear, Non-Flourescent (30 Ml Pack) , Iodine Powder 100 Gm , Iron Alum 250 Gm , Liquid Rpmi1640 Media With L- Glutamine, Phenol Red, Hepes & Sodium Bicarbonate, Sterile For Cell Culture-(Pack Of 500 Ml) , Mercuric Oxide (100 Gm Pack) , Methanol Gr Grade (Pack Of 2.5 L) , Methanol Hplc Grade ( Pack Of 2.5 L) , Methylene Blue 500 Ml , Microscope Oil (For Flourescent Microscopy) (Make: Olympus/ Sigma/ Carl Zeiss) (Pack Of 50 Ml) , Oxalic Acid Salt500 Gm , Paraffin Wax Melting Point 58-600C (Pellets Form) (Pack Of 500 Gm) , Periodic Acid Salt 25 Gm , Pha- M Form -Sterile For Cell Culture,(Pack Of 25 Mg) - , Phenol (500 Gms) , Phloxine B (50 Gm) , Phosphomolybdic Acid 25 Gm , Phosphotungstic Acid 1 L , Potassium Hydroxide 500 Gm , Potassium Iodide Powder 100 Gm , Potassium Metabisulfate 250 Gm , Potassium Permanganate Salt500 Gm , Silver Nitrate 10% 25 Gm , Sodium Citrate (500 Gms) , Sodium Hydroxide 500 Gm , Sodium Metabisulphite (Pack Of 500 Gm) , Sodium Thiosulphate 500 Gm , Sulphuric Acid 500 Ml , Thymol (Pack Of 1000 G) , Toluidine Blue 25 Gm , Trisodium Citrate, Ar (Pack Of 500 Gm) , Trypsin Edta, Sterile For Cell Culture(Pack Of 100Ml) , Trypsin With Proteolytic Activity1:250, (Pack Of 100 Gm) , Xylene Ar (Pack Of 500 Ml) , Glassware/ Plasticware , Aspirator Bottle With Stopper And Mouth Basefor Cadaver Embalming- 10/15 Litres Capacity. , Conical Glass 1000 Ml , Conical Glass 500 Ml , Coplin Jar (Glass) With Lid 50 Ml , Coplin Jar (Plastic) With Lid 50 Ml , Cover Glass (Square) No.1 22 Mmx22mm (Thickness 0.13Mm. To 0.15 Mm.) Pack Of 10 Gms , Cover Glass No.1 22Mmx50mm (Thickness 0.13Mm. To 0.15 Mm.)Pack Of 10 Gms , Cover Glass( Round )No.1, 16Mm Diameter (Thickness 0.13Mm. To 0.15 Mm.) Pack Of 10 Gms , Cylindrical Measuring Jar 500 Ml , Cylindrical Museum Glass Jar With Lid And Supporting Plates- 110 Mm (Height) X 12.5 Cm Dia. , Cylindrical Museum Glass Jar With Lid And Supporting Plates- 370 Mm (Height) X 31 Cm Dia. , Dropper Bottle Each 500 Ml - Plastic , Glass Beaker Capacity 100 Ml Autoclavable , Glass Beaker Capacity 250 Ml Autoclavable , Glass Bottle Graduated With Screw Cap Capacity 100 Ml, Autoclavable , Glass Bottle Graduated With Screw Cap Capacity 1000 Ml, Autoclavable , Glass Bottle Graduated With Screw Cap Capacity 250 Ml, Autoclavable , Glass Bottle Graduated With Screw Cap Capacity 500 Ml, Autoclavable , Glass Conical Flask - 250 Ml , Glass Cylinder, Capacity 1000 Ml, Measuring, Graduated, With Spout, Hexagonal Base,Autoclavable , Glass Cylinder, Capacity 250 Ml, Measuring, Graduated, With Spout, Hexagonal Base, Autoclavable , Glass Cylinder, Capacity 500 Ml, Measuring, Graduated, With Spout, Hexagonal Base, Autoclavable , Glass Dropping Bottle 100 Ml , Glass Funnels, Autoclavable , Glass Staining Rods , Glass Staining Trough With Holding Steel Tray With Handle For Staining 10 Slides , Measuring Jars 1000 Ml , Measuring Jars 500 Ml , Microscopic Slides 75X25 Mm. Thickness Not Than Less 1.35Mm ±1Mm As Per Iso 8037 (Clean And Clear Without Fungus) Pack Of 50 Slides , Painting Brush Set (Flat ) , Painting Brush Set (Round) , Pasteur Pipette, Disposable - 3 Ml((Pack Of 500 Nos)) , Glass Jars- Specifications: Jar Made Of 3.3 Low Expansion Borosilicate Glass. Lid Made From Sodalime Glass,Formalin Resistant, Sturdy And Long Life. Top Edges Should Be Flat Ground.For Storage Of Organs And Specimens In Formalin. With H X L X W (In Mm) 360X250x 220 , Glass Jars- Specifications: Jar Made Of 3.3 Low Expansion Borosilicate Glass. Lid Made From Sodalime Glass,Formalin Resistant, Sturdy And Long Life. Top Edges Should Be Flat Ground.For Storage Of Organs And Specimens In Formalin. With H X L X W (In Mm) 250X250x 120 , Glass Jars- Specifications: Jar Made Of 3.3 Low Expansion Borosilicate Glass. Lid Made From Sodalime Glass,Formalin Resistant, Sturdy And Long Life. Top Edges Should Be Flat Ground.For Storage Of Organs And Specimens In Formalin. With H X L X W (In Mm) 180X160x 60 , Glass Jars- Specifications: Jar Made Of 3.3 Low Expansion Borosilicate Glass. Lid Made From Sodalime Glass,Formalin Resistant, Sturdy And Long Life. Top Edges Should Be Flat Ground.For Storage Of Organs And Specimens In Formalin. With H X L X W (In Mm) 180X125x 120 , Glass Jars- Specifications: Jar Made Of 3.3 Low Expansion Borosilicate Glass. Lid Made From Sodalime Glass,Formalin Resistant, Sturdy And Long Life. Top Edges Should Be Flat Ground.For Storage Of Organs And Specimens In Formalin. With H X L X W (In Mm) 300X280x260 , Glass Jars- Specifications: Jar Made Of 3.3 Low Expansion Borosilicate Glass. Lid Made From Sodalime Glass,Formalin Resistant, Sturdy And Long Life. Top Edges Should Be Flat Ground.For Storage Of Organs And Specimens In Formalin. With H X L X W (In Mm) 380X 260 X200 , Non - Consumables , Acrylic Bending Machine; Specifications : Thermal Forming Principle , Applicable Length Approx650 Mm.Thickness 1 – 10Mm, Working Power 1000 W, Temperature Range Approx 600 C.With Heating Area Adjustment, Temperature Adjustment, Spare Heating Rod. Used For Bending Acrylic Sheets In Making Acrylic Models For Teaching. , Automatic Variable Volume Pipette (2 - 20 Microlitre) Pvde Single Channel, Adjustable 2 -20 Micolitres, With Tip Ejector , Automatic Variable Volume Pipette (2 - 5 Ml) Pvde Single Channel, Adjustable 2-5 Ml, With Tip Ejector , Automatic Variable Volume Pipette (20 - 200 Microlitre) Pvde Single Channel, Adjustable 20 - 200 Micolitres, With Tip Ejector , Automatic Variable Volume Pipette (200 - 1000 Microlitre) Pvde Single Channel, Adjustable 200 -1000 Micolitres, With Tip Ejector , Cardboard Microscopic Slide Folder For 20 Slides With Lid To Be Tied By A Rope , Conical Centrifuge Tube Rack For 15 Ml Tubes ( 15 Rows × 4 Columns , Cryobox, Pp, Autoclavable, 100 Places For 1.5Ml Vials , Digital Timer With Lcd Display (Multipurpose Programmable ) Hand Held, With Aaa Battery , Fish Probes For Aneuploidy Screening - Should Consist Of Combination Of21, X, Y Kit. Kit Size For 10 Samples. Expiry Should Be Valid For Min 1 Year From Date Of Supply. , Hygrometer With Lcd Display Showing Temperature, Humidity And Date And Time , Microscope Slide Storage Box - 100 Slides Capacity , Microscope Slide Storage Box - 50 Slides Capacity , Microtome Blade High Profile - Stainless Steel, Disposable 50/Pack , Pipette Stand For Holding Atleast 4 Automatic Variable Pipeetes , Poly Wire Rack For 50 Ml Centrifuge Tube Rack, 20Placed And 30 Placed For 15 Ml Tube , Polystyrene , Slide Storage File For 25Mm * 75Mm Slide, 20 Places / File , Slide Drying Tray (To Hold 40 Slides) , Slide Staining Rod/Stands , Stainless Steel Forceps With A Grade Of 410, 6Inches, Curved With Ridges For Precision Handling , Stainless Steel Forceps With A Grade Of 410, 6Inches, Toothed Margins With Ridges For Precision Handling , Stainless Steel Forceps With A Grade Of 410, 8Inches, Curved With Ridges For Precision Handling , Stainless Steel Forceps With A Grade Of 410, 8Inches, Pointed Ends For Delicate Procedures And With Ridges For Precision Handling , Stainless Steel Forceps With A Grade Of 410, 8Inches, Toothed Edges And Ridges For Precision Handling , Stainless Steel Forceps With A Grade Of 410, Blunt (8Inches), Straight Tipped With Ridges For Precision Handling , Stainless Steel Forceps With A Grade Of 410, Pointed, 6Inches, Without Ridges , Stainless Steel Forceps With A Grade Of 410, Straight Tipped, 6Inches,Without Ridges , Stainless Steel Scissors With A Grade Of 410, Straight, 6 Inches , Stainless Steel Scissors With A Grade Of 410, Straight, Standard Size , Stainless Steel Spatula 6 Inches Long , Station Stand To Hold 100 Ml Bottles:Specification With Two Rows In Steps. , Sterile T-25 Flask, For Cell Culture(Pack Of 25)
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 12
9.
Educational and Research Institute #9418923 Technical Bid
Rate Contract For The Procurement Of Consumables/Non-Consumables For The Department Of Forensic Medicine , Autopsy& Embalming , Rock Salt For Viscera Preservation (One Bag Is 25 Kg) , Lacquer / Sealing Wax ( 1 Box Of 1 Kg) , Potassium Nitrate (1 Bottle Is 500 Gms) , Potassium Acetate (1 Bottle Is 500 Gms) , Formalin , Sodium Acetate (1 Bottle Is 500 Gms) , Glycerin (1 Bottle Is 1 Kg) , Rectified Spirit , Acrylic Sheet Glue/Cyanoacrylic Glue (1 Tube Is 100 Gms) , Eucalyptus Oil (1 Bottle Is 100 Ml) , Sodium Fluride (1 Jar Is 500 Gm) , Sodium Citrate (1 Jar Is 500 Gm) , Sodium Borate (1 Jar Is 500 Gm) , Eosin (1 Bottle Is 500Ml) , Hydrogen Peroxide (1 Bottle Is 500 Ml) , Sodium Hypochlorite (1 Bottle Is 500 Ml) , Platform Trolley , Instrument Trolley , Pet/Plastic Jar For Viscera Packing (1 Jar Has Voloume Of 2000 Ml) , Plastic Sheet For Body Wrapping: Breadth 2 Meters (1 Roll Is 40Kg) , Kada Cloth: 4000 Meters X 3 Meters Breadth (One Roll Is 200 Meters) , Plastic Jar (100 Ml) (1 Plastic Jar Of 100 Ml Volume) , Suction Apparatus: Storage Bottles (2500 Ml Each Or More) 2, Tubes, Input Power , Electric Stainless Steel Steriliser Or Boiler For Disinfection Of Instruments. , Electronic Weighing Scale Brand With Load Capacity Of 10 Kg , American Board Of Forensic Odontology (Abfo) Scale , Museum , Museum Jar With Mounting Plate ( Acrylic) Jar: 140 Mm X 215 Mm X100mm Mounting Plate: 150 Mm X 200 Mm The Thickness Of The Acrylic Jar & Plate - 5 Mm. Moulding Of The Angles Of The Acrylic Jar,Smoothening Of The Base Of The Acrylic Jar , Museum Jar With Mounting Plate ( Acrylic) Jar: 210 Mm X 170 Mmx 130 Mm Mounting Plate: 200 Mm X 150 Mm The Thickness Of The Acrylic Jar & Plate - 5 Mm. Moulding Of The Angles Of The Acrylic Jar, Smoothening Of The Base Of The Acrylic Jar , Museum Jar With Mounting Plate ( Acrylic)Jar: 250 Mm X 150 Mmx 150 Mm Mounting Plate: 250 Mm X 140 Mm The Thickness Of The Acrylic Jar & Plate - 5 Mm. Moulding Of The Angles Of The Acrylic Jar, Smoothening Of The Base Of The Acrylic Jar , Museum Jar With Mounting Plate ( Acrylic)Jar: 220 Mm X 140 Mmx 140 Mm Mounting Plate: 220 Mm X 100 Mm The Thickness Of The Acrylic Jar & Plate - 5 Mm. Moulding Of The Angles Of The Acrylic Jar, Smoothening Of The Base Of The Acrylic Jar , Acrylic Plate Of Size (148 X 210Mm And 5 Mm Thick), With Two Photo Frame Screw At Bottom (2 Inches) , Anthropometry , Stadiometer (1 Set Is One Stadiometer) , Osteomatric Board , Spreading Calliper , Sliding Calliper , Goniometer , Mandibulometer , Craniophore , Magnifying Lens/Glass With Led Light , Clinical Forensic Medicine , Colposcope , Proctoscope , Glaister Keen Rod , Breath Alcohol Analyzer , Forensic Biochemistry , Medical Centrifuge: 4000 Rpm Or More, Rotor Size 16X15 Ml , Medical Centrifuge: 12000 Rpm , Projectors Ceiling Mounted , Ug & Pg Teaching For Specifications Please Refer Tender Document , Projectors Ceiling Mounted , Projectors Portable , Bluetooth Speaker With Two Mic , Modular Extendanle Conference Table , Podium , Forensic Histopathology , 96% Absolute Alcohol (1 Bottle Is 1 Litre) , Xylene (1 Bottle Is 1 Litre) , Merck Low Melting Wax 56-58 Degree (1 Jar Is 1 Kg) , High Melting Wax (1 Jar Is 1 Kg) , Isopropyl Alcohol (1 Bottle Is 1 Litre) , High Profile Blades , Embedding Rings (1 Pack Contains 100 Rings) , L-Mold , Toxicology Lab , Sodium Tungstate (1 Pack Consists Of 250Grams) , Glacial Acetic Acid (1 Bottle Is 500Ml) , Chloroform (1 Bottle Is 500Ml) , Diethyl Ether (1 Bottle Is 1 Litre) , Ammonia Solution (1 Bottle Is 500Ml) , Methanol (1 Bottle Is 500Ml) , Dragendroffs Reagent (1 Bottle Is 125Ml) , Chloroplatinic Acid (1 Bottle Is 1 Gm) , Hydrochloric Acid (1 Jar Is 2 Kg) , Ethanol (1 Bottle Is 500Ml) , Acetone (1 Bottle Is 500Ml) , Ammonium Ceric Nitrate (100 Gram Pack) , Ammonium Ferrous Sulfate (500 Gram Pack) , Ammonium Molybdate (100 Gram Pack) , Ammonium Sulphate (1 Jar Is 500Gram) , Bismuth(Iii) Sulphate 98% (1 Jar Is 100 Gram) , Diethyl Ester (1 Bottle Is 500Ml) , Diphenylamine (1 Jar Is 100 Gram) , Dpx Mountan (1 Bottle Is 250Ml) , Ethanol,Absolute Ar (1 Bottle Is 500Ml) , Ethylene Glycol Mr (1 Bottle Is 500Ml) , Ferric Chloride (1 Jar Is 500Grams) , Anhydrous Ferric Chloride (1 Jar Is 500Grams) , Glucose Broth (1 Jar Is 500Grams) , Hydrochloric Acid (1 Bottle Is 500 Ml) , Hydrogen Peroxide (1 Bottle Is 400Ml) , Hydrogen Peroxide (1 Bottle Is 500Ml) , Iodine (1 Jar Is 100Grams) , Liquor Ammonia (Can Of 2500Ml) , N-Hexane 95 % For Synthesis C6h14 (1 Bottle Is 500Ml) , Nitric Acid (1 Can Is 2500Ml) , Palladium Chloride (1 Jar Is 1 Gram) , Perchloric Acid 70% (1 Bottle Is 500Ml) , Potassium Dichromate Pure (1 Jar Is 500Grams) , Potassium Iodine (1 Jar Is 100Grams) , Potassium Permanganate (1 Jar Is 500Grams) , Silica Gel (1 Jar Is 500Grams) , Silver Diethyldithicarbamate Acs Reagent 99% (1 Jar Is 25Grams) , Silver Nitrate (1 Jar Is 25Grams) , Sodium Hydroxide Pellets (1 Jar Is 500Grams) , Sodium Sulfate (1 Jar Is 500Grams) , Water (Molecular Biology Reagent) (1 Bottle Is 1 Litre) , Zinc Chloride (1 Jar Is 500Grams) , Zinc Metal ((1 Jar Is 500Grams)) , Amber Culture Tube (Volume - 30Ml) , Arsenic Apparatus As Per Usp , Beaker (Volume - 50Ml) , Beaker Low Form (Volume - 500Ml) , Beaker Low Form With Spout (Volume - 250Ml) , Beake Tall From With Spout Db (Volume - 100Ml) , Beake Tall With Spout (Volume - 500Ml) , Bottles Wm Screw Cap (Volume - 100Ml) , Bottles Wm Screw Cap (Volume - 250Ml) , Bottles Wm Screw Cap (Volume - 500Ml) , Burette Boroflo Cl A (Volume - 25*0.1Ml) , Burette Clamp Pp Single , Cylinder (Volume - 100Ml) , Cylinder (Volume - 500Ml) , Cylinder With Spout Cl A (Volume - 100Ml) , Cylinder With Spout Cl A (Volume - 500Ml) , Cylinde With Spout, Cl B (Volume - 50Ml) , Cylinde With Spout, Cl B (Volume - 100Ml) , Dessicator Set With Plastic Knob (Dimension-150Mm) , Erlenmeyer Flask Narrow Neck (Volume - 100Ml) , Erlenmeyer Flask Narrow Neck (Volume - 500Ml) , Erlenmeyer Flask Wide Neck (Volume - 100Ml) , Erlenmeyer Flask Wide Neck (Volume - 500Ml) , Flask Conical Narrow Mouth (Volume - 250Ml) , Flasks Volumetric With I/C Stopper (Volume - 10Ml) , Flasks Volumetric With I/C Stopper (Volume - 50Ml) , Flasks Volumetric With I/C Stopper Cl A (Volume - 25Ml) , Funnel Holder Single , Funnel Pear Gi Stopcock (Volume - 125Ml) , Funnel Pear Gi Stopcock (Volume - 250Ml) , Funnel Plain 60* Angle Long (Glasswort) (Dimension-50Mm) , Funnel Plain 60* Angle Long (Super Trek) (Dimension-75Mm) , Laboratory Bottles With Blue Cap And Ring (Volume - 500Ml) , Measuring Cylinder Class A Borosil (Volume - 50Ml) , Measuring Cylinder Class A Borosil (Volume - 100Ml) , Measuring Cylinder With Hex Base (Volume - 10Ml) , Pestle And Mortar (Dimension-150Mm) , Pipettes Measuring Mohr Type (Microlit 5000 Ui Medical Grade) , Retort Stand , Funnel Holder , Stirrer Glass Rod (Dimension 7*255Mm) , Test Tube Stand (Abdos Polycarbonate) , Test Tube With Rim(Borosil Grade 1 Highly Chemical Resistant) , Beakers (Volume - 250Ml) , Beakers (Volume - 500Ml) , Separating Funnels (Volume - 250Ml) , Separating Funnels (Volume - 500Ml) , Funnels (Dimension-75Mm) , Funnels (Dimension-100Mm) , Conical Flasks (Volume - 100Ml) , Conical Flasks (Volume - 250Ml) , Conical Flasks (Volume - 500Ml) , Test Tube (Dimension 150Mm*100Mm) , Evaporating Dish (Dimension 3 Inches) , Evaporating Dish (Dimension 4 Inches) , Glass Plates For Tlc (Dimension 200*100Mm) , Developing Chamber (Glass) (For Running Glass Plates Of 200*200Mm) , Capillary Tubes , Water Bath , Incubator , Hot Air Oven With Digital Control , Tlc Sprayer , Vertical Autoclave , Bunsen Burner
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 10
10.
Educational and Research Institute #9302684 Technical Bid
Supply Of Chemical Glass Ware Lab Ware Regents Kit Etc , Isopropyl Alcohol 5 Lt Bottle , Papanicolau O.G.6 125 Mlbottle , Papanicolau E.A 36 125 Mlbottle , Papanicolau E.A 65 125 Mlbottle , May.Grunwald Stain (Mgg) 100 Mlbottle , Giemsa Staining 100 Mlbottle , H2so4 (Sulphuric Acid) 500 Mlbottle , Methanol 500 Mlbottle , Diethy Ethyl Ether L.R 500 Mlbottle , Leishman’S Stain Solution (Cytochrome) 500 Mlbottle , Tincture Benzoin 100 Mlbottle , Semen Diluting Fluid 200 Ml Bottle , Platelet Diluting Fluid 50 Mlbottle , Chloroform 05Ltbottle , Wbc Diluting Fluid 500 Ml Bottle , Rbc Diluting Fluid 500 Mlbottle , N/ 10 Hcl 1000Ml Bottle , Formaldehyde 5 Ltbottle , Xylene 2.5Ltbottle , Conc. Hcl(Hydrochloric Acid) 500Ml Bottle , Liquid Ammonia 500Ml Bottle , D.P.X. 250 Ml Bottle , Conc.Nitric Acid 500Mlbottle , Glycerine 500 Ml Bottle , Glycerine 1000 Ml Bottle , Liquid Paraffin 500 Ml Bottle , Na Oh(Sodium Hydroxide) 500 Ml Bottle , Poly-L Lysine Solution 100 Ml Bottle , Citric Acid (Anhydrous Pure) 1000 Ml Bottle , H 2 O2(Hydrogen Peroxide) 1000 Mlbottle , Deionized Water 5 Lt. Bottle , Schiffsreagent 500 Ml Bottle , Bendictreagent 500 Ml , Drabkinssolution 5Lit , Fouchet’S Reagent 200 Ml , Ehrlich Reagent 200 Ml , Methylene Blue Stain 125Mlbottle , A.F.Bstain Kit , Carbolfuchsin Stain 125Mlbottle , Reticulocytestain(Biolab) 01 Packet , Acetone 500 Mlbottle , Sodium Hypo Chloride 5 Ltr Bottle , Spirit 5Ltr Bottle , Glucose God- Pod Kit 500 Ml , Glacial Acetic Acid 500Ml Bottle , Hematoxylin Stain Powder(Sd Fine) 25Gm/ 5 Gmpacket , Eosin Powder (Water Soluble) 25Gm Packet , Aluminum Potassium Sulphate500 Gmpacket , Mercuric Oxide Red 500 Gm Packet , Wax 600-620 500Gmpacket , Albumin Powder 500 Gmpacket , Periodic Acid 25 Gmpacket , Mercuric Oxide 25Gmpacket , Dextrose (Anhydrous) 500 Gm Packet , Sulphur Powder100 Gm , Barium Chloridepowder500 Gm , Ammonium Sulphate500 Gm , Sodium Sulphate 500 Gm , Sulphosalicylicacid 500 Gm , Gentian Violet100 Gm , Tris Buffer (Sd Fine) 500 Gmpacket , Edta 100 Gmpacket , Low Profiledisposablemicrotome Blade For Cutting Tissue Section , Urinestrip( Distix) Packet (1X100 Strips) , Phosphotungisticacid 100 Gmpacket , Brilliant Crystalblue Stain 100 Gm , Plastictissue Embedding Cassettes Packet(1X1000 Pieces) , Oxalic Acid 500 Gm , Ferric Chloride 500 Gm , Sodium Thio Sulphate 500 Gm , Potassium Ferrocyanide 500 Gm , Sodium Chloride 500 Gm , Sodium Nitroprusside 500 Gm , Orthotoludine Reagent 500 Gm , Benzidinepowder 25 Gm , Diamino Benzidine 25 Gm Powder , Total Protein Kit , Albumin Kit , Serum Creatinine Kit , Serum Urea Kit , Serumsgot Kit , Serum Sgpt Kit , Directs.Bilirubinkit , Serumcalcium Kit , Serumalkalinephosphate Kit , Serumcholesterol Kit , Serumtriglyceride Kit , Serum Hdl Cholesterol Kit , Serumuric Acid Kit , Tpo(Thyroid Peroxidase Antibody) 6 Ml Vial , Mouse/Rabbit Specific Polymer Hrp- Dab Ihc Detection Kit 15 Ml Vial , Desminantibody (Ihc) 6 Ml Vial , Vimentin Antibody (Ihc) 6Ml Vial , Estrogen Receptor Antibody (Er) 6Ml Vial , Anti-Progesterone Receptor Antibody 6Ml Vial , Anti S-100 Antibody 6Ml Vial , Anti Human Her2/Neu Antibody 6Ml Vial , Anti Human Cytokeratin(Pan) Antibody Cocktail 6Ml Vial , Anti Melanoma Antibody( Anti Hmb45 Antibody) 6Ml Vial , Anti Neuron Specific Enolase (Nse) Antibody 6Ml Vial , Anti Cd45 Antibody 6Ml Vial , Anti Hpv-16 Antibody 6Ml Vial , Anti Cd20 Antibody 6Ml Vial , Anti Cd15 Antibody 6Ml Vial , Anti Cd30 Antibody 6Ml Vial , Antibody (Anti C –Kit) 6Ml Vial , Myeloperoxidase Reagent 6Ml Vial , Anti Ki 67 Antibody6ml Vial , Antiecadherin Antibody 6Ml Vial , Anticd- 34 Antibody 6Ml Vial , Anti P-63 Antibody 6Ml Vial , Antip-53 Antibody 6Ml Vial , Anti Smoothmuscle Actin Antibody 6Ml Vial , Anti Ck -6 Antibody 6Ml Vial , Anti Ck -17 Antibody 6Ml Vial , Anti Cd-68 Antibody 6Ml Vial , Whatman Filter Papersheet , Coplin Jar (Plastic) 01Piece , Tuff’S Jar (Glass) Piece , K3 Edta Vacutainar 1 X100 , Plain Vacutainar 1 X100 , Riya Vial( Plastic) 1 X100 , Test Tube Stand(Plastic) Piece , Test Tube Holder Piece , Plastic Beaker 25Ml Piece , Plastic Beaker 100Ml Piece , Semen Collection Container 20 Ml (1X50) Packet , Urine Sample Container 50 Ml (1X50) Packet , Micro Tips Pippt(200- 1000 Ul) , Micro Tips Pippt (20- 200 Ul) , Sprit Lamp 50Ml Piece , Plastic Dropper Piece , Pipettebulb Piece , Glass Testtube 7Ml,Piece , Glass Testtube 10Ml,Piece , Glass Testtube20ml Piece , Glass Slide (Blue Star) Packet , Cover Slip (Blue Star) Packet , Neubauer Chamberpiece , Glass Pipette 5 Ml 20 Micro Lit Piece , Glass Pipette 10 Ml 20 Micro Lit Piece , Glass Pipette 1 Ml 20 Micro Lit Piece , Micropipette 10Microlitre Fix Piece , Micro Pipette 100Microlitre Fix Piece , Micro Pipette(5-50)Microlitrevariablepiece , Micro Pipette 20 Microlitre Fix Piece , Micro Pipette 1000 Microlitrefixpiece , Micro Pipette50 Microlitrefixpiece , Wintrobe Esr Tube With Stand Piece , Westergreen Esrpipette With Stand Piece , Pricking Needileno 23 (1 X100) Packet , Pricking Needileno 24 (1 X100) Packet , Pricking Needileno 21 (1 X100) Packet , Pricking Needileno 20 (1 X100) Packet , Surgicaltray 6X8 “ Inch (Rectangular) Piece , Microscopicslide Tray (Aluminium) Holding Capacity20 (3X1”Inch)Piece , Bone Marrow Aspiration Needle16 No Piece , Bone Marrow Aspiration Needle18 Nopiece , L P Needle Piece , Histology Tissue Base Mold (Steel ) Piece , Bone Marrow Biopsy Needle(Trephinebiopsy) Piece , Glass Rodpiece , Ph Paper Strip (5.0-7.5) Booklet(1X20 Strips) , Ph Paper Strip (2.0-10.5) Booklet(1X20 Strips) , Lens Cleaningpaperbooklet (9Cmx14.5Cm,100 Leaves) , Museum Mounting Jar(With Cover) (10Cm X 5Cmx 20Cm) , Museum Mounting Jar(With Cover) (15Cm X 10Cmx 25Cm) , Museum Mounting Jar(With Cover) (16.2Cm X 6Cmx 18Cm) , Museum Mounting Jar(With Cover) (12Cm X 10Cmx 20Cm) , Museum Mounting Jar(With Cover) (12Cm X 12Cmx 20Cm) , Museum Mounting Jar(With Cover) (17Cm X 8Cmx 18Cm) , Museum Mounting Jar(With Cover) (5.5Cm X 5Cmx 10Cm) , Museum Mounting Jar(With Cover) (17Cm X 9.5Cmx 30Cm) , Museum Mounting Jar(With Cover) (28Cm X 24Cmx 29Cm) , Museum Mounting Jar(With Cover) (21Cm X 19Cmx 27Cm) , Museum Mounting Jar(With Cover) (11Cm X 25Cmx 24Cm) , Hiv Rapid Tridotkit , Hbsag Immunoassay Rapid Kit , Hcv Rapidkit,(Fourth Generation Immunoassay For Core,Ns3,Ns4,Ns5) , Rdt Formprapidkit (Immunochromatographic Kit For Pf/Pan Antigen) , Vdrl Rapid Immunoassay Kit , Typhoidrapidkit (Igg,Igm) , Filaria Rapid Ag Card Test , H3n2 Rtpcr Kit , Zika Virus Rtpcr Kit , Dengue Rapidkit (Immunochromatographic Assay For Ns1,Igg ,Igm) , Plain Vial5 Ml Vial , Abo Rh Anti Sera10 Ml Packet , Ppd Vial 5 Ml Vial , Sodium Citrate Vial 5 Ml Vial , Capillary Tube Piece , A.H.G. 5Ml , Anti A1 Lectin 5Ml , Anti H Lectin 5Ml , Anti D (Igm + Igg Monoclonal) 10Ml , Pt 5Ml , Aptt 3Ml , Calcium Chloride 10Ml , Bovine Albumin 5Ml , Hiv Rapid Kit 4Th Generation , Hiv Rapid Kit 3Th Generation , Hcv Rapidkit,3Th Generation , Hbaag Rapid Kit 4Th Generation , Hbaag Rapid Kit 3Th Generation , Hiv Elisa Kit 4Th Generation , Hcv Elisa Kit 4Th Generation , Hcv Elisa Kit 3Th Generation , Hbaag Elisa Kit 4Th Generation , Hbaag Elisa Kit 3Th Generation , Troniquete , Micro Pipette 10 Ul Fix , Micro Pipette 50 Ul Fix , Micro Pipette 25 Ul Fix , Micro Pipette 100 Ul Fix , Micro Pipette 1000 Ul Fix , Micro Pipette 100-1000 Ul Variable , Micro Pipette 10-100 Ul Variable , Micro Pipette 0-10 Ul Variable , Micro Pipette 20-200 Ul Variable , Micro Pipette Stand (Big) Plastic Make , Micro Pipette Stand (Small) Plastic Make , Transfer Bag Of 300Ml , Double Bag 350Ml With Sagm And Diversion Pouch (With Luer Adapter) , Tripal Blood Bag 350Ml With Sagm And Diversion Pouch (With Luer Adapter) , Leucodepltion Blood Bag 350Ml (Inline Top And Top) , Leucodepltion Blood Bag 350Ml (Lab Side) , Pregnancy Kit Test , Cappilary Tub , Swab Stick , Benedict Reagent Quanitateive 500 Ml , Benedict Reagent Qualitateive 500 Ml , Sulphar Powder 500 Gm , Occult Blood Powder 100Gm , Hydrozen Peroxide 500Ml , Egg Albumin 500Gm , Sulphuric Acid 1000Ml , Sodium Hydroxide 500Gm , Copper Sulphate 500Gm , Picric Acid 500Ml , Arcino Molibate 500Ml , Phaspho Tungstic Acid 500Gm , Sodium Carbonate 500Gm , Nitric Acid 500Ml , Silver Nitrate 25Gm , Hydrochloric Acid 500Ml , Taffers Reagent 250Ml , Bromo Cresol Green Reagent Box , Urea Kit , Protein Kit , Cholesterol Kit , Pipette 1Ml , Pipette 2Ml , Test Tub , Burette With Tip , Burette Stopper , Burette Stand , Filter Paper , Mesauring Cylinder 50Ml , Beaker 250Ml , Beaker 500Ml , Round Bottle Flask 200Ml , Conical Flask 200Ml , Urin Jar Plastic , Funnel Plastic , Cuvette Colouimeton , Dispenser Bottle , Amikacin 30 Mcg / Disc , 100 Disc / Vial , Amoxicillin Clavulanic Acid 20/10 Mcg/ Disc , 100 Disc / Vial , Cefoperazone75 Mcg / Disc , 100 Disc / Vial , Ceftriaxone 30 Mcg / Disc , 100 Disc / Vial , Nitrofurantoin 300 Mcg/ Disc , 100 Disc / Vial , Ceftazidime /Avibacatam 30/10 Mcg / Disc , 100 Disc / Vial , Ofloxacin 5 Mcg/ Disc , 100 Disc / Vial , Ceftazidime /Clavulanic Acid 30/10 Mcg / Disc , 100 Disc / Vial , Ciprofloxacin 5 Mcg / Disc , 100 Disc / Vial , Ertapenem 10 Mcg/ Disc , 100 Disc / Vial , Gentamicin 10 Mcg / Disc , 100 Disc / Vial , Imipenem 10 Mcg / Disc , 100 Disc / Vial , Levofloxacin 5 Mcg / Disc , 100 Disc / Vial , Meropenem 10 Mcg / Disc , 100 Disc / Vial , Moxifloxacin 5 Mcg / Disc , 100 Disc / Vial , Prulifloxacin 5 Mcg / Disc , 100 Disc / Vial , Vancomycin 30 Mcg / Disc , 100 Disc / Vial , Azithromycin 15 Mcg / Disc , 100 Disc / Vial , Erythromycin 15 Mcg / Disc , 100 Disc / Vial , Chloramphenicol 30 Mcg / Disc , 100 Disc / Vial , Piperacillin/Tazobactam 100/10 Mcg / Disc , 100 Disc / Vial , Tobramycin 10 Mcg / Disc , 100 Disc / Vial , Tetracycline 30 Mcg / Disc , 100 Disc / Vial , Cefotaxime 30 Mcg / Disc , 100 Disc / Vial , Fluconazole 10 Mcg / Disc , 100 Disc / Vial , Amphotericin B 100 Units / Disc , 100 Disc / Vial , Itraconazole 30 Mcg / Disc , 100 Disc / Vial , Nystatin 100 Units / Disc , 100 Disc / Vial , Voriconazole 1Mcg / Disc , 100 Disc / Vial , Co-Trimoxazole 25 Mcg/ Disc , 100 Disc / Vial , Clindamycin 2 Mcg/ Disc , 100 Disc / Vial , Teicoplanin 30 Mcg/ Disc , 100 Disc / Vial , Cefdinir 5 Mcg / Disc , 100 Disc / Vial , Cefpirome 30 Mcg / Disc , 100 Disc / Vial , Imipenem –Cilastin 10 Mcg / Disc , 100 Disc / Vial , Ampicillin 2 Mcg / Disc , 100 Disc / Vial , Ampicillin + Sulbactam 6 Mcg / Disc , 100 Disc / Vial , Polymyxin-B 100 Unit / Disc , 100 Disc / Vial , Bacitracin 8 Unit / Disc , 100 Disc / Vial , Cefoxitin 20 Mcg / Disc , 100 Disc / Vial , Linezolid 30 Mcg / Disc , 100 Disc / Vial , Gentamicin (High) 50 Mcg / Disc , 100 Disc / Vial , Faropenem 5 Mcg / Disc , 100 Disc / Vial , Doxycycline 10 Mcg / Disc , 100 Disc / Vial , Aztreonam 50 Mcg / Disc , 100 Disc / Vial , Fosfomycin 50 Mcg / Disc , 100 Disc / Vial , Novobiocin 30 Mcg / Disc , 100 Disc / Vial , Optochin 5 Mcg / Disc , 100 Disc / Vial , Cefuroxime 30 Mcg / Disc , 100 Disc / Vial , Minocyline 30 Mcg / Disc , 100 Disc / Vial , Nalidixicacid 30 Mcg / Disc , 100 Disc / Vial , Norfloxacin 10 Mcg / Disc , 100 Disc / Vial , Tigecycline 15 Mcg / Disc , 100 Disc / Vial , Clarithromycin 15 Mcg / Disc , 100 Disc / Vial , Ketoconazole 30 Mcg / Disc , 100 Disc / Vial , Vancomycin (E Test Strip) 0.5 – 32 Mcg/Ml , Cefepime/Cefepime+Clavulanic Acid (E Test Strip) Cefepime (0.25-16Mcg)/Cefepime+Clavulanic Acid (0.064-4 Mcg) , Imipenem And Imipenem + Edta(E Test Strip) Imipenem (4-256 Mcg) And Imipenem+ Edta (1-64 Mcg) , Macconkey Agar 500G / Bottle , Muller-Hinton-Agar 500G / Bottle , Chrome Universal Agar 500G / Bottle , Lugol’S Iodine 125 Ml/Bottle , Urea Agar Base 100G / Bottle , Simmons Citrate Agar 100G / Bottle , Triple Sugar Iron Agar 100G / Bottle , Blood Agar Base 500G / Bottle , Robertson Cooked Meat Media 500G / Bottle , Sucrose 500G / Bottle , Lactose (Lr) 500G / Bottle , Mannitol (C6h14c6) 500G / Bottle , Peptone, 500G / Bottle , Dextrose Anhydrous(C6h12o6) 500G / Bottle , Bile Esculin Reagent/Agar 500G / Bottle , Methylene Blue For Zn Stain 500Ml / Bottle , Carbol Fuchsin For Zn Stain 500Ml / Bottle , Giemsa Stain 500Ml / Bottle , Periodic Acid Schiff Stain 500Ml / Bottle , Safranine For Zn Stain 500Ml / Bottle , Gentian Violet(Crystal) 100G / Bottle , Phenol (C6h5oh) (Crystal) 500G / Bottle , Methyl Red Reagent 500G / Bottle , Phenyl Pyruvic Acid(Ppa Test) 100G / Bottle , Prepared Oxidase Disc 50 Disc/ Box , Iodine (Crystal)100G / Bottle , Tri-Sodium Citrate ( Na3c6h5o72h2o) 500G / Bottle , Citric Acid (C6h8o7) 500G / Bottle , Kovac’S Indole Reagent 100Ml / Bottle , 40 % Urea (Nh2conh7) 500G / Bottle , Antibiotic Zone Scale 1Pc/Box , Antisera-Salmonella O And H A,2 Ml / Vial , Antisera-Shigella Dysenteriae, 2 Ml / Vial , Antisera-Shigella Flexnari, 2 Ml / Vial , Antisera-Shiegella Sonnie,2 Ml / Vial , Antisera-Vibrio Cholera O139 ,2 Ml / Vial , Atcc Strain - E.Coli 25922,Freeze Dried Lyophilized / Vial , Atcc Strain - E.Coli 35218, Freeze Dried Lyophilized / Vial , Atcc Strain - Pseudomonas Aeruginosa 27853 Freeze Dried Lyophilized / Vial , Atcc Strain - Staphylococcus Aureus 25923 Freeze Dried Lyophilized / Vial , Atcc Strain - Staphylococcus Aureus 29213 Freeze Dried Lyophilized / Vial , Mounted Peripheral Blood Smear Slides For Gametocytes Of Plasmodium Vivax And Falciparum,(1 – Slide) , Potassium Permagnate (Kmno4) 500G / Bottle , Formalin (20%) 500Ml / Bottle , Methanol (Ch3oh) 500Ml / Bottle , Acetone (Lr) (Reagent ) 500Ml / Bottle , 100 % Sulphuric Acid (H2so4) 500Ml / Bottle , Gram’S Iodine 500Ml / Bottle , Boric Acid500g / Bottle , Di- Sodium Hydrogen Ortho-Phosphate500g / Bottle , Formaldehydesolution (37-41)%1000Ml / Bottle , Potassium Iodide (Ki) 500G / Bottle , Hydrogen Peroxide Solution(H2o2) 6%1000Ml / Bottle , Sodium Hydroxide Pellets Purified (Naoh) 500G / Bottle , Potassiumhydroxide Pellets (Koh) 500G / Bottle , Sodium Chloride (Nacl) 500G / Bottle , Amyl Alcohol ( C5h11oh)500Ml / Bottle , Xylene Sulphur 500Ml / Bottle , 70 % Isopropyl Alcohol 500Ml / Bottle , Normal Saline 500Ml / Bottle , Digital Weighing Balance 2Kg/ Machine , Test Tube (Glass 7Ml) 100Pc/ Pkt , Sterile Swab Stick, 100Pc/Pkt , Test Tube Holder (Small)10Pc/Box , Test Tube Holder (Large)10Pc/Box , Petri Disk 90X90 (10Pc/Pkt) , Petri Disk 90X120, (10Pc/Pkt) , Stock Vial (50Pc/Pkt) , Sterile Disposable Square Petri Plates (10Pc/Pkt) , Viral Transport Medium (3Ml/Vial) , Kovac’S Indole Reagent 100 Ml/ Bottle , Centrifuge Tubes 50Ml (Glass) 100Pc/Box , Centrifuge Tubes 15Ml (Glass) (Consumable)100Pc/Box , Erlenmeyer Flask (1000Ml) (Consumable) 1Pc , Microtube Rack (5X16 Holes) Per Rack , Wash Bottle Capacity 500Ml/Pc , Sterile Disposable Forceps (10Pc/Pack) , Steam Indicator Tape Size 18Mm (1-Pc) , Autoclavable Dispo Bag “14” (50/Pack) , Indicator Ph Paper(Ph 5 To 7.5)(5 Bundle / Pack) , Permanent Marker Pen (Red/Black) (Narrow Tip) (1-Pc) , Homogeniser With Serrated Pestle S.P 10Ml (1-Pc) , Nichrome Loop 4Mm, Double Wound (10Pc/Pack) , Nichrome Loop 2Mm, Double Wound (10Pc/Pack) , Semisolid Imrv Medium And Selective Supplement Fd19 -2Vl, 500Gm/Bottle , Sample Discarding Jar 3L Capacity (Borosil) (1-Pc) , Sample Discarding Jar 5L Capacity (Borosil) (1-Pc) , Conical Flask500ml Capacity(Borosil) (1-Pc) , Kala-Azar Detection Rapid Test (25Kit/Box) , Blood Culture Bottle/Bhi (Paediatric) 20Ml Capacity (10Pc/Box) , Blood Culture Bottle /Bhi(Adult) 70Ml Capacity (10Pc/Box) , India Ink Reagent (Nigrosin Stain 10% W/V (100 Ml) And Methylene Blue (125Ml/Bottle) , Scrub Typhus Igm Elisa 96Well Test Kit/Box , Chikungunya Igm Elisa 96Well Test Kit/Box , Je Igm Capture Elisa 96Well Test Kit/Box , Dengue Igm Elisa 96Well Testkit/Box , Dengue Ns-1 Ag Elisa 96Well Test Kit/Box , Cryptococcal Ag Rapid Test (25Kit/Box) , L J Medium Slant 10 Slant/Pack , Capped Collection Tube 1.5Ml Capacity (50Pc/Box) , Microamp Optical Tube 8/Strips (0.2 Ml Capacity) , Microamp Optical 8 Cap Strips (0.2 Ml) , Micro Centrifuge Tube 1.5Ml Capacity (500Pc/Box) , Serological Pipette 10Ml (200Pc/Box) , Serological Pipette 5Ml (250Pc/Box) , Art Barrier Specialty Pipettetips 100-1000?L Racked(96X1 Box) , Art Barrier Specialty Pipette Tips 20-200?L Racked (96X1 Box) , Art Barrier Specialty Pipette Tips 2-20?L Racked (96X1 Box) , Art Barrier Specialty Pipette Tips 50?L Racked (96X1 Box) , Art Barrier Specialty Pipette Tips 0-10?L Racked (96X1 Box) , Safeskin Purple Nitrile Gloves (Medium) 100/Box , N95 Particulate Respirator (Niosh Approved) 1Pc , Kimwipes 37.33X42.16 Cmn (140/Box) , Cryo Vial Sterile 1.8Ml (25Vial/Pkt) , Cryo Box 1.8Ml (9X9 Wells)(1 X 4 / Box) , Fg-Optical Adhesive Covers For Pcr, 1Pc , Microamp Optical 96-Well Reaction Plate(0.2Ml),(1- Plate) , Zip Lock Bag 21.3X18cm (10Bag/Box) , 96 Well Pcr Plate, (1- Plate) , Falcon Tube 10Ml (1Pc) , Falcon Tube50ml (1Pc) , Dacron Swab Stick (Nylon Flocked) (100Pc/Box) , Polypropylene Trigger Sprayers (500Ml), 1Pc , Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( Size 11 X 8 Inch),1Pc , Paraffin Film (M) (1-Roll) , Red Cap Tube 3Ml (1-Pc) , Aluminum Foil (72 Meter) (1-Pc) , Isopropanol 99.9%(500Ml/Bottle) , Spirit Surgical Grade (1Lt/Bottle) , Spirit Absolute (40 Lt/Gallon) , Hypochlorite Soln (5%/4.6%) (1Lt/Bottle) , Sterilium Hand Rub ( 500Ml/Bottle) , Liquid Hand Wash (750Ml/Pack) , Blotting Paper (1-Sheet) , Tourniquets For Blood Collection (1-Pc) , Loose Gloves M (7/7.5)(100/Box) , Surgical Gloves M (7/7.5),(1-Pc) , 3 Ply Surgical Mask , (1-Pc) , Surgical Head Cap, (1-Pc) , Face/Protective Shield , (1-Pc) , Bleaching Powder (25Kg/Bag) , Protective Goggles (1-Pc) , Rna Extraction Kit(1-Rxn) , Rna Zap Water 200Ml /Bottle , Ethanol Absolute Molecular Grade(500Ml/Bottle) , Thermacol Transport Box (18Cm X 12 Cm) (500Pc/Bag) , Tissue Paper (Toilet Paper Roll)(9Pc/Pack) , Labeling Stickers Sheets(St-65A4) (100Sheets/Pack) , Disposable Tongue Depressor (Spatula) (100Pc/Pack) , Nuclease Free Water (Molecular Grade) 1000Ml/Pack , Glucose Strip , Taqpath Multiplex Rt Pcr Kit For The Detection Sars Cov-2 1000 Rxn , Taqman Sequence Detection (Primer + Probe) For Screening (E Gene & Rnp) And Confirmatory (Rdrp, & Hku Orf Ib) , Seegene Allplex 2019-Ncov Assay R , Mylab Patho Detect Covid-19 Qualitative Pcr Kit , A*Star Fortitued Kit 2.0 Covid-19 Rt-Pcr Test , Pandemic H1n109 Assay Set 1000 Rxn , Super Script Iii Platinum Qrt Pcr Reagent 5 Rxn , Agpath One Step Rt Pcr Reagent , Labgun Covid-19 Rt Pcr Kit , Bgi Rt Pcr Kit For Detection Sars Cov-2 , 1-Napthol 200 Gm , 2,4-Dinitrophenyl Hydrazine 300 Gm , 2-Amino Diphenyl Oxalic Acid 500 Gm , 2-Chloro-2H-Azirine 500 Gm , 2-Napthol 250 Gm , 3,5- Dinitrosalicylic Acid 500 Gm , 8-Hydroxy Quinoline 250 Gm , Absolute Ethanol 10 Lit , Acacia 500 Gm , Acetaldehyde 500 Ml , Acetamide 500 Gm , Acetanilide 1 Kg , Acetic Acid 10 Lit , Acetic Anhydride 2.5 Lit. , Acetone 05 Lit , Acetonitrile 05 Lit , Acetophenone 500Ml , Acetyl Acetone 1 Lit , Acetylcholine Iodide 5Gm , Activated Charcoal 1Kg , Nutrient Agar 500Gm , Alcohol /Spirit 25Lit , Almond Oil 1Lit , Aloe Vera Gel 1Kg , Alpha-Amylase 100Gm , Alpha-Napthol 250Gm , Aluminium Chloride 1Kg , Aluminium Hydroxide 500Gm , Aluminium Sulphate 500Gm , Amaranth Red 100Gm , Amino Acid Kit , Ammonia 10 Lit , Ammonium Acetate 1Kg , Ammonium Bicarbonate 500Gm , Ammonium Carbonate 1Kg , Ammonium Chloride 1Kg , Ammonium Citrate (Tri) 500Gm , Ammonium Hydroxide 1Kg , Ammonium Molybdate 500Gm , Ammonium Nitrate 1Kg , Ammonium Oxalate 500Gm , Ammonium Reineckate 1Kg , Ammonium Sulphate 1Kg , Amyloglucosidase 50Ml , Anhydrous Sodium Sulfite 1Kg , Aniline 5Lit , Aniline Acetate 500Gm , Anthranilic Acid 250Gm , Apple Essence 50Ml , Arachis Oil 500Ml , Arsenic Trioxide 500Gm , Ascorbic Acid 500Gm , Ashwagandha 500Gm , Aspartic Acid 100Gm , Aspirin 1Kg , Atropine Sulphate 10Ml , Atropine Sulphate 25Gm , Bahera 1Kg , Barfoed’S Reagent 1Lit , Barium Chloride 1Kg , Barium Sulphate 500Gm , Bay Leaf 500Gm , Beef Extract 500Gm , Beeswax 2Kg , Belladonna Leaf Dry 500Gm , Benedict’S Reagent 1 Lit , Bentonite Powder 1Kg , Benzaldehyde 5 Lit , Benzamide 1Kg , Benzene 2.5 Lit , Benzidine 500 Gm , Benzil 1Kg , Benzoic Acid 5Kg , Benzoic Anhydride 500Gm , Benzoin 500Gm , Benzothiazole 250Gm , Benzoyl Chloride 4 Lit , Benzyl Alcohol 2.5 Lit , Benzylpenicillin 250Gm , Bial’S Reagent 1Lit , Blood Group Test Kit (10 Ml Anti A,B & D) , Borax 1Kg , Boric Acid 500Gm , Bovine Serum Albumin 10Gm , Bramhi 500Gm , Brilliant Blue 5Gm , Bromine 500Ml , Bromocresol Green Solution 250Ml , Butanol 2.5 Lit , Butyl Isocyanate 500 Gm , Cadmium Sulfate 5Gm , Caffeine 500Gm , Calamine 1Kg , Calcium Chloride Anhydrous 2.5Kg , Calcium Gluconate 500Gm , Calcium Hydroxide 5Kg , Camphor 250Gm , Carbolfuchsin 100Gm , Carbon Tetrachloride 2.5 Lit , Cardamom 250 Gm , Carrageenan 500Gm , Castor Oil 2.5 Lit , Catechol 500Gm , Cellulose Acetate Hydrogen Phthalate 500Gm , Ceric Ammonium Sulphate 500Gm , Cetyl Alcohol 500Gm , Chandan Powder 500Gm , Charcoal500gm , Chloral Hydrate 500Gm , Chloroform 10 Lit , Chloroquine Powder250gm , Chlorosulfonic Acid1 Lit , Chlorpheniramine Maleate Powder 250Gm , Chlorpromazine 250Gm , Cinchona 500 Gm , Cinnamic Acid 250 Gm , Cinnamon 500 Gm , Citric Acid 500 Gm , Clove 500 Gm , Cobalt Chloride 500 Gm , Cocoa Butter 200 Gm , Codeine Phosphate 50 Gm , Compound Tartrazine Solution 100Gm , Copper (Ii) Acetate 2.5Kg , Copper (Ii) Oxide 1Kg , Copper (Ii) Sulphate 1Kg , Copper (Metal) Turning 500Gm , Copper Sulfate 1Kg , Coriander 500Gm , Corn Oil 500Ml , Corn Starch 500Gm , Creatinine 100Gm , Crystal Violet 500Ml , Cupric Acetate 500Gm , Dapsone Powder 250Gm , Dextrin 500Gm , Dextrose 1Kg , Dichloro Methane 5Lit , Diethyl Ether10lit , Diethylmalonate500ml , Dioscorea 250Gm , Diphenylamine 500Gm , Disodium Edta 500Gm , Disodium Phosphate Heptahydrate 1Kg , Dmso 5Lit , Dragendroff’S Reagent 1Lit , Ephedra 500Gm , Eriochrome Black T (Solochrome Black T) 25Gm , Ethanol 10Lit , Ethyl Acetate 5Lit , Ethyl Acetoacetate5lit , Ethyl Benzoate 500Ml , Ethyl Cellulose500gm , Ethylene Diamine Tetra Acetic Acid (Edta) 2Kg , Eucalyptus Oil 500Ml , Eudragit 500Gm , Fehling’S Solution A 2Lit , Fehling’S Solution B 2Lit , Ferric Ammonium Sulphate 1Kg , Ferric Chloride 500Gm , Ferric Chloride 1Kg , Ferrous Sulphate 500Gm , Formaldehyde 5Lit , Formic Acid 5Lit , Fructose 1Kg , Furosemide 25Gm , Gelatin 1Kg , Glacial Acetic Acid 5Lit , Glucose 1Kg , Glycine 1Kg , Glycine 100Gm , Glyoxalic Acid 1Lit , Granulated Zinc 500Gm , Gum Trgacanth Powder 1Kg , Hagers Reagent 1Lit , Harde 500Gm , Histamine 25Gm , Honey 1Kg , Hydrazine Hydrate 2.5 Lit , Hydrochloric Acid 10Lit , Hydrogen Peroxide 1 Lit , Hydroxy Napthol Blue 25Gm , Hydroxy Propyl Methyl Cellulose 500Gm , Hydroxylamine Hydrochloride 500Gm , Ibuprofen Powder 500Gm , Iodine 500Gm , Iron Oxide 500Gm , Isabgol 1Kg , Iso Propanolol 2.5 Lit , Isoniazid Powder 250Gm , Jatamansi 500Gm , Kaolin 500Gm , Lactose 1Kg , Lanolin 1Kg , Lead Acetate 1Kg , Lead Nitrate 500Gm , Lead Subacetate 2Lit , Leishman Reagent In Methanol 25Gm , Lemon Essential Oil 250Ml , Leucine 25Gm , Light Magnesium Oxide 500Gm , Light Mineral Oil5lit , Light Petroleum Ether (40 -600) 2.5 Lit , Liquid Paraffin (Heavy) 500Ml , Liquid Paraffin (Light) 500Ml , Liquorice 500Gm , Long Pepper 500Gm , Lwinoff’S Reagent 1 Lit , Magnesium Chloride 1Kg , Magnesium Hydroxide 500Gm , Magnesium Stearate 2Kg , Magnesium Sulfate 2Kg , Magnesium Turning 250Gm , Malonic Acid 1Kg , Maltose 1Kg , Mayer’S Reagent 1Lit , Menthol 500Gm , Mercuric Chloride 50Gm , Mercurous Nitrate 25Gm , Metaphosphoric Acid 1Kg , Methanol 10 Lit , Methi 500Gm , Methyl Blue 25Gm , Methyl Cellulose 500Gm , Methyl Ethyl Ketone 1 Lit , Methyl Orange 100Gm , Methyl Orange Indicator 250Ml , Methyl Paraben 500Gm , Methyl Red 25Gm , Methyl Red 500Ml , Methyl Salicylate 500Ml , Methylene Blue500 Ml , Methylene Chloride 2.5 Lit , Metol Solution 100 Ml , Metronidazole Powder 250 Gm , Microcrystalline Cellulose 1Kg , Millon’S Reagent 1 Lit. , Mineral Oil 500 Ml , Molisch Reagent 100 Ml , Monosodium Phosphate 1 Kg , Morpholino Propane Sulphonic Acid (Mops) 25 Gm , Nagkeshara 500 Gm , Napthol Blue 25 Gm , Napthoquinone100 Gm , N-Hexane 5 Lit , Ninhydrin 100 Gm , Nitric Acid 10 Lit , N-Phenylanthranilic Acid (Ferroin Sulphate) 100 Ml , O-Cresol 500 Ml , Octanol 2.5 Lit , Oil Of Anise 30 Ml , Olive Oil 1 Lit , O-Phenylenediamine 250 Gm , Orange Oil 500 Ml , Orthophosphoric Acid 2.5 Lit , Osmic Acid 500 Gm , Oxalic Acid 500 Gm , O-Xylene 500 Ml , P-Aminobenzoic Acid 1 Kg , Para Amino Benzoic Acid (Paba) 250 Gm , Paracetamol Powder 500 Gm , Paraffin Liquid Heavy5 Lit. , Paraffin Liquid Light5 Lit. , P-Benzoquinone100 Gm , P-Chloromercuribenzoic Acid 1 Kg , Peg 200 2.5 Lit , Peg 3350 500 Gm , Peg 400 500 Ml , Peg 400 2.5 Lit , Peg 6000 500 Gm , Peptone Soya 500 Gm , Perchloric Acid 2.5 Lit , Petroleum Ether 5 Lit , Phenobarbitone 10 Gm , Phenol 1 Kg , Phenophthaline Indicator , Phenyl Hydrazine Hydrochloride 500 Gm , Phenylalanine25 Gm , Phloroglucinol 250 Gm , Phosphoric Acid 1 Kg , Physostigmine 10 Gm , Picric Acid 500 Gm , Picrolonic Acid 500 Gm , Pine Oil 250 Ml , Pineapple Flavour100 Ml , Piper Longum Fruit 500 Gm , Piper Longum Root 500 Gm , Piperazine Citrate 500 Gm , Plumbagoo Zeylanica 500 Gm , Potassiumdichromate 2 Kg , Potassium Bromide 2 Kg , Potassium Chloride 2 Kg , Potassium Dihydrogen Phosphate 500 Gm , Potassium Ferricyanide 1 Kg , Potassium Ferrocyanide 1 Kg , Potassium Hydrogen Phthalate 1 Kg , Potassium Hydroxide 2 Kg , Potassium Iodide 500 Gm , Potassium Permanganate 500 Gm , Potassium Sodium Tartrate 500 Gm , Potassium Sulphate 1Kg , Precipitated Chalk 500 Gm , Precipitated Sulphur 500 Gm , Propanol 05 Lit , Propyl Glycol 1 Kg , Propyl Paraben 500 Gm , Propylene Glycol 2.5 Lit , P-Toluene Sulfonylamide 500 Gm , P-Toluene Sulphonic Acid 2.5 Lit , Pyridine 2.5 Lit , Quinine Sulphate 100 Gm , Rbc Diluting Fluid 500 Ml , Rectified Sprit 5 Lit , Resorcinol 2 Kg , Rose Oil 500 Ml , Ruthenium Red 5 Gm , Saccharin Sodium 500 Gm , Safranine 500 Ml , Salicylic Acid 1 Kg , Seliwanoff’S Reagent 500 Ml , Senna Leaves 500 Gm , Sesame Oil 2.5 Lit , Shakhpushpi 500 Gm , Shatavari 500 Gm , Silica Gel 100-200 Mesh (For Column Chromatography) 2 Kg , Silica Gel 60-120 Mesh (For Column Chromatography) 2 Kg , Silica Gel G 5 Kg , Silver Nitrate 25 Gm , Sodium Acetate 1 Kg , Sodium Arsenate Dibasic 100 Gm , Sodium Benzoate 1 Kg , Sodium Bicarbonate 5 Kg , Sodium Bisulfate 500 Gm , Sodium Carbonate 2 Kg , Sodium Chloride 5 Kg , Sodium Citrate 2 Kg , Sodium Dihydrogen Phosphate 1 Kg , Sodium Dodecyl Sulphate 5 Kg , Sodium Formate500 G , Sodium Hydroxide 2.5 Kg , Sodium Metal 500 Gm , Sodium Methyl Paraben 500 Gm , Sodium Nitrite1 Kg , Sodium Nitropruside 1 Kg , Sodium Oxalate 500 Gm , Sodium Phosphate Dibasic 1 Kg , Sodium Phosphate Monobasic 1 Kg , Sodium Picrate 500 Gm , Sodium Potassium Tartarate 500 Gm , Sodium Propyl Paraben 250 Gm , Sodium Salicylate 500 Gm , Sodium Succinate 500 Gm , Sodium Sulfate 1 Kg , Sodium Thiocyanate 500 Gm , Sodium Thiosulfate 500G , Sodium Tungstate250 Gm , Soft Soap 1 Kg , Solochrome Black T 25 Gm , Sorbitol Solution (70%) 250 Gm , Spermaceti 500 Gm , Standard Cholesterol 25 Gm , Starch 2 Kg , Stearicacid 1 Kg , Strong Ammonium Solution 2.5 Lit , Sucrose 2 Kg , Sudan Red Iii 5 Gm , Sugar 2 Kg , Sulfanilamide 500 Gm , Sulfuric Acid 15 Lit , Sulphamic Acid500 Gm , Sulphanilic Acid 500 G , Sulphosalicylic Acid 500 Gm , Sulphur 1 Kg , Talc 2 Kg , Tannic Acid 1 Kg , Tartaric Acid 1 Kg , Tartrazine Yellow 25 Gm , T-Butyl Alcohol 1 Lit , Tetracycline Hydrochloride 250 Gm , Thioglycollic Acid 500 Ml , Thiourea 500 Gm , Thymol Blue 25 Gm , Titanium Dioxide 500 Gm , Toluene 5 Lit , Tragacanth1 Kg , Triethanol Amine 2.5 Lit , Trisodium Citrate, Dihydrate 500 Gm , Turpentine Oil 300 Ml , Tween 80 500 Gm , Tyrosine 100 Gm , Urea 1 Kg , Uric Acid 25 Gm , Vanillin 100 Gm , Vegetable Oil 1 Lit , Wagners Reagent 1 Lit. , Wbc Diluting Fluid (Turks Fluid) 500 Ml , White Ointment 1 Kg , White Wax 500 Gm , Xylenol Orange 10 Gm , Yellow Soft Paraffin 500 Gm , Zinc Dust 500 Gm , Zinc Oxide 2 Kg , Zinc Stearate 1 Kg , Zinc Sulfate 1 Kg , Zinziberofficinalis500 Gm , Air Condenser 300 Mm (With Joint B-19 Or B-24 And Plain Without Joint) , Ampoules , Arsenic Test Apparatus , Beaker 100Ml , Beaker 250Ml , Beaker 500Ml , Beaker 1000Ml , Boiling Tubes , Borer Dia. 8Mm, Thickness 3Mm , Length 99 , Buchnerfunnel Ceramic And Plastic 70Mm , Buchnerfunnel Ceramic And Plastic 110 Mm , Buchner Flask 250Ml , Buchner Flask 500Ml , Burette Stand , Burette With Rota Flow Stop Cock , Capillaries For Melting Point Determination , Centrifugal Tube Graduated , Centrifugal Tube Plain , China Dish , Clavengerapparatus , Column For Column Chromatography , Conical Flask 100 Ml , Conical Flask250ml , Cover Slips , Dessicator Plain 150 Mm , Dessicator Plain 250 Mm , Distillation Flask Bg , Distillation Set (Condenser Reciever) , Distillation Unit , Droppong Bottle 60 Ml , Droppong Bottle 125 Ml , Eppindroff1.5 Ml , Eppindroff2.0 Ml , Erlenmeyer Flask , Filter Paper Rim 8X22 , Flat Bottom Flask (100 And 250) , Flilter Paper Pkt Round , Funnel (Small, Medium And Large Size) , Glass Rod , Glass Slides , Graduated Measuring Cylinder 10Ml , Graduated Measuring Cylinder 50Ml , Graduated Measuring Cylinder 100Ml , Graduated Measuring Cylinder 500Ml , Graduated Measuring Cylinder 1000 Ml , Ignition Tube (Pkt Of 5 Grs, Superior Quality) , Iodine Flask , Kipps Apparatus , Lens Cleaning Tissue (Paper Book Of 100) , Litmus Paper Red/Blue Pkt Of 100 Lbs , Microtips , Mortar Pastel (Dia 5, 6 And 8) , Nessler Cylinder (50 Ml) , Ostwald Viscometer , Petridish 100 Mm , Petridish 75Mm , Ph Paper In Plastic Box Pkt Of 100 Lbs , Pipette Bulb Rubber , Pipette Pump 2 Ml , Pipette Pump 25Ml , Pipette Pump 10Ml , Pipette Stand Horizontal For 12 Pipettte , Pipette Volumetric20ml , Pipette Volumetric 10Ml , Pipette Volumetric 25Ml , Pipettes 1Ml , Pipettes 2Ml , Pipettes 5Ml , Pipettes 10Ml , Plane Slide With Cavity , Reagent Bottle Narrow Mouth Amber 500 Ml , Reagent Bottle Narrow Mouth Amber 125Ml , Reagent Bottle Narrow Mouth Amber 250Ml , Round Bottom Flask (250 Ml) , Round Bottom Flask (Double And Triple Neck) , Rubber Cork (Extra Soft) Superior Quality (Top Dia 13Mm) , Rubber Tubing Coil (10 Meter) , Separating Funnel 250 Ml , Separating Funnel 100Ml , Silica Crucibles 15 Mm , Soxhlet Apparatus Complete With All Capacity , Specific Gravity Bottle N.G. 25 Ml , Specific Gravity Bottle N.G. 50 Ml , Starch Iodine Paper 100 Leaves , Steam Distillation Assembly , Stoppered Tubes , Suction Pump Made Of Glass , Test Tube , Test Tube Holder , Test Tube Stand , Thermometer 30 Cm Length (10-360 Degree) , Thiele`S Tube , Tlc Chamber With Lid , Tlc Plates , Tlc Sprayer , Volumetric Flask 10Ml , Volumetric Flask 25Ml , Volumetric Flask 100Ml , Volumetric Flask 250Ml , Volumetric Flask 1000Ml , Wash Bottle 250 Ml , Watch Glass , Whatman Filter Paper For Paper Chromatography , White Tiles , Wire Gauge , Rnase/Dnase Away(Ivd, Us Fda, Icmr Approved) 250Ml , Taqpath Covid-19 Combo Kit Multiplex Real-Time Rt-Pcr (Catalog Numbers A47813 And A47814)(Ivd, Us Fda, Icmr Approved) , A* Star Fortitude Kit 2.0 Covid-19 Qualitative Pcr Kit(Ivd, Us Fda, Icmr Approved) , Mylabpatho Detect Covid-19 Qualitative Pcr Kit(Indian Fda/ Central Drugs Standard Control Organisatio (Cdsco),Icmr Approved) , Kilpest (Blackbio) Trupcr Sars-Cov 2Rt-Qpcr Kit Version 2 (Usfda /Or Ce- Approved) , Biomerieux Argene Sars-Cov-2 R-Gene(Ivd, Us Fda, Icmr Approved) , Water, Ultrapure, Free Of Dnase, Rnase, Protease, Endonuclease(Ivd, Indian Fda/ Central Drugs Standard Control Organisatio (Cdsco),Icmr Approved) 1 Litre , N-95 Particulate Respirator (Valved Particulate Respirator, 42Cfr84 Approved Product, 95% Filter Efficiency Level, Effective Against Particulate Aerosols Free Of Oil) , Wipes 37.33X42.16 Cm(Anti-Stat Polyshield: Anti-Static Dispensing System Reduces Lint And Electrostatic Discharge, Easily Wipe Up Liquids, Dust And Tiny Particles And Are Designed For Delicate Tasks) , Cryo Box 1.8Ml (9X9) (Chipboard, 132 X 132 X 51Mm, Square,Durable Plastic Cryoboxes With Keyed Lid Orientation And Printed Via Location Grid.) , Zip Lock Bag 21.3X18cm(Thickness: 52 Micron, Prevents Aroma Transfer, Keep Out Dirt And Moisture, Made From Fda Approved) , Polypropylene Trigger Sprayers (500Ml)(Made From Durable, Chemical Resistant Polypropylene,Trigger Sprayer With Adapters.) , Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides (11X8 Inch) (Stainless Steel, Autoclavable, Chemical Resistantand For Laboratory Use) , Deep Well Storage Plasticware 96 Well Plate(Height 4.1Cm, Wellcut 1 Cm, Length 12.1Cm Polypropylene) , Plasticware Magnetic 8 Strip Comb (Height 4.5Cm, Length 10.2Cm, Distance Between Each Comb=1Cm) , Duo Rna Elution Plate 96 Well (Wall Thiekness 6Mm, Nominal Size 50, Neutral Glass) , Reinelene Solution (Peracetic Acid) 1X 5Lit , Glutaraldehyde 2.4% Solution 1X 5 Lit , Self Lock Pouch (Plastic) , Deep Well 96 Plate (Size 50Mm, 200Ul, Wall Thickness 6Mm Nominal Size 50, Neutral Glass) , 96 Tip Comb For Deep Well Plates (Wall Thickness 5Mm, Nominal Size 90, Neutral Glass) , Volmutric Flask 500Ml , Rose Water 250Ml , Manitol 500Gm , Renelene Solution 5 Litr. , Cidex 5 Litr. , Cidex 1 Litr. , Carbolic Acid 1000Ml , Hplc Variant Ii Bts Test Ket 500Test Packet , Inflamable Sprit 5 Ltr , Rotoquac (Hiv Fourt) Kit , Anti Sera A 10Ml , Anti Sera B 10Ml , Anti Sera D 10Ml , Hcv Rapid Kit 4Th , Medicated Sprit 5Ltr , Savelon 05 Ltr , Savelon 01 Ltr , Distle Water 05 Ltr , Reniplus Solution 05 Ltr , Variant Iind Bts , Albumin Kit , Protein Kit , Nacl 500Ml , Droper 3Ml , Cedarwood Oil 5Ml , Reticulocytes Counting Fluid 100Ml , Improve Newbarcounting Chamber , Rbc Pipette , Wbc Pipette , Reagent Bottle (Glass 250Ml) , Platelet Diluting Fluid 125Ml , Hemoglobino Meter , Acetic Acid 1000Ml , P 16 Antibody 6Ml Vail , Hemaccue Cuvette , Art Barriar Tips 20Ul - 200Ul , Art Barriar Tips 1000 Ul , Art Barriar Tips 10 Ul , Soda Lime , 96 Well Pcr Plate, Sealer (Rtpcr Mechine) , Pre Filled Automated Rna Extraction Plate With Tip Comb (96 Well Zybio) , Vtm , Micri Barrier Tips 20 -200 Ul , Micri Barrier Tips 10 Ul , Micri Barrier Tips 1000 Ul
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 10
Uttar Pradesh View Result →
11.
Health and Family Welfare #9040904 Technical Bid
Purchasing Of Chemical Re Agent Equipment And Consumables Items , Items : , Absolute Alcohol , Acetone , Albumin Reagent Kit (Colorimetric Mehtod) , Alcohol 70% , Aliquote Stand , Alkaline Peptone Dehydrated Water , Alkaline Phosphatase Reagent Kit , Aluminium Foils (.14 Mm Thickness) , Ammonium Hydroxide , Ammonium Sulphate , Analytical Balance , Antibiotic Disc Amikacin (30 Mcg) , Antibiotic Disc Amoxycillin (30 Mcg 20/10Mcg) , Antibiotic Disc Ampicillin (10 Mcg) , Antibiotic Disc Ampicillin Sulbactam (20 Mcg 10/10 Mcg) , Antibiotic Disc Azithromycin (15 Mcg) , Antibiotic Disc Aztreonam(30 Mcg) , Antibiotic Disc Bacitracin Discs , Antibiotic Disc Cefepime (30Mcg) , Antibiotic Disc Cefoperazone (75 Mcg) , Antibiotic Disc Cefotaxim (30 Mcg) , Antibiotic Disc Cefoxitin (30 Mcg) , Antibiotic Disc Cefpodoxine(10 Mcg) , Antibiotic Disc Ceftazidime (30 Mcg) , Antibiotic Disc Ceftriaxone (30 Mcg) , Antibiotic Disc Chloramphenicol (30 Mcg) , Antibiotic Disc Ciprofloxacin (5 Mcg) , Antibiotic Disc Clindamycin (2 Mcg) , Antibiotic Disc Colistin (10 Mcg) Mic Kit , Antibiotic Disc Cotrimoxazole (Cot) (25 Mcg) , Antibiotic Disc Doxycycline (30 Mcg) , Antibiotic Disc Erythromycin (15 Mcg) , Antibiotic Disc Gentamycin (120 Mcg) , Antibiotic Disc Gentamycin 10 Mcg) , Antibiotic Disc Imipenem (10 Mcg) , Antibiotic Disc Levofloxacin (5 Mcg) , Antibiotic Disc Linezolid (10 Mcg) , Antibiotic Disc Meropenem (10 Mcg) , Antibiotic Disc Moxifloxacin (5 Mcg) , Antibiotic Disc Nalidixic Acid (30 Mcg) , Antibiotic Disc Nitrofurantoin (100 Mcg) , Antibiotic Disc Norfloxacin (10Mcg) , Antibiotic Disc Novobiocin , Antibiotic Disc Ofloxacin (01 Mcg) , Antibiotic Disc Pipracillin-Tazobactam (Pit) (30/6 Mcg) , Antibiotic Disc Polymyxin B (300 Units) , Antibiotic Disc Spaxfloxacin (5 Mcg) , Antibiotic Disc Vancomycin (5 Mcg , E-Strips) , Antisera -Salmonella Typhi , Antisera -Vibrio Cholarae (O1,O139) , Applicator , Apron Full Sleeves (Lab Coat) , Atcc Strain - E.Coli 25922 , Atcc Strain - Psendomonas Aeruginosa 27853 , Atcc Strain - Staphylococcus Aureus 25923 , Autoclavable Bags (Bmw) , Autoclave Bag , Ayre’S Spatula , Barcode/Barcode Readerstrip , Benedict Reagent , Benedicts Quantitative Solution , Benzidine Reagent Powder , Bijous Bottle (For Blood Culture ) 15 Ml Vial , Bile Broth Base , Bile Esculin Agar Base , Bile Esculin Discs , Binocular Microscope With Led Light Source , Biomedical Waste Bag , Bismuth Sulphite Agar , Black Bag (Biomedical Waste Bag) , Black Bucket , Bleaching Powder , Blood Agar Base (For Haemolysis Activity) , Blood Culture Bottle 50 Ml , Blood Culture Media (Prepared) , Blood Grouping Anti Rh , Blood Grouping(Anti A, Anti B) Anti Rh , Blotting Paper , Brain Heart Infusion Agar , Bunsen Burner , Calcium Reagent Kit (Calcium Estimation) , Calcium Reagent Kit (Coloriometric Method) , Cavity Slides For Bacterial Mobility , Chocholate Agar Base , Cholesterol Reagent Kit (Colorimetric Method) , Citrate Agar Base (Simmons)Dehydrated , Cled Agar , Corn Meal Agar(Dehydrated) , Cotton (500Gm Net) , Couplin Jars , Coverslip Large Size , Coverslip Small Size , Creatinine Reagent Kit (Colorimetric Mehtod) , Cromogenic Cled Agar Base , Crystal Violet , Dengue Card Test(Igm/Igg Antibody) , Dengue Card Test(Ns1 Antigen) , Deoxy Chocholate Citrate Agar , Diamond Pencil , Dil. Acetic Acid , Disposable Gloves , Disposable Scalpel Blades , Disposable Syringe With Needle 10 Ml , Disposable Syringe With Needle 20 Ml , Disposable Syringe With Needle 3Ml , Disposable Syringe With Needle 5Ml , Distilled Water , Dropping Bottles , Drum (Net) For Autoclave (11X9) , Durham Tubes , Duster Cloth , Edta Vial , Elisa Testing Kit For Dengue Nsi Antigen , Elisa Testing Kit For Hav , Elisa Testing Kit For Hev , Face Shield / Goggles , Filter Paper , Flasks 1000 Ml , Flasks 500 Ml , Formaldehyde 40% , Fungus Teasing Needle , Gas Cylinder With Regulator & Pipe , Glacial Acetic Acid , Glass Slides (1X3 Inch) , Gloves (Nitrile) M Size Disposable , Glucose Broth , Gown (Disposable) , Grams Iodine , H2so4 (100% ) Conc , Hand Washing Liquid Soap , Harris Hematoxylin , Head Cover , Hematoxylin And Eosin Stain Set , Histology Slide Trey(Not Box) , Hydrogen Peroxide (H2o2 ,3%) , Hydrochloric Acid Dilute , India Ink. , Inoculating Loop (Nichrome) , Insulin Pen , Isopropyl Alcohol , Jamshidi Bone Marrow Biopsy Needle(18G, Steel) , Jamshidi Bone Marrow Biopsy Needle(20G, Steel) , Kahns Test Tube (5Ml) , Klimas Bone Marrow Aspiration Needle(18G, Steel) , Klimas Bone Marrow Aspiration Needle(20G, Steel) , Kovacsreagent Strip , Kovacs Indole Reagent , L. J. Medium Slant (Ready To Use) , Laboratory Refrigerator (Minimum 400L) - 02 To 08 Degree Celcius , Laminar Hood , Lancet , Leishman’S Stain , Lens Cleaner , Leukart L Blocks/Molds , Liquide Paraffin , Liquor Ammonia , Lowenstein Jensen Prepared Media , Lumbar Puncture Needle(18G, Steel) , Mac Conkey Agar (Dehydrated Powder) , Mannitol Salt Agar Base , Masks (Dispoable) , Mc Cartney Bottles , Mc Intosh , Metal Rod - 48 Cm/ 20 Inch Length , Metered Dose Inhalers , Methanol 500Ml , Methylene Blue , Mbi Kit For Iodine Test , Micro Auto Pipette 10?L - 100?L , Micro Auto Pipette 100?L- 1000?L , Micro Fixed Pipette 05?L- 50?L , Micro Fixed Pipette 10?L- 100?L , Mp Card Test Kit , Muller Hinton Agar Base , Museum Jars (Size 200X150x100) , Museum Jars (Size 360X150x100) , Museum Jars(Size200x195x80) , N/10 Hcl , N-95 Mask , Nasal Sprays , Needle (Pricking) , Needle Burner & Syringe Destroyer (Electrical) , Nichrome Loop /Loop Holder , Nitric Acid 500Ml , Nuclease Free Water , Nutrient Agar Base , Nutrient Broth , Optochin Discs , Oxidase Discs , Oxidase Reagent , Paraffin , Paraffin Wax (Solid) , Parafilm , Pcr Kit (Detection) Covid -19 , Pcr Plate And Pcr Sealer , Pcr Tube And Cap Stripe , Pen , Permanent Marker (Fine Tip) , Petri Plates (Disposable) , Phenolphthalein Red Indicator , Phosphorus Reagent Kit (Colorimetric Method) , Platelet Diluting Fluid , Potassium Oxalate , Potassium Iodide , Powder Latex Gloves , Ppe Kit/Gown , Protein Reagent Kit (Colorimetric Method) , Puncture Proof Container , Rapid Pap Stain Kit , Rbc Diluting Fluid , Record File , Redbag (Bmw) , Redbucket , Register , Rna Extraction Kit (Covid -19) , Robertsons Cooked Meat Medium(Prepared) , Rotahalers , Safranin Oil , Salahs Bone Marrow Aspiration Needle(18G, Steel) , Salahs Bone Marrow Aspiration Needle(20G, Steel) , Sanitizer , Scalpel Handle No.3 , Scissor , Sda Agar(Dehydrated) , Sgot Reagent Kit (Colorimetric Method) , Sgpt Reagent Kit (Colorimetric Method0 , Sharp Container , Shoe Cover , Silver Nitrate , Silver Nitrate Solution , Simmohs Citrate Agar Base , Sodium Carbonate , Sodium Chloride , Sodium Chloride (0.9%) , Sodium Hypochloride (4%) , Sodium Hypochloride 5% , Sodium Nitroprusside , Sodium Potassium Dihydrate , Spirit Lamp , Spray Fixative , Sprit , Stand For Handling 20 Ml Test Tube , Starch Soluble (Extrapure) , Sterile Cotton Swab , Stop Watch Reading At 1/15 Second , Stopwatch , Straight Wire , Sugar (God/Pod Method) Kit , Sulphide Indole Motility Media , Sulphuric Acid Conc. , Surgical Mask , Swab Stick ( Nasopharyngeal) , Swab Stick (Oropharyngeal ) , Test Tube Rack , Test Tube Rack (16 Mm , 31 Hole ) , Test Tube Rack/Stand For Holding 10 Ml Testtubes , Test Tube Stand (12 Mm ,24 Hole) , Tips 10 Micro Liter Filter Tips (Sterile) , Tips 1000 Micro Liter Filter Tips (Sterile) , Tips 20 Micro Liter Filter Tips (Sterile) , Tips 200 Micro Liter Filter Tips (Sterile) , Tissue Embedding Cassette , Tissue Embedding Mold , Tissue Paper Roll , Transparent Tape , Triglyceride Reagent Kit (Colorimetric Method) , Triplesugar Iron Agar , Turpentine Oil , Urea Agar Base-Christensen (Dehydrate) , Urea Reagent Kit , Uric Acid Reagent , Urine Culture Pot , Vim Silverman Liver Biopsy Needle(18G, Steel) , Vtm , Vtm Stand , Watch Glass , Wbc Diluting Fluid , Westergren Pipette And Stand , Westergrens Esr Pipette , Westergrens Esr Stand , White Board Duster , White Board Marker , Widal Test Kit , Wintrobes Esr Stand , Wintrobes Esr Tube , Xld Agar , Xylene , Yellow Bag (Bmw) , Yellow Bucket (Bmw) , Zip Lock Pouch , 0.1 Ml Pcr Tube , 0.5 Mac Farland Solution , 1.5 Ml Centrifuge Tube , 2 Ml Centrifuge Tube , A 4 Size Paper
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 7
12.
Health and Family Welfare #9030991 Technical Bid
For Purchasing/Rate Contract Of Chemicals Reagents, Equipments And Consumables Items , Items : , Absolute Alcohol , Acetone , Albumin Reagent Kit (Colorimetric Mehtod) , Alcohol 70% , Aliquote Stand , Alkaline Peptone Dehydrated Water , Alkaline Phosphatase Reagent Kit , Aluminium Foils (.14 Mm Thickness) , Ammonium Hydroxide , Ammonium Sulphate , Analytical Balance , Antibiotic Disc Amikacin (30 Mcg) , Antibiotic Disc Amoxycillin (30 Mcg 20/10Mcg) , Antibiotic Disc Ampicillin (10 Mcg) , Antibiotic Disc Ampicillin Sulbactam (20 Mcg 10/10 Mcg) , Antibiotic Disc Azithromycin (15 Mcg) , Antibiotic Disc Aztreonam(30 Mcg) , Antibiotic Disc Bacitracin Discs , Antibiotic Disc Cefepime (30Mcg) , Antibiotic Disc Cefoperazone (75 Mcg) , Antibiotic Disc Cefotaxim (30 Mcg) , Antibiotic Disc Cefoxitin (30 Mcg) , Antibiotic Disc Cefpodoxine(10 Mcg) , Antibiotic Disc Ceftazidime (30 Mcg) , Antibiotic Disc Ceftriaxone (30 Mcg) , Antibiotic Disc Chloramphenicol (30 Mcg) , Antibiotic Disc Ciprofloxacin (5 Mcg) , Antibiotic Disc Clindamycin (2 Mcg) , Antibiotic Disc Colistin (10 Mcg) Mic Kit , Antibiotic Disc Cotrimoxazole (Cot) (25 Mcg) , Antibiotic Disc Doxycycline (30 Mcg) , Antibiotic Disc Erythromycin (15 Mcg) , Antibiotic Disc Gentamycin (120 Mcg) , Antibiotic Disc Gentamycin 10 Mcg) , Antibiotic Disc Imipenem (10 Mcg) , Antibiotic Disc Levofloxacin (5 Mcg) , Antibiotic Disc Linezolid (10 Mcg) , Antibiotic Disc Meropenem (10 Mcg) , Antibiotic Disc Moxifloxacin (5 Mcg) , Antibiotic Disc Nalidixic Acid (30 Mcg) , Antibiotic Disc Nitrofurantoin (100 Mcg) , Antibiotic Disc Norfloxacin (10Mcg) , Antibiotic Disc Novobiocin , Antibiotic Disc Ofloxacin (01 Mcg) , Antibiotic Disc Pipracillin-Tazobactam (Pit) (30/6 Mcg) , Antibiotic Disc Polymyxin B (300 Units) , Antibiotic Disc Spaxfloxacin (5 Mcg) , Antibiotic Disc Vancomycin (5 Mcg , E-Strips) , Antisera -Salmonella Typhi , Antisera -Vibrio Cholarae (O1,O139) , Applicator , Apron Full Sleeves (Lab Coat) , Atcc Strain - E.Coli 25922 , Atcc Strain - Psendomonas Aeruginosa 27853 , Atcc Strain - Staphylococcus Aureus 25923 , Autoclavable Bags (Bmw) , Autoclave Bag , Ayre’S Spatula , Barcode/Barcode Readerstrip , Benedict Reagent , Benedicts Quantitative Solution , Benzidine Reagent Powder , Bijous Bottle (For Blood Culture ) 15 Ml Vial , Bile Broth Base , Bile Esculin Agar Base , Bile Esculin Discs , Binocular Microscope With Led Light Source , Biomedical Waste Bag , Bismuth Sulphite Agar , Black Bag (Biomedical Waste Bag) , Black Bucket , Bleaching Powder , Blood Agar Base (For Haemolysis Activity) , Blood Culture Bottle 50 Ml , Blood Culture Media (Prepared) , Blood Grouping Anti Rh , Blood Grouping(Anti A, Anti B) Anti Rh , Blotting Paper , Brain Heart Infusion Agar , Bunsen Burner , Calcium Reagent Kit (Calcium Estimation) , Calcium Reagent Kit (Coloriometric Method) , Cavity Slides For Bacterial Mobility , Chocholate Agar Base , Cholesterol Reagent Kit (Colorimetric Method) , Citrate Agar Base (Simmons)Dehydrated , Cled Agar , Corn Meal Agar(Dehydrated) , Cotton (500Gm Net) , Couplin Jars , Coverslip Large Size , Coverslip Small Size , Creatinine Reagent Kit (Colorimetric Mehtod) , Cromogenic Cled Agar Base , Crystal Violet , Dengue Card Test(Igm/Igg Antibody) , Dengue Card Test(Ns1 Antigen) , Deoxy Chocholate Citrate Agar , Diamond Pencil , Dil. Acetic Acid , Disposable Gloves , Disposable Scalpel Blades , Disposable Syringe With Needle 10 Ml , Disposable Syringe With Needle 20 Ml , Disposable Syringe With Needle 3Ml , Disposable Syringe With Needle 5Ml , Distilled Water , Dropping Bottles , Drum (Net) For Autoclave (11X9) , Durham Tubes , Duster Cloth , Edta Vial , Elisa Testing Kit For Dengue Nsi Antigen , Elisa Testing Kit For Hav , Elisa Testing Kit For Hev , Face Shield / Goggles , Filter Paper , Flasks 1000 Ml , Flasks 500 Ml , Formaldehyde 40% , Fungus Teasing Needle , Gas Cylinder With Regulator & Pipe , Glacial Acetic Acid , Glass Slides (1X3 Inch) , Gloves (Nitrile) M Size Disposable , Glucose Broth , Gown (Disposable) , Grams Iodine , H2so4 (100% ) Conc , Hand Washing Liquid Soap , Harris Hematoxylin , Head Cover , Hematoxylin And Eosin Stain Set , Histology Slide Trey(Not Box) , Hydrogen Peroxide (H2o2 ,3%) , Hydrochloric Acid Dilute , India Ink. , Inoculating Loop (Nichrome) , Insulin Pen , Isopropyl Alcohol , Jamshidi Bone Marrow Biopsy Needle(18G, Steel) , Jamshidi Bone Marrow Biopsy Needle(20G, Steel) , Kahns Test Tube (5Ml) , Klimas Bone Marrow Aspiration Needle(18G, Steel) , Klimas Bone Marrow Aspiration Needle(20G, Steel) , Kovacsreagent Strip , Kovacs Indole Reagent , L. J. Medium Slant (Ready To Use) , Laboratory Refrigerator (Minimum 400L) - 02 To 08 Degree Celcius , Laminar Hood , Lancet , Leishman’S Stain , Lens Cleaner , Leukart L Blocks/Molds , Liquide Paraffin , Liquor Ammonia , Lowenstein Jensen Prepared Media , Lumbar Puncture Needle(18G, Steel) , Mac Conkey Agar (Dehydrated Powder) , Mannitol Salt Agar Base , Masks (Dispoable) , Mc Cartney Bottles , Mc Intosh , Metal Rod - 48 Cm/ 20 Inch Length , Metered Dose Inhalers , Methanol 500Ml , Methylene Blue , Mbi Kit For Iodine Test , Micro Auto Pipette 10?L - 100?L , Micro Auto Pipette 100?L- 1000?L , Micro Fixed Pipette 05?L- 50?L , Micro Fixed Pipette 10?L- 100?L , Mp Card Test Kit , Muller Hinton Agar Base , Museum Jars (Size 200X150x100) , Museum Jars (Size 360X150x100) , Museum Jars(Size200x195x80) , N/10 Hcl , N-95 Mask , Nasal Sprays , Needle (Pricking) , Needle Burner & Syringe Destroyer (Electrical) , Nichrome Loop /Loop Holder , Nitric Acid 500Ml , Nuclease Free Water , Nutrient Agar Base , Nutrient Broth , Optochin Discs , Oxidase Discs , Oxidase Reagent , Paraffin , Paraffin Wax (Solid) , Parafilm , Pcr Kit (Detection) Covid -19 , Pcr Plate And Pcr Sealer , Pcr Tube And Cap Stripe , Pen , Permanent Marker (Fine Tip) , Petri Plates (Disposable) , Phenolphthalein Red Indicator , Phosphorus Reagent Kit (Colorimetric Method) , Platelet Diluting Fluid , Potassium Oxalate , Potassium Iodide , Powder Latex Gloves , Ppe Kit/Gown , Protein Reagent Kit (Colorimetric Method) , Puncture Proof Container , Rapid Pap Stain Kit , Rbc Diluting Fluid , Record File , Redbag (Bmw) , Redbucket , Register , Rna Extraction Kit (Covid -19) , Robertsons Cooked Meat Medium(Prepared) , Rotahalers , Safranin Oil , Salahs Bone Marrow Aspiration Needle(18G, Steel) , Salahs Bone Marrow Aspiration Needle(20G, Steel) , Sanitizer , Scalpel Handle No.3 , Scissor , Sda Agar(Dehydrated) , Sgot Reagent Kit (Colorimetric Method) , Sgpt Reagent Kit (Colorimetric Method0 , Sharp Container , Shoe Cover , Silver Nitrate , Silver Nitrate Solution , Simmohs Citrate Agar Base , Sodium Carbonate , Sodium Chloride , Sodium Chloride (0.9%) , Sodium Hypochloride (4%) , Sodium Hypochloride 5% , Sodium Nitroprusside , Sodium Potassium Dihydrate , Spirit Lamp , Spray Fixative , Sprit , Stand For Handling 20 Ml Test Tube , Starch Soluble (Extrapure) , Sterile Cotton Swab , Stop Watch Reading At 1/15 Second , Stopwatch , Straight Wire , Sugar (God/Pod Method) Kit , Sulphide Indole Motility Media , Sulphuric Acid Conc. , Surgical Mask , Swab Stick ( Nasopharyngeal) , Swab Stick (Oropharyngeal ) , Test Tube Rack , Test Tube Rack (16 Mm , 31 Hole ) , Test Tube Rack/Stand For Holding 10 Ml Testtubes , Test Tube Stand (12 Mm ,24 Hole) , Tips 10 Micro Liter Filter Tips (Sterile) , Tips 1000 Micro Liter Filter Tips (Sterile) , Tips 20 Micro Liter Filter Tips (Sterile) , Tips 200 Micro Liter Filter Tips (Sterile) , Tissue Embedding Cassette , Tissue Embedding Mold , Tissue Paper Roll , Transparent Tape , Triglyceride Reagent Kit (Colorimetric Method) , Triplesugar Iron Agar , Turpentine Oil , Urea Agar Base-Christensen (Dehydrate) , Urea Reagent Kit , Uric Acid Reagent , Urine Culture Pot , Vim Silverman Liver Biopsy Needle(18G, Steel) , Vtm , Vtm Stand , Watch Glass , Wbc Diluting Fluid , Westergren Pipette And Stand , Westergrens Esr Pipette , Westergrens Esr Stand , White Board Duster , White Board Marker , Widal Test Kit , Wintrobes Esr Stand , Wintrobes Esr Tube , Xld Agar , Xylene , Yellow Bag (Bmw) , Yellow Bucket (Bmw) , Zip Lock Pouch , 0.1 Ml Pcr Tube , 0.5 Mac Farland Solution , 1.5 Ml Centrifuge Tube , 2 Ml Centrifuge Tube , A 4 Size Paper
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 5
13.
Educational and Research Institute #8948032 Technical Bid
Supply Of Chemical , Reagents , Diagnostic Kit Etc-1 Isopropyl Alcohol 2.5 Lt Bottle 2 Papanicolau O.G.6 125 Ml Bottle 3 Papanicolau E.A 36 125 Ml Bottle 4 Papanicolau E.A 65 125 Ml Bottle 5 May.Grunwald Stain ( Mgg ) 100 Ml Bottle 6 Giemsa Staining 100 Ml Bottle 7 H2so4 ( Sulphuric Acid ) 500 Ml Bottle 8 Methanol 500 Ml Bottle 9 Diethy Ethyl Ether L.R 500 Ml Bottle 10 Leishman’S Stain Solution ( Cytochrome ) 500 Ml Bottle 11 Tincture Benzoin 100 Ml Bottle 12 Semen Diluting Fluid 200 Ml Bottle 13 Platelet Diluting Fluid 50 Ml Bottle 14 Chloroform 2.5 Lt Bottle 15 Wbc Diluting Fluid 50 Ml Bottle 16 Rbc Diluting Fluid 50 Ml Bottle 17 N / 10 Hcl 500Ml Bottle 18 Formaldehyde 5 Lt Bottle 19 Xylene 2.5 Lt Bottle 20 Conc. Hcl ( Hydrochloric Acid ) 500 Ml Bottle 21 Liquid Ammonia 500 Ml Bottle 22 D.P.X. 250 Ml Bottle 23 Conc.Nitric Acid 500Ml Bottle 24 Glycerine 500 Ml Bottle 25 Liquid Paraffin 500 Ml Bottle 26 Na Oh ( Sodium Hydroxide ) 500 Ml Bottle 27 Poly-L Lysine Solution 100 Ml Bottle 28 Citric Acid ( Anhydrous Pure ) 500 Ml Bottle 29 H 2 O2 ( Hydrogen Peroxide ) 100 Ml Bottle 30 Deionized Water 5 Lt. Bottle 31 Schiffs Reagent 500 Ml Bottle 32 Bendict Reagent 500 Ml 33 Drabkins Solution 5 Lit 34 Fouchet’S Reagent 200 Ml 35 Ehrlich Reagent 200 Ml 36 Methylene Blue Stain 125 Ml Bottle 37 Rapid A.F.B Stain Kit 38 Carbol Fuchsin Stain 125 Ml Bottle 39 Reticulocyte Stain ( Biolab ) 01 Packet 40 Acetone 500 Ml Bottle 41 Sodium Hypo Chloride 5 Ltr Bottle 42 Spirit 5 Ltr Bottle 43 Glucose God- Pod Kit 500 Ml 44 Glacial Acetic Acid 500 Ml Bottle 45 Hematoxylin Stain Powder ( Sd Fine ) 25Gm / 5 Gm Packet 46 Eosin Powder ( Water Soluble ) 25Gm Packet 47 Aluminum Potassium Sulphate 500 Gm Packet 48 Mercuric Oxide Red 100 Gm Packet 49 Wax 600-620 500 Gm Packet 50 Albumin Powder 500 Gm Packet 51 Periodic Acid 25 Gm Packet 52 Mercuric Oxide 25 Gm Packet 53 Dextrose ( Anhydrous ) 500 Gm Packet 54 Sulphur Powder 100 Gm 55 Barium Chloride Powder 500 Gm 56 Ammonium Sulphate 500 Gm 57 Sodium Sulphate 500 Gm 58 Sulphosalicylic Acid 500 Gm 59 Gentian Violet 100 Gm 60 Tris Buffer ( Sd Fine ) 500 Gm Packet 61 Edta 100 Gm Packet 62 Low Profile Disposable Microtome Blade For Cutting Tissue Section 63 Urine Strip ( Distix ) Packet ( 1X100 Strips ) 64 Phosphotungistic Acid 100 Gm Packet 65 Brilliant Crystal Blue Stain 100 Gm 66 Plastic Tissue Embedding Cassettes Packet ( 1X1000 Pieces ) 67 Oxalic Acid 50 Gm 68 Ferric Chloride 500 Gm 69 Sodium Thio Sulphate 500 Gm 70 Potassium Ferrocyanide 500 Gm 71 Sodium Chloride 500 Gm 72 Sodium Nitroprusside 500 Gm 73 Orthotoludine Reagent 500 Gm 74 Benzidine Powder 25 Gm 75 Diamino Benzidine 25 Gm Powder 76 Total Protein Kit 77 Albumin Kit 78 Serum Creatinine Kit 79 Serum Urea Kit 80 Serum Sgot Kit 81 Serum Sgpt Kit 82 Direct S. Bilirubin Kit 83 Serum Calcium Kit 84 Serum Alkaline Phosphate Kit 85 Serum Cholesterol Kit 86 Serum Triglyceride Kit 87 Serum Hdl Cholesterol Kit 88 Serum Uric Acid Kit 89 Tpo ( Thyroid Peroxidase Antibody ) 3 Ml Vial 90 Mouse / Rabbit Specific Polymer Hrp- Dab Ihc Detection Kit 5 Ml Vial 91 Desmin Antibody ( Ihc ) 3 Ml Vial 92 Vimentin Antibody ( Ihc ) 3Ml Vial 93 Estrogen Receptor Antibody ( Er ) 3Ml Vial 94 Anti-Progesterone Receptor Antibody 3Ml Vial 95 Anti S-100 Antibody 3Ml Vial 96 Anti Human Her2 / Neu Antibody 3Ml Vial 97 Anti Human Cytokeratin ( Pan ) Antibody Cocktail 3Ml Vial 98 Anti Melanoma Antibody ( Anti Hmb45 Antibody ) 3Ml Vial 99 Anti Neuron Specific Enolase ( Nse ) Antibody 3Ml Vial 100 Anti Cd45 Antibody 3Ml Vial 101 Anti Hpv-16 Antibody 3Ml Vial 102 Anti Cd20 Antibody 3Ml Vial 103 Anti Cd15 Antibody 3Ml Vial 104 Anti Cd30 Antibody 3Ml Vial 105 Antibody ( Anti C –Kit ) 3Ml Vial 106 Myeloperoxidase Reagent 3Ml Vial 107 Anti Ki 67 Antibody 3Ml Vial 108 Anti E Cadherin Antibody 3Ml Vial 109 Anti Cd- 34 Antibody 3Ml Vial 110 Anti P-63 Antibody 3Ml Vial 111 Anti P-53 Antibody 3Ml Vial 112 Anti Smooth Muscle Actin Antibody 3Ml Vial 113 Anti Ck -6 Antibody 3Ml Vial 114 Anti Ck -17 Antibody 3Ml Vial 115 Anti Cd-68 Antibody 3Ml Vial 116 Whatman Filter Paper Sheet 117 Coplin Jar ( Plastic ) 01 Piece 118 Tuff’S Jar ( Glass ) Piece 119 K3 Edta Vacutainar 1 X100 120 Plain Vacutainar 1 X100 121 Riya Vial ( Plastic ) 1 X100 122 Test Tube Stand ( Plastic ) Piece 123 Test Tube Holder Piece 124 Plastic Beaker 25Ml Piece 125 Plastic Beaker 100Ml Piece 126 Semen Collection Container 20 Ml ( 1X50 ) Packet 127 Urine Sample Container 50 Ml ( 1X50 ) Packet 128 Micro Tips Large ( 200- 2000 Micro Liter ) Packet ( 1X500 Pieces ) 129 Micro Tips Small ( 20- 200 Micro Liter ) Packet ( 1X1000 Pieces ) 130 Sprit Lamp 50Ml Piece 131 Plastic Dropper Piece 132 Pipette Bulb Piece 133 Glass Test Tube 7Ml, Piece 134 Glass Test Tube 10Ml, Piece 135 Glass Test Tube 20Ml Piece 136 Glass Slide ( Blue Star ) Packet 137 Cover Slip ( Blue Star ) Packet 138 Neubauer Chamber Piece 139 Glass Pipette 5 Ml 20 Micro Lit Piece 140 Glass Pipette 10 Ml 20 Micro Lit Piece 141 Glass Pipette 1 Ml 20 Micro Lit Piece 142 Micro Pipette 10 Microlitre Fix Piece 143 Micro Pipette 100 Microlitre Fix Piece 144 Micro Pipette ( 5-50 ) Microlitre Variable Piece 145 Micro Pipette 20 Microlitre Fix Piece 146 Micro Pipette 1000 Microlitre Fix Piece 147 Micro Pipette 50 Microlitre Fix Piece 148 Wintrobe Esr Tube With Stand Piece 149 Westergreen Esr Pipette With Stand Piece 150 Pricking Needile No 23 ( 1 X100 ) Packet 151 Pricking Needile No 24 ( 1 X100 ) Packet 152 Pricking Needile No 21 ( 1 X100 ) Packet 153 Pricking Needile No 20 ( 1 X100 ) Packet 154 Surgical Tray 6X8 “ Inch ( Rectangular ) Piece 155 Microscopic Slide Tray ( Aluminium ) Holding Capacity 20 ( 3X1”Inch ) Piece 156 Bone Marrow Aspiration Needle 16 No Piece 157 Bone Marrow Aspiration Needle 18 No Piece 158 L P Needle Piece 159 Histology Tissue Base Mold ( Steel ) Piece 160 Bone Marrow Biopsy Needle ( Trephine Biopsy ) Piece 161 Glass Rod Piece 162 Ph Paper Strip ( 5.0-7.5 ) Booklet ( 1X20 Strips ) 163 Ph Paper Strip ( 2.0-10.5 ) Booklet ( 1X20 Strips ) 164 Lens Cleaning Paper Booklet ( 9Cmx14.5Cm, 100 Leaves ) 165 Museum Mounting Jar ( With Cover ) ( 10Cm X 5Cm X 20Cm ) 166 Museum Mounting Jar ( With Cover ) ( 15Cm X 10Cm X 25Cm ) 167 Museum Mounting Jar ( With Cover ) ( 16.2Cm X 6Cm X 18Cm ) 168 Museum Mounting Jar ( With Cover ) ( 12Cm X 10Cm X 20Cm ) 169 Museum Mounting Jar ( With Cover ) ( 12Cm X 12Cm X 20Cm ) 170 Museum Mounting Jar ( With Cover ) ( 17Cm X 8Cm X 18Cm ) 171 Museum Mounting Jar ( With Cover ) ( 5.5Cm X 5Cm X 10Cm ) 172 Museum Mounting Jar ( With Cover ) ( 17Cm X 9.5Cm X 30Cm ) 173 Museum Mounting Jar ( With Cover ) ( 28Cm X 24Cm X 29Cm ) 174 Museum Mounting Jar ( With Cover ) ( 21Cm X 19Cm X 27Cm ) 175 Museum Mounting Jar ( With Cover ) ( 11Cm X 25Cm X 24Cm ) 176 Hiv Rapid Tridot Kit 177 Hbsag Immunoassay Rapid Kit 178 Hcv Rapid Kit, ( Fourth Generation Immunoassay For Core, Ns3, Ns4, Ns5 ) 179 Rdt For Mp Rapid Kit ( Immunochromatographic Kit For Pf / Pan Antigen ) 180 Vdrl Rapid Immunoassay Kit 181 Typhoid Rapid Kit ( Igg, Igm ) 182 Dengue Rapid Kit ( Immunochromatographic Assay For Ns1, Igg , Igm ) 183 Plain Vial 5 Ml Vial 184 Abo Rh Anti Sera 10 Ml Packet 185 Ppd Vial 5 Ml Vial 186 Sodium Citrate Vial 5 Ml Vial 187 Capillary Tube Piece 188 A.H.G. 5Ml 189 Anti A1 Lectin 5Ml 190 Anti H Lectin 5Ml 191 Anti D ( Igm + Igg Monoclonal ) 10Ml 192 Pt 5Ml 193 Aptt 3Ml 194 Calcium Chloride 10Ml 195 Bovine Albumin 5Ml 196 Hiv Rapid Kit 4Th Generation 197 Hiv Rapid Kit 3Th Generation 198 Hcv Rapid Kit, 3Th Generation 199 Hbaag Rapid Kit 4Th Generation 200 Hbaag Rapid Kit 3Th Generation 201 Hiv Elisa Kit 4Th Generation 202 Hcv Elisa Kit 4Th Generation 203 Hcv Elisa Kit 3Th Generation 204 Hbaag Elisa Kit 4Th Generation 205 Hbaag Elisa Kit 3Th Generation 206 Troniquete 207 Micro Pipette 10 Ul Fix 208 Micro Pipette 50 Ul Fix 209 Micro Pipette 25 Ul Fix 210 Micro Pipette 100 Ul Fix 211 Micro Pipette 1000 Ul Fix 212 Micro Pipette 100-1000 Ul Variable 213 Micro Pipette 10-100 Ul Variable 214 Micro Pipette 0-10 Ul Variable N 215 Micro Pipette 20-200 Ul Variable 216 Micro Pipette Stand ( Big ) Plastic Make 217 Micro Pipette Stand ( Small ) Plastic Make 218 Transfer Bag Of 300Ml 219 Double Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 220 Tripal Blood Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 221 Leucodepltion Blood Bag 350Ml ( Inline Top And Top ) 222 Leucodepltion Blood Bag 350Ml ( Lab Side ) 223 Pregnancy Kit Test 224 Cappilary Tub 225 Swab Stick 226 Benedict Reagent Quanitateive 500 Ml 227 Benedict Reagent Qualitateive 500 Ml 228 Sulphar Powder 500 Gm 229 Occult Blood Powder 100Gm 230 Hydrozen Peroxide 500Ml 231 Egg Albumin 500Gm 232 Sulphuric Acid 500Ml 233 Sodium Hydroxide 500Gm 234 Copper Sulphate 500Gm 235 Picric Acid 500Ml 236 Arcino Molibate 500Ml 237 Phaspho Tungstic Acid 500Gm 238 Sodium Carbonate 500Gm 239 Nitric Acid 500Ml 240 Silver Nitrate 25Gm 241 Hydrochloric Acid 500Ml 242 Taffers Reagent 250Ml 243 Bromo Cresol Green Reagent Box 244 Urea Kit 245 Protein Kit 246 Cholesterol Kit 247 Pipette 1Ml 248 Pipette 2Ml 249 Test Tub 250 Burette With Tip 251 Burette Stopper 252 Burette Stand 253 Filter Paper 254 Mesauring Cylinder 50Ml 255 Beaker 250Ml 256 Beaker 500Ml 257 Round Bottle Flask 200Ml 258 Conical Flask 200Ml 259 Urin Jar Plastic 260 Funnel Plastic 261 Cuvette Colouimeton 262 Dispenser Bottle 263 Amikacin 30 Mcg / Disc , 100 Disc / Vial 264 Amoxicillin Clavulanic Acid 20 / 10 Mcg / Disc , 100 Disc / Vial 265 Cefoperazone75 Mcg / Disc , 100 Disc / Vial 266 Ceftriaxone 30 Mcg / Disc , 100 Disc / Vial 267 Nitrofurantoin 300 Mcg / Disc , 100 Disc / Vial 268 Ofloxacin 5 Mcg / Disc , 100 Disc / Vial 269 Ceftazidime / Clavulanic Acid 30 / 10 Mcg / Disc , 100 Disc / Vial 270 Ciprofloxacin 5 Mcg / Disc , 100 Disc / Vial 271 Ertapenem 10 Mcg / Disc , 100 Disc / Vial 272 Gentamicin 10 Mcg / Disc , 100 Disc / Vial 273 Imipenem 10 Mcg / Disc , 100 Disc / Vial 274 Levofloxacin 5 Mcg / Disc , 100 Disc / Vial 275 Meropenem 10 Mcg / Disc , 100 Disc / Vial 276 Moxifloxacin 5 Mcg / Disc , 100 Disc / Vial 277 Prulifloxacin 5 Mcg / Disc , 100 Disc / Vial 278 Vancomycin 30 Mcg / Disc , 100 Disc / Vial 279 Azithromycin 15 Mcg / Disc , 100 Disc / Vial 280 Chloramphenicol 30 Mcg / Disc , 100 Disc / Vial 281 Piperacillin / Tazobactam 100 / 10 Mcg / Disc , 100 Disc / Vial 282 Tobramycin 10 Mcg / Disc , 100 Disc / Vial 283 Tetracycline 30 Mcg / Disc , 100 Disc / Vial 284 Cefotaxime 30 Mcg / Disc , 100 Disc / Vial 285 Fluconazole 10 Mcg / Disc , 100 Disc / Vial 286 Amphotericin B 100 Units / Disc , 100 Disc / Vial 287 Itraconazole 30 Mcg / Disc , 100 Disc / Vial 288 Nystatin 100 Units / Disc , 100 Disc / Vial 289 Voriconazole 1Mcg / Disc , 100 Disc / Vial 290 Co-Trimoxazole 25 Mcg / Disc , 100 Disc / Vial 291 Clindamycin 2 Mcg / Disc , 100 Disc / Vial 292 Teicoplanin 30 Mcg / Disc , 100 Disc / Vial 293 Cefdinir 5 Mcg / Disc , 100 Disc / Vial 294 Cefpirome 30 Mcg / Disc , 100 Disc / Vial 295 Imipenem –Cilastin 10 Mcg / Disc , 100 Disc / Vial 296 Ampicillin 2 Mcg / Disc , 100 Disc / Vial 297 Polymyxin-B 100 Unit / Disc , 100 Disc / Vial 298 Bacitracin 8 Unit / Disc , 100 Disc / Vial 299 Cefoxitin 200 Mcg / Disc , 100 Disc / Vial 300 Linezolid 30 Mcg / Disc , 100 Disc / Vial 301 Gentamicin ( High ) 50 Mcg / Disc , 100 Disc / Vial 302 Faropenem 5 Mcg / Disc , 100 Disc / Vial 303 Doxycycline 10 Mcg / Disc , 100 Disc / Vial 304 Aztreonam 50 Mcg / Disc , 100 Disc / Vial 305 Fosfomycin 50 Mcg / Disc , 100 Disc / Vial 306 Novobiocin 30 Mcg / Disc , 100 Disc / Vial 307 Optochin 5 Mcg / Disc , 100 Disc / Vial 308 Cefuroxime 30 Mcg / Disc , 100 Disc / Vial 309 Minocyline 30 Mcg / Disc , 100 Disc / Vial 310 Nalidixicacid 30 Mcg / Disc , 100 Disc / Vial 311 Norfloxacin 10 Mcg / Disc , 100 Disc / Vial 312 Tigecycline 15 Mcg / Disc , 100 Disc / Vial 313 Clarithromycin 15 Mcg / Disc , 100 Disc / Vial 314 Ketoconazole 30 Mcg / Disc , 100 Disc / Vial 315 Vancomycin ( E Test Strip ) 0.5 – 32 Mcg / Ml 316 Cefepime / Cefepime+Clavulanic Acid ( E Test Strip ) Cefepime ( 0.25-16Mcg ) / Cefepime+Clavulanic Acid ( 0.064-4 Mcg ) 317 Imipenem And Imipenem + Edta ( E Test Strip ) Imipenem ( 4-256 Mcg ) And Imipenem+ Edta ( 1-64 Mcg ) 318 Macconkey Agar 500G / Bottle 319 Muller-Hinton-Agar 500G / Bottle 320 Chrome Universal Agar 500G / Bottle 321 Lugol’S Iodine 125 Ml / Bottle 322 Urea Agar Base 100G / Bottle 323 Simmons Citrate Agar 100G / Bottle 324 Triple Sugar Iron Agar 100G / Bottle 325 Blood Agar Base 500G / Bottle 326 Robertson Cooked Meat Media 500G / Bottle 327 Sucrose 500G / Bottle 328 Lactose ( Lr ) 500G / Bottle 329 Mannitol ( C6h14c6 ) 500G / Bottle 330 Peptone, 500G / Bottle 331 Dextrose Anhydrous ( C6h12o6 ) 500G / Bottle 332 Bile Esculin Reagent / Agar 500G / Bottle 333 Methylene Blue For Zn Stain 500Ml / Bottle 334 Carbol Fuchsin For Zn Stain 500Ml / Bottle 335 Giemsa Stain 500Ml / Bottle 336 Periodic Acid Schiff Stain 500Ml / Bottle 337 Safranine For Zn Stain 500Ml / Bottle 338 Gentian Violet ( Crystal ) 100G / Bottle 339 Phenol ( C6h5oh ) ( Crystal ) 500G / Bottle 340 Methyl Red Reagent 500G / Bottle 341 Phenyl Pyruvic Acid ( Ppa Test ) 100G / Bottle 342 Prepared Oxidase Disc 50 Disc / Box 343 Iodine ( Crystal ) 100G / Bottle 344 Tri-Sodium Citrate ( Na3c6h5o72h2o ) 500G / Bottle 345 Citric Acid ( C6h8o7 ) 500G / Bottle 346 Kovac’S Indole Reagent 100Ml / Bottle 347 40 % Urea ( Nh2conh7 ) 500G / Bottle 348 Antibiotic Zone Scale 1Pc / Box 349 Antisera-Salmonella O And H A, 2 Ml / Vial 350 Antisera-Shigella Dysenteriae, 2 Ml / Vial 351 Antisera-Shigella Flexnari, 2 Ml / Vial 352 Antisera-Shiegella Sonnie, 2 Ml / Vial 353 Antisera-Vibrio Cholera O139 , 2 Ml / Vial 354 Atcc Strain - E.Coli 25922, Freeze Dried Lyophilized / Vial 355 Atcc Strain - E.Coli 35218, Freeze Dried Lyophilized / Vial 356 Atcc Strain - Pseudomonas Aeruginosa 27853 Freeze Dried Lyophilized / Vial 357 Atcc Strain - Staphylococcus Aureus 25923 Freeze Dried Lyophilized / Vial 358 Atcc Strain - Staphylococcus Aureus 29213 Freeze Dried Lyophilized / Vial 359 Mounted Peripheral Blood Smear Slides For Gametocytes Of Plasmodium Vivax And Falciparum, ( 1 – Slide ) 360 Potassium Permagnate ( Kmno4 ) 500G / Bottle 361 Formalin ( 20% ) 500Ml / Bottle 362 Methanol ( Ch3oh ) 500Ml / Bottle 363 Acetone ( Lr ) ( Reagent ) 500Ml / Bottle 364 100 % Sulphuric Acid ( H2so4 ) 500Ml / Bottle 365 Gram’S Iodine 500Ml / Bottle 366 Boric Acid 500G / Bottle 367 Di- Sodium Hydrogen Ortho-Phosphate 500G / Bottle 368 Formaldehyde Solution ( 37-41 ) % 1000Ml / Bottle 369 Potassium Iodide ( Ki ) 500G / Bottle 370 Hydrogen Peroxide Solution ( H2o2 ) 6% 1000Ml / Bottle 371 Sodium Hydroxide Pellets Purified ( Naoh ) 500G / Bottle 372 Potassium Hydroxide Pellets ( Koh ) 500G / Bottle 373 Sodium Chloride ( Nacl ) 500G / Bottle 374 Amyl Alcohol ( C5h11oh ) 500Ml / Bottle 375 Xylene Sulphur 500Ml / Bottle 376 70 % Isopropyl Alcohol 500Ml / Bottle 377 Normal Saline 500Ml / Bottle 378 Digital Weighing Balance 24Kg / Machine 379 Test Tube ( Glass 7Ml ) 100Pc / Pkt 380 Sterile Swab Stick, 100Pc / Pkt 381 Test Tube Holder ( Small ) 10Pc / Box 382 Test Tube Holder ( Large ) 10Pc / Box 383 Petri Disk 90X90 ( 10Pc / Pkt ) 384 Petri Disk 90X120, ( 10Pc / Pkt ) 385 Stock Vial ( 50Pc / Pkt ) 386 Sterile Disposable Square Petri Plates ( 10Pc / Pkt ) 387 Viral Transport Medium ( 3Ml / Vial ) 388 Kovac’S Indole Reagent 100 Ml / Bottle 389 Centrifuge Tubes 50Ml ( Glass ) 100Pc / Box 390 Centrifuge Tubes 15Ml ( Glass ) ( Consumable ) 100Pc / Box 391 Erlenmeyer Flask ( 1000Ml ) ( Consumable ) 1Pc 392 Microtube Rack ( 5X16 Holes ) Per Rack 393 Wash Bottle Capacity 500Ml / Pc 394 Sterile Disposable Forceps ( 10Pc / Pack ) 395 Steam Indicator Tape Size 18Mm ( 1-Pc ) 396 Autoclavable Dispo Bag “14” ( 50 / Pack ) 397 Indicator Ph Paper ( Ph 5 To 7.5 ) ( 5 Bundle / Pack ) 398 Permanent Marker Pen ( Red / Black ) ( Narrow Tip ) ( 1-Pc ) 399 Homogeniser With Serrated Pestle S.P 10Ml ( 1-Pc ) 400 Nichrome Loop 4Mm, Double Wound ( 10Pc / Pack ) 401 Nichrome Loop 2Mm, Double Wound ( 10Pc / Pack ) 402 Semisolid Imrv Medium And Selective Supplement Fd19 -2Vl, 500Gm / Bottle 403 Sample Discarding Jar 3L Capacity ( Borosil ) ( 1-Pc ) 404 Sample Discarding Jar 5L Capacity ( Borosil ) ( 1-Pc ) 405 Conical Flask 500Ml Capacity ( Borosil ) ( 1-Pc ) 406 Kala-Azar Detection Rapid Test ( 25Kit / Box ) 407 Blood Culture Bottle / Bhi ( Paediatric ) 20Ml Capacity ( 10Pc / Box ) 408 Blood Culture Bottle / Bhi ( Adult ) 70Ml Capacity ( 10Pc / Box ) 409 India Ink Reagent ( Nigrosin Stain 10% W / V ( 100 Ml ) And Methylene Blue ( 125Ml / Bottle ) 410 Scrub Typhus Igm Elisa 96 Well Test Kit / Box 411 Chikungunya Igm Elisa 96 Well Test Kit / Box 412 Je Igm Capture Elisa 96 Well Test Kit / Box 413 Dengue Igm Elisa 96 Well Test Kit / Box 414 Dengue Ns-1 Ag Elisa 96 Well Test Kit / Box 415 Cryptococcal Ag Rapid Test ( 25Kit / Box ) 416 L J Medium Slant 10 Slant / Pack 417 Capped Collection Tube 1.5Ml Capacity ( 50Pc / Box ) 418 Microamp Optical Tube 8 / Strips ( 0.2 Ml Capacity ) 419 Microamp Optical 8 Cap Strips ( 0.2 Ml ) 420 Micro Centrifuge Tube 1.5Ml Capacity ( 500Pc / Box ) 421 Serological Pipette 10Ml ( 200Pc / Box ) 422 Serological Pipette 5Ml ( 250Pc / Box ) 423 Art Barrier Specialty Pipette Tips 1000Μl Racked ( 96X1 Box ) 424 Art Barrier Specialty Pipette Tips 20-200Μl Racked ( 96X1 Box ) 425 Art Barrier Specialty Pipette Tips 2-20Μl Racked ( 96X1 Box ) 426 Art Barrier Specialty Pipette Tips 50Μl Racked ( 96X1 Box ) 427 Art Barrier Specialty Pipette Tips 0-10Μl Racked ( 96X1 Box ) 428 Safeskin Purple Nitrile Gloves ( Medium ) 100 / Box 429 N95 Particulate Respirator ( Niosh Approved ) 1Pc 430 Kimwipes 37.33X42.16 Cmn ( 140 / Box ) 431 Cryo Vial Sterile 1.8Ml ( 25Vial / Pkt ) 432 Cryo Box 1.8Ml ( 9X9 Wells ) ( 1 X 4 / Box ) 433 Fg-Optical Adhesive Covers For Pcr, 1Pc 434 Microamp Optical 96-Well Reaction Plate ( 0.2Ml ) , ( 1- Plate ) 435 Zip Lock Bag 21.3X18cm ( 10Bag / Box ) 436 384 Well Pcr Plate, ( 1- Plate ) 437 Falcon Tube 10Ml ( 1Pc ) 438 Falcon Tube 50Ml ( 1Pc ) 439 Dacron Swab Stick ( Nylon Flocked ) ( 100Pc / Box ) 440 Polypropylene Trigger Sprayers ( 500Ml ) , 1Pc 441 Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( Size 11 X 8 Inch ) , 1Pc 442 Paraffin Film ( M ) ( 1-Roll ) 443 Red Cap Tube 3Ml ( 1-Pc ) 444 Aluminum Foil ( 72 Meter ) ( 1-Pc ) 445 Isopropanol 99.9% ( 500Ml / Bottle ) 446 Spirit Surgical Grade ( 1Lt / Bottle ) 447 Spirit Absolute ( 40 Lt / Gallon ) 448 Hypochlorite Soln ( 5% / 4.6% ) ( 1Lt / Bottle ) 449 Sterilium Hand Rub ( 500Ml / Bottle ) 450 Liquid Hand Wash ( 750Ml / Pack ) 451 Blotting Paper ( 1-Sheet ) 452 Tourniquets For Blood Collection ( 1-Pc ) 453 Loose Gloves M ( 7 / 7.5 ) ( 100 / Box ) 454 Surgical Gloves M ( 7 / 7.5 ) , ( 1-Pc ) 455 3 Ply Surgical Mask , ( 1-Pc ) 456 Surgical Head Cap, ( 1-Pc ) 457 Face / Protective Shield , ( 1-Pc ) 458 Bleaching Powder ( 25Kg / Bag ) 459 Protective Goggles ( 1-Pc ) 460 Rna Extraction Kit ( 1-Rxn ) 461 Rna Zap Water 200Ml / Bottle 462 Ethanol Absolute Molecular Grade ( 500Ml / Bottle ) 463 Thermacol Transport Box ( 18Cm X 12 Cm ) ( 500Pc / Bag ) 464 Tissue Paper ( Toilet Paper Roll ) ( 9Pc / Pack ) 465 Labeling Stickers Sheets ( St-65A4 ) ( 100Sheets / Pack ) 466 Disposable Tongue Depressor ( Spatula ) ( 100Pc / Pack ) 467 Nuclease Free Water ( Molecular Grade ) 1000Ml / Pack 468 Glucose Strip 469 Taqpath Multiplex Rt Pcr Kit For The Detection Sars Cov-2 1000 Rxn 470 Taqman Sequence Detection ( Primer + Probe ) For Screening ( E Gene & Rnp ) And Confirmatory ( Rdrp, & Hku Orf Ib ) 471 Seegene Allplex 2019-Ncov Assay R 472 Mylab Patho Detect Covid-19 Qualitative Pcr Kit 473 A*Star Fortitued Kit 2.0 Covid-19 Rt-Pcr Test 474 Pandemic H1n109 Assay Set 1000 Rxn 475 Super Script Iii Platinum Qrt Pcr Reagent 5 Rxn 476 Agpath One Step Rt Pcr Reagent 477 Labgun Covid-19 Rt Pcr Kit 478 Bgi Rt Pcr Kit For Detection Sars Cov-2 479 1-Napthol 200 Gm 480 2, 4-Dinitrophenyl Hydrazine 300 Gm 481 2-Amino Diphenyl Oxalic Acid 500 Gm 482 2-Chloro-2H-Azirine 500 Gm 483 2-Napthol 250 Gm 484 3, 5- Dinitrosalicylic Acid 500 Gm 485 8-Hydroxy Quinoline 250 Gm 486 Absolute Ethanol 10 Lit 487 Acacia 500 Gm 488 Acetaldehyde 500 Ml 489 Acetamide 500 Gm 490 Acetanilide 1 Kg 491 Acetic Acid 10 Lit 492 Acetic Anhydride 2.5 Lit. 493 Acetone 05 Lit 494 Acetonitrile 05 Lit 495 Acetophenone 500Ml 496 Acetyl Acetone 1 Lit 497 Acetylcholine Iodide 5Gm 498 Activated Charcoal 1Kg 499 Agar 500Gm 500 Alcohol / Spirit 25Lit 501 Almond Oil 1Lit 502 Aloe Vera Gel 1Kg 503 Alpha-Amylase 100Gm 504 Alpha-Napthol 250Gm 505 Aluminium Chloride 1Kg 506 Aluminium Hydroxide 500Gm 507 Aluminium Sulphate 500Gm 508 Amaranth Red 100Gm 509 Amino Acid Kit 510 Ammonia 10 Lit 511 Ammonium Acetate 1Kg 512 Ammonium Bicarbonate 500Gm 513 Ammonium Carbonate 1Kg 514 Ammonium Chloride 1Kg 515 Ammonium Citrate ( Tri ) 500Gm 516 Ammonium Hydroxide 1Kg 517 Ammonium Molybdate 500Gm 518 Ammonium Nitrate 1Kg 519 Ammonium Oxalate 500Gm 520 Ammonium Reineckate 1Kg 521 Ammonium Sulphate 1Kg 522 Amyloglucosidase 50Ml 523 Anhydrous Sodium Sulfite 1Kg 524 Aniline 5Lit 525 Aniline Acetate 500Gm 526 Anthranilic Acid 250Gm 527 Apple Essence 50Ml 528 Arachis Oil 500Ml 529 Arsenic Trioxide 500Gm 530 Ascorbic Acid 500Gm 531 Ashwagandha 500Gm 532 Aspartic Acid 100Gm 533 Aspirin 1Kg 534 Atropine Sulphate 10Ml 535 Atropine Sulphate 25Gm 536 Bahera 1Kg 537 Barfoed’S Reagent 1Lit 538 Barium Chloride 1Kg 539 Barium Sulphate 500Gm 540 Bay Leaf 500Gm 541 Beef Extract 500Gm 542 Beeswax 2Kg 543 Belladonna Leaf Dry 500Gm 544 Benedict’S Reagent 1 Lit 545 Bentonite Powder 1Kg 546 Benzaldehyde 5 Lit 547 Benzamide 1Kg 548 Benzene 2.5 Lit 549 Benzidine 500 Gm 550 Benzil 1Kg 551 Benzoic Acid 5Kg 552 Benzoic Anhydride 500Gm 553 Benzoin 500Gm 554 Benzothiazole 250Gm 555 Benzoyl Chloride 4 Lit 556 Benzyl Alcohol 2.5 Lit 557 Benzylpenicillin 250Gm 558 Bial’S Reagent 1Lit 559 Blood Group Test Kit ( 10 Ml Anti A, B & D ) 560 Borax 1Kg 561 Boric Acid 500Gm 562 Bovine Serum Albumin 10Gm 563 Bramhi 500Gm 564 Brilliant Blue 5Gm 565 Bromine 500Ml 566 Bromocresol Green Solution 250Ml 567 Butanol 2.5 Lit 568 Butyl Isocyanate 500 Gm 569 Cadmium Sulfate 5Gm 570 Caffeine 500Gm 571 Calamine 1Kg 572 Calcium Chloride Anhydrous 2.5Kg 573 Calcium Gluconate 500Gm 574 Calcium Hydroxide 5Kg 575 Camphor 250Gm 576 Carbolfuchsin 100Gm 577 Carbon Tetrachloride 2.5 Lit 578 Cardamom 250 Gm 579 Carrageenan 500Gm 580 Castor Oil 2.5 Lit 581 Catechol 500Gm 582 Cellulose Acetate Hydrogen Phthalate 500Gm 583 Ceric Ammonium Sulphate 500Gm 584 Cetyl Alcohol 500Gm 585 Chandan Powder 500Gm 586 Charcoal 500Gm 587 Chloral Hydrate 500Gm 588 Chloroform 10 Lit 589 Chloroquine Powder 250Gm 590 Chlorosulfonic Acid 1 Lit 591 Chlorpheniramine Maleate Powder 250Gm 592 Chlorpromazine 250Gm 593 Cinchona 500 Gm 594 Cinnamic Acid 250 Gm 595 Cinnamon 500 Gm 596 Citric Acid 500 Gm 597 Clove 500 Gm 598 Cobalt Chloride 500 Gm 599 Cocoa Butter 200 Gm 600 Codeine Phosphate 50 Gm 601 Compound Tartrazine Solution 100Gm 602 Copper ( Ii ) Acetate 2.5Kg 603 Copper ( Ii ) Oxide 1Kg 604 Copper ( Ii ) Sulphate 1Kg 605 Copper ( Metal ) Turning 500Gm 606 Copper Sulfate 1Kg 607 Coriander 500Gm 608 Corn Oil 500Ml 609 Corn Starch 500Gm 610 Creatinine 100Gm 611 Crystal Violet 500Ml 612 Cupric Acetate 500Gm 613 Dapsone Powder 250Gm 614 Dextrin 500Gm 615 Dextrose 1Kg 616 Dichloro Methane 5Lit 617 Diethyl Ether 10Lit 618 Diethylmalonate 500Ml 619 Dioscorea 250Gm 620 Diphenylamine 500Gm 621 Disodium Edta 500Gm 622 Disodium Phosphate Heptahydrate 1Kg 623 Dmso 5Lit 624 Dragendroff’S Reagent 1Lit 625 Ephedra 500Gm 626 Eriochrome Black T ( Solochrome Black T ) 25Gm 627 Ethanol 10Lit 628 Ethyl Acetate 5Lit 629 Ethyl Acetoacetate 5Lit 630 Ethyl Benzoate 500Ml 631 Ethyl Cellulose 500Gm 632 Ethylene Diamine Tetra Acetic Acid ( Edta ) 2Kg 633 Eucalyptus Oil 500Ml 634 Eudragit 500Gm 635 Fehling’S Solution A 2Lit 636 Fehling’S Solution B 2Lit 637 Ferric Ammonium Sulphate 1Kg 638 Ferric Chloride 500Gm 639 Ferric Chloride 1Kg 640 Ferrous Sulphate 500Gm 641 Formaldehyde 5Lit 642 Formic Acid 5Lit 643 Fructose 1Kg 644 Furosemide 25Gm 645 Gelatin 1Kg 646 Glacial Acetic Acid 5Lit 647 Glucose 1Kg 648 Glycine 1Kg 649 Glycine 100Gm 650 Glyoxalic Acid 1Lit 651 Granulated Zinc 500Gm 652 Gum Trgacanth Powder 1Kg 653 Hagers Reagent 1Lit 654 Harde 500Gm 655 Histamine 25Gm 656 Honey 1Kg 657 Hydrazine Hydrate 2.5 Lit 658 Hydrochloric Acid 10Lit 659 Hydrogen Peroxide 1 Lit 660 Hydroxy Napthol Blue 25Gm 661 Hydroxy Propyl Methyl Cellulose 500Gm 662 Hydroxylamine Hydrochloride 500Gm 663 Ibuprofen Powder 500Gm 664 Iodine 500Gm 665 Iron Oxide 500Gm 666 Isabgol 1Kg 667 Iso Propanolol 2.5 Lit 668 Isoniazid Powder 250Gm 669 Jatamansi 500Gm 670 Kaolin 500Gm 671 Lactose 1Kg 672 Lanolin 1Kg 673 Lead Acetate 1Kg 674 Lead Nitrate 500Gm 675 Lead Subacetate 2Lit 676 Leishman Reagent In Methanol 25Gm 677 Lemon Essential Oil 250Ml 678 Leucine 25Gm 679 Light Magnesium Oxide 500Gm 680 Light Mineral Oil 5Lit 681 Light Petroleum Ether ( 40 -600 ) 2.5 Lit 682 Liquid Paraffin ( Heavy ) 500Ml 683 Liquid Paraffin ( Light ) 500Ml 684 Liquorice 500Gm 685 Long Pepper 500Gm 686 Lwinoff’S Reagent 1 Lit 687 Magnesium Chloride 1Kg 688 Magnesium Hydroxide 500Gm 689 Magnesium Stearate 2Kg 690 Magnesium Sulfate 2Kg 691 Magnesium Turning 250Gm 692 Malonic Acid 1Kg 693 Maltose 1Kg 694 Mayer’S Reagent 1Lit 695 Menthol 500Gm 696 Mercuric Chloride 50Gm 697 Mercurous Nitrate 25Gm 698 Metaphosphoric Acid 1Kg 699 Methanol 10 Lit 700 Methi 500Gm 701 Methyl Blue 25Gm 702 Methyl Cellulose 500Gm 703 Methyl Ethyl Ketone 1 Lit 704 Methyl Orange 100Gm 705 Methyl Orange Indicator 250Ml 706 Methyl Paraben 500Gm 707 Methyl Red 25Gm 708 Methyl Red 500Ml 709 Methyl Salicylate 500Ml 710 Methylene Blue 500 Ml 711 Methylene Chloride 2.5 Lit 712 Metol Solution 100 Ml 713 Metronidazole Powder 250 Gm 714 Microcrystalline Cellulose 1 Kg 715 Millon’S Reagent 1 Lit. 716 Mineral Oil 500 Ml 717 Molisch Reagent 100 Ml 718 Monosodium Phosphate 1 Kg 719 Morpholino Propane Sulphonic Acid ( Mops ) 25 Gm 720 Nagkeshara 500 Gm 721 Napthol Blue 25 Gm 722 Napthoquinone 100 Gm 723 N-Hexane 5 Lit 724 Ninhydrin 100 Gm 725 Nitric Acid 10 Lit 726 N-Phenylanthranilic Acid ( Ferroin Sulphate ) 100 Ml 727 O-Cresol 500 Ml 728 Octanol 2.5 Lit 729 Oil Of Anise 30 Ml 730 Olive Oil 1 Lit 731 O-Phenylenediamine 250 Gm 732 Orange Oil 500 Ml 733 Orthophosphoric Acid 2.5 Lit 734 Osmic Acid 500 Gm 735 Oxalic Acid 500 Gm 736 O-Xylene 500 Ml 737 P-Aminobenzoic Acid 1 Kg 738 Para Amino Benzoic Acid ( Paba ) 250 Gm 739 Paracetamol Powder 500 Gm 740 Paraffin Liquid Heavy 5 Lit. 741 Paraffin Liquid Light 5 Lit. 742 P-Benzoquinone 100 Gm 743 P-Chloromercuribenzoic Acid 1 Kg 744 Peg 200 2.5 Lit 745 Peg 3350 500 Gm 746 Peg 400 500 Ml 747 Peg 400 2.5 Lit 748 Peg 6000 500 Gm 749 Peptone Soya 500 Gm 750 Perchloric Acid 2.5 Lit 751 Petroleum Ether 5 Lit 752 Phenobarbitone 10 Gm 753 Phenol 1 Kg 754 Phenophthaline Indicator 755 Phenyl Hydrazine Hydrochloride 500 Gm 756 Phenylalanine 25 Gm 757 Phloroglucinol 250 Gm 758 Phosphoric Acid 1 Kg 759 Physostigmine 10 Gm 760 Picric Acid 500 Gm 761 Picrolonic Acid 500 Gm 762 Pine Oil 250 Ml 763 Pineapple Flavour 100 Ml 764 Piper Longum Fruit 500 Gm 765 Piper Longum Root 500 Gm 766 Piperazine Citrate 500 Gm 767 Plumbagoo Zeylanica 500 Gm 768 Potassium Dichromate 2 Kg 769 Potassium Bromide 2 Kg 770 Potassium Chloride 2 Kg 771 Potassium Dihydrogen Phosphate 500 Gm 772 Potassium Ferricyanide 1 Kg 773 Potassium Ferrocyanide 1 Kg 774 Potassium Hydrogen Phthalate 1 Kg 775 Potassium Hydroxide 2 Kg 776 Potassium Iodide 500 Gm 777 Potassium Permanganate 500 Gm 778 Potassium Sodium Tartrate 500 Gm 779 Potassium Sulphate 1Kg 780 Precipitated Chalk 500 Gm 781 Precipitated Sulphur 500 Gm 782 Propanol 2.5 Lit 783 Propyl Glycol 1 Kg 784 Propyl Paraben 500 Gm 785 Propylene Glycol 2.5 Lit 786 P-Toluene Sulfonylamide 500 Gm 787 P-Toluene Sulphonic Acid 2.5 Lit 788 Pyridine 2.5 Lit 789 Quinine Sulphate 100 Gm 790 Rbc Diluting Fluid 500 Ml 791 Rectified Sprit 5 Lit 792 Resorcinol 2 Kg 793 Rose Oil 500 Ml 794 Ruthenium Red 5 Gm 795 Saccharin Sodium 500 Gm 796 Safranine 500 Ml 797 Salicylic Acid 1 Kg 798 Seliwanoff’S Reagent 500 Ml 799 Senna Leaves 500 Gm 800 Sesame Oil 2.5 Lit 801 Shakhpushpi 500 Gm 802 Shatavari 500 Gm 803 Silica Gel 100-200 Mesh ( For Column Chromatography ) 2 Kg 804 Silica Gel 60-120 Mesh ( For Column Chromatography ) 2 Kg 805 Silica Gel G 5 Kg 806 Silver Nitrate 25 Gm 807 Sodium Acetate 1 Kg 808 Sodium Arsenate Dibasic 100 Gm 809 Sodium Benzoate 1 Kg 810 Sodium Bicarbonate 5 Kg 811 Sodium Bisulfate 500 Gm 812 Sodium Carbonate 2 Kg 813 Sodium Chloride 5 Kg 814 Sodium Citrate 2 Kg 815 Sodium Dihydrogen Phosphate 1 Kg 816 Sodium Dodecyl Sulphate 5 Kg 817 Sodium Formate 500 G 818 Sodium Hydroxide 2.5 Kg 819 Sodium Metal 500 Gm 820 Sodium Methyl Paraben 500 Gm 821 Sodium Nitrite 1 Kg 822 Sodium Nitropruside 1 Kg 823 Sodium Oxalate 500 Gm 824 Sodium Phosphate Dibasic 1 Kg 825 Sodium Phosphate Monobasic 1 Kg 826 Sodium Picrate 500 Gm 827 Sodium Potassium Tartarate 500 Gm 828 Sodium Propyl Paraben 250 Gm 829 Sodium Salicylate 500 Gm 830 Sodium Succinate 500 Gm 831 Sodium Sulfate 1 Kg 832 Sodium Thiocyanate 500 Gm 833 Sodium Thiosulfate 500G 834 Sodium Tungstate 250 Gm 835 Soft Soap 1 Kg 836 Solochrome Black T 25 Gm 837 Sorbitol Solution ( 70% ) 250 Gm 838 Spermaceti 500 Gm 839 Standard Cholesterol 25 Gm 840 Starch 2 Kg 841 Stearic Acid 1 Kg 842 Strong Ammonium Solution 2.5 Lit 843 Sucrose 2 Kg 844 Sudan Red Iii 5 Gm 845 Sugar 2 Kg 846 Sulfanilamide 500 Gm 847 Sulfuric Acid 15 Lit 848 Sulphamic Acid 500 Gm 849 Sulphanilic Acid 500 G 850 Sulphosalicylic Acid 500 Gm 851 Sulphur 1 Kg 852 Talc 2 Kg 853 Tannic Acid 1 Kg 854 Tartaric Acid 1 Kg 855 Tartrazine Yellow 25 Gm 856 T-Butyl Alcohol 1 Lit 857 Tetracycline Hydrochloride 250 Gm 858 Thioglycollic Acid 500 Ml 859 Thiourea 500 Gm 860 Thymol Blue 25 Gm 861 Titanium Dioxide 500 Gm 862 Toluene 5 Lit 863 Tragacanth 1 Kg 864 Triethanol Amine 2.5 Lit 865 Trisodium Citrate, Dihydrate 500 Gm 866 Turpentine Oil 300 Ml 867 Tween 80 500 Gm 868 Tyrosine 100 Gm 869 Urea 1 Kg 870 Uric Acid 25 Gm 871 Vanillin 100 Gm 872 Vegetable Oil 1 Lit 873 Wagners Reagent 1 Lit. 874 Wbc Diluting Fluid ( Turks Fluid ) 500 Ml 875 White Ointment 1 Kg 876 White Wax 500 Gm 877 Xylenol Orange 10 Gm 878 Yellow Soft Paraffin 500 Gm 879 Zinc Dust 500 Gm 880 Zinc Oxide 2 Kg 881 Zinc Stearate 1 Kg 882 Zinc Sulfate 1 Kg 883 Zinziber Officinalis 500 Gm 884 Air Condenser 300 Mm ( With Joint B-19 Or B-24 And Plain Without Joint ) 885 Ampoules 886 Arsenic Test Apparatus 887 Beaker 100Ml 888 Beaker 250Ml 889 Beaker 500Ml 890 Beaker 1000Ml 891 Boiling Tubes 892 Borer Dia. 8Mm, Thickness 3Mm , Length 99 893 Buchner Funnel Ceramic And Plastic 70Mm 894 Buchner Funnel Ceramic And Plastic 110 Mm 895 Buchner Flask 250Ml 896 Buchner Flask 500Ml 897 Burette Stand 898 Burette With Rota Flow Stop Cock 899 Capillaries For Melting Point Determination 900 Centrifugal Tube Graduated 901 Centrifugal Tube Plain 902 China Dish 903 Clavenger Apparatus 904 Column For Column Chromatography 905 Conical Flask 100 Ml 906 Conical Flask 250Ml 907 Cover Slips 908 Dessicator Plain 150 Mm 909 Dessicator Plain 250 Mm 910 Distillation Flask Bg 911 Distillation Set ( Condenser Reciever ) 912 Distillation Unit 913 Droppong Bottle 60 Ml 914 Droppong Bottle 125 Ml 915 Eppindroff 1.5 Ml 916 Eppindroff 2.0 Ml 917 Erlenmeyer Flask 918 Filter Paper Rim 8X22 919 Flat Bottom Flask ( 100 And 250 ) 920 Flilter Paper Pkt Round 921 Funnel ( Small, Medium And Large Size ) 922 Glass Rod 923 Glass Slides 924 Graduated Measuring Cylinder 10Ml 925 Graduated Measuring Cylinder 50Ml 926 Graduated Measuring Cylinder 100Ml 927 Graduated Measuring Cylinder 500Ml 928 Graduated Measuring Cylinder 1000 Ml 929 Ignition Tube ( Pkt Of 5 Grs, Superior Quality ) 930 Iodine Flask 931 Kipps Apparatus 932 Lens Cleaning Tissue ( Paper Book Of 100 ) 933 Litmus Paper Red / Blue Pkt Of 100 Lbs 934 Microtips 935 Mortar Pastel ( Dia 5, 6 And 8 ) 936 Nessler Cylinder ( 50 Ml ) 937 Ostwald Viscometer 938 Petridish 100 Mm 939 Petridish 75Mm 940 Ph Paper In Plastic Box Pkt Of 100 Lbs 941 Pipette Bulb Rubber 942 Pipette Pump 2 Ml 943 Pipette Pump 25Ml 944 Pipette Pump 10Ml 945 Pipette Stand Horizontal For 12 Pipettte 946 Pipette Volumetric 20Ml 947 Pipette Volumetric 10Ml 948 Pipette Volumetric 25Ml 949 Pipettes 1Ml 950 Pipettes 2Ml 951 Pipettes 5Ml 952 Pipettes 10Ml 953 Plane Slide With Cavity 954 Reagent Bottle Narrow Mouth Amber 500 Ml 955 Reagent Bottle Narrow Mouth Amber 125Ml 956 Reagent Bottle Narrow Mouth Amber 250Ml 957 Round Bottom Flask ( 250 Ml ) 958 Round Bottom Flask ( Double And Triple Neck ) 959 Rubber Cork ( Extra Soft ) Superior Quality ( Top Dia 13Mm ) 960 Rubber Tubing Coil ( 10 Meter ) 961 Separating Funnel 250 Ml 962 Separating Funnel 100Ml 963 Silica Crucibles 15 Mm 964 Soxhlet Apparatus Complete With All Capacity 965 Specific Gravity Bottle N.G. 25 Ml 966 Specific Gravity Bottle N.G. 50 Ml 967 Starch Iodine Paper 100 Leaves 968 Steam Distillation Assembly 969 Stoppered Tubes 970 Suction Pump Made Of Glass 971 Test Tube 972 Test Tube Holder 973 Test Tube Stand 974 Thermometer 30 Cm Length ( 10-360 Degree ) 975 Thiele`S Tube 976 Tlc Chamber With Lid 977 Tlc Plates 978 Tlc Sprayer 979 Volumetric Flask 10Ml 980 Volumetric Flask 25Ml 981 Volumetric Flask 100Ml 982 Volumetric Flask 250Ml 983 Volumetric Flask 1000Ml 984 Wash Bottle 250 Ml 985 Watch Glass 986 Whatman Filter Paper For Paper Chromatography 987 White Tiles 988 Wire Gauge 989 Rnase / Dnase Away ( Ivd, Us Fda, Icmr Approved ) 250Ml 990 Taqpath Covid-19 Combo Kit Multiplex Real-Time Rt-Pcr ( Catalog Numbers A47813 And A47814 ) ( Ivd, Us Fda, Icmr Approved ) 991 A* Star Fortitude Kit 2.0 Covid-19 Qualitative Pcr Kit ( Ivd, Us Fda, Icmr Approved ) 992 Mylabpatho Detect Covid-19 Qualitative Pcr Kit ( Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 993 Kilpest ( Blackbio ) Trupcr Sars-Cov 2Rt-Qpcr Kit Version 2 ( Usfda / Or Ce- Approved ) 994 Biomerieux Argene Sars-Cov-2 R-Gene ( Ivd, Us Fda, Icmr Approved ) 995 Water, Ultrapure, Free Of Dnase, Rnase, Protease, Endonuclease ( Ivd, Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 1 Litre 996 N-95 Particulate Respirator ( Valved Particulate Respirator, 42Cfr84 Approved Product, 95% Filter Efficiency Level, Effective Against Particulate Aerosols Free Of Oil ) 997 Wipes 37.33X42.16 Cm ( Anti-Stat Polyshield: Anti-Static Dispensing System Reduces Lint And Electrostatic Discharge, Easily Wipe Up Liquids, Dust And Tiny Particles And Are Designed For Delicate Tasks ) 998 Cryo Box 1.8Ml ( 9X9 ) ( Chipboard, 132 X 132 X 51Mm, Square, Durable Plastic Cryoboxes With Keyed Lid Orientation And Printed Via Location Grid. ) 999 Zip Lock Bag 21.3X18cm ( Thickness: 52 Micron, Prevents Aroma Transfer, Keep Out Dirt And Moisture, Made From Fda Approved ) 1000 Polypropylene Trigger Sprayers ( 500Ml ) ( Made From Durable, Chemical Resistant Polypropylene, Trigger Sprayer With Adapters. ) 1001 Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( 11X8 Inch ) ( Stainless Steel, Autoclavable, Chemical Resistantand For Laboratory Use ) 1002 Deep Well Storage Plasticware 96 Well Plate ( Height 4.1Cm, Wellcut 1 Cm, Length 12.1Cm Polypropylene ) 1003 Plasticware Magnetic 8 Strip Comb ( Height 4.5Cm, Length 10.2Cm, Distance Between Each Comb=1Cm ) 1004 Duo Rna Elution Plate 96 Well ( Wall Thiekness 6Mm, Nominal Size 50, Neutral Glass ) 1005 Reinelene Solution ( Peracetic Acid ) 1X 5Lit 1006 Glutaraldehyde 2.4% Solution 1X 5 Lit 1007 Self Lock Pouch ( Plastic ) 1008 Deep Well 96 Plate ( Size 50Mm, 200Ul, Wall Thickness 6Mm Nominal Size 50, Neutral Glass ) 1009 96 Tip Comb For Deep Well Plates ( Wall Thickness 5Mm, Nominal Size 90, Neutral Glass ) 1010 Volmutric Flask 500Ml 1011 Rose Water 250Ml 1012 Manitol 500Gm 1013 Renelene Solution 5 Litr. 1014 Cidex 5 Litr. 1015 Fully Automatic Pre Filled Rna Extraction Kit ( Compatible To Zybio Rna Extractor Machine ) 1016 Carbolic Acid 500Ml 1017 Hplc Variant Ii Bts Test Ket 500Test Packet
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 11
Uttar Pradesh View Result →
14.
Educational and Research Institute #8891580 Technical Bid
Supply Of List-Iii Laboratory Kits And Consumables , Supply Of List-Iii Laboratory Kits And Consumables: , Consolidated Amount For Supply Of List-Iii Laboratory Kits And Consumables - 1 2 1 Fecal Occult Blood Card Test Kits 2 Filariasis Igg / Igm Card Test Kits 3 Aso ( Antistreptolysi N O ) Kit 4 Crp ( C-Reactive Protein ) Kit 5 Ra ( Rheumatoid Arthritis ) Kit 6 Rpr ( Rapid Plasma Reagin Test ) Kit 7 Malaria Test Kit 8 Dengue Test Kit 9 Hcg Test Kit 10 Widal Kit- Slide 11 Widal Kit- Tube 12 Typhidot Igm / Igg 13 Mantoux Test Kit 14 Dengue Elisa 15 Hiv Rapid 16 Hiv Elisa 17 Western Blot Hiv 18 Hbv Rapid 19 Hbv Elisa 20 Hav Igm Elisa 21 Hev Igm Elisa 22 Hcv Rapid 23 Hcv Elisa 24 Leptospira Igm Rapid Kit 25 Leptospira Igm Elisa 26 Scrub Typhus Rapid 27 Scrub Typhus Igm Elisa 28 Chikungunya Rapid 29 Tpha Rapid Kit 30 Diagnostic Reagent Kit For Estimation Of Serum Glucose 31 Diagnostic Kit For Estimation Of Serum Total Cholesterol 32 Diagnostic Kit For Estimation Of Serum Triglycerides 33 Diagnostic Kit For Estimation Of Serum Uric Acid 34 Diagnostic Kit For Estimation Of Serum Electrolytes 35 Diagnostic Kit For Estimation Of Serum Calcium 36 Diagnostic Kit For Estimation Of Serum Phosphorus 37 Diagnostic Kit For Estimation Of Serum Urea 38 Diagnostic Kit For Estimation Of Serum Creatinine 39 Diagnostic Kit For Estimation Of Serum Alanine Transaminase ( Alt ) 40 Diagnostic Kit For Estimation Of Serum Alkaline Phosphatase ( Alp ) 41 Diagnostic Kit For Estimation Of Serum Total And Direct Bilirubin 42 Diagnostic Kit For Estimation Of Serum Total Protein 43 Diagnostic Kit For Estimation Of Serum Albumin 44 Diagnostic Kit For Estimation Of Serum Lactate Dehydrogenase 45 Diagnostic Kit For Estimation Of Serum Aspartate Transaminase 46 Diagnostic Kit For Estimation Of Serum Total Ck 47 Diagnostic Kit For Estimation Of Serum Hdl 48 Diagnostic Kit For Estimation Of Serum Amylase 49 Diagnostic Kit For Estimation Of Serum Lipase 50 Ria Tubes 51 Pm Kits Forchem 5 And 7 Erba Semi Auto Analyze 52 Lyphocheck Chemistry Control Level 1 53 Lyphocheck Chemistry Control Level 2 54 Urine Chemistry Control Level 1 55 Urine Chemistry Control Level 2 56 Diabetic Bi Level Control 57 Glucose For Gtt 58 Dextrose Mono Hydrate For Gtt 59 Nichrome Loops 60 Metal Loop Holder 61 Straight Wire Nichrome 62 Spirit Lamp 63 Gas Lighter 64 Oil Dropper Bottles ( Small ) 65 Plastic Staining Bottles 66 Discard Jars 67 Geobacillus Stearothermoph Illus- Spore Ampoules 68 Bowie & Dick Tape 69 Sterile Swabs 70 Sodium Borate Tubes 71 Aluminium Foils 72 Serum Vial Sample Storage Box 73 Sterile Uricol With 1.8% Boric Acid 74 Centrifuge Tubes , 50 Ml 75 Micropipettes- Single Channel 0.5-10Μl 76 Micropipettes- Single Channel 2-20Μl 77 Micropipettes- Single Channel 5-50 Μl 78 Micropipettes- Single Channel 20-200 Μl 79 Micropipettes- Single Channel 30-300 Μl 80 Micropipettes- Single Channel 100-1000Μl 81 Micropipettes, Single Channel 10 Μl 82 Micropipettes, Single Channel 100 Μl 83 Micropipettes, Single Channel 200 Μl 84 Micropipettes, Single Channel 1 Ml 85 Multichannel Pipettes 5-50 Μl 86 Multichannel Pipettes 20- 200 Μl 87 Multichannel Pipettes 30- 300 Μl 88 Multichannel Pipettes 100- 1000 Μl 89 Multichannel Pipettes 1000 90 Pipette Tips 91 Pipette Tips 92 Pipette Tips 93 Micropipette Tips. 94 Micro Tips Box ( 96 Place ) 95 Micro Tips Box ( 96 Place ) 96 Micro Tips Box ( 96 Place ) 97 Pipette Stand 98 Autoclave Tape 99 Spore Ampoules 100 Screw Capped Bottles 101 Funnels 50Mm 102 Microcentrifuge Tubes 103 Plastic Trays Big Size 104 Plastic Trays Small Size 105 Slide Storage Box 106 Hi Dispo Bag 14* 107 Test Tube Stand 108 Cleaning Brushes 109 Antibiotic Zone Scale 110 Mc Farland Standard 111 Forceps, Blunt 6 Inch 112 Heavy Duty Gloves 113 Spatula 200 114 Endotoxin Assay 115 Macintosh Anaerobic 3.5 L 116 Anaerogas Pack 3.5L 117 Sterile Scalpel Blades 118 Non Absorbent Cotton 119 Ph Indicator Strips 120 Whatman No 1 Filter Paper 121 Sterile Sample Containers 122 Vacutainers Top Color- Purple ( Edtak3 ) 123 Vacutainers Top Color- Red ( Nil ) 124 Vacutainers Top Color- Blue- ( Sodium Citrate 1:9 ) 125 Vacutainers Top Color- Black ( Sodium Citrae 1:4 ) 126 Vacutainers Top Color- ( Potassium Oxalate Monohydrate And Sodium Fluoride ) , 127 Vacutainers Top Color- Yellow ( Sst ) 128 Vacutainers Top Color- Heparinised Vacutainers 129 Droppers 130 Filter Paper 131 Adhesive Labels 132 Cotton Lab Wipes 133 Ria Vial Plastic Test Tube 134 Ria Vial Plastic Test Tube 135 Para Film M Roll 136 Micro Centrifuge Tube 137 Micro Centrifuge Tube 138 Micro Centrifuge Tube Rack 139 Sterile Urine Container 140 Falcon Tubes 141 Falcon Tubes 142 Sample Storage Box 143 Plastic Test Tube Rack 144 Permanent Marker 145 24 Hour Urine Collection Pot 146 Urine Concentration With Amicon® Ultra Centrifugal Filters 147 Urinalysis Reagent Test Strips 148 Pap Smear Kit 149 Microtainer Blood Collection Tubes 150 Slide Carrying Trays ( Aluminium ) 151 Sahlis Hemoglobinometer Set 152 Hemocytometer Set ( Including Improved Neubauers Chamber, Rbc Pipette, Wbc Pipette, Thick Cover Glass ) 153 Improved Neubaur’S Chamber 154 Plastic Conical Flasks 100 Ml 155 Bunsen Burners 156 Stainless Steel Tissue Cassette 157 L Moulds ( Leukharts Moulds ) 158 Tissue Embedding And Processing Cassettes Base Mold 60Mm X 37Mm X 10Mm 159 Tissue Embedding Cassettes Stainless Steel Medium Base Mold 160 Tissue Embedding Cassette Stainless Steel Mini Base Mold 15Mmx15mmx7mm 161 Plastic Embedding Cassettes With Lid For Histopathology 162 Slide Staining Rack For 20 Slides 163 Manual Staining Station 164 Polypropylene Plastic Measuring Cylinder Transparent Graduated Combo Of 10Ml, 25Ml, 50Ml &100Ml 165 Coplin Jar, For Chemical Laboratory 166 Microtome Blade 167 Surgical Scalpel Handle 168 Carbon Steel Surgical Blade No 23 169 Diamond Pencil 170 Viral Transport Medium ( Vtm ) With Nasopharyngeal & Throat Swab 171 Vtm Rack ( 15 Ml Tube Rack ) 172 Ice Pack Box 173 Rna Extraction Kit 174 1.5 Ml Eppendorf Tubes 175 Racks For 1.5 Ml Eppendorf Tubes 176 Filter Barrier Tips 0.5-10 Μl 177 Filter Barrier Tips 20-200 Μl 178 Filter Barrier Tips 100-1000 Μl 179 Cryovials 2 Ml 180 Cryobox 181 Rt Pcr Kit 182 Pcr Tubes ( 0.1 Ml ) 183 Pcr Tubes ( 0.2 Ml ) 184 Pcr Plates And Sealer 185 Cooler Box 186 Glass Plate 187 Tlc Developing Tank 188 Tlc Developing Tank 189 Tlc Flask Type Sprayer
Contract Date: Ref. Documents Contract Value : Ref. Document
Government Departments No of Bidders 7
15.
Educational and Research Institute #8869773 Technical Bid
Supply Of Chemical , Regents , Plastic Ware Etc .-1 Papanicolau O.G.6 125 Ml Bottle 2 Papanicolau E.A 36 125 Ml Bottle 3 Poly-L Lysine Solution 100 Ml Bottle 4 Urine Strip ( Distix ) Packet ( 1X100 Strips ) 5 Plastic Tissue Embedding Cassettes Packet ( 1X1000 Pieces ) 6 Diamino Benzidine 25 Gm Powder 7 Tpo ( Thyroid Peroxidase Antibody ) 3 Ml Vial 8 Mouse / Rabbit Specific Polymer Hrp- Dab Ihc Detection Kit 5 Ml Vial 9 Desmin Antibody ( Ihc ) 3 Ml Vial 10 Vimentin Antibody ( Ihc ) 3Ml Vial 11 Estrogen Receptor Antibody ( Er ) 3Ml Vial 12 Anti-Progesterone Receptor Antibody 3Ml Vial 13 Anti S-100 Antibody 3Ml Vial 14 Anti Human Her2 / Neu Antibody 3Ml Vial 15 Anti Human Cytokeratin ( Pan ) Antibody Cocktail 3Ml Vial 16 Anti Melanoma Antibody ( Anti Hmb45 Antibody ) 3Ml Vial 17 Anti Neuron Specific Enolase ( Nse ) Antibody 3Ml Vial 18 Anti Cd45 Antibody 3Ml Vial 19 Anti Hpv-16 Antibody 3Ml Vial 20 Anti Cd20 Antibody 3Ml Vial 21 Anti Cd15 Antibody 3Ml Vial 22 Anti Cd30 Antibody 3Ml Vial 23 Antibody ( Anti C –Kit ) 3Ml Vial 24 Myeloperoxidase Reagent 3Ml Vial 25 Anti Ki 67 Antibody 3Ml Vial 26 Anti E Cadherin Antibody 3Ml Vial 27 Anti Cd- 34 Antibody 3Ml Vial 28 Anti P-63 Antibody 3Ml Vial 29 Anti P-53 Antibody 3Ml Vial 30 Anti Smooth Muscle Actin Antibody 3Ml Vial 31 Anti Ck -6 Antibody 3Ml Vial 32 Anti Ck -17 Antibody 3Ml Vial 33 Anti Cd-68 Antibody 3Ml Vial 34 Tuff’S Jar ( Glass ) Piece 35 Pricking Needile No 23 ( 1 X100 ) Packet 36 Pricking Needile No 24 ( 1 X100 ) Packet 37 Pricking Needile No 21 ( 1 X100 ) Packet 38 Pricking Needile No 20 ( 1 X100 ) Packet 39 Surgical Tray 6X8 “ Inch ( Rectangular ) Piece 40 Microscopic Slide Tray ( Aluminium ) Holding Capacity 20 ( 3X1”Inch ) Piece 41 Bone Marrow Aspiration Needle 16 No Piece 42 Bone Marrow Aspiration Needle 18 No Piece 43 L P Needle Piece 44 Histology Tissue Base Mold ( Steel ) Piece 45 Bone Marrow Biopsy Needle ( Trephine Biopsy ) Piece 46 Museum Mounting Jar ( With Cover ) ( 10Cm X 5Cm X 20Cm ) 47 Museum Mounting Jar ( With Cover ) ( 15Cm X 10Cm X 25Cm ) 48 Museum Mounting Jar ( With Cover ) ( 16.2Cm X 6Cm X 18Cm ) 49 Museum Mounting Jar ( With Cover ) ( 12Cm X 10Cm X 20Cm ) 50 Museum Mounting Jar ( With Cover ) ( 12Cm X 12Cm X 20Cm ) 51 Museum Mounting Jar ( With Cover ) ( 17Cm X 8Cm X 18Cm ) 52 Museum Mounting Jar ( With Cover ) ( 5.5Cm X 5Cm X 10Cm ) 53 Museum Mounting Jar ( With Cover ) ( 17Cm X 9.5Cm X 30Cm ) 54 Museum Mounting Jar ( With Cover ) ( 28Cm X 24Cm X 29Cm ) 55 Museum Mounting Jar ( With Cover ) ( 21Cm X 19Cm X 27Cm ) 56 Museum Mounting Jar ( With Cover ) ( 11Cm X 25Cm X 24Cm ) 57 Ppd Vial 5 Ml Vial 58 A.H.G. 5Ml 59 Pt 5Ml 60 Aptt 3Ml 61 Hbaag Rapid Kit 4Th Generation 62 Hbaag Elisa Kit 4Th Generation 63 Transfer Bag Of 300Ml 64 Double Blood Bag 350Ml With Sagm 65 Triple Blood Bag 350Ml With Sagm 66 Double Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 67 Triple Blood Bag 350Ml With Sagm And Diversion Pouch ( With Luer Adapter ) 68 Leucodepletion Blood Bag 350Ml ( Inline Top And Top ) 69 Leucodepletion Blood Bag 350Ml ( Lab Side ) 70 Occult Blood Powder 100Gm 71 Arcino Molibate 500Ml 72 Taffers Reagent 250Ml 73 Bromo Cresol Green Reagent Box 74 Protein Kit 75 Urin Jar Plastic 76 Cuvette Colouimeton 77 Dispenser Bottle 78 Prulifloxacin 5 Mcg / Disc , 100 Disc / Vial 79 Amphotericin B 100 Units / Disc , 100 Disc / Vial 80 Itraconazole 30 Mcg / Disc , 100 Disc / Vial 81 Co-Trimoxazole 25 Mcg / Disc , 100 Disc / Vial 82 Cefoxitin 200 Mcg / Disc , 100 Disc / Vial 83 Optochin 5 Mcg / Disc , 100 Disc / Vial 84 Cefuroxime 30 Mcg / Disc , 100 Disc / Vial 85 Minocyline 30 Mcg / Disc , 100 Disc / Vial 86 Nalidixicacid 30 Mcg / Disc , 100 Disc / Vial 87 Norfloxacin 10 Mcg / Disc , 100 Disc / Vial 88 Tigecycline 15 Mcg / Disc , 100 Disc / Vial 89 Clarithromycin 15 Mcg / Disc , 100 Disc / Vial 90 Ketoconazole 30 Mcg / Disc , 100 Disc / Vial 91 Vancomycin ( E Test Strip ) 0.5 – 32 Mcg / Ml 92 Cefepime / Cefepime+Clavulanic Acid ( E Test Strip ) Cefepime ( 0.25-16Mcg ) / Cefepime+Clavulanic Acid ( 0.064-4 Mcg ) 93 Imipenem And Imipenem + Edta ( E Test Strip ) Imipenem ( 4-256 Mcg ) And Imipenem+ Edta ( 1-64 Mcg ) 94 Periodic Acid Schiff Stain 500Ml / Bottle 95 Phenyl Pyruvic Acid ( Ppa Test ) 100G / Bottle 96 40 % Urea ( Nh2conh7 ) 500G / Bottle 97 Antibiotic Zone Scale 1Pc / Box 98 Antisera-Salmonella O And H A, 2 Ml / Vial 99 Antisera-Shigella Dysenteriae, 2 Ml / Vial 100 Antisera-Shigella Flexnari, 2 Ml / Vial 101 Antisera-Shiegella Sonnie, 2 Ml / Vial 102 Antisera-Vibrio Cholera O139 , 2 Ml / Vial 103 Mounted Peripheral Blood Smear Slides For Gametocytes Of Plasmodium Vivax And Falciparum, ( 1 – Slide ) 104 Normal Saline 500Ml / Bottle 105 Stock Vial ( 50Pc / Pkt ) 106 Microtube Rack ( 5X16 Holes ) Per Rack 107 Homogeniser With Serrated Pestle S.P 10Ml ( 1-Pc ) 108 Nichrome Loop 4Mm, Double Wound ( 10Pc / Pack ) 109 Nichrome Loop 2Mm, Double Wound ( 10Pc / Pack ) 110 Semisolid Imrv Medium And Selective Supplement Fd19 -2Vl, 500Gm / Bottle 111 Sample Discarding Jar 3L Capacity ( Borosil ) ( 1-Pc ) 112 Kala-Azar Detection Rapid Test ( 25Kit / Box ) 113 Cryptococcal Ag Rapid Test ( 25Kit / Box ) 114 Capped Collection Tube 1.5Ml Capacity ( 50Pc / Box ) 115 Spirit Absolute ( 40 Lt / Gallon ) 116 Sterilium Hand Rub ( 500Ml / Bottle ) 117 Bleaching Powder ( 25Kg / Bag ) 118 Thermacol Transport Box ( 18Cm X 12 Cm ) ( 500Pc / Bag ) 119 Labeling Stickers Sheets ( St-65A4 ) ( 100Sheets / Pack ) 120 Disposable Tongue Depressor ( Spatula ) ( 100Pc / Pack ) 121 Taqman Sequence Detection ( Primer + Probe ) For Screening ( E Gene & Rnp ) And Confirmatory ( Rdrp, & Hku Orf Ib ) 122 Labgun Covid-19 Rt Pcr Kit 123 Bgi Rt Pcr Kit For Detection Sars Cov-2 124 Tscd Wafers 125 Exercising Ball ( Gripper ) 126 Rnase / Dnase Away ( Ivd, Us Fda, Icmr Approved ) 250Ml 127 Taqpath Covid-19 Combo Kit Multiplex Real-Time Rt-Pcr ( Catalog Numbers A47813 And A47814 ) ( Ivd, Us Fda, Icmr Approved ) 128 A* Star Fortitude Kit 2.0 Covid-19 Qualitative Pcr Kit ( Ivd, Us Fda, Icmr Approved ) 129 Mylabpatho Detect Covid-19 Qualitative Pcr Kit ( Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 130 Kilpest ( Blackbio ) Trupcr Sars-Cov 2Rt-Qpcr Kit Version 2 ( Usfda / Or Ce- Approved ) 131 Biomerieux Argene Sars-Cov-2 R-Gene ( Ivd, Us Fda, Icmr Approved ) 132 Water, Ultrapure, Free Of Dnase, Rnase, Protease, Endonuclease ( Ivd, Indian Fda / Central Drugs Standard Control Organisatio ( Cdsco ) , Icmr Approved ) 1 Litre 133 N-95 Particulate Respirator ( Valved Particulate Respirator, 42Cfr84 Approved Product, 95% Filter Efficiency Level, Effective Against Particulate Aerosols Free Of Oil ) 134 Wipes 37.33X42.16 Cm ( Anti-Stat Polyshield: Anti-Static Dispensing System Reduces Lint And Electrostatic Discharge, Easily Wipe Up Liquids, Dust And Tiny Particles And Are Designed For Delicate Tasks ) 135 Cryo Box 1.8Ml ( 9X9 ) ( Chipboard, 132 X 132 X 51Mm, Square, Durable Plastic Cryoboxes With Keyed Lid Orientation And Printed Via Location Grid. ) 136 Zip Lock Bag 21.3X18cm ( Thickness: 52 Micron, Prevents Aroma Transfer, Keep Out Dirt And Moisture, Made From Fda Approved ) 137 Polypropylene Trigger Sprayers ( 500Ml ) ( Made From Durable, Chemical Resistant Polypropylene, Trigger Sprayer With Adapters. ) 138 Stainless Steel Rectangular Pan With Sliding Lid And Handles Tapered Sides ( 11X8 Inch ) ( Stainless Steel, Autoclavable, Chemical Resistantand For Laboratory Use ) 139 Deep Well Storage Plasticware 96 Well Plate ( Height 4.1Cm, Wellcut 1 Cm, Length 12.1Cm Polypropylene ) 140 Plasticware Magnetic 8 Strip Comb ( Height 4.5Cm, Length 10.2Cm, Distance Between Each Comb=1Cm ) 141 Duo Rna Elution Plate 96 Well ( Wall Thiekness 6Mm, Nominal Size 50, Neutral Glass ) 142 Reinelene Solution ( Peracetic Acid ) 1X 5Lit 143 Glutaraldehyde 2.4% Solution 1X 5 Lit 144 Self Lock Pouch ( Plastic ) 145 Deep Well 96 Plate ( Size 50Mm, 200Ul, Wall Thickness 6Mm Nominal Size 50, Neutral Glass ) 146 96 Tip Comb For Deep Well Plates ( Wall Thickness 5Mm, Nominal Size 90, Neutral Glass )
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 5
Uttar Pradesh View Result →
16.
Educational and Research Institute #8855101 Technical Bid
Supply Of Chemical Reagents And Glass Ware And Others-1 Papanicolau O.G.6 125 ml bottle 2 Papanicolau E.A 36 125 ml bottle 3 Poly-L lysine solution 100 ml bottle 4 Urine Strip ( Distix) Packet (1x100 strips) 5 Plastic Tissue Embedding Cassettes Packet (1x1000 pieces) 6 Diamino Benzidine 25 gm Powder 7 TPO(Thyroid peroxidase antibody) 3 ml vial 8 Mouse/Rabbit Specific Polymer HRP- DAB IHC detection kit 5 ml vial 9 Desmin Antibody (IHC) 3 ml vial 10 Vimentin Antibody (IHC) 3ml vial 11 Estrogen receptor antibody (ER) 3ml vial 12 Anti-Progesterone receptor antibody 3ml vial 13 Anti S-100 antibody 3ml vial 14 Anti Human HER2/neu antibody 3ml vial 15 Anti Human cytokeratin(Pan) Antibody cocktail 3ml vial 16 Anti melanoma Antibody( Anti HMB45 Antibody) 3ml vial 17 Anti neuron specific enolase (NSE) Antibody 3ml vial 18 Anti CD45 Antibody 3ml vial 19 Anti HPV-16 Antibody 3ml vial 20 Anti CD20 Antibody 3ml vial 21 Anti CD15 Antibody 3ml vial 22 Anti CD30 Antibody 3ml vial 23 Antibody (Anti c –kit) 3ml vial 24 Myeloperoxidase Reagent 3ml vial 25 Anti Ki 67 Antibody 3ml vial 26 Anti E Cadherin Antibody 3ml vial 27 Anti CD- 34 Antibody 3ml vial 28 Anti P-63 Antibody 3ml vial 29 Anti P-53 Antibody 3ml vial 30 Anti Smooth Muscle Actin Antibody 3ml vial 31 Anti CK -6 Antibody 3ml vial 32 Anti CK -17 Antibody 3ml vial 33 Anti CD-68 Antibody 3ml vial 34 Tuff’s jar (glass) Piece 35 Pricking Needile no 23 (1 x100) Packet 36 Pricking Needile no 24 (1 x100) Packet 37 Pricking Needile no 21 (1 x100) Packet 38 Pricking Needile no 20 (1 x100) Packet 39 Surgical Tray 6x8 “ Inch (Rectangular) Piece 40 Microscopic Slide Tray (Aluminium) Holding Capacity 20 (3x1”Inch) Piece 41 Bone Marrow aspiration Needle 16 No Piece 42 Bone Marrow aspiration Needle 18 No Piece 43 L P Needle Piece 44 Histology tissue base mold ( Steel ) Piece 45 Bone Marrow Biopsy Needle (Trephine Biopsy) Piece 46 Museum mounting jar (With Cover) (10cm x 5cm x 20cm) 47 Museum mounting jar (With Cover) (15cm x 10cm x 25cm) 48 Museum mounting jar (With Cover) (16.2cm x 6cm x 18cm) 49 Museum mounting jar (With Cover) (12cm x 10cm x 20cm) 50 Museum mounting jar (With Cover) (12cm x 12cm x 20cm) 51 Museum mounting jar (With Cover) (17cm x 8cm x 18cm) 52 Museum mounting jar (With Cover) (5.5cm x 5cm x 10cm) 53 Museum mounting jar (With Cover) (17cm x 9.5cm x 30cm) 54 Museum mounting jar (With Cover) (28cm x 24cm x 29cm) 55 Museum mounting jar (With Cover) (21cm x 19cm x 27cm) 56 Museum mounting jar (With Cover) (11cm x 25cm x 24cm) 57 HCV RAPID KIT, (Fourth generation immunoassay for core,NS3,NS4,NS5) 58 PPD VIAL 5 ml VIAL 59 A.H.G. 5ml 60 PT 5ml 61 APTT 3ml 62 HBaAg Rapid Kit 4th Generation 63 HCV Elisa Kit 4th Generation 64 HBaAg Elisa Kit 4th Generation 65 Transfer Bag of 300ml 66 Double Bag 350ml with SAGM 67 Tripal Blood Bag 350ml with SAGM 68 Double Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 69 Tripal Blood Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 70 Leucodepltion blood bag 350ml (inline TOP and TOP) 71 Leucodepltion blood bag 350ml (Lab Side) 72 Occult Blood Powder 100gm 73 Arcino Molibate 500ml 74 Taffers Reagent 250ml 75 Bromo Cresol Green Reagent Box 76 Protein Kit 77 Urin Jar Plastic 78 Cuvette Colouimeton 79 Dispenser Bottle 80 Prulifloxacin 5 Mcg / disc , 100 disc / vial 81 Amphotericin B 100 Units / disc , 100 disc / vial 82 Itraconazole 30 Mcg / disc , 100 disc / vial 83 Co-Trimoxazole 25 Mcg / disc , 100 disc / vial 84 Cefoxitin 200 Mcg / disc , 100 disc / vial 85 Optochin 5 Mcg / disc , 100 disc / vial 86 Cefuroxime 30 Mcg / disc , 100 disc / vial 87 Minocyline 30 Mcg / disc , 100 disc / vial 88 Nalidixicacid 30 Mcg / disc , 100 disc / vial 89 Norfloxacin 10 Mcg / disc , 100 disc / vial 90 Tigecycline 15 Mcg / disc , 100 disc / vial 91 Clarithromycin 15 Mcg / disc , 100 disc / vial 92 Ketoconazole 30 Mcg / disc , 100 disc / vial 93 Vancomycin (E test strip) 0.5 – 32 Mcg/ML 94 Cefepime/Cefepime+Clavulanic acid (E test strip) Cefepime (0.25-16mcg)/Cefepime+clavulanic acid (0.064-4 mcg) 95 Imipenem and Imipenem + EDTA (E test strip) Imipenem (4-256 mcg) and Imipenem+ EDTA (1-64 mcg) 96 Periodic acid Schiff stain 500ml / Bottle 97 Phenyl Pyruvic Acid (PPA Test) 100g / Bottle 98 40 % Urea (NH2CONH7) 500g / Bottle 99 Antibiotic zone scale 1pc/box 100 Antisera-Salmonella O and H A, 2 ml / vial 101 Antisera-Shigella dysenteriae, 2 ml / vial 102 Antisera-Shigella flexnari, 2 ml / vial 103 Antisera-Shiegella sonnie, 2 ml / vial 104 Antisera-Vibrio cholera O139 , 2 ml / vial 105 Mounted Peripheral blood smear slides for Gametocytes of Plasmodium vivax and falciparum, (1 – Slide) 106 Normal saline 500ml / Bottle 107 Stock vial (50pc/pkt) 108 Microtube rack (5x16 holes) per rack 109 Homogeniser with serrated pestle S.P 10ml (1-Pc) 110 Nichrome loop 4mm, Double wound (10pc/Pack) 111 Nichrome loop 2mm, Double wound (10pc/Pack) 112 Semisolid IMRV Medium and selective supplement FD19 -2vl, 500gm/Bottle 113 Sample Discarding jar 3L capacity (Borosil) (1-pc) 114 Kala-azar detection rapid test (25kit/box) 115 Cryptococcal Ag rapid test (25kit/box) 116 Capped Collection tube 1.5ml capacity (50pc/box) 117 Safeskin purple nitrile gloves (Medium) 100/Box 118 N95 Particulate Respirator (NIOSH Approved) 1pc 119 wipes 37.33x42.16 cm 120 Cryo Box 1.8ml (9x9 wells) (1 x 4 / box) 121 FG-optical Adhesive Covers for PCR, 1pc 122 MicroAmp Optical 96-Well Reaction Plate (0.2ml), (1- Plate) ABI supported 123 Zip lock bag 21.3x18cm (10bag/Box) 124 384 WELL PCR PLATE, (1- Plate) 125 Polypropylene Trigger Sprayers (500ml), 1pc 126 Stainless steel rectangular pan with sliding lid and handles tapered sides ( size 11 x 8 inch) , 1pc 127 Spirit absolute (40 Lt/Gallon) 128 Sterilium hand rub ( 500ml/Bottle) 129 bleaching powder (25kg/Bag) 130 RNA Zap water 200ml /bottle 131 Thermacol transport Box (18cm x 12 cm) (500pc/bag) 132 Tissue Paper (Toilet paper roll) (9pc/Pack) 133 Labeling Stickers sheets(ST-65A4) (100sheets/Pack) 134 Disposable Tongue depressor (spatula) (100pc/Pack) 135 Nuclease Free Water (molecular grade) 1000ml/pack 136 Taqman Sequence detection (Primer + Probe) for Screening (E Gene & RNP) and Confirmatory (RdrP, & HKU ORF Ib) 137 Mylab Patho Detect Covid-19 Qualitative PCR kit 138 A*Star Fortitued kit 2.0 Covid-19 RT-PCR Test 139 Super Script III Platinum qRT PCR Reagent 500 Tests Kit 140 LabGun Covid-19 RT PCR kit 141 BGI RT PCR kit for detection SARS Cov-2 142 TSCD Wafers 143 Exercising Ball (Gripper) 144 One step RT-PCR Reagent AgPath (IVD, US FDA, ICMR APPROVED) 145 Pendemic H1N1 09 Assay set (PN-4456927) (IVD, US FDA, ICMR APPROVED) 146 RNASE/DNASE AWAY (IVD, US FDA, ICMR APPROVED) 250ml 147 Rapid Diagnostic Kit for IgG/IgM to COVID-19 (IVD, US FDA, ICMR APPROVED) 148 Super Script III Platinum qRT (IVD, US FDA, ICMR APPROVED) 149 TaqPath COVID-19 Combo Kit Multiplex real-time RT-PCR (Catalog Numbers A47813 and A47814) (IVD, US FDA, ICMR APPROVED) 150 A* Star Fortitude kit 2.0 COVID-19 Qualitative PCR Kit (IVD, US FDA, ICMR APPROVED) 151 MylabPatho Detect COVID-19 Qualitative PCR Kit (Indian FDA/ Central Drugs Standard Control Organisatio (CDSCO),ICMR Approved) 152 KILPEST (BLACKBIO) TRUPCR SARS-CoV 2RT-qPCR Kit version 2 (USFDA /OR CE- approved) 153 BIOMERIEUX ARGENE SARS-COV-2 R-GENE (IVD, US FDA, ICMR APPROVED) 154 Water, Ultrapure, Free of Dnase, Rnase, Protease, Endonuclease (IVD, Indian FDA/ Central Drugs Standard Control Organisatio (CDSCO),ICMR Approved) 1 Letter 155 Collection tube 1.5 ml (Durable—able to tolerate centrifuge speeds up to 20,000 RCF• Compatible—suitable for IP and mass spectrometry applicationsPurity: Rnase/Dnase freeShipping : RTMaterial PolypropyleneTube type: microfuge tube) 156 MicroAmp Optical tube 8/strips (0.2 ml) (Reaction speed : standard Colour: opticalVolume: 0.2mlFor use with instrument: Quant studio 7 flexTube type: strip of 8) 125x8 157 MicroAmp Optical 8 cap strips (0.2 ml) (Reaction speed : standard Colour: opticalFor use with MicroAmp Optical tube 8/strips (0.2 ml)Cap type: 8 cap strip) 300x8 Rxn 158 MicroAmp Optical 96-well Reaction Plate (For use with ABI RT-PCR machinesColour: opticalPlate type: 96 well) 159 96 well plates (For use with Agilent RT-PCR machinesPlate type: 96 well, Rigid, skirted) 160 96 well optical plates (For use with Agilent RT-PCR machines Colour: opticalPlate type: 96 well) 161 96 tube strips (Reaction speed : standardColour: opticalFor use with Agilent RT-PCR machines) 162 Optical cap, 8x strip (For use with Agilent RT-PCR machinesCap type: 8 cap stripColour: optical) 163 Safeskin purple nitrile gloves (Medium) (Gloves are powder free, minimizing the potential for powder related complications, irritation and dermatitis.) 164 N-95 Particulate Respirator (Valved particulate respirator, 42CFR84 approved product, 95% filter efficiency level, effective against particulate aerosols free of oil) 165 wipes 37.33x42.16 cm (Anti-stat polyshield: Anti-static dispensing system reduces lint and electrostatic discharge, easily wipe up liquids, dust and tiny particles and are designed for delicate tasks) 166 Cryo Box 1.8ml (9x9) (Chipboard, 132 x 132 x 51mm, Square,durable plastic cryoboxes with keyed lid orientation and printed via location grid.) 167 FG-optical Adhesive clear Covers (Plate compatibility: 384/96 well plates, colour: optical, Easy to apply-will not stick to your glove, For use with instrument: Quant studio 7 flex) 168 MicroAmp Optical 96-Well Reaction Plate (0.2ml) (Holds: 96x0.2ml of tubes, Reaction speed : standardColour: opticalVolume: 0.2ml For use with instrument: Quant studio 7 flex) 169 Zip lock bag 21.3x18cm (Thickness: 52 micron, prevents aroma transfer, keep out dirt and moisture, made from FDA approved) 170 384 WELL PCR PLATE (Holds: 384 well plate Reaction speed : standardColour: optical40 µL maximum well volume, 25 µL working volumeFor use with instrument: Quant studio 7 flex) 171 POLYPROPYLENE TRIGGER SPRAYERS (500ml) (Made from durable, chemical resistant polypropylene,Trigger sprayer with adapters.) 172 Stainless steel rectangular pan with sliding lid and handles tapered sides (11x8 inch) (Stainless steel, Autoclavable, chemical resistantand for laboratory use) 173 Deep well storage plasticware 96 well plate (For use with Zybio extraction machines) 174 Plasticware magnetic 8 strip comb (For use with Zybio extraction machines) 175 Duo elution strip (For use with Genetix 96 well extraction machines) 176 Duo cap for elution strip (For use with Genetix 96 well extraction machines) 177 Deep well 96 plate (For use with Genetix96 well extraction machines) 178 96 tip comb for deep well magnets (For use with Genetix96 well extraction machines)
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 7
Uttar Pradesh View Result →
17.
Educational and Research Institute #8827360 Technical Bid
Supply Of Chemical Reagents And Glass Ware And Others-1 Isopropyl Alcohol 2.5 LT bottle 2 Papanicolau O.G.6 125 ml bottle 3 Papanicolau E.A 36 125 ml bottle 4 Papanicolau E.A 65 125 ml bottle 5 May.Grunwald Stain (MGG) 100 ml bottle 6 Giemsa Staining 100 ml bottle 7 H2So4 (Sulphuric acid) 500 ml bottle 8 Methanol 500 ml bottle 9 Diethy Ethyl Ether L.R 500 ml bottle 10 Leishman’s Stain Solution (Cytochrome) 500 ml bottle 11 Tincture Benzoin 100 ml bottle 12 Semen Diluting Fluid 200 ml bottle 13 Platelet diluting Fluid 50 ml bottle 14 Chloroform 2.5 Lt bottle 15 WBC diluting Fluid 50 ml bottle 16 RBC diluting Fluid 50 ml bottle 17 N/ 10 HCL 500ml bottle 18 Formaldehyde 5 Lt bottle 19 Xylene 2.5 Lt bottle 20 Conc. HCL(Hydrochloric acid) 500 ml bottle 21 Liquid Ammonia 500 ml bottle 22 D.P.X. 250 ml bottle 23 Conc.Nitric Acid 500ml bottle 24 Glycerine 500 ml bottle 25 Liquid Paraffin 500 ml bottle 26 Na OH(Sodium Hydroxide) 500 ml bottle 27 Poly-L lysine solution 100 ml bottle 28 Citric Acid (anhydrous pure) 500 ml bottle 29 H 2 O2 (Hydrogen peroxide) 100 ml bottle 30 Deionized water 5 Lt. Bottle 31 Schiffs reagent 500 ml bottle 32 Bendict reagent 500 ml 33 Drabkins Solution 5 Lit 34 Fouchet’s reagent 200 ml 35 Ehrlich Reagent 200 ml 36 Methylene Blue stain 125 ml bottle 37 Rapid A.F.B stain kit 38 Carbol Fuchsin stain 125 ml bottle 39 Reticulocyte stain (Biolab) 01 Packet 40 Acetone 500 ml bottle 41 Sodium Hypo Chloride 5 LTR bottle 42 Spirit 5 LTR bottle 43 Glucose God- Pod Kit 500 ml 44 Glacial Acetic Acid 500 ml bottle 45 Hematoxylin Stain Powder(sd fine) 25gm / 5 gm Packet 46 Eosin powder (water soluble) 25gm Packet 47 Aluminum Potassium Sulphate 500 gm Packet 48 Mercuric Oxide Red 100 gm Packet 49 Wax 600-620 500 gm Packet 50 Albumin Powder 500 gm Packet 51 Periodic Acid 25 gm Packet 52 Mercuric Oxide 25 gm Packet 53 Dextrose (Anhydrous) 500 gm Packet 54 Sulphur Powder 100 gm 55 Barium Chloride Powder 500 gm 56 Ammonium Sulphate 500 gm 57 Sodium Sulphate 500 gm 58 Sulphosalicylic Acid 500 gm 59 Gentian Violet 100 gm 60 Tris buffer (SD Fine) 500 gm Packet 61 EDTA 100 gm Packet 62 Low Profile Disposable Microtome blade for cutting tissue section 63 Urine Strip ( Distix) Packet (1x100 strips) 64 Phosphotungistic Acid 100 gm Packet 65 Brilliant Crystal Blue stain 100 gm 66 Plastic Tissue Embedding Cassettes Packet (1x1000 pieces) 67 Oxalic Acid 50 gm 68 Ferric Chloride 500 gm 69 Sodium Thio Sulphate 500 gm 70 Potassium Ferrocyanide 500 gm 71 Sodium chloride 500 gm 72 Sodium Nitroprusside 500 gm 73 Orthotoludine reagent 500 gm 74 Benzidine Powder 25 gm 75 Diamino Benzidine 25 gm Powder 76 Total Protein Kit 77 Albumin Kit 78 Serum Creatinine kit 79 Serum Urea Kit 80 Serum SGOT Kit 81 Serum SGPT Kit 82 Direct S. Bilirubin Kit 83 Serum Calcium Kit 84 Serum Alkaline Phosphate Kit 85 Serum Cholesterol Kit 86 Serum Triglyceride Kit 87 Serum HDL Cholesterol Kit 88 Serum Uric Acid Kit 89 TPO(Thyroid peroxidase antibody) 3 ml vial 90 Mouse/Rabbit Specific Polymer HRP- DAB IHC detection kit 5 ml vial 91 Desmin Antibody (IHC) 3 ml vial 92 Vimentin Antibody (IHC) 3ml vial 93 Estrogen receptor antibody (ER) 3ml vial 94 Anti-Progesterone receptor antibody 3ml vial 95 Anti S-100 antibody 3ml vial 96 Anti Human HER2/neu antibody 3ml vial 97 Anti Human cytokeratin(Pan) Antibody cocktail 3ml vial 98 Anti melanoma Antibody( Anti HMB45 Antibody) 3ml vial 99 Anti neuron specific enolase (NSE) Antibody 3ml vial 100 Anti CD45 Antibody 3ml vial 101 Anti HPV-16 Antibody 3ml vial 102 Anti CD20 Antibody 3ml vial 103 Anti CD15 Antibody 3ml vial 104 Anti CD30 Antibody 3ml vial 105 Antibody (Anti c –kit) 3ml vial 106 Myeloperoxidase Reagent 3ml vial 107 Anti Ki 67 Antibody 3ml vial 108 Anti E Cadherin Antibody 3ml vial 109 Anti CD- 34 Antibody 3ml vial 110 Anti P-63 Antibody 3ml vial 111 Anti P-53 Antibody 3ml vial 112 Anti Smooth Muscle Actin Antibody 3ml vial 113 Anti CK -6 Antibody 3ml vial 114 Anti CK -17 Antibody 3ml vial 115 Anti CD-68 Antibody 3ml vial 116 Whatman Filter paper Sheet 117 Coplin Jar (plastic) 01 Piece 118 Tuff’s jar (glass) Piece 119 K3 EDTA Vacutainar 1 x100 120 Plain Vacutainar 1 x100 121 Riya vial ( Plastic) 1 x100 122 Test Tube Stand (plastic) Piece 123 Test tube holder Piece 124 Plastic beaker 25ml Piece 125 Plastic beaker 100ml Piece 126 Semen collection container 20 ML (1x50) Packet 127 Urine sample container 50 ML (1x50) Packet 128 Micro tips Large (200- 2000 Micro Liter) Packet (1x500 pieces) 129 Micro tips Small (20- 200 Micro Liter) Packet (1x1000 pieces) 130 Sprit lamp 50ml Piece 131 Plastic dropper Piece 132 Pipette bulb Piece 133 Glass Test tube 7ml, Piece 134 Glass Test tube 10ml, Piece 135 Glass Test tube 20ml Piece 136 Glass Slide (Blue Star) Packet 137 Cover Slip (Blue Star) Packet 138 Neubauer Chamber Piece 139 Glass Pipette 5 ml 20 Micro lit Piece 140 Glass Pipette 10 ml 20 Micro lit Piece 141 Glass Pipette 1 ml 20 Micro lit Piece 142 Micro pipette 10 microlitre FIX Piece 143 Micro pipette 100 microlitre FIX Piece 144 Micro pipette (5-50) microlitre Variable Piece 145 Micro pipette 20 microlitre FIX Piece 146 Micro pipette 1000 microlitre FIX Piece 147 Micro pipette 50 microlitre FIX Piece 148 Wintrobe ESR tube With Stand Piece 149 Westergreen ESR Pipette with Stand Piece 150 Pricking Needile no 23 (1 x100) Packet 151 Pricking Needile no 24 (1 x100) Packet 152 Pricking Needile no 21 (1 x100) Packet 153 Pricking Needile no 20 (1 x100) Packet 154 Surgical Tray 6x8 “ Inch (Rectangular) Piece 155 Microscopic Slide Tray (Aluminium) Holding Capacity 20 (3x1”Inch) Piece 156 Bone Marrow aspiration Needle 16 No Piece 157 Bone Marrow aspiration Needle 18 No Piece 158 L P Needle Piece 159 Histology tissue base mold ( Steel ) Piece 160 Bone Marrow Biopsy Needle (Trephine Biopsy) Piece 161 Glass Rod Piece 162 pH paper strip (5.0-7.5) Booklet (1x20 strips) 163 pH paper strip (2.0-10.5) Booklet (1x20 strips) 164 Lens cleaning paper Booklet (9cmx14.5cm, 100 leaves) 165 Museum mounting jar (With Cover) (10cm x 5cm x 20cm) 166 Museum mounting jar (With Cover) (15cm x 10cm x 25cm) 167 Museum mounting jar (With Cover) (16.2cm x 6cm x 18cm) 168 Museum mounting jar (With Cover) (12cm x 10cm x 20cm) 169 Museum mounting jar (With Cover) (12cm x 12cm x 20cm) 170 Museum mounting jar (With Cover) (17cm x 8cm x 18cm) 171 Museum mounting jar (With Cover) (5.5cm x 5cm x 10cm) 172 Museum mounting jar (With Cover) (17cm x 9.5cm x 30cm) 173 Museum mounting jar (With Cover) (28cm x 24cm x 29cm) 174 Museum mounting jar (With Cover) (21cm x 19cm x 27cm) 175 Museum mounting jar (With Cover) (11cm x 25cm x 24cm) 176 HIV RAPID TRIDOT KIT 177 HBSAG immunoassay RAPID KIT 178 HCV RAPID KIT, (Fourth generation immunoassay for core,NS3,NS4,NS5) 179 RDT FOR MP RAPID KIT (immunochromatographic kit for pf/pan antigen) 180 VDRL Rapid IMMUNOASSAY KIT 181 TYPHOID RAPID KIT (IgG,IgM) 182 DENGUE RAPID KIT (IMMUNOCHROMATOGRAPHIC ASSAY FOR NS1,IgG ,IgM) 183 PLAIN VIAL 5 ml VIAL 184 ABO RH ANTI SERA 10 ml PACKET 185 PPD VIAL 5 ml VIAL 186 SYRINGE 3ML (1x100) Packet 187 SYRINGE 5ML (1x100) Packet 188 SYRINGE 5ML (1x100) Packet 189 SODIUM CITRATE VIAL 5 ml VIAL 190 CAPILLARY TUBE PIECE 191 A.H.G. 5ml 192 Anti A1 Lectin 5ml 193 Anti H Lectin 5ml 194 Anti D (IgM + IgG Monoclonal) 10ml 195 PT 5ml 196 APTT 3ml 197 Calcium Chloride 10ml 198 Bovine Albumin 5ml 199 HIV Rapid Kit 4Th Generation 200 HIV Rapid Kit 3Th Generation 201 HCV RAPID KIT, 3Th Generation 202 HBaAg Rapid Kit 4th Generation 203 HBaAg Rapid Kit 3th Generation 204 HIV Elisa Kit 4th Generation 205 HCV Elisa Kit 4th Generation 206 HCV Elisa Kit 3th Generation 207 HBaAg Elisa Kit 4th Generation 208 HBaAg Elisa Kit 3th Generation 209 Troniquete 210 Micro Pipette 10 ul Fix 211 Micro Pipette 50 ul Fix 212 Micro Pipette 25 ul Fix 213 Micro Pipette 100 ul Fix 214 Micro Pipette 1000 ul Fix 215 Micro Pipette 100-1000 ul Variable 216 Micro Pipette 10-100 ul Variable 217 Micro Pipette Stand (Big) Plastic Make 218 Micro Pipette Stand (Small) Plastic Make 219 Transfer Bag of 300ml 220 Double Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 221 Tripal Blood Bag 350ml with SAGM and Diversion Pouch (with Luer Adapter) 222 Leucodepltion blood bag 350ml (inline TOP and TOP) 223 Leucodepltion blood bag 350ml (Lab Side) 224 Pregnancy Kit Test 225 Cappilary Tub 226 Swab Stick 227 Benedict Reagent Quanitateive 500 ml 228 Benedict Reagent Qualitateive 500 ml 229 Sulphar Powder 500 gm 230 Occult Blood Powder 100gm 231 Hydrozen Peroxide 500ml 232 Egg Albumin 500gm 233 Sulphuric Acid 500ml 234 Sodium Hydroxide 500gm 235 Copper Sulphate 500gm 236 Picric Acid 500ml 237 Arcino Molibate 500ml 238 Phaspho Tungstic Acid 500gm 239 Sodium Carbonate 500gm 240 Nitric Acid 500ml 241 Silver Nitrate 25gm 242 Hydrochloric Acid 500ml 243 Taffers Reagent 250ml 244 Bromo Cresol Green Reagent Box 245 Urea Kit 246 Protein Kit 247 Cholesterol Kit 248 Pipette 1ml 249 Pipette 2ml 250 Test Tub 251 Burette with Tip 252 Burette Stopper 253 Burette Stand 254 Filter Paper 255 Mesauring Cylinder 50ml 256 Beaker 250ml 257 Beaker 500ml 258 Round Bottle Flask 200ml 259 Conical Flask 200ml 260 Urin Jar Plastic 261 Funnel Plastic 262 Cuvette Colouimeton 263 Dispenser Bottle 264 Amikacin 30 Mcg / disc , 100 disc / vial 265 Amoxicillin Clavulanic acid 20/10 Mcg / disc , 100 disc / vial 266 Cefoperazone75 Mcg / disc , 100 disc / vial 267 Ceftriaxone 30 Mcg / disc , 100 disc / vial 268 Nitrofurantoin 300 Mcg / disc , 100 disc / vial 269 Ofloxacin 5 Mcg / disc , 100 disc / vial 270 Ceftazidime /clavulanic acid 30/10 Mcg / disc , 100 disc / vial 271 Ciprofloxacin 5 Mcg / disc , 100 disc / vial 272 Ertapenem 10 Mcg / disc , 100 disc / vial 273 Gentamicin 10 Mcg / disc , 100 disc / vial 274 Imipenem 10 Mcg / disc , 100 disc / vial 275 Levofloxacin 5 Mcg / disc , 100 disc / vial 276 Meropenem 10 Mcg / disc , 100 disc / vial 277 Moxifloxacin 5 Mcg / disc , 100 disc / vial 278 Prulifloxacin 5 Mcg / disc , 100 disc / vial 279 Vancomycin 30 Mcg / disc , 100 disc / vial 280 Azithromycin 15 Mcg / disc , 100 disc / vial 281 Chloramphenicol 30 Mcg / disc , 100 disc / vial 282 Piperacillin/Tazobactam 100/10 Mcg / disc , 100 disc / vial 283 Tobramycin 10 Mcg / disc , 100 disc / vial 284 Tetracycline 30 Mcg / disc , 100 disc / vial 285 Cefotaxime 30 Mcg / disc , 100 disc / vial 286 Fluconazole 10 Mcg / disc , 100 disc / vial 287 Amphotericin B 100 Units / disc , 100 disc / vial 288 Itraconazole 30 Mcg / disc , 100 disc / vial 289 Nystatin 100 units / disc , 100 disc / vial 290 Voriconazole 1Mcg / disc , 100 disc / vial 291 Co-Trimoxazole 25 Mcg / disc , 100 disc / vial 292 Clindamycin 2 Mcg / disc , 100 disc / vial 293 Teicoplanin 30 Mcg / disc , 100 disc / vial 294 Cefdinir 5 Mcg / disc , 100 disc / vial 295 Cefpirome 30 Mcg / disc , 100 disc / vial 296 Imipenem –Cilastin 10 Mcg / disc , 100 disc / vial 297 Ampicillin 2 Mcg / disc , 100 disc / vial 298 Polymyxin-B 100 UNIT / disc , 100 disc / vial 299 Bacitracin 8 UNIT / disc , 100 disc / vial 300 Cefoxitin 200 Mcg / disc , 100 disc / vial 301 Linezolid 30 Mcg / disc , 100 disc / vial 302 Gentamicin (High) 50 Mcg / disc , 100 disc / vial 303 Faropenem 5 Mcg / disc , 100 disc / vial 304 Doxycycline 10 Mcg / disc , 100 disc / vial 305 Aztreonam 50 Mcg / disc , 100 disc / vial 306 Fosfomycin 50 Mcg / disc , 100 disc / vial 307 Novobiocin 30 Mcg / disc , 100 disc / vial 308 Optochin 5 Mcg / disc , 100 disc / vial 309 Cefuroxime 30 Mcg / disc , 100 disc / vial 310 Minocyline 30 Mcg / disc , 100 disc / vial 311 Nalidixicacid 30 Mcg / disc , 100 disc / vial 312 Norfloxacin 10 Mcg / disc , 100 disc / vial 313 Tigecycline 15 Mcg / disc , 100 disc / vial 314 Clarithromycin 15 Mcg / disc , 100 disc / vial 315 Ketoconazole 30 Mcg / disc , 100 disc / vial 316 Vancomycin (E test strip) 0.5 – 32 Mcg/ML 317 Cefepime/Cefepime+Clavulanic acid (E test strip) Cefepime (0.25-16mcg)/Cefepime+clavulanic acid (0.064-4 mcg) 318 Imipenem and Imipenem + EDTA (E test strip) Imipenem (4-256 mcg) and Imipenem+ EDTA (1-64 mcg) 319 MacConkey Agar 500g / Bottle 320 Muller-Hinton-Agar 500g / Bottle 321 Chrome Universal Agar 500g / Bottle 322 Lugol’s Iodine 125 ml/Bottle 323 Urea Agar Base 100g / Bottle 324 Simmons Citrate Agar 100g / Bottle 325 Triple Sugar Iron Agar 100g / Bottle 326 Blood Agar Base 500g / Bottle 327 Robertson cooked Meat Media 500g / Bottle 328 Sucrose 500g / Bottle 329 Lactose (LR) 500g / Bottle 330 Mannitol (C6H14C6) 500g / Bottle 331 Peptone, 500g / Bottle 332 Dextrose Anhydrous (C6H12O6) 500g / Bottle 333 Bile esculin Reagent/Agar 500g / Bottle 334 Methylene Blue for ZN stain 500ml / Bottle 335 Carbol Fuchsin for ZN stain 500ml / Bottle 336 Giemsa stain 500ml / Bottle 337 Periodic acid Schiff stain 500ml / Bottle 338 Safranine for ZN stain 500ml / Bottle 339 Gentian Violet (crystal) 100g / Bottle 340 Phenol (C6H5OH) (crystal) 500g / Bottle 341 Methyl red reagent 500g / Bottle 342 Phenyl Pyruvic Acid (PPA Test) 100g / Bottle 343 Prepared Oxidase disc 50 Disc/ Box 344 Iodine (crystal) 100g / Bottle 345 Tri-Sodium Citrate ( Na3C6H5O72H2O) 500g / Bottle 346 Citric Acid (C6H8O7) 500g / Bottle 347 Kovac’s indole reagent 100ml / Bottle 348 40 % Urea (NH2CONH7) 500g / Bottle 349 Antibiotic zone scale 1pc/box 350 Antisera-Salmonella O and H A, 2 ml / vial 351 Antisera-Shigella dysenteriae, 2 ml / vial 352 Antisera-Shigella flexnari, 2 ml / vial 353 Antisera-Shiegella sonnie, 2 ml / vial 354 Antisera-Vibrio cholera O139 , 2 ml / vial 355 ATCC strain - E.coli 25922, Freeze dried lyophilized / Vial 356 ATCC strain - E.coli 35218, Freeze dried lyophilized / Vial 357 ATCC strain - Pseudomonas aeruginosa 27853 Freeze dried lyophilized / Vial 358 ATCC strain - Staphylococcus aureus 25923 Freeze dried lyophilized / Vial 359 ATCC strain - Staphylococcus aureus 29213 Freeze dried lyophilized / Vial 360 Mounted Peripheral blood smear slides for Gametocytes of Plasmodium vivax and falciparum, (1 – Slide) 361 Potassium permagnate (KMnO4) 500g / Bottle 362 Formalin (20%) 500ml / Bottle 363 Methanol (CH3OH) 500ml / Bottle 364 Acetone (LR) (Reagent ) 500ml / Bottle 365 100 % Sulphuric Acid (H2SO4) 500ml / Bottle 366 Gram’s Iodine 500ml / Bottle 367 Boric Acid 500g / Bottle 368 di- Sodium Hydrogen ortho-phosphate 500g / Bottle 369 Formaldehyde Solution (37-41)% 1000ml / Bottle 370 Potassium Iodide (KI) 500g / Bottle 371 Hydrogen Peroxide Solution (H2O2) 6% 1000ml / Bottle 372 Sodium hydroxide Pellets Purified (NaOH) 500g / Bottle 373 Potassium hydroxide Pellets (KOH) 500g / Bottle 374 Sodium Chloride (NaCl) 500g / Bottle 375 Amyl Alcohol ( C5H11OH) 500ml / Bottle 376 Xylene Sulphur 500ml / Bottle 377 70 % Isopropyl alcohol 500ml / Bottle 378 Normal saline 500ml / Bottle 379 Digital weighing Balance 24Kg/ machine 380 Test Tube (Glass 7ml) 100pc/ pkt 381 Sterile Swab Stick, 100pc/pkt 382 Test tube holder (small) 10pc/box 383 Test tube holder (Large) 10pc/box 384 Petri disk 90x90 (10pc/pkt) 385 Petri disk 90x120, (10pc/pkt) 386 Stock vial (50pc/pkt) 387 Sterile disposable square petri plates (10pc/pkt) 388 Viral transport medium (3ml/Vial) 389 Kovac’s indole reagent 100 ml/ Bottle 390 Centrifuge tubes 50ml (Glass) 100pc/box 391 Centrifuge tubes 15ml (Glass) (Consumable)100pc/box 392 Erlenmeyer flask (1000ml) (Consumable) 1pc 393 Microtube rack (5x16 holes) per rack 394 Wash bottle capacity 500ml/pc 395 Sterile Disposable Forceps (10pc/pack) 396 Steam indicator tape size 18mm (1-Pc) 397 Autoclavable Dispo bag “14” (50/Pack) 398 Indicator pH paper(pH 5 to 7.5) (5 Bundle / Pack) 399 Permanent Marker Pen (Red/Black) (narrow tip) (1-Pc) 400 Homogeniser with serrated pestle S.P 10ml (1-Pc) 401 Nichrome loop 4mm, Double wound (10pc/Pack) 402 Nichrome loop 2mm, Double wound (10pc/Pack) 403 Semisolid IMRV Medium and selective supplement FD19 -2vl, 500gm/Bottle 404 Sample Discarding jar 3L capacity (Borosil) (1-pc) 405 Sample Discarding jar 5L capacity (Borosil) (1-pc) 406 Conical flask 500ml capacity (Borosil) (1-pc) 407 Kala-azar detection rapid test (25kit/box) 408 Blood culture bottle/BHI (paediatric) 20ml capacity (10pc/box) 409 Blood culture bottle /BHI(adult) 70ml capacity (10pc/box) 410 India Ink reagent (Nigrosin stain 10% w/v (100 ml) and Methylene blue (125ml/Bottle) 411 Scrub typhus IgM ELISA 96 well test kit/box 412 Chikungunya IgM ELISA 96 well test kit/box 413 JE IgM capture ELISA 96 well test kit/box 414 Dengue IgM ELISA 96 well test kit/box 415 Dengue NS-1 Ag ELISA 96 well test kit/box 416 Cryptococcal Ag rapid test (25kit/box) 417 L J medium slant 10 Slant/pack 418 Capped Collection tube 1.5ml capacity (50pc/box) 419 MicroAmp Optical tube 8/strips (0.2 ml capacity) (8 x 125 Strip) 420 MicroAmp Optical 8 cap strips (0.2 ml) (8 x 300 strip) 421 Micro Centrifuge Tube 1.5ml capacity (500pc/Box) 422 Serological pipette 10ml (200pc/box) 423 Serological pipette 5ml (250pc/box) 424 ART Barrier Specialty Pipette Tips 1000µl racked (96x1 Box) 425 ART Barrier Specialty Pipette Tips 20-200µl racked (96x1 Box) 426 ART Barrier Specialty Pipette Tips 2-20µl racked (96x1 Box) 427 ART Barrier Specialty Pipette Tips 50µl racked (96x1 Box) 428 ART Barrier Specialty Pipette Tips 0-10µl racked (96x1 Box) 429 Safeskin purple nitrile gloves (Medium) 100/Box 430 N95 Particulate Respirator (NIOSH Approved) 1pc 431 Kimwipes 37.33x42.16 cmn (140/box) 432 Cryo Vial Sterile 1.8ml (25vial/pkt) 433 Cryo Box 1.8ml (9x9 wells) (1 x 4 / box) 434 FG-optical Adhesive Covers for PCR, 1pc 435 MicroAmp Optical 96-Well Reaction Plate (0.2ml), (1- Plate) 436 Zip lock bag 21.3x18cm (10bag/Box) 437 384 WELL PCR PLATE, (1- Plate) 438 Falcon tube 10ml (1pc) 439 Falcon tube 50ml (1pc) 440 Dacron Swab Stick (Nylon flocked) (100pc/Box) 441 Polypropylene Trigger Sprayers (500ml), 1pc 442 Stainless steel rectangular pan with sliding lid and handles tapered sides ( size 11 x 8 inch) , 1pc 443 Paraffin film (M) (1-Roll) 444 Syringe 3mL (1-Pc) 445 Ria Vial 3ML (1-Pc) 446 Red cap tube 3ml (1-Pc) 447 Aluminum foil (72 meter) (1-pc) 448 Isopropanol 99.9% (500ml/Bottle) 449 Cotton (500gm/Pack) 450 Spirit Surgical grade (1Lt/Bottle) 451 Spirit absolute (40 Lt/Gallon) 452 Hypochlorite soln (5%/4.6%) (1Lt/Bottle) 453 Sterilium hand rub ( 500ml/Bottle) 454 Liquid hand wash (750ml/Pack) 455 Blotting paper (1-Sheet) 456 Tourniquets for blood collection (1-pc) 457 Loose gloves M (7/7.5) (100/Box) 458 Surgical gloves M (7/7.5), (1-pc) 459 3 ply surgical mask , (1-pc) 460 Surgical Head cap, (1-pc) 461 Face/protective shield , (1-pc) 462 bleaching powder (25kg/Bag) 463 Protective Goggles (1-pc) 464 RNA extraction Kit (1-Rxn) 465 RNA Zap water 200ml /bottle 466 Ethanol absolute molecular grade (500ml/Bottle) 467 Thermacol transport Box (18cm x 12 cm) (500pc/bag) 468 Tissue Paper (Toilet paper roll) (9pc/Pack) 469 Labeling Stickers sheets(ST-65A4) (100sheets/Pack) 470 Disposable Tongue depressor (spatula) (100pc/Pack) 471 Nuclease Free Water (molecular grade) 1000ml/pack 472 Glucose Strip 473 Taqpath Multiplex RT PCR kit for the detection SARS CoV-2 474 Taqman Sequence detection (Primer + Probe) for Screening (E Gene & RNP) and Confirmatory (RdrP, & HKU ORF Ib) 475 Seegene Allplex 2019-nCoV assay R 476 Mylab Patho Detect Covid-19 Qualitative PCR kit 477 A*Star Fortitued kit 2.0 Covid-19 RT-PCR Test 478 Pandemic H1N109 assay set 479 Super Script III Platinum qRT PCR Reagent 480 Agpath One step RT PCR Reagent 481 LabGun Covid-19 RT PCR kit 482 BGI RT PCR kit for detection SARS Cov-2
Contract Date: Ref. Documents Contract Value : Ref. Document
Boards / Undertakings / PSU No of Bidders 9
Uttar Pradesh View Result →
18.
Defence #8347379 AOC
Tender For Special Repair To Bldg No 09 (Adm Bldg) Of 1 Up Girls Bn Ncc Under Ge (East) Agra.; 1 Taking down existing roof treatment and all loose and de-bonded concrete/ screed, loose particles, dirt etc & Debris should be removed from Bldg, roof substrate must be pressure-washed with water with, a minimum working pressure of 1,400 psi is to be used to and/or remove all dirt, dust, chalking and waste products. Remove algae, mold by using bleach solution or biowash etc complete all as specified & directed. 2 M&L for repair of all visible hairline cracks on concrete roof / screed more than 0.50 mm and not giving hollow sound, should be cut and widen in V shape with mechanical cutter in the size (10mm W x 6mm D). Fill cracks withPU sealant / Hybrid Sealant with suitable gun and smoothed with a putty knife or trowel. Allow sealant to cure a minimum (72 Hrs.) 3 days etc complete all as specified & director. 3 M&L for remove loose and damaged concrete roof screed in pockets with mechanical cutter. Clean the concrete screed with high pressure water jet to remove dirt and loose particles. Brush apply a bond coat ofPidicrete URP mix in the ratio of 1:1 (URP 1: Cement 1) by volume to make it lump free slurry when applied on in the pre wet surface. Laid to fall roof screed in correct slope and gradient. Mix Dr. Fixit Pidicrete URP 10% by weight of cement in (M20) concrete in ratio of 1:1.5:3 i.e., one bag of 50kg cements: 1.5 times volume of sand: 3 times volume of aggregates: 25L water. Level the repair mortar and finish with trowel average 25mm thick. Moist cure should be done for 7days. Air cure screed for 7days, before application of roof top coat coating system etc complete all as specified & directed. 4 Apply one coat ofCipoxy 16D primer in the ratio 1:1 spreading at the rate of 0.200 kg-0.250 kg /sqm in complete dry condition where moisture contain below 7% (should be checked with moisture meter)Allow the primer coat to dry for 6 to 8 hours. Apply 1st coat ofRoofseal Classic without dilution spreading at the rate of 0.70/litre/Sq.mt/Coat until all surface is covered. Lay a 45 GSM Fibre glass mesh as a reinforcing material which is incorporated in the coating when the first coat is still in wet condition. Allow the first coat to dry for approximately 4 to 6 hours. Apply the second of chemical with the same application coverage, but in a direction perpendicular to that of the first and second coats. Allow each coat to air cure for a minimum of 4-6 hours after application. Check to see no void surface is left untreated / uncoated.Allow the system to air cure for 7 days minimum etc complete all as specified & directed. 5 Diasmantling bricks (laid flat or on edge) or brick tiles in floors, channels,kerbs, aprons, etc. (each layer) laid bedded and pointed in nay mortor complete all as specified and directed. 6 M & L brickwork with sub- class ‘B’ bricks ( laid dry/mud mortor) straight or curved on plan exc 6 m mean radius complete all as specified and directed. 7 All as per item No 06 as above but except brick complete all as specified and directed. 8 M & L for flush pointing to brick work in CM (1: 3) on laid dry brick work as mentioned in abovecomplete all as specified and directed. 9 Dismantling floor, hearth wall tiling including cement mortar bedding (but not backing) including rubbish off the premises complete all as specified and directed. 10 M&L for vitrified colour Ceramic joint free tiles 10 mm thick (square/ rectangular) polished, area of each tiles exceeding 0.18 sqm but not exceeding 0.38sqm, in floors etc. set and jointed in neat cement slurry and pointed in white or coloured cement to match ceramic coloured tiles joint free decorative (square/ rectangular) area of each tilessqm in floors etc set and jointed in neat cement slurry and pointed with white cement and coloured pigment to match the tiles over 15mm thick screed bed in CM 1:6.complete all as specified and directed. 11 M&L for vitrified colour joint free ceramic tiles 10 mm thick (square/ rectangular)polished, area of each tiles exceeding 0.18 sqm but not exceeding 0.38sqm in skirting/vertical surface etc set and jointed in neat cement slurry and pointed with white cement and coloured pigment to match the tiles including 10mm thick rendering in CM 1:4 on brick wall complete all as specified and as directed. 12 M&L for7 to 8 mm thick non skid ceramic coloured tiles joint free(square/ rectangular) area of each tiles exceeding 0.11 sqm but not exceeding 0.18 sqm in floors etc set and jointed in neat cement slurry and pointed with white cement and coloured pigment to match the tiles over 15mm thick screed bed in CM 1:6.complete all as specified and directed. 13 M&L for coloured glazed ceramic tiles 450x350x7mm thick, on vertical surfaces such as skirting, dados and risers to stepsetc, set and jointed in neat cement slurry and pointed in white or Coloured cement to match including 10mm thick rendering in CM 1:4 on brick wall complete all as specified and as directed. 14 Dismantling stone slabsof any description or thickness in floors / dados, etc laid bedded and pointed in any mortar complete all as specified and directed. 15 M&L Granite 20 mm thick in steps, pillars, window cills, pillars, window cills, cooking platforms and like laid and jointed with grey cement slurry mixed with pigment to match the shade of the slab incl rounding edges of stone slab one edge and including 20 mm thick screed bed or bedding layer of cment mortar (1:6) complete all as specified and as directed. 16 M & L for machine cut Kota stone slab flooring 20-22mm thick over 15mm thick screed bed in CM 1:6. laid and jointed with grey cement slurry mixed with match the shade of the slab including rubbing and polishing complete all as specified and directed. 17 M & L for kota stone slab 20-22 thick in riser of steps, skirting, dado and pillar laid over 10mm thick backing coat in CM 1:4 and jointed with grey cement slurry mixed with match the shade of the slab including rubbing and polishing complete all as specified and directed. 18 Dismentling wall and ceiling board or insulation board /slabs/blanket any thickness including cover fillets etc all as specified and directed. 19 S&F 605x605mm snap grid of powder coated galvanized iron of angle of size 23mm x 23mm of 30 gauge (Perimeter), T section of size 23mm x35mm main and 23mm x 27 mm (intermediate) of 30 gaugesuitable for false ceiling including GI wire 2 mm thick @ 1200 mm centre to ceter both ways for hanging arragement coplete all as specified and directed. 20 M&L for 4mm thick non asbestos fibre cement building board designer as in ceiling (flat or slopping) of size 600 x 600mm fixed to GI snap grid frame workcomplete all as specified & directed. 21 Dismantling asbestos cement (corrugated, semi-corrugated sheet/ North light curve, Ridge etc.) sheets in roofcoverings complete all as specified and directed. 22 S&F of Pre- painted galvatume aluminum zinc coating GI based corrugated steel sheet 0.50mm thick of an colour having tensile strength of 550 Mpa as in roof covering/cladding to wall, fixed with self tapping screws as specified complete all as specified and directed. 23 Dismentling wall panneling board or insulation board /slabs/blanket any thickness including cover fillets etc all as specified and directed. 24 S&F solid PVC Wall Lining for wall panellingconsisting of 5 mm thickprintedcolour PVC sheet inclusivefixing with all accessoriesat site as per specifications and drawing complete all as specified and directed. 25 M&L for 5 mm thick PVC sheet fillet of width 35 mm for wall panelling inclusive of fixing on to wall to make PVC frame as per specified & directed. 26 Demolition of brick work or stone/boulder masonary built in cement mortar including all quoins, arches, pillars etc complete all as specified and directed. 27 M&L brick work with sub class B bricks straight or curved on plan exc 6m mean radius built in CM 1:6 complete all as specified and directed. 28 All as peritem no 27 abovebut except bricks complete all as specified and directed. (Note:- Bricks obtained from item No 26) 29 M&L brick work with sub class B bricks straight or curved on plan exc 6m mean radius in half brick thick wall built in CM 1:4 complete all as specified and directed. 30 Taking down cementplaster,and any kind wall cladding tiles/brick stone of any discription on bricks or stone walls/ceiling etc including racking out joints, hacking for kay, scrubbing down with water complete all as specified and directed. 31 M &L for 10 to 12mm smart care ready mix repair plaster is a specially designed ready to use cement-based plaster with high quality polymer additives and well graded sand and fillers which can be used for plastering (as per manufacture instructions) over interior wall surfaces complete all as specified and directed. Note: Coverage for smart care ready mix plaster shalll be 24 - 28 kg / sqm). 32 M &L for 10 to 12mm smart care ready mix repair plaster is a specially designed ready to use cement-based plaster with high quality polymer additives and well graded sand and fillers which can be used for plastering (as per manufacture instructions) over exterior wall surfaces complete all as specified and directed. Note: Coverage for smart care ready mix plaster shalll be 24 - 28 kg / sqm). 33 M & L for washed stone grit plaster on exterior walls in two layers , under layer 12mm th cement plaster 1:4 ( 1 cemant : 4 coarse sand ) furrowing the under layer with scratching tool , applying cement slurry on the under layer @3 Kg of cement per sqm , top layer 15 mm th cement plaster1 :1 / 2 :2 ( 1 cement : 1/2 coarse sand : 2 stone chipping 10 mm nominal size ) in panels with groove all arround as per approved pattern incl. scrubbing and washing the top layer with brushes and water to expose the stone shipping complete all as specified etc 34 Forming groove of uniform size 15 mm wide and 15mm deep in the top layer of washed stone grit plaster as per approved pattern using wooden battens nailed to the under layer incl. removal of wooden battens, repair to the edges of panels and finishing the groove complete all as specified & directed. 35 M&L for rendering 10mm thick in two coats each 5 mm thick plastering on concrete surfaces of ceiling/Chajja in CM 1:3, finished the surfaceeven & smooth complete all as specified and directed. 36 M&L for preparation of newly plastered surfaces of ceiling and applying three coat of white wash complete all as specified and directed. 37 M&L for applying two or more coats of acrylic emulsion polymer paint (waterproof rain coat of Dr. Fixit or equivalent )having, Alkali & fungal resistance, dirt resistance exterior paint of required shade over and including priming coat of exterior primer applied @ 0.90 litre/ 10 sqm over new plastered surfaces of wallincluding preparation and over 2-3 mm thick wall care puttycomplete all as specified & directed. 38 M&L for applying Two or more coats of acrylic emulsion polymer paint (wateproof rain coat of Dr. Fixit or equivalent )having, Alkali & fungal resistance, dirt resistance exterior paint of required shade over and including priming coat of exterior primer applied @ 0.90 litre/ 10 sqm over old plastered surfaces of wallcare putty over oldplastered surfaces of wallincluding complete removal of existing treatment of walland over 3 mm thick wall care puttycomplete all as specified & directed. 39 Complete removal of existing treatment of old plastered or unplastered surfaces of wallsand applying two coats of oil bound distamper over a coat of average 3 mm thick wall care putty complete all as specified and directed. 40 Preparing new plastered or unplastered surfaces of wallsand applying two coats of oil bound distamper over a coat of average 3 mm thick wall care putty incl rubbing complete all as specified and directed. 41 Complete removal of existing treatment of old stone/concrete surface of ceiling and applying two coats of synthetic enamel paintover a coat of primercomplete all as specified and directed. 42 Taking down chowkats or frame with shutter (without taking off shutters from the frame) not exc 1.5 Sqm each complete all as specified and directed. 43 All as per item No 42 before but exc 1.5 Sqm and not exc 4.00 Sqm each complete all as specified and directed. 44 S&F powder coatedaluminium door & framewith reqd size of aluminium sections weighing 0.55 kg/m including 5 mm thick tinted glass coloured in half portion andin other half portion 8 mm thick ACP sheet of any colour complete and fixed with anodized aluminium snap beading, glazing clips, joining clips, screws,SS hinges and 02 Nos of aluminium handle on each door shutter, aluminium anodized tower bolt 200 mm long 02 Nos on each shutter and mortice lock device complete with double keys for each lock, 01 No Hydraulic door closer for each shutter complete all as specified and directed with following specifications:- (a) Aluminium door frame = 64x38 mm(b)Aluminium style/top& middle rails of shutter = 82.5x44 mm(c) Aluminium bottom rail of shutter = 82.5x44 mm(d) Aluminium door frame with shutters shall be fixed in position in brick wall opening as required according to site conditions including all fastening arrangements etc complete all as specified and directed. 45 S&Fwindowsmade of pre-painted steel (Base steel as per IS 513 of 0.58mm thick “D” Quality galvanized as per IS 277 with zinc of 120 GSM). Primer coated with epoxy primer of 5-7 microns thick, finish painted with a polyester paint of 12-16 microns thick and back coated with 5-7 microns thick alkyd backer. Section for outer frame should be of 72x55mm, centre mullion should be of 72x50mm, section for fixed glass beading should be of 12x12mm and section for shutter should be of 52 x 25mm. Outer frame & mullion sections to have rebate for glazed shutters, fly mesh and 20 mm provision for guard bars/ grills fly mesh shutter section should be of 20x40mm. The sections are to be cut to length mitre joined with corner bracket. Centre mullions to be fixed with mullion cap. Elixir or equivalent stay, handles 2nos of heavy-duty stain less steel pivot hinges shall be provided per shutter. The windows should be panelled with 4 mm thick plain float glass and S.S. Mesh for fly mesh shutter (304 grade). Rubber Gaskets are provided all around the glass. The above frames should be fixed to the concrete/masonry wall by means of self-expanding, screws. Including 10mm square guard bars with 6” (152.4mm) pitch, complete for finished item of work including of all taxes etc as specified and directed. 46 S&F ventilator made of pre-painted steel (Base steel as per IS 513 of 0.58 mm thick “D” Quality galvanized as per IS 277 with Zinc of 120 GSM). Primer coated with epoxy primer of 5-7 microns thick, finish painted with a polyester paint of 12-16 microns thick and back coated with 5-7 microns thick alkyd backer. Section for outer frame should be of 48x50mm, centre mullion should be of 48x50mm, section for shutter should be of 52x 25mm and rebate for Glazed shutter with a 20mm provision for Guard bars/Grills. The sections are to be cut to length metre joined with corner bracket. Centre mullion is to be fixed with mullion cap. Handle, stay, 2 nos. of Stainless Steel heavy duty Pivot hinges shall be provided per shutter the windows fitted with 4mm thick plain float glass with rubber gaskets including fixing the frames in concrete/masonry wall by means of self expanding screws, Including fixed panel beading section should be of 12x12mm. Outer frame and mullions to have 10mm Square guard bars with 6” (152.4mm) pitch etc., complete for finished item of work. 47 M & L mild steel farmed work as in doors (as in ckowkats/shutter frame) or gates of angle or other section with guest plates rail, brasses rail etc exculsive of steel sheeting or other covering hanging also fastening and fixing complete confirming to GdeFe-410-W(Gde-E-250)quality-B including shop coat of red oxide including prepration of surface before fixing complete all as specified and directed. 48 M&L for Mild steel, plain, black sheet 1 mm thickin wall cladding, steel gates and similar work, cut to size, holes punched; including round headed screws, clout nails or rivets and fixed to wood or steel framing with plain 40 mm lap joints with riveted or welded seams, ncluding bending or turning up, mitred angles, etc. as required 49 S&F of factory made soild PVC door frame of size 50mmx47mm made out of 5mm thick single side prelam PVC sheet reinforced with mild steel square tube , supplying & fixing in opening as per specification and drawing complete all as specified & directed.. 50 S & F Factory Made Solid PVC Moulded Door Shutter, 28 to 30mm thick (stiles), with 2, 4, or 6 raised panel design with 2 mm thick Moulded PVC Sheet on the front face & 2mm plain colour PVC sheet on back face with particle board core, supplying & fixing in frame at site as per specification & drawing complete all as specified and directed. 51 Taking down shutter of any description area ofeach shutter exc 2 Sqm complete all as specified and directed. 52 S&F 30mm thick flush door shutter, with particle boardcore construction , and plywood face pannels , commercial type on the both sides complete all as specified and directed. 53 S&F 100 mm long stainless steel hinges type B-12 and fixed with screw/ welding complete all as specified and directed. 54 M&L 100 mm long aluminium anodized handle cast type complete all as specified and directed. 55 S&F 150mm long aluminium anodized barrel tower bolt of extruded section complete all as specified & directed. 56 S&F Aluminium alloy, anodised, 200 mm sliding door bolt with hasp, staple (bolt type) and fixing clips of sheet, cast or extruded sections and fixing bolts and sliding bolts of extruded sections or cast-aluminium alloy and fixed complete all as specified and directed. 57 S&F Aluminium alloy, anodised, 250 mm sliding door bolt with hasp, staple (bolt type) and fixing clips of sheet, cast or extruded sections and fixing bolts and sliding bolts of extruded sections or cast-aluminium alloy and fixed complete all as specified and directed. 58 M&L for applying two coats of synthetic enamel paint over a coat of pink primer on wooden surface over 10 cm width or girth including preparation of new or previously untreated wood surfaces complete all as specified. 59 M & L for preparation of new or previously untreated steel surfaces of any description, over 10 cm width or girth, not otherwise described and applying two coats of synthetic enamel paint over one coat of red oxide primer complete all as specified and directed. 60 Dismantling wrought iron or mild steel work any description not otherwise provided for complete all as specified and directed 61 S & F Steel work in tubular/angle irontrusses & postincluding special shaped washer etc. complete using ERW or induction butt welded tubes conforming to I. S.1161- 1979 grade St.-240 complete all as specified and directed. 62 Demolition of cement concrete in ground floor and paving n exc 15cm thickness (below or above the ground level) built in cement mortar complete all as specified and directed. 63 M&L for 100 mm thick Cement concrete type D-2 1:4:8 (using 40 mm graded stone aggregate) in sub base of flooring/ hard standing finishing surface even and rough using broomfinish complete all as specified and directed. 64 M & L hard core of broken stone or boulder having gauge n exc 63mm, deposited, spread and levelled in layers n exc 15 cm thk, watered and rammed to a true surface, complete all as specified and as directed. 65 M&L for providing and laying 80 mm thick factory made chamfered edge cement concrete paver block of M-30 grade with approved colour, design & pattern as in footpath,parks, lawns, drive ways or light traffic parking etc., of required strength, thickness & size/ shape, made by table vibratory method using PU mould, laid in required colour & pattern over and including 50mm thick compacted bed of coarse sand,compacting and proper embedding/ laying of inter locking paver blocks into the sand bedding layer through vibratory compaction by using plate vibrator, filling the joints with fine sand and cutting of paver block as per required size and pattern, finishing and sweeping extra sand; complete all as specified & directed. 66 M & L 75 mm thick Cement concrete type C-2, 1:3:6 (USING 40mm graded stone aggregate) as in plinth protection complete all as specified and directed. 67 M&L for providing, PCC 1:3:6 type C-1 (using 20mm graded aggregate) for embedding hold fasts/coping /padding including necessary form work etc.complete all as specified and directed. 68 S & F150mm floor door stopper of aluminium alloy body and tongue, anodised,with hard drawn steel spring, fixed in floor complete all as specified and directed. 69 S&Fdrapery (curtain)rod 25mm dia Stainless steel grade 304 approved quality and colour includingside cups,fixing arrangement with drilling holes in walls brackets etc complete all as specified and directed. 70 Taking up or down 15mm dia steel tubing and connections etc including cleaning for re-fixing or removal from site complete all as specified and directed. 71 S&F 15 mm bore GI tubes medium grade, galvanised with all fittings and fixed complete to walls and ceiling or laid in floors complete all as specified and directed. 72 Taking up or down20mm dia steel tubing and connections etc including cleaning for re-fixing or removal from site complete all as specified and directed. 73 S&F 20 mm bore GI tubes medium grade, galvanised with all fittings and fixed complete to walls and ceiling or laid in floors complete all as specified and directed. 74 Cutting Chases, pinning in brick/Concreate wall making good to facing where required and pointing in cement mortar 1:3 ends of edges of landing, steps cills sunshade shelves lintles etc and cutting chase for concealed water tubing or or concealed conduit wiring. etc and making good cutting N. exceeding 10 CM girth complete all as specified and directed. 75 S&F in repairs oval type wash basin superior quality 537x439 mm size incl fitted with granite top/baroda green stone over precast RCC slab including waste coupling and incl suitable size CPbottle trap connected upto grating complete all as specified and directed. 76 M&L for demolition of reinforced cement concrete of any description and in any position complete all as specified and directed. 77 M & L for reinforcement cement concrete (Nominal Mix) 1:2:4 type B-1 (using 20mm stone aggregrate) as in slab supported on wallfor wash hand basin complete all as specified and directed 78 M &L forFormwork to soffits of suspended slabs such as roof slabs, floor slabs, landings and similar work and fair finished surfacenot exceeding 200mm thick (Horizontal or sloping) complete all as specified and directed 79 Formwork to edges of concrete flats, treads, breaks in floors,window cills, concrete railings, openings in concrete walls, floor and roofs n exc 20 cm wide complete all as specified and directed. 80 M & L mild steel bars 10mm dia and over, cut to length, bent to shape required, including cranking, bending spirally for hooping for columns, hooking ends and binding with and including mild steel wire(annealed) not less than 0.9mm dia or securing with clips complete all as specified and directed 81 All as per Item No 80 abovebut 6 to 8mm dia complete all as specified and directed. 82 S & F vitriouschina wash down water closed pan (Pedestal Pattern ) with P and S trapp including connection to trap and cistren and flush pipe (excl flushing cistren)and making good to disturbed surface of floor all fixed as in repairs all as specified and directed. 83 S&F in repairs vitreous China squatting pan (Orissa pattern), white, of size 580x440mm white, with CI P or S trap, integral foot rests including flush pipe, trap, lime concrete bedding inlcuding taking out of old lime concrete bedding, unserviceable connections etc connecting up new and making good disturbe portioncomplete all as specified and directed. 84 S&F in repairbib taps, cast copper alloy, fancy type, chromium plated with crutch or butterfly handles, screwed down, screwed for 15 mm bore GI pipe or for brass ferrule orto GI socket or PPR pipe etc making good disturbed portion complete all as specified and directed. 85 S&Fin repair 15 mm bore CP Angle valve two way fancy type with wall flane, highpressure, withcrutch or butterfly handle, screwed both ends foriron pipe orfor unions and fixed complete all as specified & directed. 86 S&F in repair15 mm bore, single lever brass chromium plated wash basin mixer wothout popup waste with 450mm braided hoses opal prime fixed to wash hand basin complete all as specified and directed. 87 S & F in repair 15mm dia Pillar taps, cast copper alloy fancy type, with capstan eads,chromium plated, screwed down high pressure, with or without lettered Hot or Cold with long screwed shanks and fly-nuts,screwed for iron pipe complete all as specified and directed. 88 S&F in repair 15 mm borestop cock, (Concealed type) cast copper alloy, fancy type, chromium plated with crutch or butterfly handles, screwed down, screwed for 15 mm bore GI pipe or for brass ferrule orto GI socket or PPR pipe etc making good disturbed portion complete all as specified and directed. 89 S & F in repairs brass chromium plated shower rose 125 mm size, long body ( Arm size should not be less than 450 mm ) with or without swivel joints, any size, including fixing to steel pipe or union etc complete all as specified and directed. 90 S&F in repairs 5 mm thick bevelled edge mirror of selected quality glass of required size and shape with 50x20 mm teak woodpolished beading mounted on 6 mm thick commercial ply wood / ACP / PVCand fixed to wooden plugs with chromium plated brass screw and cup washers complete all as specified and directed. 91 S&F in repairs 600 x 450 mm bevelled edge mirror of selected quality glass 5 mm thick mounted on 6 mm thick commercial ply wood aluminium frame and fixed to wooden plugs with chromium plated brass screw and cup washers complete all as specified and directed. 92 S & F in reapirtoilet paper holder with flat recessed type stainless steel, chromium plated or stainless steel with necessary brass nuts & rubber washers, covered with chromium plated spring complete all as spd and directed. 93 S&F in repair 500 ltrs capacity rotational moulded polyethylene white colour water storage tank double layered, ISI engraved (cylindrical vertical with closed top) hoisted and fixed in position incl dismantling of water tankcomplete all as specified & directed. 94 S & F in repair of plastic WC seat cover and mild steel chromium plated or aluminised hinging device asetc complete all as specified and directed. 95 S & F in repairs flushing health faucet for pedestal pattern WC incl .flexible pipe and brass chromium plated nuts and bolts and water pipe of size 1150 mm long between dia & fixed completed all as specified and directed. 96 S & F in repairsPVC connections 15 mm size with PTMT nuts of length 600 mm complete all as specified and directed. 97 S&F in repairs 10 litres capacity PVC valveless, syphonic action type, flushing cistern, low level, white, with inlet, ball valve, float and handle including brackets and PVC connections 15mm size with PTMT nuts of length 450mm inlcuding taking out of old unserviceable connections etc, connecting up new and making good disturbe portion complete all as specified and directed. 98 Supply & fixing in repair brass CP tubular towel rail, 60 cm long, 20mm bore, chromium plated complete all as specified & directed 99 S & FCI floor trap, plain with grating including jointing with solvent cement (Diameter of outlet 100 mm), jointing to waste pipe and fixed in cement concrete 1:2: 4 (type B1) mixed with pedilite water proofing liquid @ 200ml in 50 kg cement, inlcuding taking out of old unserviceable connections etc, connecting up new and making good disturbed portion complete all as specified and directed. 100 S & FCI floor trap, plain with grating including jointing with solvent cement (Diameter of outlet 75 mm), jointing to waste pipe and fixed in cement concrete 1:2: 4 (type B1) mixed with pedilite water proofing liquid @ 200ml in 50 kg cement, inlcuding taking out of old unserviceable connections etc, connecting up new and making good disturbed portion complete all as specified and directed. 101 S&F in repair CP soap dish brass chromium plated, size 100 x 60mm, fixed to wall with rawl plugs and chromium plated screws complete all as specified and directed. 102 Supply only integral water proofing compound liquid admixture for mortarcomplete all as specified and directed. 103 S&F in repair 500 litres capacity Rotational moulded polyethylene water storage tanks (Cylindrical vertical with closed top) hoisted and fixed in position including 20 mm dia PVC float valve complete all as specified and directed. 104 Disconnecting existing tanks exc 250 Ltr but not exc 500ltr Cap, setting aside (or lowering if required) for repairs, cleaning, etc. and hoisting if required reconnecting and re-fixing in position. (Cleaning repairing etc. measured separately) 105 M & L for 5mm thick PVC Sheet board of size 3 x 2 and mounted on wall suitable beading including all the necessary arrangementlike screw bolt etc and basic specification written on it etc cmplete all as specifed and directed. 106 S&F in repairs 600 x 450 mm bevelled edge mirror of selected quality glass 5 mm thick mounted on 6 mm thick commercial ply wood aluminium frame and fixed to wooden plugs with chromium plated brass screw and cup washers complete all as specified and directed. 107 S & F in reapir 110mm bore PVC (SWR) pipes single socketed in any length with rubber ring joints, fixed to wall complete all as specified and directed. 108 S & F in repair110 mm bore PVC (SWR) bends of any radius complete all as specified & directed. 109 S&F stack clamps out of 50 mm by 5 mm flat iron and 16mm dia round iron stays, including bolts and nuts and securing ends of stays to wall or roof for 100mm dia bore of pipe complete all as specified and directed. 110 Taking down carefully existing unserviceable copper / aluminum point wiring of any description & in any position with and ncluding taking out existing unserviceable conduits or battens of any descriptionwith sunken boxes/junction boxesand all fitting, accessories & fixtures such as switches, ceiling roses, pendants, regulators, socket, light fittings, lamp holders etc but excluding tube light fittings and making good the disturbed surface of walls, floors, ceiling etc to match with the existing surfaces complete all as specified and directed. 111 M&L point wiring with 1.5 sqmm multi stranded copper conductor 1100 volts.grade FRLSH PVC insulated unsheathed cable with proper colour codingdrawn in including PVC concealed conduit not less than 20 mm dia with all accessoriesandFRLSH PVC insulated 1.5 Sqmm multi standard unsheathed copper wire for continues earth, including cutting and chasing of wall surface for laying PVC conduit and modular sunken box and connecting earthand making good to the disturbed surfaceof wall/floor and matching with existing specifications. Connections of cable with MCBs or bus bar shall be done through proper size copper/brassthimbles.Note :Conduit shall be fixed on surfaceof roof with necessary saddles where concealing of conduitis not feasible at no extra cost for the following :- (a) One light /fan point controlled by one switch 112 (b) One 5 pin socket outlet 5 Amps on independent board 113 (c)One 5 pin socket outlet5 Amps on same board 114 (d)One bell/buzzer point controlled by one push button on the same board with other switches or independent 115 All as per item No 111 here in before but with cable size 4 Sq mm for one 5 pin 15/16 Amps socket out let on independent board and multistrand insulated copper earth continuity conductor of size 4 sqmm all as specified and directed. 116 Supply and fixing modular switch piano single pole, one way 6 Amps 1 module, complete all as specified and directed. 117 Supply and fixing modular switch piano flush type 16 Amps single pole one way, one module, complete all as specified and directed. 118 Supply and fixing modular socket outlet2/3 pin 6 Amps combined 2 module, complete all as specified and directed. 119 Supply and fixing modular socketmultipurpose 3 pin 6/16 Amps combined 2 module, complete all as specified and directed. 120 Supply and fixing Modular Bell push 6A 1 module pole, one way, complete all as specified and directed. 121 Supply and fixing in repaircall bell, Ding dong type, 230 volts AC single pole complete all as directed. 122 Supply and fixing modular step typetwo module electronic fan regulator heavy duty 120watts 240 volts. complete all as specified and directed. 123 Supplying & fixing for ceiling rose PVC Polycarbonate isolated body 62.5 x 25 mm, three terminals, complete all as specified & directed. 124 Supply and fixing modular cover plate with frame (inner and outer) 1 module for mounting switch and sockets all as specified and as directed. 125 Supply and fixing modular cover plate with frame (inner and outer) 2 module for mounting switch and sockets all as specified and as directed. 126 Supply and fixing modular cover plate with frame (inner and outer) 3 module for mounting switch and sockets all as specified and as directed. 127 Supply and fixing modular cover plate with frame (inner and outer) 6 module for mounting switch and sockets all as specified and as directed. 128 Supply and fixing modular cover plate with frame (inner and outer) 8 module for mounting switch and sockets all as specified and as directed. 129 Supply and fixing blank spacer plate for single module. 130 Supplying and fixing 20 watt LED battan surface / wall mounted with specially designed powder coated aluminum housing, high optically efficient polycarbonate diffuser, in built electronic driver duly pre-wired upto terminal block, power consumption < 20W, luminaire lumens > 2000 lms, driver efficiency > 85%, power facor > 0.95 THD < 20% as per IEC 61000-3-2, colour temp - 6500 K Surgeprotection 2.5 KV, 50000 burning hrs (min) as per L 70 criteria, two stages isolated constant current operated driver with range 150 - 270 VAC and safety extra low voltage safe level < 60 VDC as per IEC standard with LM 70 & 80 certificationand connecting the same to electric source with & using PVC sheathed and insulated three core copper conductor cable of size 0.75 Sqmm and fixing arrangements for fixing the light fitting, complete all as specified and directed. 131 Supplying and fixing 10 watt LED battan surface / wall mounted with specially designed powder coated aluminum housing, high optically efficient polycarbonate diffuser, in built electronic driver duly pre-wired upto terminal block, power consumption < 10W, luminaire lumens > 1000 lms, driver efficiency > 85%, power facor > 0.95 THD < 20% as per IEC 61000-3-2, colour temp - 6500 K Surgeprotection 2.5 KV, 50000 burning hrs (min) as per L 70 criteria, two stages isolated constant current operated driver with range 150 - 270 VAC and safety extra low voltage safe level < 60 VDC as per IEC standard with LM 70 & 80 certificationand connecting the same to electric source with & using PVC sheathed and insulated three core copper conductor cable of size 0.75 Sqmm and fixing arrangements for fixing the light fitting, complete all as specified and directed. 132 Supply & fixing LED security light compact & trendy of35watt with aluminium pressure diecast housing,IP 65 protection, luminaire lumens > 3000 lumens/W andin built electronic driver prewire upto terminal block with driver efficiency > 85 %, power factor > 0.95, as per IEC 61000-3-2, colour temp 6500 K Surge protection 3.5 KV, 50000 burning hrs (min) as per L70 Criteria, multi stage constant current operated driver with range 150-270 VAC and safety exra low voltage safe load < 60 VDC as per IEC standards with LM 70 & 80 certification complete all as specified, fixed to pole or wall of buiding with and including suitableBracket made out of25 mm dia GIlightgrade pipe, 1.0 m long bent to shape by cutting & weldingas required & directed and fixed withtwo Nos of FI clamps 50x6 mm to be tightened with suitabe size of bolts, nut and washers and including painted withtwo coat of aluminium paint over a coat of red oxide primer, and including connecting the fittingto electric sourcewith & including twin twisted copper flexible wire of size 0.75 Sqmm including all accessories and fixing arrangements for fixing the light fitting complete all as specified & directed. 133 Supply and fixing LED luminaire 600 mm x 600 mm, 35/36 watt, 220 V AC recessed type with high efficiency PMMA diffuser soft glare free light complete with driver, holders & LED lamp suitable for roof ceiling including connecting up with driver three core flexible copper conductor cases of suitable size complete all as specified and directed. 134 Disconnecting& taking up or down existing unserviceable sub main wiring of copper/aluminium conductor of any description, any size & in any position including taking out existing unserviceable conduits or battens of any description and making good the disturbed surfaces to the existing surfaces complete all as specified and directed. 135 M&L for sub main wiring using two 2x 6 sqmm single core FRLSH PVC insulated, unsheathed stranded copper conductor cable of voltage rating upto and including 1100 Volts drawn in and including concealed PVC conduit (Medium grade) of dia not less than 20 mm with standard accessories along-with one run of PVC (green colour) insulated , unsheathed, stranded copper conductorof size 6 Sqmm as earth continuity conductor connected to earth dolly complete all as specified and directed.Note : Two run of single core PVC cable with one run ofearth conductor and conduit /batten shall be measured as one unit. 136 Disconnecting and taking down old unserviceabledistribution boards any size any type including MCB TPN/SPN/SP etc and making good the disturbed surfaces to the existing surfaces complete all as specified and directed. 137 Supply & fix in repair/replacement of sheet metal enclosure Vertical TPN DB 4 way as per IEC 61439-3, Suitable for Flush Mounting and Surface Mounting, With 160 A Copper Busbar for each phase with 2 Neutral bar, 2 Earthbar and Cable ties for Cable management, fully insulated busbar & shrouded Neutral bars, Improved Pan assembly for ease of installation, Prefitted masking sheet, Reversible Door for IP- 43 DBs, With provision for 160 Amps MCCB as incomer and SP/TP MCBs as outgoing complete all as specified and directed. 138 Supply & fix sheet metal enclosure MCB distribution board. Single pole & neutral 240 volts8 way with IP-43 protection double door complete with appropriate size bus bar and neutral link complete all as specified and directed. 139 Supply & fix sheet metal enclosure MCB distribution board. Single pole & neutral 240 volts12 way with IP-43 protection double door complete with appropriate size bus bar and neutral link complete all as specified and directed. 140 S&F in repair sheet metal enclosure with socket plug top and MCB single pole and neutralwith two pin and earth plug top with one SP MCB 20 Amp 240 volt complete all as specified and as directed. 141 Supply and fixing MCB SP 1 to 32 Amp (C curve)having short circuit rating 10KA, 240 voltscomplete with connection testing and commissioning complete all as specified and directed. 142 Supply and fixing MCB SPN 32 Amp (C curve)having short circuit rating 10KA, 240 voltscomplete with connection testing and commissioning complete all as specified and directed. 143 Supply and fixing in repairMCCB 4 pole, 160 Amps, 50 Hz, Icu=25 KA at 415 volts with thermal magneticalongwith adjustable magnetic protection for current setting Icu=Ics = 100% with adjustable over load setting (minimum 70% to 100%) value from 10 to 15 times of related capacity as per IEC-60947-1 and 60947-2 standard complete all as specified anddirected. 144 M&L for earthing complete with galvanized earth plate electrode 600 x 600 x6mm thick burried directly in ground vertically to a depth not less than 2.25 M below normal ground level ) with top edge of the plate not less than 1.50 M below normal ground level , connected to and including galvanized steel wire 4mm dia as earth lead soldered and rivetedto earth plate by means of nuts, bolts, check nuts & washers, of galvanizediron or steelwith connected to test point and testing on completion including 15mm GI light grade pipe for earth leadprotection from earth point to earth plate, including provnadequate quantity of charcoal dust mixed with35 % common salt to a packed thickness of not less than 15 cm in alternate layers of charcoal and salt on all sides of earth platewith 20mm bore medium grade GI Pipe for watering,GI check nut, funnel and wire meshwith and includingall necessary excavation& earth work in soft/loose soil, returning filling in, removal of surplus soil to a distance 50 metre,,PCC 1:3:6 type C-1 as in earth pit, 40 mm thick RCC cover using cement concrete 1:2:4 type B-1 reinforced with & including 8 mm dia mild steel TMT bar @ 100 mm c/c Both way with suitable handle for lifting arrangement & including form work complete all as specified and shown in electrical plate No 3 of MES SSR Part I 2009 and as directed. NOTES:- On testing, after completion of Job, if desired earth resistance is not obtained, the earthing shall be redone at without any extra cost by contractor. 145 Dismantling, taking down exisitng ceiling fan/Exhaust fan and deposited to E/M store for re-fixing and connecting up including provision of cable from ceiling rose or connector to fan, complete all as specified and directed. 146 Supply and fix exhaust fan made of sturdy Engineering plastic complete with louvers shutter, voltage 230V, 50 Hz, RPM 1200, Copper winding of sweep 300m complete all as specified and directed. 147 Supply, fixing, connecting & testingceiling fans complete with blades, down rods, with remoteand other accessories, 230 V, 1200 mm sweep. Min air delivery 210 CFM with service value 6.00 BEE. Five star rated with brushless direct current motor (BLDC), and including connecting wire with new 3 core 0.50 Sqmm PVC insulated and sheathed copper conductor cable from ceiling rose and also writing MES No with black paintcomplete all as specified and directed. 148 Supply and fix in replacement electric water heater, storage type steel body with S/S inner tank and heating element upto 2 KW capacity 25 litre, BEE 5 Star rated complete with all accessories such as safety valve, thermostate, NRV, connection piece etc also writing MES No with black paintcomplete all as specified and directed.
Contract Date: Nov 27, 2025 Contract Value : 35.41 Lakh
Statutory Bodies & Commissions/Committees No of Bidders 11
Uttar Pradesh View Result →
19.
Public Administrative Department #8335180 AOC
Tender For Providing Gym And Play Equipment To Public Parks At Thanthaiperiyar Nagar In Kadirkamam Constituency-1 Code No. 2.8.1 Earthwork in excavation by mechanical means Hydraulic excavator) / manual means foundation trenches or drains (not exceeding 1.5m in width or 10 sqm on plan), including dressing of sides and ramming of bottoms, for lift, including getting out the excavated soil and isposal of surplus excavated soil as per direction of Engineer-in-charge , within a lead of 50m - kinds of soil. 2 Code No. 2.27 Supplying and filling in plinth with river sand under floors, including watering ,ramming consolidating and dressing complete 3 Code No. 4.1.10 Providing and laying in position cement concrete of specified grade excluding the cost of centering and shuttering - all work upto plith level - 1:5:10 (1 cement : 5 fine aggregate : 10 graded stone aggregate 40mm nominal size) 4 Code No. 6.1.2 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 3.5 foundation and plinth in -cement mortar 1:6 cement : 6 fine aggregate) 5 Code No. 6.13.2 Half brick masonry with common burnt clay F.P.S. (non modular) bricks of class designation 3.5 in superstructure above plinth level upto floor V level - cement mortar 1:4 (1 cement : fine aggregate) 6 Code No. 6.14 Extra for half brick masonry in superstructure above floor five level for every four floors or part thereof by mechanical means 7 Code No. 10.1 Structural steel work in single section , fixed with or without connecting plate, including cutting hoisting , fixing in position and applying priming coat of approved steel primer complete 8 Code No. 13.8.3 12 mm cement plaster of mix 1:5 (1 cement : fine aggregate) 9 Code No. 13.85.3 Applying priming coats with primer of approved brand and manufacture, having low VOC (Volatile Organic Compound ) content - with water thinnable cement primer on wall surface having VOC content less than 50 grams / litre 10 Code No. 13.99.1 Painting with synthetic enamel paint of approved brand and manufacture of required colour to give an even shade- One or more coats on old work 11 Code No. 16.70.2 Providing and fixing G.I.chain link fabric fencing of required width in mesh size 50 x 50 mm including strengthening with 2mm dia wire or nuts , bolts and washers as required complete as per direction of Engineer-in-charge - Made of G.I.wire of dia 4mm , PVC coated to achieve outer dia not less than 5mm in required colour and shade 12 SE-LAD Approved Rate No.42/LAD/SE(OM)/AE(P)/OM/-24/2022-23 dt.22-05-2022 Providing and laying factory made chamfered edge 60mm thick cement concrete paver block of M-35 grade with approved color and designed in footpath, parks, lawns, driveways or light traffic parking etc., of required strength, thickness & size/shape, made by table vibratory method using PU mold, laid in required color and pattern over 50mm thick compacted bed of sand, compacting and proper embedding / laying of interlocking paver blocks into the sand bedding layer through vibratory compaction by using plate vibrator, filling the joints with sand and cutting of paver blocks as per required size and pattern, finishing and sweeping extra sand, complete all as per direction of Engineer-in- Charge. 13 SE-LAD Approved Rate No.42/LAD/SE(OM)/AE(P)/OM/-24/2022-23 dt.22-05-2022 Supplying and fixing of M20 reinforced cement concrete bench 1.83 meters length, bottom slab 0.40m width with 0.065 thickness, back slab 0.28m depth and 0.05m thickness, side support handle of 0.070m thickness. Overall height of backside 1.04mts. Front side 0.64mts, including foundation concrete etc. complete as per the direction of Engineer-in-charge.
Contract Date: Nov 27, 2025 Contract Value : 1.78 Lakh
Local Bodies No of Bidders 4
20.
Defence #8268534 AOC
Tender For Special Repair To Main Gate, Duty Jco Room And Guard Posts Of 509 Abw Under Ge (East) Agra; 1 Dismantling of Plain or corrugated steel sheeting,any gauge, thickness, including Nainital or similar pattern roof coverings etc complete all as specified and directed. 2 S&F of Pre- painted galvatume aluminum zinc coating GI based corrugated steel sheet 0.50 mm thick of any colour having tensile strength of 550 Mpa as in roof covering/cladding to wall, fixed with self tapping screws as specified complete all as specified and directed. 3 S&F of Pre- painted galvatume aluminum zinc coating GI based plain steel sheet 0.50 mm thick of any colour having tensile strength of 550 Mpa as in roof covering/cladding to wall, fixed with self tapping screws as specified complete all as specified and directed. 4 S&F Pre-painted, galvanized, pre-fabricated PPGI sheeting 1.00 mm thick in ridges, hips, valley gutters, drip and straight flashings (length and girth as fixed) with grade of zinc coating 275 including all fixing arrangement etc. complete all as specified and directed 5 M&L for Cutting grooves in brick wall, 75 mm wide and 65 mm deep and shaping horizontal face of groove with cement mortar 1:3 etc complete all as specified and directed. 6 Dismantling timber scantlings 40 sq. cm and over in section, in any position etc complete all as specified and directed. 7 M&L for2nd class hardwood in scantling clean sawn and framed for roof truss etc completeall as specified and directed. 8 M&L for Preparing surfaces of wood and wood based materials, new or old, of any description and girth, not otherwise described and treated with two coat of Creosote oil all as specified and directed. 9 S&F of Rooftrusses (framed), trussed, purlins, crane gantries, rails and fastenings and heavy bracket framing (Beam, tee, angle, wind tie,channel,pipe or flat sections) including distance pieces, welding, cutting , cleats and connecting boltsetc Fe 410 -W (GdeE- 250) qualityA complete all as specified and directed. 10 M&L for preparation of new steel surfaces of any description over 10 cm width or girth, not otherwise described and applying two coats of synthetic enamel paint over a coat of red oxide zincchrome primer complete all as specified and directed. 11 Dismantling wall and ceiling board or insulation board /slabs/blanket any thickness including cover fillets etc complete all as specified & directed. 12 S&F in repair 605x605mm snap grid of powder coated galvanized iron of angle of size 23mm x 23mm of 30 gauge (Perimeter), T section of size 23mm x35mm main and 23mm x 27 mm (intermediate) of 30 gaugesuitable for false ceiling including GI wire 4 mm thick @ 1200 mm centre to centre both ways for hanging arragement coplete all as specified and directed. 13 M&L for 4 mm thick non asbestos fibre cement building board designer as in ceiling of size 600 x 600mm fixed to GI snap grid frame workcomplete all as specified & directed. 14 M&L for refixing of 4 mm thick non asbestos fibre cement building board designer as in ceiling of size 600 x 600mm fixed to GI snap grid frame workcomplete all as specified & directed. 15 Taking down chowkats or frame with shutter (without taking off shutters from the frame) not exc 1.5 Sqm each complete all as specified and directed. 16 All as per item No 15 before but exc 1.5 Sqm and not exc 4.00 Sqm each complete all as specified and directed. 17 S&F Powder coated / anodized aluminium door & frame 0.55 Kg/m incl- 5.00mm thick tinted glass in half portion andin other half portion 6 mm thick ACP sheet of approved colour complete and fixed withaluminium snap beading, glazing clips, joining clips, screws and 02 Nos of aluminium handle on each door shutter, aluminium anodized tower bolt 200 mm long 02 Nos on each shutter and mortice lock device complete with double keys for each lock, 01 No hydraulic door closure for each shutter complete all as specified and directed with following specifications:- (a) Aluminium door frame = 101.50x44.45mm(b)Aluminium style/top & middle rails of shutter = 83.5x44.45mm(c) Aluminium bottom rail of shutter = 114.50x44.45mm(d) Aluminium door frame with shutters shall be fixed in position in brick wall opening as required according to site conditions including all fastening arrangements & making good of existing surface with obd/whitewash over plaster after fixing door etc complete all as specified and directed 18 S & F powder coatedaluminium window and ventilator shutters including frame,aluminium sections weighing 0.55 kg/m including necessary joining cleats, glazing clips,rubber packing, anodised aluminium snap beading, screws,plain glass on shutters ,anodised aluminium fittings such as peg stays 150 mm long (1 no.). hinges type B-21 100mm long (2 no.) suitable handle (1 no.) & and aluminium deco grill fixed to outerside of aluminiumframe in suitable type of aluminium beading complete all as specifiedand directed by Engr-in-Charge. 19 Providing & fixing ofwindowsmade of pre-painted steel (Base steel as per IS 513 of 0.58mm thick “D” Quality galvanized as per IS 277 with zinc of 120 GSM). Primer coated with epoxy primer of 5-7 microns thick, finish painted with a polyester paint of 12-16 microns thick and back coated with 5-7 microns thick alkyd backer. Section for outer frame should be of 72x55mm, centre mullion should be of 72x50mm, section for fixed glass beading should be of 12x12mm and section for shutter should be of 52 x 25mm. Outer frame & mullion sections to have rebate for glazed shutters, fly mesh and 20 mm provision for guard bars/ grills fly mesh shutter section should be of 20x40mm. The sections are to be cut to length mitre joined with corner bracket. Centre mullions to be fixed with mullion cap. Elixir or equivalent stay, handles 2nos of heavy-duty stain less steel pivot hinges shall be provided per shutter. The windows should be panelled with 4 mm thick plain float glass and S.S. Mesh for fly mesh shutter (304 grade). Rubber Gaskets are provided all around the glass. The above frames should be fixed to the concrete/masonry wall by means of self-expanding, screws. Including 10mm square guard bars with 6” (152.4mm) pitchincluding making good of existing surface with obd/whitewash over plaster after fixing window etc complete for finished item of work including of all taxes etc as specified and directed. 20 S&F tubular steel framed work as in chowkhat / frame for single door frame of size 100 x 50 mm & thickness of tubular sectionll be 2.5 mm for doors with one or more rebates including necessary fixing lugs, lock, strike plate,hold fast etc completecomplete all as specified and directed.(Wt. of section should be exc 4.5 Kg/Rm) 21 S&F tubular steel framed work as in chowkhat / frame for double door frame of size 130 x 65 mm & thickness of tubular sectionll be 2.5 mmfor doors with one or more rebates including necessary fixing lugs, lock, strike plate,hold fast etc complete all as specified and directed. (Wt. of section should be exc 6 Kg /Rm) 22 S&F forMild steel framed work as in chowkhat / frame of doors or gates of angle or other section with gusset plates, rails, braces,hold fast etc., complete all as specified and directed., drilled for fixing of steel sheeting or other covering. Doors, etc. to be prepared for hanging or sliding with and including either hooks and hinges or steel hanging door fittings (exclusive of steel sheeting or other covering, running rails and guides) and hanging, also fastening and fixing complete, quality conforming grade Fe- 290 or E- 165 complete all as specified and directed. 23 S&F Factory made flush shutter 30 mm thick solid core construction with block board core and plywood face panels commercial type complete all as specified & directed. 24 S&F for 1.6 mm thick mild steel black sheet as in steel gate and similar works cut to size, holes punched including round headed screw welded etc complete as specified and as directed. 25 S & F 30 mm thick, factory made , llnd class hard wood (Sal) glazed and skeleton shutter open rebated and prepared to receive glass, gauze, etc. (with out sash bars), edges of framing plain, charmfered or rounded, fitted with cut and mitred beads for securing glass, etc., sizes of members of shutters as specified in SSR Part l, section 8 clause 8.24 (a); supplied and fitted to chowkhats complete all as specified and directed. 26 S & FStainless steel wire cloth. 0.36 mm nominal dia of wire and average width of aperture 1.40mm and fixed with stainless steel wire staples etc complete all as specified and directed 27 S&F Aluminium alloy, anodised, 250 mm sliding door bolt with hasp, staple (bolt type) and fixing clips of sheet, cast or extruded sections and fixing bolts and sliding bolts of extruded sections or cast-aluminium alloy and fixed complete all as specified and directed. 28 S&F 200 mm long aluminium anodized barrel tower bolt of extruded section complete all as specified & directed. 29 S&F Mild steel butt hinge medium weight cold rolled of size 100 mm long and fixed with screw/ welding complete all as specified and directed. 30 S&F 150 mm long aluminium anodized handle cast type complete all as specified and directed. 31 S&F of factory made soild PVC door frame of size 50mmx47mm made out of 5mm thick single side prelam PVC sheet reinforced with mild steel square tube , supplying & fixing in opening as per specification and drawing complete all as specified & directed.. 32 S & F Factory Made Solid PVC Moulded Door Shutter, 28 to 30mm thick (stiles), with 2, 4, or 6 raised panel design with 2 mm thick Moulded PVC Sheet on the front face & 2 mm plain colour PVC sheet on back face with particle board core, supplying & fixing in frame at site as per specification & drawing complete all as specified and directed. 33 S&F 150 mm long aluminium anodized barrel tower bolt of extruded section complete all as specified & directed. 34 S&F 100 mm long stainless steel hinges type B-12 and fixed with screw/ welding complete all as specified and directed. 35 M&L 100 mm long aluminium anodized handle cast type complete all as specified and directed. 36 M&L for one coats of synthetic enamel paint (Ordinary tint)including preparation of old surfaces of steel of any description not otherwise described over 10cm in width or girth complete all as specified and directed. 37 M&L for Two coats of synthetic enamel paint (Ordinary tint) over a coat of pink primer including preparation of new or previously untreated surfaces of wood of any description not otherwise described over 10cm in width or girth complete all as specified. 38 S&F in repair aluminium powder coated partition of specified aluminium section as per required size & Wt. of section can not be less than 0.55 Kg / Rm including aluminium beads, rubber gasket and 5 mm thick Plain glass in upper portion and 6 mm thick ACP sheet of approved colour etc complete all as specified and directed. 39 Taking down cement or cement lime plaster of any discription on bricks or stone walls/ceiling etc including racking out joints, hacking for kay, scrubbing down with water. 40 M & L for washed stone grit plaster on exterior walls in two layers , under layer 12 mm thick cement plaster 1:4 ( 1 cemant : 4 coarse sand ) furrowing the under layer with scratching tool , applying cement slurry on the under layer @3 Kg of cement per sqm , top layer 15 mm th cement plaster1 :1 / 2 :2 ( 1 cement : 1/2 coarse sand : 2 stone chipping 10 mm nominal size ) in panels with groove all arround as per approved pattern incl. scrubbing and washing the top layer with brushes and water to expose the stone shipping complete all as specified etc 41 Forming groove of uniform size 15 mm wide and 15mm deep in the top layer of washed stone grit plaster as per approved pattern using wooden battens nailed to the under layer incl. removal of wooden battens , repair to the edges of panels and finishing the groove complete all as specified & directed. 42 M&L for 10 to 12 mm thick smart careready mixplaster with high quality polymer additives and well graded sand and fillerswhich can be used for plastering (as per manufacturer instructions) over exteriorsurface of walletccomplete all as specified & directed. (Note : Coverage for smart care ready mix plasterll be 24 - 28 kg / sqm) 43 Material & Labour for preparation of new plastered surface and applying one coat of silane siloxane primer @ 0.12 kg / sqm over two coat of apex ultima paint (silicon additive ) @ 10 sqm / litre in each coat over priming coat of exterior primer applied @ 0.90 litre/ 10 sqm etc complete all as specified and directed. 44 M&L for 10 to 12 mm thick smart careready mix repair plaster with high quality polymer additives and well graded sand and fillerswhich can be used for plastering (as per manufacturer instructions) over interior surface of walletccomplete all as specified & directed. (Note : Coverage for smart care ready mix plasterll be 24 - 28 kg / sqm) 45 M&L for two coats ofdistemper oil emulsion over a coat of average 2 mm thick wall care puttyon new plastered surfaces complete all as specified and directed. 46 M & L for applying bonding agent for bonding old to new concrete surface likes chajja/ beams/ celings/ columns/ faciaetcby high performance modified Styrene- Butadiene Rubber ( SBR ) base binder . Applying ofbinder isas 10 sqm/ per litetccomplete all as specified & directed. 47 M&L for single component polymer modifiedrepair mortar upto 30 mm thickness in double coatfor repair of RCC members likes beams, columns, chajja and facia/Ceiling, mortar having good compressive strength and shrinkage resistance etccomplete all as specified & directed. 48 Material & labour for preparation of new plastered surfaces of ceiling and applying three coats of white wash to match the existing as required, complete all as specified & directed. 49 M&L for brick work with subclass B bricks old size straight or curved on plan exc 6 m mean radius built in cement mortar 1:6 including dismantling of brick work complete all as specified and directed. 50 M&L for preparing old plastered or unplastered surfaces of walls by brooming down or by steel wire brushing scraping down smoke soot, moulds moss and efflorescent salts and applying two coats of distemper oil emulsion over 2 mm thick wall care putty complete all as specified and directed. 51 Material & Labour for preparation of old plastered surface including removal of existing treatment and applying one coat of silane siloxane primer @ 0.12 kg / sqm over one coat of apex ultima paint (silicon additive ) @ 10 sqm / litreover priming coat of exterior primer applied @ 0.90 litre/ 10 sqm etc complete all as specified and directed. 52 M&L for 2 mm thick wall care putty on wall surface etc complete all as specified & directed. 53 Material and Labour for preparation of old plastered surfaces of ceiling etc by brooming down by steel wire brushing, scrapping down smoke Soot, moulds, moss and trading oil and greasy spots etc and apply two coatof white wash complete as specified and directed. 54 Dismantling stone slabs and tiles of any description or thickness in floors / dados, etc laid bedded and pointed in any mortar complete all as specified and directed by the Engineer-in-charge 55 M&L forVirifiedtiles of any shade 8 to 10 mm thick (square/ rectangular) polished, area of each tiles n exc 0.36 sqminfloors etc white cement and coloured pigment to match the tiles over 15 mm thick screed bed in CM 1:6complete all as specified and directed. 56 All as per item no. 55 but in skirting over 10 mm thick rendering in CM 1:4 etc complete all as specified and directed. 57 Demolition of concrete in any description and in any position (unreinforced) complete all as specified and directed. 58 Material and labour plain cementconcrete type B-0, 1:2:4 (12.50mm graded aggregate) 25mm thick as in sub floor, sub base, to receivetiles omplete all as specified and directed. 59 M&L for non skid ceramic coloured tiles (Premium quality) (squre/ rectangular) area of each tiles exc 0.11 sqm but n. exc 0.18 sqm in floors etc set and jointed in neat cement slurry and pointed in white or coloured cement to match the tiles over 15 mm thick screed bed in CM 1:6 etc complete all as specified and directed. 60 M&L for glazed ceramic coloured tiles of size450x300x7mm thick fixed on vertical surfaces such as skirting, dados and risers to steps etc set and jointed in neat cement slurry and pointed in white or coloured cement to match over 10 mm thick rendering in CM 1:4 including two coats of fosroc brushbond aqua protect or equivalent which is applied on wall surface before rendering etccomplete all as specified and directed. 61 M&L for 75 mm thick Cement concrete type D-2 1:4:8 (using 40 mm graded stone aggregate) in sub base of flooring/ hard standing finishing surface even and rough using broomfinish complete all as specified and directed. 62 M&L for 80 mm thick factory made chamfered edge cement concrete paver block of M-30 grade with approved colour, design & pattern as in footpath,parks, lawns, drive ways or light traffic parking etc., of required strength, thickness & size/ shape, made by table vibratory method using PU mould, laid in required colour & pattern over and including 50 mm thick compacted bed of coarse sand,compacting and proper embedding/ laying of inter locking paver blocks into the sand bedding layer through vibratory compaction by using plate vibrator, filling the joints with fine sand and cutting of paver block as per required size and pattern, finishing and sweeping extra sand; complete all as specified & directed. 63 M & L for18-20 mm thick black granite oflength and width as required including fixing, necessary cutting including 10 mm thick CM 1:4 Plaster etc complete all as specified & directed. 64 Taking up or down 15 mm bore steel tubing including fittings and connections, including cleaning for Refixing or removal to store complete all as specified and directed. 65 S&F 15 mm bore Galvanized Steel tubes, medium grade with all fitting and fixed complete to walls and ceilings or laid in floors complete all as specified and directed. 66 Taking up or down 20 mm bore steel tubing/ PPR pipe including fitting and connections, including cleaning for Refixing or removal to store complete all as specified and directed. 67 S&F 20 mm bore Galvanized Steel tubes, medium grade with all fitting and fixed complete to walls and ceilings or laid in floors complete all as specified and directed. 68 S&F 500 litres capacity Rotational moulded polyethylene water storage tanks (Cylindrical vertical with closed top) hoisted and fixed in position including 20 mm dia PVC float valve complete all as specified in SSR Part I including dismantling of storage tank. 69 S&F20 mm diaGun-metal, globe or gate valves, with iron wheel head, screwed both ends for iron pipe and fixed all as specified & directed. 70 S&F in repairs 5 mm thick bevelled edge mirror of selected quality glass of required size and shape with 50x20 mm teak woodpolished beading mounted on 6 mm thick commercial ply wood / ACP / PVCand fixed to wooden plugs with chromium plated brass screw and cup washers complete all as specified and directed. 71 S&F in repairs Vitreous China wash hand basin counter type white of size 550x440 mm including32 mm CP waste coupling and rigid pvcwaste pipe 800 mm long fixed overblack granite etc complete all as specified and directed. 72 S&FPillar taps long bodycast copper alloy fancy typewith capstan heads chromium plated scrwed down high pressure with or without lettered Hot or Cold with long screwed shanks and fly nuts screwed for 15 mm dia iron pipe complete all as specified and directed. 73 S&F in repairs 10 litres capacity PVC valveless, syphonic action type, flushing cistern, low level, white, with inlet, ball valve, float and handle including brackets & taking out of old unserviceable connections etc, connecting up new and making good disturbe portion complete all as specified and directed. 74 S & F in repairsPVC connections 15 mm size with PTMT nuts of length 600 mm complete all as specified and directed by the Engineer-in-charge. 75 S&F in repairs 15 mm bore CP stop cock/angle cock, cast copper alloy fancy type, screwed down high pressure, screwed for iron pipe or for unions and fixed complete all as specified and directed by the Engineer-in-charge. 76 Supply & fixing in repair CP tubular towel rail, 60 cm long, 20mm bore, chromium plated complete all as specified & directed. 77 S & F in repair CI floor trap, plain including jointing with solvent cement (Diameter of outlet 75mm), jointing to waste pipe and fixed in cement concrete 1:2: 4 (type B1) mixed with water proofing liquid @ 200ml in 50 kg cement, inlcuding taking out of old unserviceable connections etc, connecting up new and making good disturbe portion complete all as specified and directed. 78 S&F in repair vitreous china wash down water closed pan (Pedestal pattern) with CI P or S trap including connection to trap and cistern and flush pipe (excl flusingh cistern ) and making good to disturbed surface of floor allfixed as in repairall as specified and directed. 79 S & F in repair of plastic WC seat cover and mild steel chromium plated or aluminised hinging device asetc complete all as specified and directed. 80 S & F in repairs Flushing Health Faucet for pedestal pattern WC incl .flexible pipe and brass chromium plated nuts and bolts and water pipe of size 1150 mm long between dia & fixed completed all as specified and directed. 81 S & FFlushing jet for pedestal pattern WC incl. flexible pipe and Brass Chromium Plated nuts and blotsandwater pipe of size 1150 mm long between dia & fixed complete all as specified and directed. 82 S&F in repairbib taps long bodycast copper alloy, fancy type, chromium plated with crutch or butterfly handles, screwed down, screwed for 15 mm bore GI pipe or for brass ferrule orto GI socket or PPR pipe etc making good disturbed portion complete all as specified and directed. 83 Supply & fixing in repairs C.P. grating 100/125 mm dia with or without centre hole etc all as reqd at site complete all as directed. 84 S&F in repairs CP Soap dish 100 mm dia fixed with cp screws etc complete all as specified and directed by the Engineer-in-charge. 85 S&F in repairs Vitreous China Urinal, full stall type complete including providing and fixing plugs bedding urinal against wall in cement mortar 1:2 securing urinal to plugs with and including 60 mmlong brass screws pointing arounds urinal back in cement , fixing of nozzles for discharge of water flushing pipe andgrating and union for discharge pipes etc complete all as specified & directed. 86 Taking down Rain water pipe of any size or pattern ( CI / pvc / AC pipe ) including all fittings etc complete all as specified & directed. 87 S&F100 mm bore cast iron soil, waste vent sand cast pipes in any length with or without ears, with cement joints fixed to walls including making good disturbe portion to match the existing complete all as specified and directed by the Engineer-in-charge. 88 S&F 100 mm bore cast iron soil, waste vent sand cast pipes in any length with or without ears, with cement joints laid in floor or in trenches including making good disturbe portion to match the existing complete all as specified and directed. 89 S&F 100 mm bore cast iron bends (any radius), diminishing pieces or tapers (larger bore measured) fitted with oval access doors and cement joint including making good disturbe portion to match the existing complete all as specified and directed. 90 S&F 100 mm bore cast iron branch pieces, single (equal or unequal), ordinary or inverted (spigot or socket type) or with parallel branches fitted with oval access doors and cement joint including making good disturbe portion to match the existing complete all as specified and directed by the Engineer-in-charge. 91 S&Fclamps out of 50 mm by 5 mm flat iron fixed with suitable bolt / screws securing ends of stays to wall or roof for PVC (SWR) / CI Pipe for 100 mm bore pipe complete all as specified & directed. 92 S&F PVC (SWR) pipes single socketed 150 mm bore Pipe incl bend,shose, Tee, Y as required, etc in any length with rubber ring joints fixed to walls with MS clamp all as specified and directed. 93 S & F in110 mm bore PVC (SWR) pipes single socketed in any length with rubber ring joints, fixed to wall/floorincluding clamp complete all as specified and directed. 94 S & F 110 mm bore PVC (SWR) bends of any radius complete all as specified & directed. 95 S&F 110 mm PVC (SWR) junction single,(Single T) equal or unequal complete all as specified & directed. 96 M&L 75 mm thick PCC (1:3:6) type C1 using 40 mm graded stone agg as in plinth protection / Path / pavingsurface even and smoothand and exposed edges fair or rounding or chamfering laid in panels with and including all necessary form work and filling the joints with mastic filling of one part of hot bitumen 85/25 grade and three part of fine sand (all by weight) complete all as specified and directed. 97 M&L for PCC 1:2:4 Type B1 ( using 20 mm graded stone aggregate), in lintels upto 1.5m clear span, cills, steps; seismic and other similar bands, plinth courses, string courses, lacing courses, parapets and railings upto 60 cm in eight, copings, kneelers, apex stones bed plates, kerbs chajjas , water troughs, bed blocks and the like including weathering, slightly rounded or chamfered angles and throating, fixing of chain link fencing etc all as directed incl necessary formwork etc complete all as specified and directed. 98 Dismantling of wooden wall panelling incl. frame and making good the surface etc all as specified and directed. 99 S&F solid PVC Wall Lining for wall panellingconsisting of 5 mm thick wood grainprintedcolour PVC sheet inclusivefixing with all accessoriesat site as per specifications and drawing complete all as specified and directed. 100 M&L for 5 mm thick PVC sheet fillet of width 35 mm for wall panelling inclusive of fixing on to wall to make PVC frame as per specified & directed. 101 M&L for ATT points of contact of wood work by chemical emulsion (Imidacloprid 30.5% SC odorless chemical) in oil or kerosene based solution @ 0.5 litre/hole by drilling 6 mm dia holes at a downward angle of 45 degree at 150 mm centre to centre and sealing the same and making good as existing surfaces complete all as specified and directed. 102 M&L for treatment of voids in masonry using chemical (Imidacloprid 30.5% SC odorless chemical) emulsion one litre per hole, at 300mm intervals including drilling holes at 45 degree and replugging them with cement mortar 1:2 (1 cement : 2 coarse sand) to match the existing floors andetc complete all as specified and directed. (No extra payment shall be claimed on this account) 103 Taking down of all loose and de-bonded concrete/ screed, loose particles, dirt etc & Debris should be removed from Bldg. Roof substrate must be pressure-washed with watertoremove all dirt, dust, chalking and waste products. Remove algae, mold by using bleach solution or biowash etc complete all as specified & directed. 104 M&L for repair of all visible hairline cracks on concrete roof / screed more than 0.50 mm and not giving hollow sound, should be cut and widen in V shape with mechanical cutter in the size (10mm W x 6mm D). Fill cracks withPU sealant / Hybrid Sealant with suitable gun and smoothed with a putty knife or trowel. Allow sealant to cure a minimum (72 Hrs.) 3 days etc complete all as specified & director. 105 M&L forClean the concrete screed with high pressure water jet to remove dirt and loose particles. Brush apply a bond coat ofPidicrete URP mix in the ratio of 1:1 (URP 1: Cement 1) by volume to make it lump free slurry when applied on in the pre wet surface. Laid to fall roof screed in correct slope and gradient. Mix Pidicrete URP 10 % by weight of cement in concrete in ratio of 1(cement) :1.5 (sand) :3(12.5 mm aggregate) & avg thickness of concrete should be 25 mm.Level the repair concrete and finish with trowel. Moist cure should be done for 7days. Air cure screed for 7days, before application of roof top coat coating system etc complete all as specified & directed. 106 M&L for Apply one coat ofCipoxy 16D primer in the ratio 1:1 spreading at the rate of 0.200 kg-0.250 kg /sqm in complete dry condition where moisture contain below 7% (should be checked with moisture meter)Allow the primer coat to dry for 6 to 8 hours. Apply 1st coat ofRoofseal Classic without dilution spreading at the rate of 0.70/litre/Sq.mt/Coat until all surface is covered. Lay a 45 GSM Fibre glass mesh as a reinforcing material which is incorporated in the coating when the first coat is still in wet condition. Allow the first coat to dry for approximately 4 to 6 hours. Apply the second of chemical with the same application coverage, but in a direction perpendicular to that of the first and second coats. Allow each coat to air cure for a minimum of 4-6 hours after application. Check to see no void surface is left untreated / uncoated.Allow the system to air cure for 7 days minimum etc complete all as specified & directed. 107 Dismantling of structural steel work incl. doors , gates etc complete all as specified & directed. 108 S&F ornamental Framed and hung as in doors or gates of angle or other section with gusset plates, rails, braces incl. pintle hinges , stops hand made sliding boltsetc. to be prepared for hanging or sliding with and including either hooks and hinges or steel hanging door fittings and hanging; also fastening and fixing complete all as specified and directed. Note:-Weight of gate decided by BOO which will be conveyed by GE before fixing and necessary arrangements for weighing of steel gate by the contractor on his own expense. 109 S & f in repair 25 mmpre cast decorative designerRCC jallies fixed in 100mm x100mm decorative designer post consists with precast concretetype B 0 1:2:4 ( 12.5 mm graded stone aggt ) set in cement mortar 1:4 etc including two coat of weather proof paint etccomplete all as specified & directed. 110 Taking down copper/aluminium point wiring (light, fan, socket or power) complete, including fixture and fittings such as switches, ceiling roses, pendants, fan regulators, sockets, lamp holders, bell push, call bell, LED bulbs, light fitting etc. removing materials to store for keeping in safe custody or for taking credit (credit for above items should be made as per conditions separately) and making good disturbed surfaces of walls, floors, etc. complete and all as specified. 111 M&L point wiring with 1.5 sqmm multi stranded copper conductor 1100 volts.grade FRLS PVC insulated unsheathed cable with proper colour codingdrawn in includingPVC conduit medium grade not less than 20 mm dia with all accessoriesandFRLS PVC insulated 1.5 Sqmm multi standard unsheathed copper wire for continues earth, sunk in cast iron/Pressed steel terminal boxes 60 mm deep & 1.6 mm thick duly painted with aluminum inside and anticorrosive paint out side, including 3 mm thick plastic laminatedsheet for mounting switches, sockets, fan regulators etcconnecting earthand making good to the disturbed surfaceof wall/floor and matching with existing specifications.Connections of cable with MCBs or bus bar shall be done through proper size copper/brassthimbles.Note :Conduit shall be fixed on surface of roof /Trece with necessary saddles where concealing of conduitis not feasible at no extra cost for the following :-(a) One light /fan point controlled by one switch 112 (b)One 5 pin socket outlet5 Amps on same board 113 (c) One 5 pin socket outlet 5 Amps on independent board 114 All as per item No 111 above but with 2.5 sqmm multi stranded copper conductor 1100 volts grade FRLS PVC insulated sheathed cable with FRLS PVC 2.5 Sqmm multi standard insulated unsheathed copper wire for continues earth on independent boardcomplete all as specified and directed. 115 Supply and fix switch piano flush button single pole one way 5 amps 240 volts with polycarbonate body complete all as specified and directed. 116 Supply and fix Switch piano flush button single pole one way 15 amps 230 Voltswith polycarbonate body complete all as specified and directed. 117 Supply and fixsocket 5 amps 5 pin flush type, 240 volts. with polycarbonate body. Complete all as specified and directed. 118 Supply and fixsocket out let, 6 pin 5 and 15 amps multi purpose 2 in 1 flush type, 230 volts with polycarbonate body complete all as specified and directed. 119 Supply and fixstepped type electronic fan regulator flush type on the existing phenolic laminated sheet etc. as reqd,complete all as specified and directed. 120 Supply and fixceiling rose , PVC/polycarbonate, insulated body surface Bakelite 65mm dia three terminals complete all as specified and directed. 121 Supply and fixing in repair ceiling fans complete with blades, down rods, electronic regulator and accessories, 230 V, 1200mm sweep. Min air delivery 210 CFM with service value 6.00 BEE. Five star rated with brushless direct current motor (BLDC) . 122 Supply and fix in repair exhaust fan made of sturdy Engineering plastic complete with louvers shutter, voltage 230V, 50 Hz, RPM 1200, Copper winding of sweep 300m incl taking down the old unsv. 123 Supply and fixing in repair LED luminaire in replacement 595 mm x 595 mm, 40 watt, 220 V AC, 6500 K recessed type with high efficiency PMMA diffuser soft glare free light complete with driver, holders & LED lamp suitable for roof ceiling including connecting up with driver and connecting the same to electric source with & using PVC sheathed and insulated three core copper conductor cable of size 0.75 Sqmm and fixing arrangements for fixing the light fitting completeall as specified and directed. 124 Supply and fixing in repairLED light fittingwith high out put diffuser 4 feet, 20 watt 220 V AC, LUMEN < 2000 with lumen efficacy 120 lumen/watt, basic all purpose surface and wall mounted LED batten with polycarbonate housing & integrated electronic driver including connecting up with three core flexible copper conductor cable of suitable size complete all as specified and directed. 125 Supply and fixing in repair LED building security light fitting 35 Watt 230 V AC out-door type with high pressure die cast aluminum hosing and heat resistant complete with driver, lamp bracket with impact and corrosion resistant including thermal management in multiple optics complete with IP 65/66 protection,fixed to pole or wall of building with and including suitableBracket made out of25 mm dia GIlightgrade pipe, 1.00 m long bent to shape by cutting & weldingas required & directed and fixed withtwo Nos of FI clamps 35x6 mm to be tightened with suitable size of bolts, nut and washers and including painted withtwo coat of aluminium paint over a coat of red oxide primer, and including connecting the fittingto electric sourcewith & including twin twisted copper flexible wire of size 0.75 sqmm three core with suitable size flexible PVC conduitincluding all accessories and fixing arrangements for fixing the light fitting and writing the date of fixing on security light with permt marker complete all as specified and directed. 126 S & F in repair Wall mounting BLDCfanwith remote control, electric driven single phase, oscillating type 400 mm sweep,plastic ABS body with noise level 55 db,1500 RPM speed including all necessary parts reqd for its installation complete all as per specified and directed incl taking down the old unsv . 127 Supply and fixing in repairMCB SP 5 to 32 Amp rating 240V, 10KA C curve and current carrying capacity in the MCB DB complete with connection testing and commissioning.Complete all as specified and directed. 128 Supply and fixing in repair MCB SPN 40 to 63 Amp rating 240V, 10KA C curve and current carrying capacity in the MCB DB complete with connection testing and commissioning. Complete all as specified and directed. 129 Supply & fixing in repairof sheet metal enclosure Vertical TPN DB 4 Way double door, Suitable for Flush Mounting and Surface Mounting, With 100 A Copper Busbar for each phase with 2 Neutral bar, 2 Earthbar and Cable ties for Cable management, fully insulated busbar & shrouded Neutral bars, Improved Pan assembly for ease of installation, Prefitted masking sheet, Reversible Door for IP 43 DBs, With provision for 160 Amp MCCB as incomer and SP/TP MCBs as outgoingincl cutting/chasing of wall and make in good to the disturbed surface complete all as specified and as directed. 130 Supply & fixing in repairsheet metal enclosure MCB distribution board. Single pole & neutral 240 volts 12 way with IP-54 protection double door complete with appropriate size bus bar and neutral link incl cutting/ chasing of wall and make in good to the disturbed surface complete all as specified and as directed. 131 Supply & fixing in repairsheet metal enclosure MCB distribution board. Single pole & neutral 240 volts 8 way with IP-54 protection double door complete with appropriate size bus bar and neutral link incl cutting/chasing of wall and make in good to the disturbed surface complete all as specified and as directed. 132 Supply & fixing in repair sheet metal enclosure MCB distribution board. Single pole & neutral 240 volts 4 way with IP-54 protection double door complete with appropriate size bus bar and neutral link incl cutting/chasing of wall and make in good to the disturbed surface complete all as specified and as directed. 133 S&F in repairsub Main Wiring with two single core FRLS PVC insulated unsheathed multistranded flexible copper conductor cable of size 2x6 sqmm and one single core PVC insulated multistranded unsheathed flexible copper conductor 1x4 sqmm size (green colour) cable as earthing lead connecting to main earthing dolly drawn in PVC Conduit medium grade not less than 25mm dia including dismantling of old unsv submain wiring complete all as specified and directed by Engineer-in-charge including taking down of existing un serviceable sub main wiring complete. 134 M&L for earthing complete with galvanized earth plate electrode 600 x 600 x6mm thick burried directly in ground vertically to a depth not less than 2.25 M below normal ground level ) with top edge of the plate not less than 1.50 M below normal ground level , connected to and including galvanized steel wire 4mm dia as earth lead soldered and rivetedto earth plate by means of nuts, bolts, check nuts & washers, of galvanizediron or steelwith connected to test point and testing on completion including 15mm GI light grade pipe for earth leadprotection from earth point to earth plate, including provnadequate quantity of charcoal dust mixed with35 % common salt to a packed thickness of not less than 15 cm in alternate layers of charcoal and salt on all sides of earth platewith 20mm bore medium grade GI Pipe for watering,GI check nut, funnel and wire meshwith and includingall necessary excavation& earth work in soft/loose soil, returning filling in, removal of surplus soil to a distance 50 metre,,PCC 1:3:6 type C-1 as in earth pit, 40 mm thick RCC cover using cement concrete 1:2:4 type B-1 reinforced with & including 8 mm dia mild steel TMT bar @ 100 mm c/c Both way with suitable handle for lifting arrangement & including form work complete all as specified and shown in electrical plate No 3 of MES SSR Part I 2009 and as directed. . 135 Supply, laying and testing cable XLPE Insulated ,screened, PVC bedded, galvanized steel strip or wire armoured, electric power cables (heavy duty) 1100Volts grade with stranded aluminium conductor of size 25sq mm 4 core incl taking down the old unservisible cable complete all as specifed and directed. 136 Supply, laying and testing cable XLPE Insulated ,screened, PVC bedded, galvanized steel strip or wire armoured, electric power cables (heavy duty) 1100Volts grade with stranded aluminium conductor of size 16sq mm 2 core incl taking down the old unservisible cable complete all as specifed and directed. 137 Supply, laying and testing cable XLPE Insulated ,screened, PVC bedded, galvanized steel strip or wire armoured, electric power cables (heavy duty) 1100Volts grade with stranded aluminium conductor of size 10 sq mm 2 core incl taking down the old unservisible cable complete all as specifed and directed. 138 Excavation in trenches in soft/loose soil N. exc 1.5 Mtr wide and not exc. 1.5 Meter deep and getting out including forming bottom surface for laying of cable complete all as specified and directed . 139 Returning filling including spreading, leveling, watering and well ramming in layers not exc 25 cm thick complete all as specified. 140 Removing surplus soil to a distance n.exc 50 Mtr and depositing where directed at a level n.exc 1.5 mtr above the starting point all as specified. 141 M&L for drilling suitable dia horizontal bore holes below/under existing road surfaces / floors at a level not less than 0.60 mtr etc with using mechanical/ or manual devices as required at site including making good the disturbed surfaces to match with the existing after laying pipes complete all as specified and directed by Engineer-in-Charge. Note : Cost of equipment, tools and plant material (horizontal boring rig machine) required for boring shall be arranged by contractor at no extra cost to the Govt. 142 S & F of double wall corrugated pipe 75/63 mm dia with all fitting laid in bore holes/trenches/drain or fixed along with pole/wall includingFI clamps, nut, bolts etc. complete all as directed. 143 Supply and fixing LED flood light 100 watt 230 V AC outdoor type with thermal management in multiple optics and equipped with IP66 protection, with impact and corrosion resistant complete with driver and lamp complete all as specified and directed. 144 Supply and fixing MCCB 4 pole, 160 Amps, 50 Hz, Icu=35 KA at 415 volts with thermal magneticalongwith adjustable magnetic protection for current setting Icu=Ics = 100% with adjustable over load setting (minimum 70% to 100%) value from 10 to 15 times of related capacity standard complete all as specified anddirected.
Contract Date: Nov 08, 2025 Contract Value : 40.94 Lakh
Statutory Bodies & Commissions/Committees No of Bidders 11
Uttar Pradesh View Result →
21.
Housing Urban and Rular Development #8256077 AOC
Tender For Tourism Development Work Of Mahakaleshwar Temple Bhadan, In District - Firozabad (U.P.) - 1 TOILET BLOCKExcavation in foundation in ordinary soil (loam clay or sand) including lift upto 1.50 meter and lead upto 30 meter and including filling, watering and ramming of excavated earth into the trenches or into the space between the building and sides of foundation trenches or into the plinth and removal and disposal of sur-plus earth as directed by the Engineer incharge up to a distance of 30 meters from the foundation trenches. 2 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 3 Sand filling in plinth including supply of necessary quantity of sand from a distance not exceeding 8 kms. from the site of work and including watering, dressing etc rate to include cost of all materials labour T & P etc required for proper completion of work. 4 Treatment of soil under existing floors using chemical emulsion @ one litre per hole, 300 mm apart including drilling 12 mm diameter holes and plugging with cement mortar 1 :2 (1 cement : 2 Coarse sand) to match the existing floor:With Chlorpyriphos E.C. 20% with 1% concentration 5 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth levelR.C.C. Work in Footing 6 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth levelR.C.C. Work in Plinth Beam 7 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth levelR.C.C. Work in Column 8 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in Lintel 9 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in Beam 10 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in slab 11 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in Column 12 Centering and shuttering including strutting, propping etc. and removal of form forFoundations, footings, bases of columns, etc. for mass concrete 13 Centering and shuttering including strutting, propping etc. and removal of form forSuspended floors, roofs, landings, balconies and access platform 14 Centering and shuttering including strutting, propping etc. and removal of form forLintels, beams, plinth beams, girders, bressumers and cantilevers 15 Centering and shuttering including strutting, propping etc. and removal of form forColumns, Pillars, Piers, Abutments, Posts and Struts 16 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in foundation and plinth in: Cement mortar 1:4 (1 cement : 4 coarse sand) 17 Providing and laying damp-proof course 40 mm thick with cement concrete 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate 12.5 mm nominal size) 18 Applying a coat of residual petroleum bitumen of grade of VG-10 of approved quality using 1.7 kg per square metre on damp proof course after cleaning the surface with brushes and finally with a piece of cloth lightly soaked in kerosene oil. 19 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level in all shapes and sizes in :Cement mortar 1:4 (1 cement : 4 coarse sand) 20 Half brick masonry with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level.Cement mortar 1:4 (1 cement :4 coarse sand) 21 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete upto plinth level.Thermo-Mechanically Treated bars of grade Fe-500D or more. 22 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete above plinth levelThermo-Mechanically Treated bars of grade Fe-500D or more 23 15mm thick plaster with cement mortar in proportion of 1:4 cement & coarse sand of 2.25 F.M. 24 15mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 25 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 26 Making groove 10 to 12 mm wide x 8 mm deep in plaster of the wall or in ceiling vertically or horizontally as required. 27 Providing and laying Ceramic glazed floor tiles of size 300x300 mm (thickness to be specified by the manufacturer) of 1st quality conforming to IS : 15622 of approved make in colours such as White, Ivory, Grey, Fume Red Brown, laid on 20 mm thick cement mortar 1:4 (1 Cement : 4 Coarse sand), Jointing with grey cement slurry @ 3.3 kg/sqm including pointing the joints with white cement and matching pigment etc., complete. 28 Providing and laying Polished Granite stone flooring in required design and patterns, in linear as well as curvilinear portions of the building all complete as per the architectural drawings with 18 mm thick stone slab over 20 mm (average) thick base of cement mortar 1:4 (1 cement : 4 coarse sand) laid and jointed with cement slurry and pointing with white cement slurry admixed with pigment of matching shade including rubbing ,curing and polishing etc. all complete as specified and as directed by the Engineer-in-Charge. Polished Granite stone slab of colour Black, Cherry/Ruby Red or equivalent 29 Kota stone slab flooring over 20 mm (average) thick base laid over and jointed with grey cement slurry mixed with pigment to match the shade of the slab, including rubbing and polishing complete with base of cement mortar 1 : 4 (1 cement : 4 coarse sand) :25 mm thick 30 Providing and fixing Ist quality ceramic glazed wall tiles conforming to IS: 15622 (thickness to be specified by the manufacturer), of approved make, in all colours, shades except burgundy, bottle green, black of any size as approved by Engineer-in-Charge, in skirting, risers of steps and dados, over 12 mm thick bed of cement mortar 1:3 (1 cement : 3 coarse sand) and jointing with grey cement slurry @ 3.3kg per sqm, including pointing in white cement mixed with pigment of matching shade complete. 31 Making plinth protection 50mm thick of cement concrete 1:3:6 (1 cement : 3 coarse sand (zone-III) derived from natural sources : 6 graded stone aggregate 20 mm nominal size derived from natural sources) over 75mm thick bed of dry brick ballast 40 mm nominal size, well rammed and consolidated and grouted with fine sand, including necessary excavation, levelling & dressing & finishing the top smooth. 32 Providing and fixing ISI marked flush door shutters conforming to IS : 2202 (Part I) non-decorative type, core of block board construction with frame of 1st class hard wood and well matched commercial 3 ply veneering with vertical grains or cross bands and face veneers on both faces of shutters:35 mm thick including ISI marked Stainless Steel butt hinges with necessary screws 33 Providing and fixing ISI marked flush door shutters conforming to IS : 2202 (Part I) non-decorative type, core of block board construction with frame of 1st class hard wood and well matched commercial 3 ply veneering with vertical grains or cross bands and face veneers on both faces of shutters:35 mm thick including ISI marked Stainless Steel butt hinges with necessary screwsBoth side laminated 34 Providing & fixing glass panes with putty and glazing clips in steel doors, windows, clerestory windows, all complete with 4.0 mm thick glass panes 35 Providing and fixing M.S. Tubular frames for doors, windows, ventilators and cupboard with rectangular/ L-Type sections, made of 1.60 mm thick M.S. Sheet, joints mitred, welded and grinded finish, with profiles ofrequired size, including fixing of necessary butt hinges and screws and applying a priming coat of approved steel primer.Fixing with 15x3 mm lugs 10 cm long embedded in cement concrete block 15x10x10 cm of C.C. 1:3:6 (1 Cement : 3 coarse sand : 6 graded stone aggregate 20 mm nominal size) 36 Finishing with Deluxe Multi surface paint system for interiors and exteriors using Primer as per manufacturers specifications :Painting Steel work with Deluxe Multi Surface Paint to give an even shade. Two or more coat applied @ 0.90 ltr/10 sqm over an under coat of primer applied @ 0.80 ltr/10 sqm of approved brand and manufacture 37 Distempering with oil bound washable distemper of approved brand and manufacture to give an even shade :New work (two or more coats) over and including waterthinnable priming coat with cement primer 38 Finishing walls with textured exterior paint of required shade :New work (Two or more coats applied @ 3.28 ltr/10 sqm)over and including priming coat of exterior primer applied @ 2.20kg/10 sqm 39 Distempering with oil bound washable distemper of approved brand and manufacture to give an even shade :New work (two or more coats) over and including waterthinnable priming coat with cement primer 40 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 41 Providing and fixing 150 mm bright finished floor brass door stopper with rubber cushion, necessary brass screws etc. to suit shutter thickness complete. 42 Providing and fixing ISI marked oxidised M.S. Sliding door bolts with nuts and screws etc. complete300 mm x 16mm 43 Providing and fixing ISI marked oxidised M.S. Tower bolts black finish, (Barrel Type) with necessaryscrews etc. complete250 mm x 10mm 44 Providing and fixing ISI marked oxidised M.S. handles conforming to IS 4992 with necessary screws etc. complete.125mm 45 Stone work, plain in copings, cornices, string courses and plinth courses, upto 75 mm thick in Cement mortar 1:6 (1 cement : 6 coarse sand), including pointing with white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade.Red sand stone 46 Stone work (machine cut edges) for wall lining etc. (veneer work) upto 10 metre height, backing filled with a grout of average 12 mm thick cement mortar 1:3 (1 cement : 3 coarse sand) including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade : (To be secured to the backing and the sides by means of cramps and pins which shall be paid for separately) : Red sand stone - exposed face fine dressed with rough backing . 40mm thick 47 Providing and fixing stainless steel cramps of required size and shape for anchoring stone wall lining to the backing or securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases in stone and holes in walls wherever required. 48 Providing and fixing copper pins 7.5 cm long 6 mm diameter for securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases. 49 Supplying, fabricating, transporting, hoisting and fixing in position good quality of 70 mm red sandstone in various elements for all levels. Stone shall be free from cracks, lines stains and even in shade for each element. The stone shall be fine grained and reddish or buff-colored (locally available). The work shall be carried out as per attached drawings with different process of i.e carving (manual/ by machine), ornamental work, traditional work, figure work (any type, any size), CNC cutting, moulding. The carving and molding work shall be of very good quality. The stones to be fixed in line, level and plumb in all respect with the use of brass clamps, pins, (to be paid separetely) dowels, cement slurry with matching pigment and Epoxy of Akemi Germany, Ardex Endura, MYK laticrete or approved make as required and as approved by the Architects. 50 Providing and laying integral cement based water proofing treatment including preparation of surface as required for treatment of roofs, balconies, terraces etc consisting of following operations: a) Applying a slurry coat of neat cement using 2.75 kg/sqm. of cement admixed with water proofing compound conforming to IS. 2645 and approved by Engineer-in-charge over the RCC slab including adjoining walls upto 300mm height including cleaning the surface before treatment.b) Laying brick bats with mortar using broken bricks/brick bats 25 mm to 115mm size with 50% of cement mortar 1:5 (1 cement : 5 coarse sand)admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge over 20 mm thick layer of cement mortar of mix 1:5 (1 cement :5 coarse sand ) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge to required slope and treating similarly the adjoining walls upto 300 mm height including rounding of junctions of walls and slabs c) After two days of proper curing applying a second coat of cement slurry using 2.75kg/ sqm of cement admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge. d) Finishing the surface with 20 mm thick jointless cement mortar of mix 1:4 (1 cement :4 coarse sand) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge including laying glass fibre cloth of approved quality in top layer of plaster and finally finishing the surface with trowel with neat cement slurry and making pattern of 300x300 mm square 3mm deep. e) The whole terrace so finished shall be flooded with water for a minimum period of two weeks for curing and for final test. All above operations to be done in order and as directed and specified by the Engineer-in-Charge : With average thickness of 120mm and minimum thickness at khurra as 65 mm. 51 ELECTRICALWiring for light point/ fan point/ exhaust fan point/ call bell point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable in surface/ recessed medium class PVC conduit,with modular switch, modular plate, suitable GI box and earthing the point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable etc. as required.Group C 52 Wiring for light/ power plug with 2X4 sq. mm FRLS PVC insulated copper conductor single core cable in surface/ recessed medium class PVC conduit alongwith 1 No. 4 sq. mm FRLS PVC insulated copper conductor single core cable for loop earthing as required. 53 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required.2 X 1.5 sq. mm + 1 X 1.5 sq. mm earth wire 54 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required.2 X 2.5 sq. mm + 1 X 2.5 sq. mm earth wire 55 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required.2 X 4 sq. mm + 1 X 4 sq. mm earth wire 56 Supplying and fixing following modular switch/ socket on the existing modular plate & switch box including connections but excluding modular plate etc. as required.5/6 A switch 57 Supplying and fixing following modular switch/ socket on the existing modular plate & switch box including connections but excluding modular plate etc. as required.3 pin 5/6 A socket outlet 58 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providing and fixing 3 pin 5/6 A modular socket outlet and 5/6 A modular switch, connections etc. as required. 59 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providing and fixing 6 pin 5/6 & 15/16 A modular socket outlet and 15/16 A modular switch, connections etc. as required. 60 Installation of exhaust fan in the existing opening, including making good the damage, connection, testing, commissioning etc. as required.Upto 450 mm sweep 61 Supplying and fixing PVC batten/ angle holder including connections etc. as required. 62 Supplying and laying ofaluminium conductor PVC insulated armoured served sheathed cable 1100 volts grade at the depth of 750 mm bellow ground level over a cushion of 75 mm thick sand all around and protected with burnt bricks on side and on top .On surface the cable run shall be fixed on MS clamps etc.of suitable size or as directed bythe Engineer-Incharge ,complete in all respect.The armouring of the cable shall be properly connected with the earth conductor by clamps etc. Following sizesize 6 sq mm x 2 core 63 Supply and fixing of brass nickle plated compression gland for pvc insulated & armoured served sheaththed ,underground cable including rubber ring etc. complete in all respect. Thearmouring of the cable shall be properly connected with the earthas per direction of engineer-incharge. for cable size 6 sq mm x2 core 64 Supply and fixing ofplain or pin type copper tin plated cable socket (lug) to cable leadsfor pvc insulated & armoured cable insulating with tape and making connection. complete in all respect as per direction of engineer -incharge. for cablesize 6 sq mm 65 Supplying and fixing following way, single pole and neutral (SPN), sheet steel, MCB distribution board, 415 V, on surface/ recess, complete with tinned copper bus bar, neutral bus bar, earth bar, din bar, interconnections, powder painted including earthing etc. as required. (But without MCB/RCCB/Isolator)6 way , Double door 66 Supplying and fixing 5 A to 32 A rating, 240/415 V, 10 kA, C curve, miniature circuit breaker suitable for inductive load of following poles in the existing MCB DB complete with connections, testing and commissioning etc. as required.Single pole 67 Supplying and fixing single pole blanking plate in the existing MCB DB complete etc. as required. 68 Supplying and fixing following rating, double pole, 240 volts, isolator in the existing MCB DB complete with connections, testing and commissioning etc. as required.40 A 69 Supply and fixing of LED 18w Round Sky Glow Next Gen LED Downlight fitting 18 watt suitable with complete Including tube suitable for both surface & suspended complete in all respect.CAT. - AAA 70 Supply & fixing of 225/300mm sweep ventilating (Light Duty) exhaust fan complete with Metallic Blade (Steel bird guard protector /Copper motor for high air suction performance /Capacitor etc.), Noise level : (45 - 50) dB, Power consumption : 45 W, Rated voltage : 230 V, Rated frequency : 50 Hz, Motor type : Normal Speed. Complete in all respect. 71 Supply and Fixing Mirror Light(Philips/Siems/or Equivalent) 72 PLUMBINGProviding and fixing water closet squatting pan (Indian type W.C. pan ) with 100 mm sand cast Iron P or S trap, 10 litre low level white P.V.C. flushing cistern, including flush pipe, with manually controlled device (handle lever) conforming to IS : 7231, with all fittings and fixtures complete, including cutting and making good the walls and floors wherever required: 73 Providing and fixing wash basin with C.I. brackets, 15 mm C.P. brass pillar taps,32 mm C.P. brass waste of standard pattern, including painting of fittings and brackets, cutting and making good the walls wherever require:White Vitreous China Flat back wash basin size 550x 400 mm with single 15 mm C.P. brass pillar tap 74 Extra for providing opening of required size & shape for wash basin/ kitchen sink in kitchen platform, vanity counter and similar location in marble/ Granite/ stone work, including necessary holes for pillar taps etc. including moulding, rubbing and polishing of cut edges etc. complete. 75 Providing and fixing flexible P.V.C. waste pipe for sink or wash basin including PVC waste fittings complete.Flexible pipe 32 mm dia 76 Providing and fixing mirror of superior glass (of approved quality) and of required shape and size with plastic moulded frame of approved make and shade with 6 mm thick hard board backing :Circular shape 450 mm dia 77 Providing and fixing 600x120x5 mm glass shelf with edges round off, supported on anodised aluminium angle frame with C.P. brass brackets and guard rail complete fixed with 40 mm long screws, rawl plugs etc., complete. 78 Supply and fixing of UPVC S.W.R. pipe type -B confirming to IS- 13592 including jointing the pipes with rubber ring, lubricant and UPVC SWR cuplar confirming to IS - 14735. Also including excavation of trenches cutting of walls and holes and repairing the walls floors and refilling the trenches as before but excluding supply and cost of other fittings such as elbow, bead, tee and Y-tee including supply of all material labour and T&P .Required for proper completion of the work.90 mm O.D. 79 Supply and fixing of UPVC S.W.R. pipe type -B confirming to IS- 13592 including jointing the pipes with rubber ring, lubricant and UPVC SWR cuplar confirming to IS - 14735. Also including excavation of trenches cutting of walls and holes and repairing the walls floors and refilling the trenches as before but excluding supply and cost of other fittings such as elbow, bead, tee and Y-tee including supply of all material labour and T&P .Required for proper completion of the work.110 mm O.D. 80 Providing and fixing unplasticised -PVC pipe clips of approved design to unplasticised - PVC rain water pipes by means of 50x50x50 mm hard wood plugs, screwed with M.S. screws of required length, including cutting brick work and fixing in cement mortar 1:4 (1 cement : 4 coarse sand) and making good the wall etc. complete.110 mm 81 Supply and fixing of UPVC S.W.R. door bend confirming to IS- 1473590 mm size 82 Supply and fixing of UPVC S.W.R. door bend confirming to IS- 14735110 mm size 83 Supply and fixing of UPVC S.W.R. Plain Tee confirming to IS- 1473590x90x90 mm size 84 Supply and fixing of UPVC S.W.R. Plain Tee confirming to IS- 14735110x110x110 mm size 85 Supply and fixing of UPVC S.W.R. Plain bend confirming to IS- 1473590 mm size 86 Supply and fixing of UPVC S.W.R. Plain bend confirming to IS- 14735110 mm size 87 Supply and fixing of UPVC S.W.R. Door Y confirming to IS- 1473590 mm size 88 Supply and fixing of UPVC S.W.R. Door Y confirming to IS- 14735110 mm size 89 Supply and fixing of UPVC S.W.R. Cowel confirming to IS- 1473590 mm size 90 Supply and fixing of UPVC S.W.R. Cowel confirming to IS- 14735110 mm size 91 Supply and fixin g of UPVC S.W.R. Nahni trap size 100/75mm, 100/90mm confirming to IS - 14735 self cleannig design fixed in PCC 1:2:4 and supply and fixing of 125mm dia heavy duty CP brass jali. 92 Providing and fixing PTMT liquid soap container 109 mm wide, 125 mm high and 112 mm distance from wall of standard shape with bracket of the same materials with snap fittings of approved quality and colour weighing not less than 105 gms. 93 Providing and fixing G.I. pipes complete with G.I. fittings and clamps, i/c cutting and making good the walls etc.Internal work - Exposed on wall 20 mm nominal outer dia pipes 94 Providing and fixing G.I. pipes complete with G.I. fittings and clamps, i/c cutting and making good the walls etc.Internal work - Exposed on wall 25 mm nominal outer dia pipes 95 Providing and fixing G.I. pipes complete with G.I. fittings and clamps, i/c cutting and making good the walls etc.Internal work - Exposed on wall 32 mm nominal outer dia pipes 96 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings, including fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings with one step CPVC solvent cement and testing of joints complete as per direction of Engineer in Charge.Internal work - Exposed on wall25 mm nominal outer dia Pipes 97 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings, including fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings with one step CPVC solvent cement and testing of joints complete as per direction of Engineer in Charge.Internal work - Exposed on wall32 mm nominal outer dia Pipes 98 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings i/c fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings, with one step CPVC solvent cement and the cost of cutting chases and making good the same including testing of joints complete as per direction of Engineer-in-Charge. Concealed work, including cutting chases and making good the wall etc.15 mm nominal outer dia pipes 99 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings i/c fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings, with one step CPVC solvent cement and the cost of cutting chases and making good the same including testing of joints complete as per direction of Engineer-in-Charge. Concealed work, including cutting chases and making good the wall etc.20 mm nominal outer dia pipes 100 Providing and fixing G.I. pipes complete with GI fittings and clamps including cutting and making good the walls etc. External work40 mm dia, nominal bore 101 Providing and fixing G.I. pipes complete with GI fittings and clamps including cutting and making good the walls etc. External work50 mm dia, nominal bore 102 Providing and fixing of gun metal gate valve with CI wheel of approved quality (screwed ends)25mm dia, nominal bore 103 Providing and fixing of gun metal gate valve with CI wheel of approved quality (screwed ends)32 mm dia, nominal bore 104 Making connection of G.I. distribution branch with G.I. main of following sizes by providing and fixing tee, including cutting and threading the pipe etc. complete :25 to 40 mm nominal bore 105 Making connection of G.I. distribution branch with G.I. main of following sizes by providing and fixing tee, including cutting and threading the pipe etc. complete :50 to 80 mm nominal bore 106 Providing and fixing uplasticised PVC connection pipe with brass unions :45 cm length15 mm nominal bore 107 Providing and fixing ball valve (brass) of approved quality, High or low pressure, with plastic floats complete :20 mm nominal bore 108 Providing and fixing ball valve (brass) of approved quality, High or low pressure, with plastic floats complete :25 mm nominal bore 109 Providing and fixing C.P. brass bib cock of approved quality confirming to IS:893115mm nominal bore 110 Providing and fixing C.P.brass angle valve for basin mixer and geyser points of approved quality conforming to IS 8931 a) 15 mm nominal bore.15 mm nominal bore 111 Excavating trenches of required width for pipes, cables, etc, including excavation for sockets, depth upto 1.5 m including getting out the excavated materials, returning the soil as required in layers not exceeding 20 cm in depth including consolidating each deposited layers by ramming, watering etc. stacking serviceable material for measurements and disposal of unserviceable material as directed, within a lead of 50m :Pipes, cables etc. exceeding 80 mm dia but not exceeding 300 mm dia. 112 Supply and fixing of UPVC S.W.R. pipe type -B confirming to IS- 13592 including jointing the pipes with rubber ring, lubricant and UPVC SWR cuplar confirming to IS - 14735. Also including excavation of trenches cutting of walls and holes and repairing the walls floors and refilling the trenches as before but excluding supply and cost of other fittings such as elbow, bead, tee and Y-tee including supply of all material labour and T&P .Required for proper completion of the work.160 mm O.D. 113 Providing and laying cement concrete 1:5:10 (1 cement : 5 coarse sand : 10 graded stone aggregate 40 mm nominal size) all-round S.W. pipes including bed concrete as per standard design : 150 mm diameter pipe 114 Supply and fixing of UPVC S.W. R. Gully trap confirming to IS - 14735 size 150x110 mm dia of self cleaning design including fixed brick Masonary chamber 250x250x250mm Size i/ c supply and fixing of CI cover with frame weight not less then 4.50Kg. & CI grating 150x150mm complete in all respects. 115 Constructing brick masonry manhole in cement mortar 1:4 ( 1 cement : 4 coarse sand ) with R.C.C. top slab with 1:2:4 mix (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size), foundation concrete 1:4:8 mix (1 cement : 4 coarse sand : 8 graded stone aggregate 40 mm nominal size), inside plastering 12 mm thick with cement mortar 1:3 (1 cement : 3 coarse sand) finished with floating coat of neat cement and making channels in cement concrete 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size) Fisnihed with a floating coat of neat cement complete as per standard design : Inside size 900 x 800mm and 500mm deep including C.I. Cover frame. 116 Providing and placing on terrace (at all floor levels) polyethylene water storage tank, IS : 12701 marked, with cover and suitable locking arrangement and making necessary holes for inlet, outlet and overflowpipes but without fittings and the base support for tank. 117 KIOSKExcavation in foundation in ordinary soil (loam clay or sand) including lift upto 1.50 meter and lead upto 30 meter and including filling, watering and ramming of excavated earth into the trenches or into the space between the building and sides of foundation trenches or into the plinth and removal and disposal of sur-plus earth as directed by the Engineer incharge up to a distance of 30 meters from the foundation trenches. 118 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 119 Sand filling in plinth including supply of necessary quantity of sand from a distance not exceeding 8 kms. from the site of work and including watering, dressing etc rate to include cost of all materials labour T & P etc required for proper completion of work. 120 Treatment of soil under existing floors using chemical emulsion @ one litre per hole, 300 mm apart including drilling 12 mm diameter holes and plugging with cement mortar 1 :2 (1 cement : 2 Coarse sand) to match the existing floor:With Chlorpyriphos E.C. 20% with 1% concentration 121 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth level 122 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works above plinth level upto floor V level 123 Centering and shuttering including strutting, propping etc. and removal of form forFoundations, footings, bases of columns, etc. for mass concrete 124 Centering and shuttering including strutting, propping etc. and removal of form forSuspended floors, roofs, landings, balconies and access platform 125 Centering and shuttering including strutting, propping etc. and removal of form forLintels, beams, plinth beams, girders, bressumers and cantilevers 126 Centering and shuttering including strutting, propping etc. and removal of form forColumns, Pillars, Piers, Abutments, Posts and Struts 127 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in foundation and plinth in:Cement mortar 1:4 (1 cement : 4 coarse sand) 128 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level in all shapes and sizes in :Cement mortar 1:4 (1 cement : 4 coarse sand) 129 Half brick masonry with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level.Cement mortar 1:4 (1 cement :4 coarse sand) 130 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete above plinth levelThermo-Mechanically Treated bars of grade Fe-500D or more 131 15mm thick plaster with cement mortar in proportion of 1:4 cement & coarse sand of 2.25 F.M. 132 15mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 133 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 134 Kota stone slab flooring over 20 mm (average) thick base laid over and jointed with grey cement slurry mixed with pigment to match the shade of the slab, including rubbing and polishing complete with base of cement mortar 1 : 4 (1 cement : 4 coarse sand) :25 mm thick 135 Providing and laying Polished Granite stone flooring in required design and patterns, in linear as well as curvilinear portions of the building all complete as per the architectural drawings with 18 mm thick stone slab over 20 mm (average) thick base of cement mortar 1:4 (1 cement : 4 coarse sand) laid and jointed with cement slurry and pointing with white cement slurry admixed with pigment of matching shade including rubbing ,curing and polishing etc. all complete as specified and as directed by the Engineer-in-Charge. Polished Granite stone slab of colour Black, Cherry/Ruby Red or equivalent 136 Distempering with 1st quality acrylic distemper (ready mixed) having VOC content less than 50 gram/litre, of approved manufacturer and of required shade and colour all complete to achieve even shade and colour :New work (two or more coats) over and including water thinnable priming coat with cement primer having VOC content less than 50 gram/litre 137 Finishing walls with Premium Acrylic Smooth exterior paint with Silicone additives of required shade: New work (Two or more coats applied @ 1.43 ltr/10 sqm over and including priming coat of exterior primer applied @ 0.9 Ltr/10 sqm) 138 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 139 Stone work (machine cut edges) for wall lining etc. (veneer work) upto 10 metre height, backing filled with a grout of average 12 mm thick cement mortar 1:3 (1 cement : 3 coarse sand) including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade : (To be secured to the backing and the sides by means of cramps and pins which shall be paid for separately) : Red sand stone - exposed face fine dressed with rough backing .40mm thick 140 Providing and fixing stainless steel cramps of required size and shape for anchoring stone wall lining to the backing or securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases in stone and holes in walls wherever required. 141 Providing and fixing copper pins 7.5 cm long 6 mm diameter for securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases. 142 Stone work, plain in copings, cornices, string courses and plinth courses, upto 75 mm thick in Cement mortar 1:6 (1 cement : 6 coarse sand), including pointing with white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade.Red sand stone 143 Providing and fixing stone jali 40 mm thick throughout in cement mortar 1:3 (1 cement : 3 coarse sand), including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment, matching the stone shade, jali slab without any chamfers etc. Red sand stone 144 Supplying, fabricating, transporting, hoisting and fixing in position good quality of 70 mm red sandstone in various elements for all levels. Stone shall be free from cracks, lines stains and even in shade for each element. The stone shall be fine grained and reddish or buff-colored (locally available). The work shall be carried out as per attached drawings with different process of i.e carving (manual/ by machine), ornamental work, traditional work, figure work (any type, any size), CNC cutting, moulding. The carving and molding work shall be of very good quality. The stones to be fixed in line, level and plumb in all respect with the use of brass clamps, pins, (to be paid separetely) dowels, cement slurry with matching pigment and Epoxy of Akemi Germany, Ardex Endura, MYK laticrete or approved make as required and as approved by the Architects. 145 Supply & filling of cinder in sunken portion of building including breaking into required sizes including supply of all materials,Labour, T & P required for proper complition of work. 146 Providing and laying water proofing treatment on roofs of slabs by applying cement slurry mixed with water proofing cement compound consisting of applying:(a) after surface preparation, first layer of slurry of cement @ 0.488 kg/ sqm mixed with water proofing cement compound @ 0.253 kg/sqm.(b) laying second layer of Fibre glass cloth when the first layer is stillgreen. Overlaps of joints of fibre cloth should not be less than 10 cm.(c) third layer of 1.5 mm thickness consisting of slurry of cement @ 1.289 kg/sqm mixed with water proofing cement compound @ 0.670 kg/sqm and coarse sand @ 1.289 kg/sqm. This will be allowed to air cure for 4 hours followed by water curing for 48 hours. The entire treatment will be taken upto 30 cm on parapet wall and tucked into groove in parapet all around.(d) fourth and final layer of brick tiling with cement mortar (which will be paid for separately.For the purpose of measurement the entire treated surface will be measured. 147 ELECTRICALWiring for light point/ fan point/ exhaust fan point/ call bell point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable in surface / recessed medium class PVC conduit, with modular switch, modular plate, suitable GI box and earthing the point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable etc. as required.Group - C 148 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required.2 X 2.5 sq. mm + 1 X 2.5 sq. mm earth wire 149 Supplying and fixing modular blanking plate on the existing modular plate & switch box excluding modular plate as required 150 Supply & fixing of recess mounting round 15 to 18 watt LED down Lighter having Powder coated die cast aluminium housing with heat sink , diffuser /reflector and driver with theft protection set complete in all respect. 151 Supplying and fixing following way ,single pole and neutral,sheet steel, MCB distribution board, 240 V, on surface/ recess, complete with tinned copper bus bar, earth bar, din bar, interconnections, powder painted including earthing etc. as required. (But without MCB/RCCB/Isolator)6 Way Double Door 152 Supplying and fixing 5 amps to 32 amps rating, 240/415 volts, C curve, miniature circuit breaker suitable for inductive load of following poles in the existing MCB DB complete with connections, testing and commissioning etc. as required.Single pole 153 Supplying and fixing single pole blanking plate in the existing MCB DB complete etc. as required. 154 Laying of one number PVC insulated and PVC sheathed / XLPE powerCable of 1.1 KV grade of following size direct in ground including excavation, sand cushioning, protective covering and refilling the trench etc as required.Up to 35 sq.mm. 155 Supplying and making cable end terminations with brasscompression gland and aluminium lugs for following size of PVC insulated PVC sheathed/XLPE aluminium conductor cable of 1.1 KV grade, completeas required.2 X 6 sq. mm (19mm) 156 TOURIST SHELTERExcavation in foundation in ordinary soil (loam clay or sand) including lift upto 1.50 meter and lead upto 30 meter and including filling, watering and ramming of excavated earth into the trenches or into the space between the building and sides of foundation trenches or into the plinth and removal and disposal of sur-plus earth as directed by the Engineer incharge up to a distance of 30 meters from the foundation trenches. 157 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 158 Sand filling in plinth including supply of necessary quantity of sand from a distance not exceeding 8 kms. from the site of work and including watering, dressing etc rate to include cost of all materials labour T & P etc required for proper completion of work. 159 Treatment of soil under existing floors using chemical emulsion @ one litre per hole, 300 mm apart including drilling 12 mm diameter holes and plugging with cement mortar 1 :2 (1 cement : 2 Coarse sand) to match the existing floor:With Chlorpyriphos E.C. 20% with 1% concentration 160 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth levelR.C.C. Work in Footing 161 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth levelR.C.C. Work in Plinth Beam 162 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth levelR.C.C. Work in Column 163 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in Lintel 164 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in Beam 165 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in slab 166 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works Above plinth levelR.C.C. work in Column 167 Centering and shuttering including strutting, propping etc. and removal of form forFoundations, footings, bases of columns, etc. for massconcrete 168 Centering and shuttering including strutting, propping etc. and removal of form forSuspended floors, roofs, landings, balconies and access platform 169 Centering and shuttering including strutting, propping etc. and removal of form forLintels, beams, plinth beams, girders, bressumers and cantilevers 170 Centering and shuttering including strutting, propping etc. and removal of form forColumns, Pillars, Piers, Abutments, Posts and Struts 171 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in foundation and plinth in:Cement mortar 1:4 (1 cement : 4 coarse sand) 172 Providing and laying damp-proof course 40 mm thick with cement concrete 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate 12.5 mm nominal size) 173 Applying a coat of residual petroleum bitumen of grade of VG-10 of approved quality using 1.7 kg per square metre on damp proof course after cleaning the surface with brushes and finally with a piece of cloth lightly soaked in kerosene oil. 174 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level in all shapes and sizes in :Cement mortar 1:4 (1 cement : 4 coarse sand) 175 Half brick masonry with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in superstructure above plinth level up to floor V level.Cement mortar 1:4 (1 cement :4 coarse sand) 176 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete upto plinth level.Thermo-Mechanically Treated bars of grade Fe-500D or more. 177 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete above plinth levelThermo-Mechanically Treated bars of grade Fe-500D or more 178 15mm thick plaster with cement mortar in proportion of 1:4 cement & coarse sand of 2.25 F.M. 179 15mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 180 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 181 Making groove 10 to 12 mm wide x 8 mm deep in plaster of the wall or in ceiling vertically or horizontally as required. 182 Providing and laying Vitrified tiles in floor in different sizes (thickness to be specified by the manufacturer) with water absorption less than 0.08% and conforming to 1S:15622, of approved brand & manufacturer, in all colours and shade, laid on 20 mm thick cement mortar 1:4 (1 cement: 4 coarse sand) jointing with grey cement slurry @3.3 kg/sqm including grouting the joints with white cement and matching pigments etc. The tiles must be cut with the zero chipping diamond cutter only . Laying of tiles will be done with the notch trowel, plier, wedge, clips of required thickness, leveling system and rubber mallet for placing the tiles gently and easily.Glazed Vitrified tiles Matt/Antiskid finish of size Size of Tile 600 x 600 mm 183 Providing and laying Vitrified tiles in different sizes (thickness to be specified by manufacturer), with water absorption less than 0.08 % and conforming to |.S. 15622, of approved make, in all colours & shade, inskirting, riser of steps, over 12 mm thick bed of cement mortar 1:3 (1 cement: 3 coarse sand), jointing with grey cement slurry @ 3.3 kg/ sqm including grouting the joint with white cement & matching pigments etc. complete.Size of Tile 600x600 mm 184 Providing and laying Polished Granite stone flooring in required design and patterns, in linear as well as curvilinear portions of the building all complete as per the architectural drawings with 18 mm thick stone slab over 20 mm (average) thick base of cement mortar 1:4 (1 cement : 4 coarse sand) laid and jointed with cement slurry and pointing with white cement slurry admixed with pigment of matching shade including rubbing ,curing and polishing etc. all complete as specified and as directed by the Engineer-in-Charge. Polished Granite stone slab of colour Black, Cherry/Ruby Red or equivalent 185 Providing and fixing Ist quality ceramic glazed wall tiles conforming to IS: 15622 (thickness to be specified by the manufacturer), of approved make, in all colours, shades except burgundy, bottle green, black of any size as approved by Engineer-in-Charge, in skirting, risers of steps and dados, over 12 mm thick bed of cement mortar 1:3 (1 cement : 3 coarse sand) and jointing with grey cement slurry @ 3.3kg per sqm, including pointing in white cement mixed with pigment of matching shade complete. 186 Making plinth protection 50mm thick of cement concrete 1:3:6 (1 cement : 3 coarse sand (zone-III) derived from natural sources : 6 graded stone aggregate 20 mm nominal size derived from natural sources) over 75mm thick bed of dry brick ballast 40 mm nominal size, well rammed and consolidated and grouted with fine sand, including necessary excavation, levelling & dressing & finishing the top smooth. 187 Providing and fixing ISI marked flush door shutters conforming to IS : 2202 (Part I) non-decorative type, core of block board construction with frame of 1st class hard wood and well matched commercial 3 ply veneering with vertical grains or cross bands and face veneers on both faces of shutters:35 mm thick including ISI marked Stainless Steel butt hinges with necessary screws 188 Providing and fixing ISI marked flush door shutters conforming to IS : 2202 (Part I) non-decorative type, core of block board construction with frame of 1st class hard wood and well matched commercial 3 ply veneering with vertical grains or cross bands and face veneers on both faces of shutters:35 mm thick including ISI marked Stainless Steel butt hinges with necessary screwsBoth side laminated 189 Providing and fixing factory made uPVC white colour casement/casement cum fixed glazed windows comprising of uPVC multi-chambered frame, sash and mullion (where ever required) extruded profiles duly reinforced with 1.60 ± 0.2 mm thick galvanized mild steel section made from roll forming process of required length (shape & size according to uPVC profile), uPVC extruded glazing beads of appropriate dimension, EPDM gasket, stainless steel (SS 304 grade) friction hinges, zinc alloy (white powder coated) casement handles, G.I fasteners 100 x 8 mm size for fixing frame to finished wall, plastic packers, plastic caps and necessary stainless steel screws etc. Profile of frame & sash shall be mitred cut and fusion welded at all corners, mullion (if required) shall be also fusion welded including drilling of holes for fixing hardwares and drainage of water etc. After fixing frame the gap between frame and adjacent finished wall shall be filled with weather proof silicon sealant over backer rod of required size and of approved quality, all complete as per approved drawing & direction of Engineer-in-Charge. (Single / double glass panes and silicon sealant shall be paid separately)Using R4 series with frame (64 mm & above) x (50 mm & above) & sash (64 mm & above) x (70 mm & above) & mullion (64 mm & above) x (70 mm & above). (Height above 1.8 metre; each openable shutter upto 0.8m width) 190 Providing and fixing M.S. Tubular frames for doors, windows, ventilators and cupboard with rectangular/ L-Type sections, made of 1.60 mm thick M.S. Sheet, joints mitred, welded and grinded finish, with profiles ofrequired size, including fixing of necessary butt hinges and screws and applying a priming coat of approved steel primer.Fixing with 15x3 mm lugs 10 cm long embedded in cement concrete block 15x10x10 cm of C.C. 1:3:6 (1 Cement : 3 coarse sand : 6 graded stone aggregate 20 mm nominal size) 191 Distempering with oil bound washable distemper of approved brand and manufacture to give an even shade : New work (two or more coats) over and including water thinnable priming coat with cement primer 192 Finishing walls with Premium Acrylic Smooth exterior paint with Silicone additives of required shade:New work (Two or more coats applied @ 1.43 ltr/10 sqm over and including priming coat of exterior primer applied @ 2.20 kg/10 sqm) 193 Distempering with oil bound washable distemper of approved brand and manufacture to give an even shade : New work (two or more coats) over and including water thinnable priming coat with cement primer 194 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 195 Providing and fixing stone jali 40 mm thick throughout in cement mortar 1:3 (1 cement : 3 coarse sand), including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment, matching the stone shade, jali slab without any chamfers etc. Red sand stone 196 Stone work, plain in copings, cornices, string courses and plinth courses, upto 75 mm thick in Cement mortar 1:6 (1 cement : 6 coarse sand), including pointing with white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade.Red sand stone 197 Stone work (machine cut edges) for wall lining etc. (veneer work) upto 10 metre height, backing filled with a grout of average 12 mm thick cement mortar 1:3 (1 cement : 3 coarse sand) including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade : (To be secured to the backing and the sides by means of cramps and pins which shall be paid for separately) : Red sand stone - exposed face fine dressed with rough backing .40mm thick 198 Providing and fixing stainless steel cramps of required size and shape for anchoring stone wall lining to the backing or securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases in stone and holes in walls wherever required. 199 Providing and fixing copper pins 7.5 cm long 6 mm diameter for securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases. 200 Reinforced cement concrete work in arches, archribs, domes, vaults, shells, folded plate and roofs having slope more than 15° up to floor five level, excluding the cost of centering, shuttering, finishing and reinforcement with 1:1.5:3 (1 cement : 1.5 coarse sand (zone-lll) derived from natural sources : 3 graded stone aggregate 20 mm nominal size derived from natural sources). 201 Providing and fixing 150 mm bright finished floor brass door stopper with rubber cushion, necessary brass screws etc. to suit shutter thickness complete. 202 Providing and fixing ISI marked oxidised M.S. Sliding door bolts with nuts and screws etc. complete 300 mm x 16mm 203 Providing and fixing ISI marked oxidised M.S. Tower bolts black finish, (Barrel Type) with necessaryscrews etc. complete250 mm x 10mm 204 Providing and fixing ISI marked oxidised M.S. handles conforming to IS 4992 with necessary screws etc. complete.125mm 205 Providing and laying integral cement based water proofing treatment including preparation of surface as required for treatment of roofs, balconies, terraces etc consisting of following operations: a) Applying a slurry coat of neat cement using 2.75 kg/sqm. of cement admixed with water proofing compound conforming to IS. 2645 and approved by Engineer-in-charge over the RCC slab including adjoining walls upto 300mm height including cleaning the surface before treatment.b) Laying brick bats with mortar using broken bricks/brick bats 25 mm to 115mm size with 50% of cement mortar 1:5 (1 cement : 5 coarse sand) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge over 20 mm thick layer of cement mortar of mix 1:5 (1 cement :5 coarse sand ) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge to required slope and treating similarly the adjoining walls upto 300 mm height including rounding of junctions of walls and slabs c) After two days of proper curing applying a second coat of cement slurry using 2.75kg/ sqm of cement admixed with water proofing compound conforming to IS : 2645 and approved byEngineer-in-charge. d) Finishing the surface with 20 mm thick jointless cement mortar of mix 1:4 (1 cement :4 coarse sand) admixed with water proofing compound conforming to IS : 2645 and approved by Engineer-in-charge including laying glass fibre cloth of approved quality in top layer of plaster and finally finishing the surface with trowel with neat cement slurry and making pattern of 300x300 mm square 3mm deep. e) The whole terrace so finished shall be flooded with water for a minimum period of two weeks for curing and for final test. All above operations to be done in order and as directed and specified by the Engineer-in-Charge : With average thickness of 120mm and minimum thickness at khurra as 65 mm. 206 ELECTRICALWiring for light point/ fan point/ exhaust fan point/ call bell point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable in surface/ recessed medium class PVC conduit,with modular switch, modular plate, suitable GI box and earthing the point with 1.5 sq.mm FRLS PVC insulated copper conductor single core cable etc. as required.Group C 207 Wiring for light/ power plug with 2X4 sq. mm FRLS PVC insulated copper conductor single core cable in surface/ recessed medium class PVC conduit alongwith 1 No. 4 sq. mm FRLS PVC insulated copper conductor single core cable for loop earthing as required. 208 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required.2 X 1.5 sq. mm + 1 X 1.5 sq. mm earth wire 209 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required.2 X 2.5 sq. mm + 1 X 2.5 sq. mm earth wire 210 Wiring for circuit/ submain wiring alongwith earth wire with the following sizes of FRLS PVC insulated copper conductor, single core cable in surface/ recessed medium class PVC conduit as required.2 X 4 sq. mm + 1 X 4 sq. mm earth wire 211 Supplying and fixing following modular switch/ socket on the existing modular plate & switch box including connections but excluding modular plate etc. as required.5/6 A switch 212 Supplying and fixing following modular switch/ socket on the existing modular plate & switch box including connections but excluding modular plate etc. as required.3 pin 5/6 A socket outlet 213 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providing and fixing 3 pin 5/6 A modular socket outlet and 5/6 A modular switch, connections etc. as required. 214 Supplying and fixing suitable size GI box with modular plate and cover in front on surface or in recess, including providing and fixing 6 pin 5/6 & 15/16 A modular socket outlet and 15/16 A modular switch, connections etc. as required. 215 Installation of exhaust fan in the existing opening, including making good the damage, connection, testing, commissioning etc. as required.Upto 450 mm sweep 216 Supplying and fixing PVC batten/ angle holder including connections etc. as required. 217 Supplying and laying ofaluminium conductor PVC insulated armoured served sheathed cable 1100 volts grade at the depth of 750 mm bellow ground level over a cushion of 75 mm thick sand all around and protected with burnt bricks on side and on top .On surface the cable run shall be fixed on MS clamps etc.of suitable size or as directed bythe Engineer-Incharge ,complete in all respect.The armouring of the cable shall be properly connected with the earth conductor by clamps etc. Following sizesize 6 sq mm x 2 core 218 Supply and fixing of brass nickle plated compression gland for pvc insulated & armoured served sheaththed ,underground cable including rubber ring etc. complete in all respect. Thearmouring of the cable shall be properly connected with the earthas per direction of engineer-incharge. for cable size 6 sq mm x2 core 219 Supply and fixing ofplain or pin type copper tin plated cable socket (lug) to cable leadsfor pvc insulated & armoured cable insulating with tape and making connection. complete in all respect as per direction of engineer -incharge. for cable size 6 sq mm 220 Supplying and fixing following way, single pole and neutral (SPN), sheet steel, MCB distribution board, 415 V, on surface/ recess, complete with tinned copper bus bar, neutral bus bar, earth bar, din bar, interconnections, powder painted including earthing etc. as required. (But without MCB/RCCB/Isolator)6 way , Double door 221 Supplying and fixing 5 A to 32 A rating, 240/415 V, 10 kA, C curve, miniature circuit breaker suitable for inductive load of following poles in the existing MCB DB complete with connections, testing and commissioning etc. as required.Single pole 222 Supplying and fixing single pole blanking plate in the existing MCB DB complete etc. as required. 223 Supplying and fixing following rating, double pole, 240 volts, isolator in the existing MCB DB complete with connections, testing and commissioning etc. as required.40 A 224 Supply of Ceiling Fan with fan motor of A.C Permanent insulation, capacitor rating conforming BEE 5 star rating and IS:374/79 and also comply with IS: 1709/1984 with latest amendment. The rated voltage 220/240 volts, 50Hz, 1-ph AC the fan assemble should consists of down road blades, shackle canopies etc and with double ball bearing system.BEE 5 Star rated-1200mm sweep 225 Supply & fixing of recess mounting round 15 to 18 watt LED down Lighter having Powder coated die cast aluminium housing with heat sink , diffuser /reflector and driver with theft protection set complete in all respect. 226 Supply & fixing of 225/300mm sweep ventilating (Light Duty) exhaust fan complete with Metallic Blade (Steel bird guard protector /Copper motor for high air suction performance /Capacitor etc.), Noise level : (45 - 50) dB, Power consumption : 45 W, Rated voltage : 230 V, Rated frequency : 50 Hz, Motor type : Normal Speed. Complete in all respect. 227 PLUMBINGProviding and fixing white vitreous china pedestal type water closet (European type W.C. pan) with seat and lid, 10 litre low level white P.V.C. flushing cistern, including flush pipe, with manually controlled device (handle lever), conforming to IS : 7231, with all fittings and fixtures complete, including cutting and making good the walls and floors wherever required:W.C. pan with ISI marked white solid plastic seat and lid 228 Providing and fixing wash basin with C.I. brackets, 15 mm C.P. brass pillar taps,32 mm C.P. brass waste of standard pattern, including painting of fittings and brackets, cutting and making good the walls wherever require: White Vitreous China Flat back wash basin size 550x 400 mm with single 15 mm C.P. brass pillar tap 229 Extra for providing opening of required size & shape for wash basin/ kitchen sink in kitchen platform, vanity counter and similar location in marble/ Granite/ stone work, including necessary holes for pillar taps etc. including moulding, rubbing and polishing of cut edges etc. complete. 230 Providing and fixing flexible P.V.C. waste pipe for sink or wash basin including PVC waste fittings complete.Flexible pipe32 mm dia 231 Providing and fixing mirror of superior glass (of approved quality) and of required shape and size with plastic moulded frame of approved make and shade with 6 mm thick hard board backing :Circular shape 450 mm dia 232 Providing and fixing 600x120x5 mm glass shelf with edges round off, supported on anodised aluminium angle frame with C.P. brass brackets and guard rail complete fixed with 40 mm long screws, rawl plugs etc., complete. 233 Providing and fixing toilet paper holder :C.P. brass 234 Supply and fixing of UPVC S.W.R. pipe type -B confirming to IS- 13592 including jointing the pipes with rubber ring, lubricant and UPVC SWR cuplar confirming to IS - 14735. Also including excavation of trenches cutting of walls and holes and repairing the walls floors and refilling the trenches as before but excluding supply and cost of other fittings such as elbow, bead, tee and Y-tee including supply of all material labour and T&P .Required for proper completion of the work.90 mm O.D. 235 Supply and fixing of UPVC S.W.R. pipe type -B confirming to IS- 13592 including jointing the pipes with rubber ring, lubricant and UPVC SWR cuplar confirming to IS - 14735. Also including excavation of trenches cutting of walls and holes and repairing the walls floors and refilling the trenches as before but excluding supply and cost of other fittings such as elbow, bead, tee and Y-tee including supply of all material labour and T&P .Required for proper completion of the work.110 mm O.D. 236 Providing and fixing unplasticised -PVC pipe clips of approved design to unplasticised - PVC rain water pipes by means of 50x50x50 mm hard wood plugs, screwed with M.S. screws of required length, including cutting brick work and fixing in cement mortar 1:4 (1 cement : 4 coarse sand) and making good the wall etc. complete.110 mm 237 Providing and fixing PTMT liquid soap container 109 mm wide, 125 mm high and 112 mm distance from wall of standard shape with bracket of the same materials with snap fittings of approved quality and colour weighing not less than 105 gms. 238 Providing and fixing G.I. pipes complete with G.I. fittings and clamps, i/c cutting and making good the walls etc.Internal work - Exposed on wall 20 mm nominal outer dia pipes 239 Providing and fixing G.I. pipes complete with G.I. fittings and clamps, i/c cutting and making good the walls etc.Internal work - Exposed on wall 25 mm nominal outer dia pipes 240 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings, including fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings with one step CPVC solvent cement and testing of joints complete as per direction of Engineer in Charge.Internal work - Exposed on wall25 mm nominal outer dia Pipes 241 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings, including fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings with one step CPVC solvent cement and testing of joints complete as per direction of Engineer in Charge.Internal work - Exposed on wall32 mm nominal outer dia Pipes 242 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings i/c fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings, with one step CPVC solvent cement and the cost of cutting chases and making good the same including testing of joints complete as per direction of Engineer-in-Charge. Concealed work, including cutting chases and making good the wall etc.15 mm nominal outer dia pipes 243 Providing and fixing Chlorinated Polyvinyl Chloride (CPVC) pipes, having thermal stability for hot & cold water supply, including all CPVC plain & brass threaded fittings i/c fixing the pipe with clamps at 1.00 m spacing. This includes jointing of pipes & fittings, with one step CPVC solvent cement and the cost of cutting chases and making good the same including testing of joints complete as per direction of Engineer-in-Charge. Concealed work, including cutting chases and making good the wall etc.20 mm nominal outer dia pipes 244 Providing and fixing of gun metal gate valve with CI wheel of approved quality (screwed ends)25mm dia, nominal bore 245 Providing and fixing of gun metal gate valve with CI wheel of approved quality (screwed ends)32 mm dia, nominal bore 246 Providing and fixing uplasticised PVC connection pipe with brass unions :45 cm length15 mm nominal bore 247 Painting G.I. pipes and fittings with synthetic enamel white paint with two coats over a ready mixed priming coat, both of approved quality for new work (internal work -exposed on walls)20 mm nominal outer dia pipes 248 Painting G.I. pipes and fittings with synthetic enamel white paint with two coats over a ready mixed priming coat, both of approved quality for new work (internal work -exposed on walls)25 mm nominal outer dia pipes 249 Providing and fixing C.P. brass bib cock of approved quality confirming to IS:893115mm nominal bore 250 Providing and fixing C.P.brass angle valve for basin mixer and geyser points of approved quality conforming to IS 8931 a) 15 mm nominal bore.15 mm nominal bore 251 Providing and fixing 8 mm dia C.P. / S.S. Jet with flexible tube upto 1 metre long with S.S. triangular plate to Eureopean type W.C. of quality and make as approved by Engineer - in - charge. 252 Excavating trenches of required width for pipes, cables, etc, including excavation for sockets, depth upto 1.5 m including getting out the excavated materials, returning the soil as required in layers not exceeding 20 cm in depth including consolidating each deposited layers by ramming, watering etc. stacking serviceable material for measurements and disposal of unserviceable material as directed, within a lead of 50m :Pipes, cables etc. exceeding 80 mm dia but not exceeding 300 mm dia. 253 Supply and fixing of UPVC S.W.R. pipe type -B confirming to IS- 13592 including jointing the pipes with rubber ring, lubricant and UPVC SWR cuplar confirming to IS - 14735. Also including excavation of trenches cutting of walls and holes and repairing the walls floors and refilling the trenches as before but excluding supply and cost of other fittings such as elbow, bead, tee and Y-tee including supply of all material labour and T&P .Required for proper completion of the work.160 mm O.D. 254 Providing and laying cement concrete 1:5:10 (1 cement : 5 coarse sand : 10 graded stone aggregate 40 mm nominal size) all-round S.W. pipes including bed concrete as per standard design : 150 mm diameter pipe 255 Supply and fixing of UPVC S.W. R. Gully trap confirming to IS - 14735 size 150x110 mm dia of self cleaning design including fixed brick Masonary chamber 250x250x250mm Size i/ c supply and fixing of CI cover with frame weight not less then 4.50Kg. & CI grating 150x150mm complete in all respects. 256 Constructing brick masonry manhole in cement mortar 1:4 ( 1 cement : 4 coarse sand ) with R.C.C. top slab with 1:2:4 mix (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size), foundation concrete 1:4:8 mix (1 cement : 4 coarse sand : 8 graded stone aggregate 40 mm nominal size), inside plastering 12 mm thick with cement mortar 1:3 (1 cement : 3 coarse sand) finished with floating coat of neat cement and making channels in cement concrete 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate 20 mm nominal size) Fisnihed with a floating coat of neat cement complete as per standard design : Inside size 900 x 800mm and 500mm deep including C.I. Cover frame. 257 Providing and placing on terrace (at all floor levels) polyethylene water storage tank, IS : 12701 marked, with cover and suitable locking arrangement and making necessary holes for inlet, outlet and overflowpipes but without fittings and the base support for tank. 258 BEAUTIFICATION OF TEMPLEProviding and fixing double scaffolding system (cup lock type) on the exterior side, up to seven story height made with 40 mm dia M.S. tube 1.5 m centre to centre, horizontal & vertical tubes joining with cup & lock system with M.S. tubes, M.S. tube challies, M.S. clamps and M.S. staircase system in the scaffolding for working platform etc. and maintaining it in a serviceable condition for the required duration as approved and removing it there after .The scaffolding system shall be stiffened with bracings, runners, connection with the building etc wherever required for inspection of work at required locations with essential safety features for the workmen etc. complete as per directions and approval of Engineerin-charge .The elevational area of the scaffolding shall be measured for payment purpose .The payment will be made once irrespective of duration of scaffolding.Note: - This item to be used for maintenance work judicially, necessary deduction for scaffolding in the existing item to be done. 259 Very carefull removal and scrapping of existing pulverised plaster from traditional brick surface, including raking out the joints andscrapping out dead and decayed mortar very-very carefully including washing and preparing the surface good for replastering. Note:it is to be noted that tradional plaster that is intact shall not be taken out or damaged and shall remain intact.(Labour Rates as perA.S.IL.K.O CurrentRate.) 260 Filling of minor cracks, hair cracks, fissures & minor cavaities after proper cleaning of surface with soft brush and presurised air, with Lime putty ,sand & Surkhi matching the colour final finishing with lime punning very-2 carefully.(Labour Rates as perA.S.IL.K.O CurrentRate.) 261 Stitching of wide cracks carefully by taking out all loose materials, cleaning with pressure water pumps & air blower and filling 1/3 depth with lime mortar with cross masonry stitching using Brass/SS clamps and chiken mesh with matching bricks in lime mortar 1:1:1 (1 lime putty : 1 coarse sand: 1surkhi) matching the courses and features of existing masonry under the supervision of the conservation architect.(Labour Rates as perA.S.IL.K.O CurrentRate.) 262 Raking out the joints of traditional brick masonrysurface to the required width and depth, with due care and precaution, by mechanical/manual means including preparing & cleaning the surface re-filling of joints, including disposal of rubbish within headlead of 50 metres. (Labour Rates as perA.S.IL.K.O CurrentRate.) 263 Base layer Rough mortar as base of plaster & filling the core masonry voids very carefully and pushing the mortarin joints upto8-10 mm thick in (1:1:1) 1 Lime putty: 1 Surkhi: 1 Coarse sand on the traditional underpinning(brick masonry),mixed with oraganic additivesWood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P(Labour Rates as perA.S.IL.K.O CurrentRate.) 264 Restoration of damaged & Pulverized simple plaster of thickness 20-40 mm in combination mortarusing 1:1:1 (1 Lime putty: 1 Surkhi: 1 Coarse sand) mixed with other traditional material for more strength of mortar mixing withWood Apple,Gum, Black Gram,Molasses & Fenugreek seeds ,including all supply of labour,material & T&P required for proper completion in all respect as per original pattern, matching with original colour and texture.(Labour Rates as perA.S.IL.K.O CurrentRate.) 265 Restoration and reproduction of damaged and pulverised lime plasterwith grooves/curved plaster as per original geometrical pattern with thickness of upto 20-40 mm with traditional lime mortar in ratio (1 lime putty: 1 surkhi: 1 sand) mixed with gur/sheera & belgiri, including final finishing of surface. 266 Decorative lime plaster application with a 1:1:1 mortar mix, encompassing meticulous replication of all intricate design elements present on-site, atop a base layer plaster adhering to traditional techniques, while ensuring the preservation of all curves and contours. The preparation of mortar strictly involves grinding mill procedures. Given the intricate nature of this task, it necessitates meticulous execution under the vigilant oversight of a Conservation Architect. (Labour Rates as perA.S.IL.K.O CurrentRate.) 267 Traditional stucco works using lime putty mortar in accordance with established conventions and design specifications, ensuring the preservation of contours and curves through pattern molds. The mortar preparation exclusively involves grinding mill procedures. Thickness ranges from 10mm to 100mm, tailored to the specific design requirements. 268 Removing white or color wash by scrapping and sand paperingwithout causing damage to the below stone/brick/plastered surface.and preparing the surface smooth including necessary repairs to scratches etc. complete. 269 Disposal of building rubbish / malba / similar unserviceable, dismantled or waste materials by mechanical means, including loading, transporting, unloading to approved municipal dumping ground or as approved by Engineer-in-charge, beyond 50 m initial lead, for all leads including all lifts involved. 270 Steel work welded in built up sections/ framed work, including cutting, hoisting, fixing in position and applying a priming coat of approved steel primer using structural steel etc. as required.In gratings, frames, guard bar, ladder, railings, brackets, gates and similar works 271 40mm thick fine dressed stone flooring over 20 mm (average) thick base of cement mortar 1:5 (1 cement : 5 coarse sand), including pointing with cement mortar 1:2 (1 cement: 2 stone dust) with an admixture of pigment to match the shade of stone.Red sand stone 272 Fresco works on interiors of dome 273 BEAUTIFICATION OF EXISTING SAMADHIDismantling old plaster or skirting raking out joints and cleaning the surface for plaster including disposal of rubbish to the dumping ground within 50 metres lead. 274 Disposal of building rubbish / malba / similar unserviceable, dismantled or waste materials by mechanical means, including loading, transporting,unloading to approved municipal dumping ground or as approved byEngineer-in-charge, beyond 50 m initial lead, for all leads including all lifts involved. 275 15mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 276 Providing and laying Polished Granite stone flooring in required design and patterns, in linear as well as curvilinear portions of the building all complete as per the architectural drawings with 18 mm thick stone slab over 20 mm (average) thick base of cement mortar 1:4 (1 cement : 4 coarse sand) laid and jointed with cement slurry and pointing with white cement slurry admixed with pigment of matching shade including rubbing ,curing and polishing etc. all complete as specified and as directed by the Engineer-in-Charge. Polished Granite stone slab of colour Black, Cherry/Ruby Red or equivalent 277 BEAUTIFICATION OFSURROUNDING PERIPHERIRemoving dry or oil bound distemper, water proofing cement paint and the like by scrapping, sand papering and preparing the surface smooth including necessary repairs to scratches etc. complete 278 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 279 Finishing walls with Premium Acrylic Smooth exterior paint with Silicone additives of required shade: New work (Two or more coats applied @ 1.43 ltr/10 sqm over and including priming coat of exterior primer applied @ 2.20 kg/10 sqm) 280 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 281 SAND STONE FLOORINGDismantling old plaster or skirting raking out joints and cleaning the surface for plaster including disposal of rubbish to the dumping ground within 50 metres lead. 282 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 283 Disposal of building rubbish / malba / similar unserviceable, dismantled or waste materials by mechanical means, including loading, transporting,unloading to approved municipal dumping ground or as approved byEngineer-in-charge, beyond 50 m initial lead, for all leads including all lifts involved. 284 15mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 285 40mm thick fine dressed stone flooring over 20 mm (average) thick base of cement mortar 1:5 (1 cement : 5 coarse sand), including pointing with cement mortar 1:2 (1 cement: 2 stone dust) with an admixture of pigment to match the shade of stone.Red sand stone 286 BOUNDRYWALLExcavation in foundations in ordinary soil (Loam clay or sand) including lift upto 1.5 m (5 fts.) and lead upto 30 mt. (100 fts.) & including filling, watering and ramming of excavated earth into the trenches or into the space between the building and the sides of foundation trenches or into the plinth and removal and disposal of surplus earth as directed by the Engineer-Incharges upto a distance of 30mt. (100 fts) from the foundation trenches. 287 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 288 Providing and laying in position ready mixed or site batched design mix cement concrete for reinforced cement concrete work; using coarse aggregate and fine aggregate derived from natural sources, Portland Pozzolana / Ordinary Portland /Portland Slag cement, admixtures in recommended proportions as per IS: 9103 to accelerate / retard setting of concrete, to improve durability and workability without impairing strength; including pumping of concrete to site of laying, curing, carriage for all leads; but excluding the cost of centering, shuttering, finishing and reinforcement as per direction of the engineer-in-charge; for the following grades of concrete.Note: Extra cement up to 10% of the minimum specified cement content in design mix shall be payable separately. In case the cement content in design mix is more than 1.10 times of the specified minimum cement content, the contractor shall have discretion to either re-design the mix or bear the cost of extraement,Concrete of M-25 grade with minimum cement content of 330 kg /cum.All works upto plinth level 289 Steel Reinforcement for R.C.C. work including straightening, cutting, bening, placing in position & binding all complete upto plinth level or above plinth level. Thermo-mechanically, Treating bars of grade Fe-500D or more. 290 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in foundation and plinth in:Cement mortar 1:4 (1 cement : 4 coarse sand) 291 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 292 Providing and laying Polished Granite stone flooring in required design and patterns, in linear as well as curvilinear portions of the building all complete as per the architectural drawings with 18 mm thick stone slab over 20 mm (average) thick base of cement mortar 1:4 (1 cement : 4 coarse sand) laid and jointed with cement slurry and pointing with white cement slurry admixed with pigment of matching shade including rubbing ,curing and polishing etc. all complete as specified and as directed by the Engineer-in-Charge. Polished Granite stone slab of colour Black, Cherry/Ruby Red or equivalent 293 Finishing walls with Premium Acrylic Smooth exterior paint with Silicone additives of required shade:New work (Two or more coats applied @ 1.43 ltr/10 sqm over and including priming coat of exterior primer applied @ 2.20 kg/10 sqm) 294 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 295 Steel work welded in built up sections/ framed work, including cutting, hoisting, fixing in position and applying a priming coat of approved steel primer using structural steel etc. as required.In gratings, frames, guard bar, ladder, railings, brackets, gates and similar works 296 Painting Steel work with Deluxe Multi Surface Paint to give an even shade. Two or more coat applied @ 0.90 ltr/10 sqm over an under coat of primer applied @ 0.80 ltr/10 sqm of approved brand and manufacture 297 Centering and shuttering including strutting, propping etc. and removal of form forLintels, beams, plinth beams, girders, bressumers and cantilevers 298 Centering and shuttering including strutting, propping etc. and removal of form forFoundations, footings, bases of columns, etc. for mass concrete 299 Centering and shuttering including strutting, propping etc. and removal of form forColumns, Pillars, Piers, Abutments, Posts and Struts 300 GATE - 1Dismantling old plaster or skirting raking out joints and cleaning the surface for plaster including disposal of rubbish to the dumping ground within 50 metres lead. 301 Disposal of building rubbish / malba / similar unserviceable, dismantled or waste materials by mechanical means, including loading, transporting,unloading to approved municipal dumping ground or as approved by Engineer-in-charge, beyond 50 m initial lead, for all leads including all lifts involved. 302 Half brick masonry with common burnt clay F.P.S. (non modular) brick of class designation 7.5 in superstructure above plinth level up to floorV level.6.13.2 Cement mortar 1:4 (1 cement :4 coarse sand) 303 Cement plaster 1:3 (1 cement: 3 coarse sand) finished with a floating coat of neat cement.12 mm cement plaster 304 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 305 Finishing walls with Premium Acrylic Smooth exterior paint with Silicone additives of required shade: New work (Two or more coats applied @ 1.43 ltr/10 sqm over and including priming coat of exterior primer applied @ 2.20 kg/10 sqm) 306 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 307 Stone work (machine cut edges) for wall lining etc. (veneer work) upto 10 metre height, backing filled with a grout of average 12 mm thick cement mortar 1:3 (1 cement : 3 coarse sand) including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade : (To be secured to the backing and the sides by means of cramps and pins which shall be paid for separately) : Red sand stone - Exposed face machine cut and table rubbed with rough backing. . 40 mm thick 308 Providing and fixing stainless steel cramps of required size and shape for anchoring stone wall lining to the backing or securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases in stone and holes in walls wherever required. 309 Providing and fixing copper pins 7.5 cm long 6 mm diameter for securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases. 310 Painting Steel work with Deluxe Multi Surface Paint to give an even shade. Two or more coat applied @ 0.90 ltr/10 sqm over an under coat of primer applied @ 0.80 ltr/10 sqm of approved brand and manufacture 311 Supplying, fabricating, transporting, hoisting and fixing in position good quality of 70 mm red sandstone in various elements for all levels. Stone shall be free from cracks, lines stains and even in shade for each element. The stone shall be fine grained and reddish or buff-colored (locally available). The work shall be carried out as per attached drawings with different process of i.e carving (manual/ by machine), ornamental work, traditional work, figure work (any type, any size), CNC cutting, moulding. The carving and molding work shall be of very good quality. The stones to be fixed in line, level and plumb in all respect with the use of brass clamps, pins, (to be paid separetely) dowels, cement slurry with matching pigment and Epoxy of Akemi Germany, Ardex Endura, MYK laticrete or approved make as required and as approved by the Architects. 312 GATE-2Dismantling old plaster or skirting raking out joints and cleaning the surface for plaster including disposal of rubbish to the dumping ground within 50 metres lead. 313 Disposal of building rubbish / malba / similar unserviceable, dismantled or waste materials by mechanical means, including loading, transporting, unloading to approved municipal dumping ground or as approved by Engineer-in-charge, beyond 50 m initial lead, for all leads including all lifts involved. 314 Reinforced cement concrete work in beams, suspended floors, roofs having slope up to 15° landings, balconies, shelves, chajjas, lintels, bands, plain window sills, staircases and spiral stair cases above plinth level up to floor five level, excluding the cost of centering, shuttering, finishing and reinforcement with 1:1.5:3 (1 cement : 1.5 coarse sand(zone-III) derived from natural sources : 3 graded stone aggregate 20 mm nominal size derived from natural sources). 315 Brick work with common burnt clay F.P.S. (non modular) bricks of class designation 7.5 in foundation and plinth in:Cement mortar 1:6 (1 cement : 6 coarse sand) 316 Cement plaster 1:3 (1 cement: 3 coarse sand) finished with a floating coat of neat cement.12 mm cement plaster 317 12mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 318 Finishing walls with Premium Acrylic Smooth exterior paint with Silicone additives of required shade: New work (Two or more coats applied @ 1.43 ltr/10 sqm over and including priming coat of exterior primer applied @ 2.20 kg/10 sqm) 319 Providing and applying white cement based putty of average thickness 1 mm, of approved brand and manufacturer, over the plastered wall surface to prepare the surface even and smooth complete. 320 Centering and shuttering including strutting, propping etc. and removal of form forSuspended floors, roofs, landings, balconies and access platform 321 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete upto plinth level.Thermo-Mechanically Treated bars of grade Fe-500D or more. 322 Stone work (machine cut edges) for wall lining etc. (veneer work) upto 10 metre height, backing filled with a grout of average 12 mm thick cement mortar 1:3 (1 cement : 3 coarse sand) including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade : (To be secured to the backing and the sides by means of cramps and pins which shall be paid for separately) : Red sand stone - Exposed face machine cut and table rubbed with rough backing. . 40 mm thick 323 Providing and fixing stainless steel cramps of required size and shape for anchoring stone wall lining to the backing or securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases in stone and holes in walls wherever required. 324 Providing and fixing copper pins 7.5 cm long 6 mm diameter for securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases. 325 Painting Steel work with Deluxe Multi Surface Paint to give an even shade. Two or more coat applied @ 0.90 ltr/10 sqm over an under coat of primer applied @ 0.80 ltr/10 sqm of approved brand and manufacture 326 Supplying, fabricating, transporting, hoisting and fixing in position good quality of Red sandstone Chhatri in various elements for all levels, inlcuding the cost of oranmental stone work and mouldings, carvings as required, the stone of varied thickness shall be used for stacking. Also includes the cost of structural load calculation and design with respect to the drawing recevied from architect in charge.Preferable tentative size 2.0M X 0.6 MX 1.50 M OR tentative Size as approved from architect in charge 327 Supplying, fabricating, transporting, hoisting and fixing in position good quality of 70 mm red sandstone in various elements for all levels. Stone shall be free from cracks, lines stains and even in shade for each element. The stone shall be fine grained and reddish or buff-colored (locally available). The work shall be carried out as per attached drawings with different process of i.e carving (manual/ by machine), ornamental work, traditional work, figure work (any type, any size), CNC cutting, moulding. The carving and molding work shall be of very good quality. The stones to be fixed in line, level and plumb in all respect with the use of brass clamps, pins, (to be paid separetely) dowels, cement slurry with matching pigment and Epoxy of Akemi Germany, Ardex Endura, MYK laticrete or approved make as required and as approved by the Architects. 328 Providing and laying cement concrete 1:4:8 (1 cement :4 coarse sand :8 graded Stone aggregate 40 mm nominal size) including supply of all materials, labour T & P rtc required for proper completion of the work and curing complete also including cost of formwork in foundation & floors. 329 15mm thick plaster with cement mortar in proportion of 1:6 cement & coarse sand of 2.25 F.M. (1) 1 cement : 6 coarse sand 330 Cement concrete flooring 1:2:4 (1 cement : 2 coarse sand : 4 graded stone aggregate) finished with a floating coat of neat cement, including cement slurry, but excluding the cost of nosing of steps etc. complete. 40 mm thick with 20 mm nominal size stone aggregate 331 Painting Steel work with Deluxe Multi Surface Paint to give an even shade. Two or more coat applied @ 0.90 ltr/10 sqm over an under coat of primer applied @ 0.80 ltr/10 sqm of approved brand and manufacture 332 40 mm thick fine dressed stone flooring over 20 mm (average) thick base of cement mortar 1:5 (1 cement : 5 coarse sand), including pointing with cement mortar 1:2 (1 cement: 2 stone dust) with an admixture of pigmentto match the shade of stone.Red sand stone 333 Kota stone slab flooring over 20 mm (average) thick base laid over and jointed with grey cement slurry mixed with pigment to match the shade of the slab, including rubbing and polishing complete with base of cementmortar 1 : 4 (1 cement : 4 coarse sand) : 25 mm thick 334 Stone work (machine cut edges) for wall lining etc. (veneer work) upto 10 metre height, backing filled with a grout of average 12 mm thick cement mortar 1:3 (1 cement : 3 coarse sand) including pointing in white cement mortar 1:2 (1 white cement : 2 stone dust) with an admixture of pigment matching the stone shade : (To be secured to the backing and the sides by means of cramps and pins which shall be paid for separately) : Red sand stone - exposed face fine dressed with rough backing .40mm thick 335 Providing and fixing stainless steel cramps of required size and shape for anchoring stone wall lining to the backing or securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases in stone and holes in walls wherever required. 336 Providing and fixing copper pins 7.5 cm long 6 mm diameter for securing adjacent stones in stone wall lining in cement mortar 1:2 (1 cement : 2 coarse sand), including making the necessary chases. 337 Providing and fixing M.S.brackets 55x22.5x45 cm sunk and moulded including providing and fixing with 4 Nos gun metal cramp 25x6 mm 30 cm long 338 Supplying, fabricating, transporting, hoisting and fixing in position good quality of 70 mm red sandstone in various elements for all levels. Stone shall be free from cracks, lines stains and even in shade for each element. The stone shall be fine grained and reddish or buff-colored (locally available). The work shall be carried out as per attached drawings with different process of i.e carving (manual/ by machine), ornamental work, traditional work, figure work (any type, any size), CNC cutting, moulding. The carving and molding work shall be of very good quality. The stones to be fixed in line, level and plumb in all respect with the use of brass clamps, pins, (to be paid separetely) dowels, cement slurry with matching pigment and Epoxy of Akemi Germany, Ardex Endura, MYK laticrete or approved make as required and as approved by the Architects. 339 SEPTIC TANK & SOAKPITEarth work in surface excavation not exceeding 30 cm in depth but exceeding 1.5 m in width as well as 10 sqm on plan including getting out and disposal of excavated earth upto 50 m and lift upto 1.5 m, as directed by Engineer-in- Charge: All kinds of soil 340 Earth work in surface excavation not exceeding 30 cm in depth but exceeding 1.5 m in width as well as 10 sqm on plan including getting out and disposal of excavated earth upto 50 m and lift upto 1.5 m, as directed by Engineer-in- Charge: All kinds of soil1.50 M TO 3.0 M 341 Providing and laying in position cement concrete of specified grade excluding the cost of centering and shuttering - All work up to plinth level : 1:4:8 (1 Cement : 4 coarse sand (zone-III) derived from natural sources : 8 graded stone aggregate 40 mm nominal size derived from natural sources) 342 Reinforced cement concrete work in beams, suspended floors, roofs having slope up to 15° landings, balconies, shelves, chajjas, lintels, bands, plain window sills, staircases and spiral stair cases above plinth level up to floor five level, including the cost of centering, shuttering, finishing and reinforcement with 1:1.5:3 (1 cement : 1.5 coarse sand(zone-III) derived from natural sources : 3 graded stone aggregate 20 mm nominal size derived from natural sources). 343 Centering and shuttering including strutting, propping etc. and removal of form forSuspended floors, roofs, landings, balconies and access platform 344 Brick Work with common burnt clay ( non modular) bricks of class - 150 in foundation and plinth in: Cement mortar 1:6 ( 1 cement : 6 coarse sand) 345 Steel reinforcement for R.C.C. work including straightening, cutting, bending, placing in position and binding all complete upto plinth level.Thermo-Mechanically Treated bars of grade Fe-500D or more. 346 Cement plaster (1:3) finished with a floating coat of neat cement.20 mm Cement Plaster 347 Providing M.S. foot rest including fixing with 20x20x10 cm. cement concrete block 1:3:6 (1 cement : 3 coarse sand : 6 gradded aggregate of nominal size 20mm ) as per standard design with 20x20mm sq bars. 348 Providing and fixing C.I. tee at the inlet and outlet of septic tank. 349 Providing & fixing 75mm dia vent pipes. 350 Providing & fixing of 75mm dia cast iron terminal guard. 351 Providing and fixing in position precast RCC manhole cover and frame of required shape and approved quality.HD . -20- Circular shape 500mm internal diameter 352 Making soak pit 2.5 m diameter 3.0 metre deep with 45 x 45 cm dry brick honey comb shaft with bricks of class designation 75 and S.W. drain pipe 100 mm diameter, 1.8m long complete as per standard design.With F.P.S. bricks 353 SUMERSABLE WITHBOARINGBoring/drilling bore well of required dia for casing/ strainer pipe, by suitable method prescribed in IS: 2800 (part I), including collecting samples from different strata, preparing and submitting strata chart/ bore log, including hire & running charges of all equipments, tools, plants & machineries required for the job, all complete as per direction of Engineer -in-charge, beyond 90 metre below ground level. 300 mm dia 354 Supplying, assembling, lowering and fixing in vertical position in bore well, unplasticized PVC medium well casing (CM) pipe of requireddia, conforming to IS: 12818, including required hire and labour charges, fittings & accesDSRies etc. all complete, for all depths, as per direction of Engineer -in-charge. 150 mm nominal size dia 355 Supplying, assembling, lowering and fixing in vertical position in bore well unplasticized PVC medium well screen (RMS) pipes with ribs, conforming to IS: 12818, including hire & labour charges, fittings & accesDSRies etc. all complete, for all depths, as per direction of Engineer-in-charge.150 mm Nominal Size dia 356 Gravel packing in tubewell construction in accordance with IS: 4097, including providing gravel fine/ medium/ coarse, in required grading& sizes as per actual requirement, all complete as per direction of Engineer-in-charge. 357 Development of tube well in accordance with IS : 2800 (part I) and IS: 11189, to establish maximum rate of usable water yield without sand content (beyond permissible limit), with required capacity air compresDSR, running the compresDSR for required time till well is fully developed, measuring yield of well by V notch method or any other approved method, measuring static level & draw down etc. by step draw down method, collecting water samples & getting tested in approved laboratory, i/c disinfection of tubewell, all complete, including hire & labour charges of air compresDSR, tools & accesDSRies etc., all as per requirement and direction of Engineer-in-charge. 358 Providing and fixing suitable size threaded mild steel cap or spot welded plate to the top of bore well housing/ casing pipe, removable as per requirement, all complete for borewell of: 150 mm Dia 359 Providing and fixing M.S. clamp of required dia to the top of casing/ housing pipe of tubewell as per IS: 2800 (part I), including necessary bolts & nuts of required size complete.150 mm clamp 360 Providing and fixing Bail plug/ Bottom plug of required dia to the bottom of pipe assembly of tubewell as per IS:2800 (part I).150 mm Dia 361 Providing and fixing G.I. pipes complete with G.I. fittings including trenching and refilling etc.50 mm nominal size dia 362 Electric logging of bore hole 363 Supply and Installation of 1.5 HP Submersible pump set complete 364 INTERLOCKING PATHWAYEarth work in Excavation in trenches for foundations pipes cable etc in ordinary soil (loam clay or sand) including lift upto 1.50 meter and lead upto 50 meter and including filling, watering and ramming of excavated earthdisposal of sur-plus earth as directed by the Engineer incharge up to a distance of 50 meters from the foundation trenches. DSR2.8.1 365 Providing and layingin cement concrete 1:4:8 (1 cement: 4 coarse sand : 8 graded Stone aggregate 40 mm nominal size) and curing complete, including cost ofform-work, in foundation and floors. DSR 4.1.8 366 Providing and laying factory made chamfered edge Cement Concrete paver blocks in footpath, parks, lawns, drive ways or light traffic parking etc, of required strength, thickness & size/ shape, made by table vibratory method using PU mould, laid in required colour & pattern over 50 mm thick compacted bed of sand, compacting and proper embedding/laying of inter locking paver blocks into the sand bedding layer through vibratory compaction by using plate vibrator, filling the joints with sand and cutting of paver blocks as per required size and pattern, finishing and sweepingextra sand. complete all as per direction of Engineer-in-Charge.80 mm thick C.C. paver block of M-35 grade with approved colour design and pattern.DSR 16.91.2 367 Providing and laying at or near ground level factory made kerb stone of M-25 grade cement concrete in position to the required line, level and curvature, jointed with cement mortar 1:3 (1 cement: 3 coarse sand), including making joints with or without grooves (thickness of joints except at sharp curve shall not to more than 5 mm), including making drainage opening wherever required complete etc. as per direction of Engineerin- charge (length of finished kerb edging shall be measured to calculatevolume for payment). (Precast C.C. kerb stone shall be approved by Engineer-in-charge). 368 TOURIST FACILITYProviding & fixing ofred/pink Sandstone/MS bench without Handrest and backrest with Ornamentetion engraving/embossing(size 1500mm length and 450mm and height 600 mm) including foundation & support with all necessary T&P etc all complete as per design of direction in engineer/ Architect in charge. 369 Providing & fixing of SS/MS Dustbin size 487 x 399 x 1138 fixing on a foundation with base plate and wrapped with red sandstone from all sides of 75mm with all complete as per design of direction in engineer/ Architect in charge. 370 Signage- A :- Providing and fixing StandAlone Signage in marble/sanstone/ss/ms of approved thickness with powder coated 10-12 mm MS letters and illustration at desired locations with letters (in english, hindi and Braille) - etched, through cut, infilled or painted, also including the cost of design, fabrication and onsite installation with all the necessary accessories and equipments fior fixing on any surface as per drawing and design approved from Architect in charge English- Helvetica font with min 36 size Hindi -Krutidev font with min 36 size 371 Signage-C :- Providing and installing signage made of 25 mm thick red/white sandstone with dimensions of 600 mm x 200 mm. The signage shall feature text in English and Hindi, with the English text -Helvetica and the Hindi text - Devanagari , both in approved sizes. The signage shall be mounted on an MS plate and securely fixed to the wall using holdfasts. The design, finish, and text specifications shall be approved by the Architect-in-Charge. 372 EXTERNAL ELECTRIFICATIONSITC of 15w integrated Solar All in one suitable at height of 4-6mtr mounting arrangement. pole with minimum 2250 lumen , luminous flux with min.>150lm/w luminous efficacy having power of PV module (Wp) 40, Panel Type Mono Crystalline, Panel Dimensions not more than (mm) 775 (L) x 340 (W) x 60 (H), Battery Capacity max. 18 (Ah), Battery Rated Voltage 12.8(V), Battery type LiFePO4, having BMS protection Battery Management System ,having min. Battery Back up to 2days (24 hours) (Autonomy mode),MPPT charge controller type, Efficacy>90%, having facility of Charging Indicator (Green blinking),Low Battery Indicator (Red blinking),Error Indicator (Both blinking),For the better battery life having Over Charge Protection, Deep Discharge Protection, Battery reverse polarity protection ,Load Short circuit protection, Load Open circuit protection, Reverse polarity protection for Panel, Over temperature protection. Motion sensor detection facility with Long Distance Detection 12m.CCT-5500-6000k, Make-Panasonic, Philips or equivalent 373 Supply and laying of aluminium conductor PVC insulated armoured served sheathed cables 1100 Volts grade at a depth of 750 mm below ground level over a cushion of 75 mm. thick sand all around and protected with burnt bricks on sides and on top. On surface the cable run shall be fixed on M.S. clamps etc. of suitable size or as directed by the Engineer-Incharge ,complete in all respect. The armouring of the cable shall be properly connected with the earth conductor by clamps etc. 10.00 Sqmm 4 Core 374 Supply and laying of aluminium conductor PVC insulated armoured served sheathed cables 1100 Volts grade at a depth of 750 mm below ground level over a cushion of 75 mm. thick sand all around and protected with burnt bricks on sides and on top. On surface the cable run shall be fixed on M.S. clamps etc. of suitable size or as directed by the Engineer-Incharge ,complete in all respect. The armouring of the cable shall be properly connected with the earth conductor by clamps etc. 25.00 Sqmm 3.5 Core 375 Supply and laying of aluminium conductor PVC insulated armoured served sheathed cables 1100 Volts grade at a depth of 750 mm below ground level over a cushion of 75 mm. thick sand all around and protected with burnt bricks on sides and on top. On surface the cable run shall be fixed on M.S. clamps etc. of suitable size or as directed by the Engineer-Incharge ,complete in all respect. The armouring of the cable shall be properly connected with the earth conductor by clamps etc. 70.00 Sqmm 3.5 Core 376 Supplying and laying of following size DWC HDPE pipe ISI marked along with all accessories like socket, bend, couplers etc.conforming to IS 14930, Part II complete with fitting and cutting,jointing etc. in the existing trench, complete as required.63 mm dia (OD-63 mm & ID-51 mm nominal) 377 Supply, Installation, Testing and Commissioning of LEDRGB/RGBW flood lighting luminaire for facade lighting with Die- cast aluminium housing, powder- coated finish, of following wattage. Luminaire shall be capable of producing dynamic color changing light for with 16 million colors by DMX/ Ethernet based control. The be amangle of the fitting shall be narrow, medium, wide or asymmetric as per the requirement. Luminaire shall be complete with driver and capable of operating at line voltage without any separate power supply from 100-270 VAC, 50Hz with power factor>0.9. Fixture shall be suitable to operate at anambient temperature range of-10°Cto +50° C and shall be IP65 and IK06 rated. Life time shall be atleast L70:50000 burning hours at 50°C. Luminaire shall be conforming to BIS(IS10322) and shall be complete with all necessary accessories required for proper working of fixture in cluding weatherproof connection cables, waterproof connector setc. as required. 30 W 378 Supply and Fixing 12 Wattage Burial UNIIn Ground- Burial ip68 waterproof 12W 100-240V (Philips/Siems/or Equivalent) 379 KIDS PLAYSupplying and Fixing of Parallel Bars outdoor playing equipment(Make Arihant/ Kompain) including necessaryfittings, T&P etc all complete in direction of engineer in charge. 380 Supplying and Fixing of Monkey Bar outdoor playing equipment(Make Arihant/ Kompain) including necessaryfittings, T&P etc all complete in direction of engineer in charge. 381 Supplying and Fixing of Swing Economy outdoor playing equipment(Make Arihant/ Kompain) including necessaryfittings, T&P etc all complete in direction of engineer in charge. 382 Supplying and Fixing ofRabbit Rider outdoor playing equipment(Make Arihant/ Kompain) including necessaryfittings, T&P etc all complete in direction of engineer in charge. 383 Supplying and Fixing ofSliding Model No. outdoor playing equipment(Make Arihant/ Kompain) including necessaryfittings, T&P etc all complete in direction of engineer in charge. 384 DRINKING WATER COOLERReceiving, storing, handling, shifting, installation, testing & commissioning ofVoltas water cooler, including all accessories complete in all respect etc. (Make - Voltas or Equivalent) 385 G.S.T Extra as per applicable
Contract Date: Mar 19, 2025 Contract Value : 1.07 Crore
Government Departments No of Bidders 4
Uttar Pradesh View Result →
22.
Educational and Research Institute #7800250 AOC
Supply And Installation Of Mlt Lab Package-1MLT Laboratory Equipment (Major,Minor,Glassware, Plasticware,Reagents,Chemicals & Miscellaneous Items, Semi Automatic Biochemistry Analyzer , Spectrophotometer , Photo Colorimeter , Water Bath , Benchtop Non Refrigerated Centrifuge Got General Purpose(16 Bucket) , Incubator , Analytical Balance , Ph Meter , Automated Hematology Analyzer 3 Part , Binocular Microscope With Camera Attached For Faculty , Binocular Microscope For Students , Refrigerator-280 Liter Laboratory Type , Microtome Semi Automated , Tissue Floatation Bath , Hot Plate ( Slide Warming Table ) , Tissue Embedding Station , Biosafety Cabinet Class-2 A , Laminar Airflow , Autoclave- Vertical 100 Liter , Autoclave- Vertical 40 Liter , Rotary Shaker , Bod Incubator , Vortex Mixer , Semi Automated Elisa Reader With Washer & Pc Software , Deep Freezer (-20 C ) , Hot Air Oven , Adjustable Micropipettes 100-1000Ul , Adjustable Micropipettes 10-100Ul , Adjustable Micropipettes Upto 0.5 To 20 Ul , Fixed Micropipettes 20 ?L , Adjustable Micropipettes 5 To 50 Ul , Fixed Auto Pipettes 5Ml , Electric Needle And Syringe Destroyer (Needles Not To Be Destroyed) , Stage Micrometer , Timers , Audiometer , Sphygmomanometer- Digital (Automated) , Hygrometer , Temperature Indicator , Anaerobic Culture Jar , Sahli’Shaemoglobin Meter , Blood Mixer Roller , Tds Meter , Sphygmomanometer- Manual , Stethoscope , Water Purification Ro System , Icu Bed , Micro Centrifuge , Beakers -100 Ml Plastic , Beakers -250 Ml Plastic , Beakers - 500 Ml Plastic , Beakers-1 Liter Plastic , Test Tube Stand 1.5 Ml , Puncture Proof Container , Dustbin (Red, Yellow And Black) , Dropper Bottles Lab Use-300 Ml , Coplin Jar , Test Tube Stand Plastic- 5 Ml , Test Tube Stand Plastic- 15 Ml , 3 Ml Plastic Leak Proof Tube With Cap , Micropipette Stand , Sample Transportation Box , Urine Container -30 Ml , Stool Container-20 Ml , Syringe-2Ml , Syringe-5 Ml , Westergren Tubes , Capillary Tubes - Heparinised , Capillary Tubes Plain , Pasteur 3 Ml , Vacutainer Red Top With Vaccum , Tips 20-200 Ul , Tips 100-1000Ul , Tips 0.5-20 Ul , Sample Collection Holder , Wintrobe Tubes , Petridishes -90 Mm , Glass Funnels 50 Mm , Glass Funnels 75 Mm , Glass Funnels 100 Mm , Conical Flask-50 Ml , Conical Flask- 100 Ml , Conical Flask- 250 Ml , Conical Flask- 500 Ml , Clear Glass Media Bottle 50 Ml , Clear Glass Media Bottle 100 Ml , Clear Glass Media Bottle 50 Ml , Clear Glass Media Bottle 250 Ml , Clear Glass Media Bottle 500 Ml , Measuring Cylinder- Glass - 100 Ml , Measuring Cylinder- Glass - 250 Ml , Measuring Cylinder-Plastic-500 Ml , Centrifuge Tubes Glass 15 Ml , Glass Rods Different Sizes , Glass Tube-15 Ml, 18 X 150 Mm , Glass Tube 3 Ml, 10 X 75 Mm , Glass Slides , Permanent Marker , Cover Slip 25 X 25 Mm , Frosted End Slides , Coverslips 40 Mm X 20 Mm , Coverslips 50Mm X20mm , Immersion Oil-100 Ml , Spirit , Leishman Stain-500 Ml , Benedict Reagent-500 Ml , Lugols Iodine-250 Ml , Normal Saline-450 Ml , Hydrochloric Acid (Hcl) , Hypochlorite , Ammonia Solution , Sulpher Powder , Isopropyl Alcohol , Paraffin Wax , Dpx Mount , Acetone Extrapure , Methanol Extrapure (Acetone Free) , Potassium Hydroxide Pellets Extrapure , Sulphuric Acid Extrapure , Drabkins Solution , R.B.C. Diluting Fluid (Hayemis) , W.B.C. Diluting Fluid , Platelet Diluting Fluid , Tri-Sodium Citrate Dihydrate Extrapure , Edta. N / 50 Solution , Brilliant Cresyl Blue Solution , Absolute Eosinophil Count Fluid , Deionized Water , Formaldehyde Solution 37-41% , Xylene Ar , Sodium Chloride Extrapure , Fouchet’S Reagent , Barium Chloride Dihydrate Extrapure , Ehrlich’S Reagent , Sodium Acetate Anhydrous Extrapure , Chloroform Extrapure , Butan-1-Ol Extrapure (N-Butanol) , Acetate Buffer Solution Ph 4.6 , Semen Diluting Fluid , Leishmans Stain Powder , Giemsas Stain , Methylene Blue Stain , Azur A Stain For Microscopy , Di-Sodium Hydrogen Ortho-Phosphate , Potassium Di-Hydrogen Ortho-Phosphate Extrapure , Sodium Nitroprussideextrapure , Acetic Acid Glacial Extrapure , Rothera’S Reagent , Resorcinol Extrapure , Resorcinol , 5-Sulphosalicylic Acid Extrapure , Turks Solution For Hematology , Nitric Acid 10% Solution Ar , Cryostat For Frozen Section , Schiffs Reagent , Periodic Acid Ar , Light Green Stain Solution , Mannitol Salt Agar , Deoxycholate Citrate Agar , Nutrient Broth , Blood Agar , Macon Key Agar , Mha (Mueller Hinton Agar) , Nutrient Agar , Sabourauds Dextrose Agar , Tcbs , Xld , Selenite F Broth , Simmons Citrate Agar , Peptone Water , Tsi (Triple Sugar Iron) Agar Medium , C.L.E.D. Agar With Bromothymol Blue , Brain Heart Infusion Broth , Lofellers Serum Media , Potassium Tellurite Media , Alkaline Peptone Water , Lowenstein Jensen Media , Robrtson Cooked Meat Broth , Nitrate Agar , Kovacs Indole Reagents , Mr/Vp Reagent , Urease Test Broth , Oxidase Test Reagent , Glucose Agar , Maltose Agar , Lactose Agar , Sucrose Agar , Mannitol Agar , Gram Stain Kit , Albert Stain Kit , Zn Stain Kit , India Ink Solution: , Amikacin Antibiotics Disc , Ampicillin Antibiotics Disc , Ampicillin/Sulbactum Antibiotics Disc , Amoxiclav Antibiotics Disc , Azithromycin Antibiotics Disc , Bacitracin Antibiotics Disc , Cefepime Antibiotics Disc , Cefepime/Tazobactum , Clindamycin Antibiotics Disc , Cefotaxime Antibiotics Disc , Ceftazidime Antibiotics Disc , Ceftazidime+Clavulinic Acid , Chloromphenicol Antibiotics Disc , C-Trimoxazole Antibiotics Disc , Cepodoxime Antibiotics Disc , Ciprofloxacin Antibiotics Disc , Ceftriaxome Antibiotics Disc , Doxycycline Antibiotics Disc , Gentamycin Antibiotics Disc , Imipenum Antibiotics Disc , Cepodoxime /Clavulinic Acid , Lactophenol Cotton Blue Solution , Yeast Nitrogen Base Powder , Total Cholesterol , Triglycerides , Hdl-C , Sgot/Ast , Sgpt/Alt , Alkalinie Phosphatase , Total Bilirubin , Direct Bilirubin , Total Protein , Albumin , Urea , Creatinie , Uric Acid , Electrolyte , Ggt , Amylase , Lipase , Glucose , Ra , Crp , Widal , Aso , Vdrl/Rpr , T3 , T4 , Tsh , Hemospot Kit Tulip , Anti Human Globulin (Ahg) , Sodium Metabisulphate (Sickling) , Blood Group Anti Abo , 1% New Methylene Blue (Retic , Count) , Lugols Iodine , Hemotoxylene And Eosin Stain Kit , Pap Staining Kit (Rapid Pap Kit) , Pas Stain , Massonstrichrome Stain , Qc Vial Biochemistry Norm And Path , Test Tube Holder , Spirit Lamp , Fire Extinguisher , Certified Weight Box With Weight , Safety Spectacles , Bacterial Loop With Holder , Charts: Models Showing Regions/Parts Human Body , Slide Staining Tray , Slide Drying Tray Aluminium , Mortar Pistol , Torniquet , Injection Tray , Esr Stand Westergren , Esr Stand Wintrobe , Forceps Tweezer Non Tooth , Forceps Tweezer Non Tooth , Spatula , Slide Cabinet , Neubar Chamber , Differential Cell Counter , Sample Collection Chair , Human Skeleton ( Articulated) , Human Skeleton , Autoclave Tape , Whatman No. 44 Filter , Ph Paper , Rubber Gloves- Medium Size , Surgical Gloves- , Face Mask , Nichrome Loops Different Size 5-10 Ul , Cotton Roll , Dimond Marker , Vacutainer Needle , Aluminium Foil , Tissue Paper , Brush (For 5Ml Glass Tube Cleaning) , Whole Body Skeleton , Structure Of All Bones , Structure Of Models System Wise , Chart , L Molds , Tissue Embedding Ring Plastic , Hospital Bed Sheet , Patient Urinals , Patient Wheel Chair , Hospital Bed
Contract Date: Aug 14, 2025 Contract Value : 57.00 Lakh
Boards / Undertakings / PSU No of Bidders 5
Contract Date: Ref. Documents Contract Value : 27.04 Lakh
Boards / Undertakings / PSU No of Bidders 5
Madhya Pradesh View Result →
25.
Educational and Research Institute #4833579 AOC
Bids Are Invited For Aluminium Foil, 18 Microns Thick Aluminium Foilbacteria Resistant / Disposable, 1 Kg - Aluminium Foil, 18 Microns Thick Aluminium Foilbacteria Resistant / Disposable, 1 Kg , Aspitator Bottle With Stop Cock, Medical Grade Pp , Class Vi , Autoclavable 20 L, - Aspitator Bottle With Stop Cock, Medical Grade Pp , Class Vi , Autoclavable 20 L, , Biohazard Bags, Pp, Autoclavable, 12X24, Pack Of 100 - Biohazard Bags, Pp, Autoclavable, 12X24, Pack Of 100 , Carboy With Stop Cock, Medical Grade Pp , Class Vi, 20 L, Pack Of 1 - Carboy With Stop Cock, Medical Grade Pp , Class Vi, 20 L, Pack Of 1 , Cotton Absorbent, Pack Of 500 Gm - Cotton Absorbent, Pack Of 500 Gm , Cotton Non-Absorbent, Pack Of 500 Gm - Cotton Non-Absorbent, Pack Of 500 Gm , Cover Slip, Glass, 22X22 Mm, Square Shape, Box Of 50 Small Packet, Price Per Packet - Cover Slip, Glass, 22X22 Mm, Square Shape, Box Of 50 Small Packet, Price Per Packet , Dettol Original Bar Soap, 75 Gm, - Dettol Original Bar Soap, 75 Gm, , Dispenser For Multi Purpose Labelling Tape Size-0.75X 500, - Dispenser For Multi Purpose Labelling Tape Size-0.75X 500, , Draining Tray 400X300x100 Mm, Pack Of 6 Pcs - Draining Tray 400X300x100 Mm, Pack Of 6 Pcs , Dura Seal Stretch Film, 4”X250’, Roll, Transparent Polyethylene Based, Solvent Resistant - Dura Seal Stretch Film, 4”X250’, Roll, Transparent Polyethylene Based, Solvent Resistant , Forecep, Stainless Steel - Forecep, Stainless Steel , Glass Slides, 76X26x1 Mm, 50 Packets Per Box, Price Per Packet - Glass Slides, 76X26x1 Mm, 50 Packets Per Box, Price Per Packet , Glass Rod In Pieces, 12”, In Pcs - Glass Rod In Pieces, 12”, In Pcs , Hand Protector Grip, Silicone, Pack Of 1 - Hand Protector Grip, Silicone, Pack Of 1 , Handypette Pipette Aid, Pp Silicon , Capacity 10 Ml, Pack Of 4 - Handypette Pipette Aid, Pp Silicon , Capacity 10 Ml, Pack Of 4 , Handypette Pipette Aid, Pp Silicon , Capacity 25 Ml, Pack Of 4 - Handypette Pipette Aid, Pp Silicon , Capacity 25 Ml, Pack Of 4 , Ice Bucket, Pcautoclavable, 2.5 L , Pack Of 01 - Ice Bucket, Pcautoclavable, 2.5 L , Pack Of 01 , Incubation Tray, Rpp, Autoclavable, 55X14mm, Pack Of 4 - Incubation Tray, Rpp, Autoclavable, 55X14mm, Pack Of 4 , Indicator Tape For Autoclave, 1”X500”, Roll - Indicator Tape For Autoclave, 1”X500”, Roll , Inoculation Needle, Pouch Of 20, Pack Of 100 - Inoculation Needle, Pouch Of 20, Pack Of 100 , L-Molds: Embedding Moulds, 50X25x15 Mm Pair - L-Molds: Embedding Moulds, 50X25x15 Mm Pair , L-Molds: Embedding Moulds, 75X30x19 Mm Pair - L-Molds: Embedding Moulds, 75X30x19 Mm Pair , Lubrication Oil ( Machine Oil ) , 100Ml - Lubrication Oil ( Machine Oil ) , 100Ml , Measuring Scoop, Pp, 10 G, Pack Of 12 - Measuring Scoop, Pp, 10 G, Pack Of 12 , Measuring Scoop, Pp, 5 G, Pack Of 12 - Measuring Scoop, Pp, 5 G, Pack Of 12 , Membrane Filter Circular, 25 Mm, For Syringe Filter, Pore Size < 0.45 Μm, Pkt Of 100 Disc - Membrane Filter Circular, 25 Mm, For Syringe Filter, Pore Size < 0.45 Μm, Pkt Of 100 Disc , Microshield Handwash, 500 Ml - Microshield Handwash, 500 Ml , Microtom Knife, A.O Spencer Type, Size: 120Mm - Microtom Knife, A.O Spencer Type, Size: 120Mm , Microtom Knife, A.O Spencer Type, Size: 160 Mm - Microtom Knife, A.O Spencer Type, Size: 160 Mm , Multi Purpose Labelling Tape, 0.75X 500, Pack Of 1 Roll. - Multi Purpose Labelling Tape, 0.75X 500, Pack Of 1 Roll. , Parafilm Dispenser, Pack Of 1 - Parafilm Dispenser, Pack Of 1 , Parafilm Roll, 4”X125’, Pack Of 1 - Parafilm Roll, 4”X125’, Pack Of 1 , Ph Indicator Paper, Range:0-14, Pack Of 10 - Ph Indicator Paper, Range:0-14, Pack Of 10 , Polygon Magnetic Stirring Bar, Ptfe / Alnico Magnet, 8X22 Mm, Pack Of 10 Pc - Polygon Magnetic Stirring Bar, Ptfe / Alnico Magnet, 8X22 Mm, Pack Of 10 Pc , Polygon Magnetic Stirring Bar, Ptfe / Alnico Magnet, 8X50 Mm , Pack Of 10 Pc - Polygon Magnetic Stirring Bar, Ptfe / Alnico Magnet, 8X50 Mm , Pack Of 10 Pc , Rack For Petridish Pmma / Pc, 60 Places, 90Mm, Pack Of 2 - Rack For Petridish Pmma / Pc, 60 Places, 90Mm, Pack Of 2 , Safeskin Purple Nitrile Gloves 12 Length, Medium, Pack Of 50 Pcs - Safeskin Purple Nitrile Gloves 12 Length, Medium, Pack Of 50 Pcs , Safeskin Purple Nitrile Gloves 12 Length, Large, Pack Of 50 Pcs - Safeskin Purple Nitrile Gloves 12 Length, Large, Pack Of 50 Pcs , Sterile Cotton Swab In Screw Capped Polypropylene Tube, Cotton Bud With Polypropylene Stick, Size 75 Mmx12mm Dia Tube Individual Box Of 100 Pcs - Sterile Cotton Swab In Screw Capped Polypropylene Tube, Cotton Bud With Polypropylene Stick, Size 75 Mmx12mm Dia Tube Individual Box Of 100 Pcs , Syringes 10 Ml, Disposable, Pack Of 50 Pcs - Syringes 10 Ml, Disposable, Pack Of 50 Pcs , Syringes 2 Ml, Disposable, Pack Of 100 Pcs - Syringes 2 Ml, Disposable, Pack Of 100 Pcs , Syringes 5 Ml, Disposable, Pack Of 100 Pcs - Syringes 5 Ml, Disposable, Pack Of 100 Pcs , Test Tube Cleaningbrush Small - Test Tube Cleaningbrush Small , Test Tube Cleaningbrush Large - Test Tube Cleaningbrush Large , Tips Capacity 0.2 – 10 Μl, Pp, Box Of 1000 Pc, Price Per Pack - Tips Capacity 0.2 – 10 Μl, Pp, Box Of 1000 Pc, Price Per Pack , Tips Capacity 20 – 1000 Μl, Pp, Box Of 500 Pc, Price Per Pack - Tips Capacity 20 – 1000 Μl, Pp, Box Of 500 Pc, Price Per Pack , Tips Capacity 200 – 1000 Μl, Pp, Box Of 500 Pc, Price Per Pack - Tips Capacity 200 – 1000 Μl, Pp, Box Of 500 Pc, Price Per Pack , Tisue Block Holder For Histopathology, Set Of 12 Pcs - Tisue Block Holder For Histopathology, Set Of 12 Pcs , Tissue Paper Roll, 100 Mtr - Tissue Paper Roll, 100 Mtr , Universal Reagent Reservoir, Pp, Autoclavable, 50 Ml, Pack Of 6 Pcs, Price Per Pack - Universal Reagent Reservoir, Pp, Autoclavable, 50 Ml, Pack Of 6 Pcs, Price Per Pack , Utility Carrier 380X240x115mm, Pp, Autoclavable, Pack Of 02 - Utility Carrier 380X240x115mm, Pp, Autoclavable, Pack Of 02 , Vetro Clean, Laboratory Glassware Cleaning Agent, 500 Ml, Pack Of 6 Bottles - Vetro Clean, Laboratory Glassware Cleaning Agent, 500 Ml, Pack Of 6 Bottles , Wintrobe Tubes: 11 Cm Long, Borosilicate Cylindrical Glass Tube Uniform Bore With Diameter Of 2 Mm Lower End Is Closed - Wintrobe Tubes: 11 Cm Long, Borosilicate Cylindrical Glass Tube Uniform Bore With Diameter Of 2 Mm Lower End Is Closed And Flat Tube Is Calibrated In Cm & Mm From 0 To 10 , White Paper Tissue Roll - White Paper Tissue Roll , Savlon 750Ml - Savlon 750Ml , Dettolhand Wash 750 Ml - Dettolhand Wash 750 Ml , Laboratory Spatulas- ( Stainless Steel, Plastic , Wooden ) : ( Size:Zmicro, Mini, Small ) ( Shape: Tapered End, Blund End ) - Laboratory Spatulas- ( Stainless Steel, Plastic , Wooden ) : ( Size:Zmicro, Mini, Small ) ( Shape: Tapered End, Blund End ) , Syringe Butterfly ( Gauze:23, 24, 25, 25 & 26 ) Pack 0F 100 Pcs - Syringe Butterfly ( Gauze:23, 24, 25, 25 & 26 ) Pack 0F 100 Pcs , Gloves ( Latex, Vinyl & Nitrile ) , Disposable Powdered Hand Gloves, Size L, Pack Of 20 - Gloves ( Latex, Vinyl & Nitrile ) , Disposable Powdered Hand Gloves, Size L, Pack Of 20 , Test Tube Racks ( Stainless Steel, Polygrid, Polycarbonate ) 50 Holes - Test Tube Racks ( Stainless Steel, Polygrid, Polycarbonate ) 50 Holes , Nichrome Loop, 11 Inches 10 Pcs Per Pack - Nichrome Loop, 11 Inches 10 Pcs Per Pack , First Aid Box ( Bandage, Antibiotic&Antiseptic, Thermometer, Elastic Bandages, Dettol, Cold Pack, Gauze Roll & Pads, Adhesive Tape, Pain Killer, Cotton, Scissor ) - First Aid Box ( Bandage, Antibiotic&Antiseptic, Thermometer, Elastic Bandages, Dettol, Cold Pack, Gauze Roll & Pads, Adhesive Tape, Pain Killer, Cotton, Scissor ) , Scissors For Laboratory Uses - Scissors For Laboratory Uses , Face Shield ( Plasatic Visor, Transparent Non Flammabale ) - Face Shield ( Plasatic Visor, Transparent Non Flammabale ) , Hand Towel ( Forlaboratory Uses ) - Hand Towel ( Forlaboratory Uses ) , Spill Kits ( Hand Gloves, Face Cover Sheet, Absorbent Pad, Bin With Lid, Plastic Bags, Hypochlorite ) - Spill Kits ( Hand Gloves, Face Cover Sheet, Absorbent Pad, Bin With Lid, Plastic Bags, Hypochlorite ) , Glass Rods ( 150 X 6 Mm ) Pack Of 12 - Glass Rods ( 150 X 6 Mm ) Pack Of 12 , Dropper ( Plastic ) 1 Pack Of 8 Set - Dropper ( Plastic ) 1 Pack Of 8 Set , Dropping Bottle ( Low Densitypolyethylene, 250 Ml - Dropping Bottle ( Low Densitypolyethylene, 250 Ml , Asbestos Gloves ( Soft And Comfortable 9.5Inch - Asbestos Gloves ( Soft And Comfortable 9.5Inch , Acid Cart Trolley ( Carrying Upto 150 Kg Of Cargo, Large Platform, With Rollings Wheels ) - Acid Cart Trolley ( Carrying Upto 150 Kg Of Cargo, Large Platform, With Rollings Wheels ) , Digital Clock ( Loud, Alarm, With Magneticstand ) - Digital Clock ( Loud, Alarm, With Magneticstand ) , Stop Watch - Stop Watch , Glass Capillaries ( Borosilicate Glass Capaillaries 90 Mm ) 1 Pack Of 100 Pcs - Glass Capillaries ( Borosilicate Glass Capaillaries 90 Mm ) 1 Pack Of 100 Pcs , Lamp Spirit ( Adjustable Aluminium Spirite Lamp ) - Lamp Spirit ( Adjustable Aluminium Spirite Lamp ) , Glass Rod: 6 Inches Long, Borosilicate Glass - Glass Rod: 6 Inches Long, Borosilicate Glass , Glass Slides : Microscope Glass Slides 75 X 25 X 1.4 Mm ( 50 Piece Per Box ) - Glass Slides : Microscope Glass Slides 75 X 25 X 1.4 Mm ( 50 Piece Per Box ) , Test Tube : Borosil Glass, 15 Ml Capacity - Test Tube : Borosil Glass, 15 Ml Capacity , Westergren Tube: 300 Mm Long Glass Pipette Calibrated In Cm & Mm From 0 To 200 From Above To Downwards In Its Lower Two-Third Bore Diameter Of 2.5Mm Lower Mark Is 180Mm It’S Both Ends Are Open - Westergren Tube: 300 Mm Long Glass Pipette Calibrated In Cm & Mm From 0 To 200 From Above To Downwards In Its Lower Two-Third Bore Diameter Of 2.5Mm Lower Mark Is 180Mm It’S Both Ends Are Open , Stethoscope: Stainless Steel Plated Chest Piece With Special Diaphragm, Compact With Dual Frequencyseamless Pvc Tubing, Brass Chrome Plated Open Spring Frame, Soft Ear Knobs With Best Sound Quality - Stethoscope: Stainless Steel Plated Chest Piece With Special Diaphragm, Compact With Dual Frequencyseamless Pvc Tubing, Brass Chrome Plated Open Spring Frame, Soft Ear Knobs With Best Sound Quality , Abdominal Belt: Abdominal Belt ( M ) - Abdominal Belt: Abdominal Belt ( M ) , Absorbent Cotton Wool: 8 Millimeter Thick 25 Millimeter Wide - Absorbent Cotton Wool: 8 Millimeter Thick 25 Millimeter Wide , Adult Catheter Without Baloon: 100% Latex With Silicon Size ( Fg ) 12 - Adult Catheter Without Baloon: 100% Latex With Silicon Size ( Fg ) 12 , Adult Two Way Foley Balloon Catheter: 100% Silicon Balloon Capacity ( Ml ) 15 - Adult Two Way Foley Balloon Catheter: 100% Silicon Balloon Capacity ( Ml ) 15 , Buchner Funnel: Porcelain, 3 - Buchner Funnel: Porcelain, 3 , Butter Paper Sheet: For Lab Use - Butter Paper Sheet: For Lab Use , Capillary Tubes: Glass Tube Size: 0. 30Mm Id To 10. 00Mm Od - Capillary Tubes: Glass Tube Size: 0. 30Mm Id To 10. 00Mm Od , China Dish : Size 80X45mm, Porcelain - China Dish : Size 80X45mm, Porcelain , Colostomy Bags: Pvc Hole Diameter ( Mm ) 50 - Colostomy Bags: Pvc Hole Diameter ( Mm ) 50 , Cotton Crepe Bandage:4 Meter X 8 Centimeter ( Lxw ) - Cotton Crepe Bandage:4 Meter X 8 Centimeter ( Lxw ) , Digital Thermometer: Accuracy-0.5 Degree Celcius - Digital Thermometer: Accuracy-0.5 Degree Celcius , Filter Paper 237 Grade Blotter Paper: 237 Grade Blotter Paper, For Lab Use - Filter Paper 237 Grade Blotter Paper: 237 Grade Blotter Paper, For Lab Use , Genaxy Grade 2 ( Usually Chemically Resist ) Neutral Glass Multipurpose Test Tubes Genaxyr - Genaxy Grade 2 ( Usually Chemically Resist ) Neutral Glass Multipurpose Test Tubes Genaxyr , Ispaghula: Herbal Drug Seeds - Ispaghula: Herbal Drug Seeds , Iv Set Transfusion Set: For  Single Use - Iv Set Transfusion Set: For  Single Use , Knee Cap: Large Size - Knee Cap: Large Size , Lancet: Material: Stainless Steel Needle Moulded In Plastic Strip Type Disposable Needle Plastic Mould Size: Medium - Lancet: Material: Stainless Steel Needle Moulded In Plastic Strip Type Disposable Needle Plastic Mould Size: Medium , Lumbo Sacchral Support Ls Belt: Large Size - Lumbo Sacchral Support Ls Belt: Large Size , Micrometer Slide Eyepiece: Size: 19Mm Round, 10 Mm Linear Scale - Micrometer Slide Eyepiece: Size: 19Mm Round, 10 Mm Linear Scale , Mortar & Pestle Porcelain: Porcelain, 4 - Mortar & Pestle Porcelain: Porcelain, 4 , Needle : 24 Nos Syringe Needle - Needle : 24 Nos Syringe Needle , Needle Sheath Disposable Hypodermic Needle 22 Mm - Needle Sheath Disposable Hypodermic Needle 22 Mm , Needle Sheath Disposable Hypodermic Needle 25 Mm - Needle Sheath Disposable Hypodermic Needle 25 Mm , Nutmeg : Herbal Drugs Seeds - Nutmeg : Herbal Drugs Seeds , Oxygen Masks: Pvc Size 2-3Cm - Oxygen Masks: Pvc Size 2-3Cm , Peadiatric Two Way Foley Balloon Catheter: Balloon Capacity ( 25Ml ) - Peadiatric Two Way Foley Balloon Catheter: Balloon Capacity ( 25Ml ) , Peak Flow Meter: Impact Resistant Polycarbonateweight Of The Instrument ( Gms ) 60 To 70Material Of Mouth Piece - Peak Flow Meter: Impact Resistant Polycarbonateweight Of The Instrument ( Gms ) 60 To 70Material Of Mouth Piece High Density Polyethyleneusage Of Mouth Piece Single Usemouth Piece Length ( Mm ) 64Mouth Piece Outer Dia ( Mm ) 22 , Plaster Of Paris Bandage: 15 Cm - Plaster Of Paris Bandage: 15 Cm , Plastic Walking Stick: Type Of Handle Ergonomicmaterial Of Handle Plastic - Plastic Walking Stick: Type Of Handle Ergonomicmaterial Of Handle Plastic , Pulse Oximeter: Low Battery Indicator, Alarm Function And Automatic Power Off In 8 Seconds - Pulse Oximeter: Low Battery Indicator, Alarm Function And Automatic Power Off In 8 Seconds , Punernava : Herbal Drug Leaf - Punernava : Herbal Drug Leaf , Pure White Sterile Gauze Pads Or Swabs: Single Use - Disposable Cotton - Pure White Sterile Gauze Pads Or Swabs: Single Use - Disposable Cotton , Ryle’S Tube: Nutritional Feeding Pvc - Ryle’S Tube: Nutritional Feeding Pvc , Stalagmometer: Borosilicate Glass - Stalagmometer: Borosilicate Glass , Test Tube Cleaning Brush: Nylon Brush, Diameter Of Brush:- 12Mm, Length Of Brush:-100Mm, Overall Length:-220Mm - Test Tube Cleaning Brush: Nylon Brush, Diameter Of Brush:- 12Mm, Length Of Brush:-100Mm, Overall Length:-220Mm , Thoracic Drainage Catheter ( Chest Drainage Catheter ) : 40Cm - Thoracic Drainage Catheter ( Chest Drainage Catheter ) : 40Cm , Urine Bag: Type Of Outlet Push - Pull Type Capacity Of Bag ( Ml ) 2000 Milliliter - Urine Bag: Type Of Outlet Push - Pull Type Capacity Of Bag ( Ml ) 2000 Milliliter , Urine Pots: Pvc / Plastic - Urine Pots: Pvc / Plastic Total Quantity : 1
Contract Date: Ref. Documents Contract Value : 3.21 Lakh
Government Departments No of Bidders 6
26.
Agriculture #4459213 AOC
Bids Are Invited For 1 5400C Agarose 500G 5 Takara 3422A 100 Bp Dna Ladder ( Dye Plus ) 500Ul 10 Takara R001a Takara Taq™ Dna Polymerase 250 Units 25 Takara 9031 X-Gal ( 5-Bromo-4- Chloro-3-Indolyl-Beta- D-Galactoside ) 1 G 2 Takara 9030 Iptg ( Dioxane Free ) ( Isopropyl-Beta-Dthiogalactopyranoside ) 5 G 1 Takara R050a Primestar® Gxl Dna Polymerase 250U 2 Takara 740609.25 Nucleospin® Gel And Pcr Clean-Up 1 ( 250 Preps ) 1 Takara Rr820a Tb Green Premix Ex Taq Ii ( Rnase H Plus ) 200Rxn 200 Rxn 10 Takara 2 9Q05fe Gelred® Nucleic Acid Stain 10000X Water 0.5Ml 2 Sigma-Aldrich K4000-5G Kanamycin Sulfate 5G 1 Sigma-Aldrich H9773-250Mg Hygromycin B 250Mg 1.00 Sigma-Aldrich A9518-5G Ampicillin Sodium Salt 5G 1.00 Sigma-Aldrich B5285-25Mg X Glu ( 5-Bromo-4- Chloro-3-Indolyl Β- D-Glucuronide Sodium Salt ) 25Mg 1 Sigma-Aldrich 702587-50G Potassium Ferricyanide ( Iii ) 50G 1 Sigma-Aldrich P3289-100G Potassium Hexacyanoferrate ( Ii ) Trihydrate 100G 1 Sigma-Aldrich X100-100Ml Triton™ X-100 100Ml 1 Sigma-Aldrich 227056-100Ml N, N- Dimethylformamide 100 Ml 1 Sigma-Aldrich F9252-100Ml Folin & Ciocalteu′S Phenol Reagent 100Ml 1 Sigma-Aldrich T1253-1G Tptz ( 2, 4, 6-Tris ( 2- 1G 1 Sigma-Aldrich Pyridyl ) -S-Triazine ) 3 K1621 Revertaid First Strand Cdna Synthesis Kit, 20 X 20 Μl Rxns 20 X 20 Μl Rxns 5 Thermo Scientific K1231 Clonejet Pcr Cloning Kit 20 Reactions 1 10 Thermo Scientific K0503 Genejet Plasmid Miniprep Kit 250 Preps 1 ( 250 Preps ) 1 Thermo Scientific Am9782 Rnasezap™ Rnase Decontamination Solution ( 6 X 250 Ml ) 2 Invitrogen Fisa452-4 Methanol ( Hplc ) 4L 1 Fisher Chemical 6401016 Stainless-Steel Embedding Base Molds ( 24 X 24 X 5 Mm ) 1 10 Fisher Scientific, Pt-099-100X1l Murashige And Skoog Medium 100X1l 10 Himedia Pct0607-1Kg Sucrose 1Kg 1 Himedia Grm887 Lithium Chloride, Hi- Lr 500G 1 Himedia Mb076 Depc 100Ml 1 Himedia Mb063 2-Propanol / Isopropyl Alcohol 500 5 Himedia Ts1094-5L Hoagland No. 2 Basal 5L 10 Himedia, Tc257-5G Toluidine Blue 5G 1 Himedia Tc260-10G Safranine 10G 1 Himedia As133 Xylene, For Histopathology 500Ml 1 Himedia Pct1301-5G Acetosyringone 5Gm 1 Himedia As134-5L Tert-Butyl Alcohol, Hi- Lr 5L 1 Himedia 4 510051 0.2 Ml Tube With Cap Flat ( Ppautoclavable ) ( Pack Of 1000 ) 5 Tarsons 500020 Micro Centrifuge Tube 2.0 Ml ( Pack Of 500 ) ( Pack Of 500 ) 20 Tarsons 500010 Micro Centrifuge Tube 1.5 Ml ( Pack Of 500 ) ( Pack Of 500 ) 20 Tarsons 521000 Micro Tips0.2 - 10 ( Pack Of 1000 ) ( Pack Of 1000 ) 20 Tarsons 521010 Micro Tips2-200 ( Pack Of 1000 ) ( Pack Of 1000 ) 20 Tarsons 521020 Micro Tips200-1000 ( Pack Of 500 ) ( Pack Of 500 ) 5 Tarsons 523090 Cryo Tags 38X19mm ( Pack Of 1000 ) ( Pack Of 1000 ) 5 Tarsons 526070 Cryo Babies 32.5X12.7Mm ( Pack Of 1000 ) ( Pack Of 1000 ) 5 Tarsons 670060 Indicator Tape For Steam Autoclave 1 Size : 1X2160 Size : 1X2160 1 Tarsons 610040 Maxiamp 0.2 Ml Tube Strip With Cap Flat Clear ( Pp ) ( Pack Of 125 ) ( Pack Of 125 ) 5 Tarsons 510030 Sample Container 50Ml ( Pp / Hdpe ) 5 Tarsons 546021 Spinwin -Tm Centrifuge Tube Conical Bottom 15 Ml Sterile ( Pack Of 500 ) ( Pack Of 500 ) 2 Tarsons 582250 Wide Mouth Bottle, Pp Autoclavable, Capacity 1000 Ml ( Pack Of 24 ) ( Pack Of 24 ) 2 Tarsons 800000 Hand Protector Grip ( Pack Of 1 ) ( Pack Of 1 ) 1 Tarsons 583256 Biohazardous Waste Container 5Ltrs ( Pp ) ( Pack Of 1 ) ( Pack Of 1 ) 1 Tarsons 380020 Parafilm M® ( W 4 X L 125 ) ( W 4 X L 125 ) 2 Tarsons 370080 Kimwipes® Disposable Wipes 280Wipes / Box 20 Tarsons 30080 Pipettor Stand, Pmma, 5 Places 1 2 Tarsons Pg-100153 Rna Rescue Stabilisation Reagent, 100Ml 100Ml 10 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific K1081 Dream Taq Green Pcr Master Mix, 2X, 200 Reaction 200 Reactions 5 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Pgk017-A Pcr Master Mix ( 2X ) , 200 Reaction 200 Reactions 5 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Np-79105 Dnasure Plant Mini Kit 50 Prep 2 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Ftg01-Xs Purple, Powder-Free Nitrile Medical Examination Gloves, 9.5” Non Sterile, 100 / Box; 10Box / Cs 100 / Box; 10Box / Cs 10 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Ftg02-S Purple, Powder-Free Nitrile Medical Examination Gloves, 9.5” Non Sterile, 100 / Box; 10Box / Cs 100 / Box; 10Box / Cs 10 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Ftg03-M Purple, Powder-Free Nitrile Medical Examination Gloves, 9.5” Non Sterile, 100 / Box; 10Box / Cs 100 / Box; 10Box / Cs 10 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Ftg04-L Purple, Powder-Free Nitrile Medical Examination Gloves, 9.5” Non Sterile, 100 / Box; 10Box / Cs 100 / Box; 10Box / Cs 10 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Ftg05-Xl Purple, Powder-Free Nitrile Medical Examination Gloves, 9.5” Non Sterile, 100 / Box; 10Box / Cs 100 / Box; 10Box / Cs 10 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Gx-41100A Cryobox, Pp, 10X10 Array, For 1-2Ml Cryovials, Hinged, 6Pc / Cs 6Pc / Cs 5 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Gx-5601 100 Well Storage Box, 5 / Pk 5 / Pk 2 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Gxm- 3150Ss 50Ml Centrifuge Tube, Self-Standing Sterile, 25 / Pk, 500 / Case 25 / Pk, 500 / Case 1 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific Gtxm- 4102E-Ss Cryogenic Vial, Sterile, Pp, 2.0 Ml, Self- Standing, External Threaded, 100 / Pk, 500 / Pk 100 / Pk, 500 / Pk 1 Genetix Biotech Asia Pvt. Ltd. / Fermentas / Thermo Fisher Scientific 3123000942 Eppendorf Research® Plus, 6-Pack With Pipette Carousel 2, 1-Channel, Variable, Incl. Pipette Carousel 2, 6X Ept.I.P.S.® Box 2.0 With 96 Pipette Tips And Ballpoint Pen, 0.1 –  2.5 Μl, 0.5– 10 Μl, 2–  20 Μl ( Yellow ) , 10 –  100 Μl, 20– 200 Μl, 100 – 1, 000 Μl 6-Pack With Pipette Carousel 2, 1-Channel, Variable, Incl. Pipette Carousel 2, 6X Ept.I.P.S.® Box 2.0 With 96 Pipette Tips And Ballpoint Pen, 0.1 – 2.5 Μl, 0.5 – 10 Μl, 2–  20 Μl ( Yellow ) , 10 – 100 Μl, 20 – 200 Μl, 100 – 1, 000 Μl 1.00 Eppendorftotal Quantity : 5
Contract Date: Ref. Documents Contract Value : 19.76 Lakh
Government Departments No of Bidders 4
Maharashtra View Result →
28.
Health and Family Welfare #3466913 AOC
Supply Of Machinery And Equipment , For Students – Led Binocular With Scanner, 10X, 40X, & Oil Immersion Lenses And Inbuilt Battery Backup Power Source , Stop Watch Reading At 1/5 Second. , Haemo-Cytometers With Red And White Pipettes , Urinometers(Mercury Based Instruments To Be Replaced With Other Alternatives) , Manual Rotary Microtome , Automated Rotary Microtome , Cryostat , Hot Plate , Paraffin Embedding Bath Machine , Heated Paraffin Embedding Module , Automated Tissue Processor –Histokinette , Autoclave , Ultrapure Water Solutions - Distilled Water Plant , Water Bath , Centrifuge Machine , Digital Slr At Least 20 Megapixel With Micro, Macro, Wide Angle Zoom Lenses, Flash And Other Accessories , Digital Automatic Camera > 5 Megapixel , Fully Automated High Throughput Multi-Stainer Workstation , Water Bath (Tissue Floatation) , Single Pan Digital Balance, Chemical , Balance, Chemical With Weights , Penta Head Microscope With High End Optics With Hdmi Multi Output Photographic Camera (> 5 Mp) Including Software , Grossing Station - Stainless Steel, With Control Panel,Air Filtration System, Track Mounted Adjustable Computerarm With Articulation, Led Lights That Are Color And Intensity, Dedicated Usb Ports For Camera Control And Data Transfer Adjustable, Integrated Pathology Camera System, Instrument Set (High Quality) Height Adjustable Stainless Steel Chairs With Split Ac Of Appropriate Capacity. , Fully Automated Immuno-Histo-Chemistry Setup With Continuous Supply Of Important Antibodies, Lymphoma Panel Etc. , Five Part Fully Automated Cell Counter , Three Part Fully Automated Cell Counter , L Mold(Medium Size) , Tooth Forceps (9 Inches) , Staining Rack (20 Slides Capacity) , Diamond Pencil , Slide Tray(Aluminium)(24 Slide Capacity) , Slide Cabinet(10,000 Slide Capacity Each) , Block Cabinet , Slide Box Plastic (50 Slide Capacity) , Hot Air Oven , Block Holder , Refrigerator (Medium End) , Incubator (Medium Size) , Elisa Reader With Washer , Trinocular Research Microscope , Refrigerated Centrifuge , Air Conditioner C 2 Tonns-Tower , Refrigerator (High End) , Deep Freezer -80 Degree
Contract Date: Oct 15, 2024 Contract Value : 3.45 Crore
Government Departments No of Bidders 4
Maharashtra View Result →
29.
Educational and Research Institute #1428523 AOC
Supply For Central Lab And Cssd Consumables And Other Item Supply For Central Lab And Cssd Consumables And Other Items In Gmc Raltam , Three Part Automated Cell Counter Model :- Swelab Alfa Plus Basic , Swelab Alfa Plus Diluents , Swelab Alfa Plus Lyser , Boule Control - Normal , Boule Control - Low , Boule Control - High , Five Part Fully Automated Cell Counter Model :- Bc 6800 , M 68Lh Lyse , M 68 Lb Lyse , M 68 Dr Diluent , M68 Ld Lyse , M 68 Ln Lyse , M 68 Ds Diluent , 68 Fd Dys , 68 Fr Dys , 68 Fn Dys , Probe Cleanser , Controls And Calibrators , Aspen Bc – 6D Control Set (6X4.5Ml (2L, 2N, 2H)) , Aspen Bc – Ret Control Set (6X4.5Ml (2L, 2N, 2H)) , Aspen Sc – Cal Plus Calibrator , Automatic Coagulation Analyzer Model :- Sta Compact Max 3 , Stac Cacl20, 0025M (00367) , Sta Cephascreen 10(00310) , Sta Cleanser Solution 6X2500ml(00973) , Sta Coag Control N+P(00679) , Sta Desorb U24x15ml (00975) , Sta Liatest Control N+P (00526) , Sta Liatest D Di (00662) , Sta @- Neoptimal 5. (01163) , Sta Owren Koller 24X15ml(00360) , Chemicals , Ethanol (99.9%) , Xylene (Sulphar Free) , Paraffin Wax (58-60 Temperature) , Acetone , Hematoxyline , Eosin (2%) , Distyrene Plasticizer Xylene (Dpx Mountant) , Glacial Acetic Acid , Formic Acid (100%) , Nitric Acid (100%) , Propanol (45%) , Oil Immersion , N/10 Hcl , Sodium Metabisulphate , Urine Strip 10 Para , Sodium Nitroprusside , Liquor Ammonia , Ammonium Sulphate , Sulphosalicilic Acid Solution , Sulphur Powder , Leishmen Stain , Wbc Diluting Fluid , Rbc Diluting Fluid , Og 6 , Ea 50 , Semen Analysis Diluting Fluid , Formaline , Spirit Alcohol , Sulphuric Acid , Reticulocyte Count Fluid , Distilled Water , Barium Chloride , Sodium Hypochloride , Methanol , Glucose Pouch , Perls Stain (Long Expiray) , Pas Stain (Long Expiray) , Mpo Sstain (Long Expiray) , Benzidine Solution (Long Expiray) , Kits , Reticulocyte Count Kit , Pt Kit , Aptt Kit , Field Stain Kit , Rapid Pap Stain Kit , Giemsa Stain Kit , G6pd Kit , Antisera A , Antisera B , Antisera D , Sickle Cell Test Kit , Pt/Inr Kit , Reagent , Benedict Reagent (Long Expiray) , Ehrlich’S Reagent (Long Expiray) , Esbech’S Reagent (Long Expiray) , Fouchet Reagent (Long Expiray) , Other Consumable Items , Microscopic Glass Slide (75X25) , Jam Microscopic Cover Glass (22X50) , Casset , Microtome Blade , Slide Box , Tissue Paper Roll , Plastic Dropper (Small) , Plastic Dropper (Big) , Test Tube 5Ml , Coupling Jar , Test Tube 10Ml , Slide Carrying Tray , Aluminium Slide Tray , Slide Staining Stand , Glass Dish Staining Jar , Test Tube Stand , Measuring Cylinder (10 Ml Borosilicate) , Glass Tube Brush , Hand Wash , Beaker Glass (100 Ml Borosilicate) , Beaker Glass (500 Ml Borosilicate) , Conical Flask (100 Ml Borosilicate) , Conical Flask (500 Ml Borosilicate) , Bubbler (Plastic Screw) , Graduate Pipette (Borosilicate ) 10Ml , Volumetric Flask 100Ml , Filter Paper 12.5Dm , Diamond Pencil , Capillary Tube For Bt Ct (Glass) , K3 Edta Vial , Urine Container , Knife (Grossing) , Speciman Jar With Lid (Glass) (200X200x70 Mm) , Speciman Jar With Lid (Glass) (150X150x60mm) , Museum Jar With Lid (Glass) (220X150x100mm) , Museum Jar With Lid (Glass) (220X195x80mm) , Museum Jar With Lid (Glass) (250X165x140mm) , Museum Jar With Lid (Glass) (360X150x100mm) , Museum Jar With Lid (Glass) (150X150x80mm) , Museum Jar With Lid (Glass) (250X250x120mm) , Museum Jar (10X10x15 Inches) , Museum Jar (18X12x12 Inches) , Museum Jar (25X15x10 Inches) , Pippette 1 Ml (Borosilicate) , Pippette 5 Ml (Borosilicate) , Glass Rod (Solid ) , Slide Holder (Steel) , Slide Staining Rack , Urinestripe 4 Parameter (1.Ph 2.Specific Gravity3. Sugar 4.Albumin(Protein)) , Sodium Citrate Vial , Esr Tube (Wintrobe) , Esr Western Green Tube , Cover Slip10 Gm , Application Plastic Stick , Sprit Lamp Glass , Tube Holder , Rbc Pipette , Wbc Pipette , Wester Green Stand , Wintrobe Stand , Pasture Pipette , Disposable Pap Smear Kit , Torniqute , Tissue Embedding Mold , Embedding O Ring , Test Tube 15 Ml , Test Tube 20 Ml , Centrifuge Tube 15Ml , Centrifugr Graduated Tube 15 Ml , Reagent Bottle 100 Ml , Reagent Bottle 250Ml , Reagent Bottle 500 Ml , Measuring Cylinder 100 Ml , Measuring Cylinder 5 Ml , Dropping Bottle 250 Ml , Detergent Powder , Culture Media , Agar Powder , Alkaline Peptone Water , Anhydrous Barium Chloride , Arabinose , Arginine Dihydrolase Powder , Automated Blood Culture Bottle (Adult) Compatible Withbact/Alert 3D 480, Bio Merieux , Automated Blood Culture Bottle (Paediatrics) Compatible Withbact/Alert 3D 480, Bio Merieux , Bile Esculin Agar , Blood Agar Powder , Brain Heart Infusion Broth , Candida Crome Agar , Cary Blair Medium Base , Christensens Urea Agar Base , Cled Agar , Corn Meal Agar , Decarboxylase Broth Moeller , Dermatophyte Test Medium , Glucose , Glucose Phosphate Broth , Hugh Leifson Medium , Lowenstein Jansens Medium(Ready Prepared) , Lactose , Lysine Decarboxylase , Macconkey Agar Without Crystal Violet , Macconckeys Agar With Crystal Violet , Macconkey Broth Double Strength (For Water Testing) , Macconkey Broth Single Strength (For Water Testing) , Maltose , Manitolmotility Test-Medium , Mannitol , Mannitol Salt Agar , Manual Blood Culture Bottle With Sds (Adult)- 70Ml , Manual Blood Culture Bottle With Sds (Paediatrics)- 20Ml , Muller Hinton Agar , Nutrient Agar , Nutrient Broth , Peptone Powder , Phenyl Alanine Agar , Pyr Agar , Robertson Cooked Meat Medium Base , Sabouraud Dextrose Agar With Chloramphenicol With Cycloheximide , Sabourauds Dextrose Agar Powder , Sabroud Dextrose Agar With Chlorophenicol , Selenite F Broth , Simmons Citrate Agar , Sodium Deoxycholate , Sucrose , Tcbs Agar , Triple Sugar Iron Agar , Xld Agar , Antibiotic Disc , Amikacin 30 Mcg , Amoxicillin , Amoxycillin-Clav 20/10Ug , Ampicillin 10 Mcg , Ampicillin-Sulbactam(10/10 ?G) , Azithromycin 15 Mcg , Aztreonam(30 ?G) , Cefazoline 30 Mcg , Cefepime 50Ug , Cefoperazone / Sulbactum , Cefoperazone 75 Mcg , Cefotaxime(30 ?G) , Cefotaxime+Clavulanate , Cefoxitin 30Ug , Cefpodoxime , Ceftazidime 30 Mcg , Ceftazidime+Clavulanate , Ceftriaxone 30 Mcg , Ceftriaxone-Sulbactum 30/15Ug , Cefuroxime 30 Mcg , Chloramphenicol 30 Mcg , Ciprofloxacin 5Mcg , Clarithromycin(15 ?G) , Clindamycin 2 Mcg , Co Trimoxazole(Sulpha/Trimethoprim) 25 Mcg (23.75/1.25) , Colistin (0.016-256 Mcg/Ml) , Colistin 10 Mcg , Cotrimoxazole(25 ?G) , Doripenem(10 ?G) , Doxycycline Hydrochloride 30 Mcg , Ertapenem(10 ?G) , Erythromycin 15 Mcg , Gatifloxacin(5?G) , Gemifloxacin(5 ?G) , Gentamicin 10 Mcg , Imipenem 10 Mcg , Linezolid(30 ?G) , Lomefloxacin(10 ?G) , Meropenam 10Ug , Minocycline(30 ?G) , Moxifloxacin(5 ?G) , Nitrofurantion 300 Mcg , Norfloxacin 10 Mcg , Novobiocin(5 ?G) , Ofloxacin(5 ?G) , Oxacillin(1 ?G) , Penicillin 10 Units , Piperacillin 100 Mcg , Piperacillin/Tazobactam 100/10 Mcg , Polymyxin-B , Quinopristin-Dalfopristin(15 ?G) , Teicoplanin , Teicoplanin 30 Mcg , Tetracycline 30 Mcg , Ticarcillin-Clavulanate(75/10 ?G) , Tobramycin 10 Mcg , Trimenthoprim(5 ?G) , Vancomycin (0.016-256 Mcg/Ml) , Vancomycin 30 Mcg , Bacitracin(0.4 U) , Sterile Disc , V Factor , X Factor , X+V Factor , Optochin(5 ?G) , Kits & Chemical , Acetone Solution , Acid Fast Staining Kit , Albert’S Metachromatic Stain Kit , Andrade’S Indicator , Anti Hav Igm (Elisa Kit) , Anti Hav Igm (Rapid Test) , Anti Hcv Antibody Kits (Elisa Kit) , Aso Kit(25 Test/Packet),Consumable , Basic Carbol Fuchsin For Afb Staining(Powder) , Conc Hcl , Crp Test Kit , Crystal Violet Powder , Dengue Ns-1 Elisa , Formaldehyde Solution , Field Stain A , Field Stain B , Filarial Antigen Card Test , Ferric Chloride (500 Gm) , Formaldehyde 40% (Conc. Formaline) , Giemsa Stain (Merck / Span) , Glycerol , Gram Iodine , Gram Staining Kit , H2so4 (Sulphuric Acid) 25% , Hbv Elisa Test Kit , Hepatitis E Virus Anti Hev Igm Antibody (Elisa) , Hiv (Rapid)(Whole Blood Finger Prick Test Kit) , Hiv Elisa Test Kit , Hydrogen Peroxide 6% Solution , India Ink , Kovac’S Reagent (Indole) , Lacto Phenol Cottons Blue Stain , Lead Acetate Strip , Leishman Stain , Liquid Paraffin , Malaria Bivalent Antigen-Detecting Rapid Diagonstic Tests(Rdts) , Methyl Blue For (Z N) , Methyl Alcohol , Methyl Red Indicator , Methylene Blue Powder , Nitrate Reagent A , Nitrate Reagent B , Occult Blood Test Kit (Haem Test Kit) , Oxidase Disc , Oxidase Reagent (Tetra Methyl Para Phenylene Di Amine Di-Hydro Chloride) , Phenol Crystals , Pyr Reagent , Ra Factor Rapid Kit , Rpr Test Kit , Safranine (Gram Stain) , Urea 40% Supplement (For Urea Agar Base) , Voges Proskauer Reagent-A , Voges Proskauer Reagent-B , Widal Slide Test(4X5ml With Control) , Xylene , Zinc Dust , Chemical Indicator For Autoclave (Indicator Tape) , Biological Indicator For Autoclave (Indicator Vial) , Glassware, Plasticware& Other Item , Autoclavable Aluminium Foil , Autoclavable Glass Bottle With Screw Cap For Culture Media (1000Ml (Borosilicate Glass Autoclavable)) , Autoclavable Glass Bottle With Screw Cap For Culture Media (500Ml (Borosilicate Glass Autoclavable)) , Autoclavable Glass Bottle With Screw Cap For Culture Media (50Ml (Borosilicate Glass Autoclavable)) , Autoclavable Petri Plate (100Mm) Plastic , Autoclavable Petri Plate (150Mm) Plastic , Autoclavable Petri Plate (90Mm) Plastic , Autoclavable Reusable Transparent Bags , Bcg(1 Ml Each) , Beaker 1000Ml (Borosilicate Glass Autoclavable) , Bloting Paper (Paper) , Burning Sprit , Cedar Wood Oil , Concavity Slide , Conical Flask (Glass)-1000Ml , Conical Flask (Glass)-100Ml , Conical Flask (Glass)-2000Ml , Conical Flask (Glass)-500Ml , Conical Flask (Glass)-50Ml , Cover Slip , Cryogenic Vial , Disposable Plastic Loop - 2Mm , Disposable Plastic Loop - 4Mm , Disposable Sharp Collection Containers(5 Ltr) , Dropping Bottle Plastic 100- 120 Ml Capacity , Durham’S Tube , Falcon Tube Sterile, (Conical Bottom)(50Ml Each Plastic Containers With Air Tight Screw Cap Printed Graduation) , Filter Paper Sheet((Whatmann No 01) , Filter Paper(12.5 Cm, 0.1 Micron) , Forceps Small , Gaspak (3.5 Liter) , Glass Marking Pen (Diamond ) , Glass Reagent Bottle (5 Litre) , Glass Test Tube 12 X 100 (Medium Size) Heavy Quality 100/Pkt(No.) , Glass Test Tube 12 X 50 Borocilicate Glass Autoclavable , Glass Test Tube 15 X 125 Borocilicate Glass Autoclavable , Measuring Cylinder Plastic (100 Ml) , Measuring Cylinder Plastic (1000 Ml) , Measuring Cylinder Plastic (50 Ml) , Measuring Cylinder Plastic (500 Ml) , Metal Loop Holder , Micropipette Tips (10 Ul )(For Serology) , Micropipette Tips (100 Ul )(For Serology) , Micropipette Tips (1000 Ul )(For Serology) , Micropipette Tips (20 Ul ) , Micropipette Tips (200 Ul ) , Microscope Lens Cleaner Kit , Para Film Sealing Film , Ph Paper Strip Range (1-10) , Soap , Sterile Cotton Swab Wooden Stick(Individually Packed) , Sterile Disposable/Hypodermic Syringe For Single Use(5Ml ) , Sterile Disposable/Hypodermic Syringe With Needle For Single Use(2Ml ) , Sterile Disposable/Hypodermic Syringe With Needle For Single Use(10Ml ) , Sterile Urine Collection Container 50Ml Disposable , Individually Packed , Swab Stick With Tube-Sterile , Test Tube Holder , Test Tube Stand (Aluminum) 10X10 Holes For 12Mm Diameter Test Tube , Test Tube Stand 10X10 Holesfor 18Mm Diameter Test Tube , Test Tube Stand 10X10 Holes For 12Mm Diameter Test Tube , Test Tube Stand, Polypropylene, 3 Tier(For Keeping 10 Ml Vtm Vials/ Tier) , Urine Container Size Of The Container Shall Be 30Ml Disposable , Utility Gloves(Medium) , Atcc Strain & Antisera , Acinetobacter Baumannii Nctc 13304 , Enterococcus Faecalis Atcc 29212 , Klebsiella Pneumoniae Atcc 700603 , Pseudomonas Aeruginosa Atcc 27853 , Staphylococcus Aureus 25923 , Escheriachia Coli 25922 , Staphylococcus Aureus Atcc43300 (Mrsa) , Shigella Boydii Polyvalent C Antisera , Shigella Dysentriae Polyvalent A Antisera , Shigella Flexneri Polyvalent B Antisera , Shigella Sonnei Polyvalent D Antisera , Vibrio Cholera O1(Ogawa)Antisera , Vibrio Cholera O1( Inaba)Antisera , Vibrio Cholera (O139 )Antisera , Salmonella Typhi Poly O Antisera , Salmonella Typhi O-2 Antisera , Salmonella Typhi O-7 Antisera , Salmonella Typhi O-9 Antisera , Rt-Pcr Kits, Chemical & Consumable , 0.2 Ml Pcr Tube (Sterile, Flat-Cap Shaped) Dnase/Rnase Free , 15 Ml Polypropylene Centrifuge Tubes, Sterile, {Certified Nonpyrogenic And Dnase-/Rnase-Free, Disposable Conical Bottom With Seal Caps(The Tubes Should Have Printed Graduations And A Large White Marking Spots)} , Alcohol 70% (Laboratory Grade) , Bio Medical Waste Bins Red (15 Ltr) , Bio Medical Waste Bins Red (25 Ltr) , Bio Medical Waste Bins Red (40 Ltr) , Bio Medical Waste Bins Yellow (15 Ltr) , Bio Medical Waste Bins Yellow (25 Ltr) , Bio Medical Waste Bins Yellow (40 Ltr) , Bmw Polybags Red Colour (18 Kg Capacity) , Bmw Polybags Red Colour (28 Kg Capacity) , Bmw Polybags Red Colour(45 Kg Capacity) , Bmw Polybags Red Colour (05 Kg Capacity) , Bmw Polybags Yellow Colour (18 Kg Capacity) , Bmw Polybags Yellow Colour (28 Kg Capacity) , Bmw Polybags Yellow Colour (45 Kg Capacity) , Cryotags / Freezer Labels, For 1.5- 2.0 Ml Cryovials {Ability To Withstand Cryogenic Temperatures Upto Minus 80 Degree C For A Wide Variety Of Plastic And Glass Vials, Test Tubes, Cryogenic Boxes And Plates} , Diluent For Dna Extraction/ Ethanol, Molecular(Biology Grade) , Filter Barrier Tips 20 Ul (In Box Packing, Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 10 Ul (Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 1000 Ul (Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 200 Ul (Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Micro Centrifuge Tube 0.5 Ml (Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Micro Centrifuge Tube 1.5 Ml(Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Micro Centrifuge Tube 2 Ml(Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Micro Pipette Tips 5-300Ul , Microcentrifuge Tube Rack (20 Tube/24 Tube Capacity)(For 1.5/2Ml Tube) , Microcentrifuge Tube Rack (80 Tube/96 Tube Capacity) Reversible One Side For 1.5Ml Tube And Other( Side With 0.2 Ml Pcr Tubes) , Non-Latex Purple Nitrile Gloves (Large) (Sterile Dnase Rnase Pyrogenfree ) , Non-Latex Purple Nitrile Gloves (Medium) (Sterile Dnase Rnase Pyrogenfree ) , Optical Adhesive Covers For Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Biorad Cfx 97 Dx Opm) , Optical Adhesive Covers For Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Thermo Fisher A28574 Quant Studiort-Pcr Machine) , Parafilm Roll (Size Approx 2 Inch Width And 250 Inch Length) , Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Biorad Cfx 97 Dx Opm) , Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Thermo Fisher A28574 Quant Studiort-Pcr Machine) , Pcr Strips 0.1 Ml (Strip Of 4) (Compatible With Qiagen 5Plex Rotorgene Rt-Pcr Machine) , Pcr Strips 0.2 Ml With Attached Cap (Strip Of 8) (Compatible With Thermo Fisher A28574 Quant Studiort-Pcr Machine) , Pcr Strips 0.2 Ml With Attached Cap (Strip Of 8) (Compatible With Biorad Cfx 97 Dx Opm) , Rnase/ Dnase Away Solution (For Complete Removal Of Rnase/ Dnase Contamination From Work Surfaces, Pipettes And Equipments(Should Be Stable At Room Temperature)) , Sterile Pasteurppipettes 3Ml , Viral Transport Media With Swabs (3Ml Vial With 2 Regular Swabs I.E. One Nasal Swab And One Throat Swab (1.Viral Transport Medium (Vtm) With Swab With Complete Directions For Collection, Storage, Transport And Carrying. 2.Sterile Dacron, Polyester Or Rayon Sterile Swabs With Plastic Shafts)) , Aluminium Foil (9 Meters Length) Thickness - 11 Microns, Width - 30 Cm , Compertable With Transasia Xl 1000Fully Automated Biochemistry Analyser , Erba Ada Kit (1X20 Ml/1X10 Ml) , Erbaalbumin Kit (10X44 Ml) , Erba Alakaline Phosphatase Kit (2X44 Ml /2X11 Ml) , Erba Amylase Kit (3X22 Ml) , Erba Autowash Kit (10X100 Ml) , Erba Bilirubin Total (Btdca) Kit (6X44 Ml /3X22 Ml) , Erba Bilirubin Direct (Btdca) Kit (6X44 Ml /3X22 Ml) , Erba Calcium (Arsenazo) Kit (10X12 Ml) , Erba Cholestrol Kit (10X44 Ml) , Erba Ck Nac Kit (2X44 Ml /2X11 Ml) , Erba Ck Mb Kit (2X44 Ml /2X11 Ml) , Erba Direct Hdl Cholestrol With Calibrator Kit (4X30ml/4X10ml) , Erba Direct Ldl Cholestrol With Calibrator Kit (2X30//2X10 Ml) , Erbacreatinine (Enzymetic) Kit (5X30 Ml/5X10 Ml) , Erba Gamma Gt Kit (5X44ml/5X11 Ml ) , Erba Glucose Kit (10X44 Ml) , Erba Fe 125 Kit (R1-4X25 Ml/R2-2X12.5 Ml/Calibrator/2X2ml) , Erba Hba1c Kit (R1.2X15 Ml/R2-2X5 Ml/5X0.5 Ml) , Erba Ldh-P Kit (2X44 Ml /2X11 Ml) , Erba Lipase Xl Kit (1X44 Ml/1X11 Ml) , Erba Magnesium Kit (2X44 Ml) , Erba Mal Kit (1X10/5X25 Ml) , Erba Microprotein Kit (10X12 Ml) , Erba Phosphorus Kit (10X12 Ml) , Erba Total Protein Kit (10X44 Ml) , Erba Sgot El Kit (6X44/3X22 Ml) , Erba Sgpt El Kit (6X44/3X22 Ml) , Erba Triglycerides Kit (5X44 Ml/5X11ml) , Erba Urea Kit (5X44 Ml/5X11ml) , Erba Uibc125 Kit (R1-4X25ml, R2-2X12.5Ml, Calibrator 2X12.5Ml ) , Erba Uric Acid Kit (5X44 Ml/5X11ml) , Xl Turbi Crp Kit (2X22 Ml/1X11 Ml) , Xl Turbi Rf Kit (1X22/1X5.5 Ml) , Erba Ada Cail Kit (1X1ml) , Erba Ada Control Kit (1X1ml) , Erba Hba1c Con H Kit (1X.0.5Ml) , Erbahba1c Con L Kit (1X.0.5Ml) , Erba Xl Multical Kit (4X3 Ml) , Erba Norm Kit (1X5ml) , Erbapath Kit (1X5ml) , Apo A1 Kit , Apo B Kit , Hs-Crp Kit , Lp(A) Kit , Xl Auto Wash Ac/Al Kit (5X44 Ml /5X44 Ml) , Sample Cups Kit , Sample Cup Vol: 1.0 Ml Unique Type Kit , Thermal Paper Roll (108 Mm X 3 M)Kit , Ise Module Reagent Pack Na+/K+/Cl./Li+(4 Channel Pack) Kit , Ise Cleaning Solution Kit , Compertable With Transasia Semi Auto Analyzer Erba Chem 5X , Glucose Kit , Urea Kit , Creatinine Kit , Total Bilirubin Kit , Total Protein Kit , Albumin Kit , Total Cholesterol Kit , Sgpt/Alt Kit , Sgot/Ast Kit , Ldh Kit , Ck-Mb Kit , Trop - I Kit (Qualitative) , Alp Kit , Triglycerides Tg Kit , Hdl Kit , Disposable Plastic Test Tube , Clot Activater Tube (Plan Tube) , Fluoride Tube , Micropipette Tip1000ul , Micropipette Tip100ul , Micropippte((0.5-50 Ul)) , Micropippte (100-1000Ml) , External Quality Control Vial For Routine Biochemistry (Erba Chem 5X) , Protein Csf Kit , Lamp. (Erba Chem 5X) , Calcium (50X1 Ml) , Uric Acid , Ada , Ark Diagnosis Electrolyte Analyzer , Electrolyte Analyzer Reagent , Electrolyte Daily Cleaner , Electrolyte Quality Control -1,2,3 (1 Box ( Serum: L1-3, L2-4, L3-3,Urin: L1-1, L2-1)) , Pm Kit , Reference Housing , Electrode (Na,K,Cl) , Compertable With Elisa Reader (Tecan Infinite F50 & Hydroflex) , T3 , T4 , Tsh , Sterilizer Item Compertable With Cisa 8 Stu Model No. 6412 , Printer Paper , Door Gasket , Heating Element , Microbiological Filter , Print Ink Ribbon For Washer , Sterilizer Item Compertable Withcisa 4 Stu Model No. 4212 , Printer Paper , Door Gasket , Heating Element , Microbiological Filter , Print Ink Ribbon For Washer , Table Topitem Compertable With Table Top Sterilizer 23 Ltr , Door Gasket , Microbiological Filter , Heating Element , Printer Paper , Washer Kf 155Item Compertable With Cisa Washer 12 Din , Liquid Alkaline Detergent , Liquid Neutralising Agent , Lubrication Spray , Enzamatic Detergent , Cleaning Indicator (Level 1) , Cleaning Indicator (Level 2) , Cleaning Indicator (Level 3) , Cleaning Indicator (Level 4) , Print Ink Ribbon For Washer , Air Filter (Hepa) , Heater Element , Gasket , Ultrasonic Washeritem Compertable With Cisa Ultrasonic Washer 30 Ltr , Cleaning Agent For Ultrasonic Cleaner , Heat Sealeritem Compertable With Cisa Heat Sealer , Print Ink Ribbon For Heat Sealer ( Pack Of 10 ) , Consumables For Operation For Cssd Equipmentitem Compatible With Cisa Cssd Machines , 3 Line Label Steam , Bowie Dick Strip , Batch Monitoring Strip , Chemical Indicator Class 4 , Chemical Indicator Class 5 , Biological Indication Steam , Wrapping Paper 40X40 Cm , Wrapping Paper 50X50 Cm , Wrapping Paper 60X60 Cm , Wrapping Paper 75X75 Cm , Wrapping Paper 90X90 Cm , Wrapping Paper 100X100 Cm , Wrapping Paper 120X120 Cm , Sterilization Reel 50X200m , Sterilization Reel 75X200m , Sterilization Reel 100X200m , Sterilization Reel 120X200m , Sterilization Reel 150X200m , Sterilization Reel 200X200m , Sterilization Reel 250X200m , Sterilization Reel 300X300m , Sterilization Reel 350X200m , Sterilization Reel 400X200m , Sterilization Reel 500X200m , Autoclave Tape ( 18X50 Meter ) , Autoclave Tape ( 24X50 Meter ) , Packing Tape (18X50 Meter) , Packing Tape (24X50 Meter) , Packing Tape (36X50 Meter) , Packing Tape (48X50 Meter) , Process Indicator ( External Labeling ) For Every Pack , Sms Paper Non Woven Material(90 X90 Mm) , Sms Paper Non Woven Material (100 X100 Mm) , Sms Paper Non Woven Material (100 X120 Mm) , Sms Paper Non Woven Material (120 X 120 Mm) , Labelling Ink Role , Ro Plant Consumables For Cssd , Anti Scaling Chemical , Cip Chemical , Chemical For Flushing , Jumbo Catridge Filter , R.O. Membrane 8040 , Water Softener Consumables For Cssd , Resin , Air Compressor Consumables For Cssd , Check Valve Kit , Intake Filter Element , Crankase Filter Element With Felet , Grease Kit , Piston Ring Set , Filter , Operational Consumables For Cssd Compertable , Apron Heavy Duty Water Proof , Brushes For Instrument Cleaner , Devices For Cssd , Pcd Device For Bms Test , Pcd Device For Bds Test , Gun For Labeling , Aqua Zero Vacuum Pump (Devices For Cssd 8 Stu) , Aqua Zero Vacuum Pump (Devices For Cssd 6 Stu) , Aqua Zero Vacuum Pump (Devices For Cssd 4 Stu)
Contract Date: Mar 01, 2023 Contract Value : 1.00 Crore
Government Departments No of Bidders 7
Madhya Pradesh View Result →
30.
Health and Family Welfare #1417343 AOC
Tender For Supply Of Chemical And Reagents For Mdru Dep , Item Name , Mdru Kits And Reagents , Ammonium Chloride 500Gm , Potassium Bi Carbonate 500Gm , Sodium Chloride 500Gm , Tris Hcl 500Gm , Sds 500Gm , Saturated Phenol 500Ml , Chloroform 500Ml , Sodium Acetate 250Gm , Isoamyl Alcohol 500Ml / 1Ltr , Glacial Acetic Acid 500Ml / 1Ltr , Molecular Biology Grade Agarose Powder 250Gm , Bromophenol Blue Dye 2Ml*5=1Pack , Ethidium Bromide 10Ml , Molecular Weight ( Dna Ladder ) 100Bp & 1Kb 1 Vial , Molecular Weight ( Dna Ladder ) 50Bp 1 Vial , Molecular Weight ( Dna Ladder ) 25Bp 1 Vial , Taq Polymerase 500Units / Vial , Amplitaq Gold Dna Polymerase Master Mix 500Units / Vial , Mgcl2 5Ml , Dntp Mix 1Ml , Dnase 1000 Unit , Rnase 1000 Unit , Proteinase K 1000 Unit , Tris-Edta 500 Gm , Edta 250Gm / 500Gm , Boric Acid 250Gm / 500Gm , Teepol5 Liter , Xylene Cynol 10 Gm , Dmso 50 Ml , Tips I. 0.2 - 20 ?L Tips , Superscript Ii Rnase Reverse Transcriptase / Episcript™ Rnase H- Reverse Transcriptase ( Episcript Rt ) 400 / 500 Reaction Pack. , Power Sybrgreen Pcr Master Mix 5 Ml , Power Sybrgreen Rt Pcr Reagent Kit 5 Ml , Oligo ( Dt ) 12-18 Primer25ug ( 0.5Ug / Ul ) , Absolute Ethanol 500Ml , Pcr Plates ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Sealing Foil ( Rt Pcr / Qpcr Grade ) ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Filter Tips Each Pack Contains 1000 Psc. , Mct Variable Tubes Each Pack Contains 1000 Psc. , I. 20 -200?L Tubes , Ii. 200 - 600 ?L Tubes , Iii. 500 - 2000 ?L Tubes , Nitrile Autodextorous Gloves Each Pack Contains 1000 Psc. , Mctstands For Variable Tubes Sizes Each Pack Contains 10 Psc. , I. 20 -200?L Tubes Stand , Ii. 200 - 600 ?L Tubes Stand , Iii. 500 - 2000 ?L Tubes Stand , Filter Tip Boxes Each Pack Contains 10 Psc. , I. 0.2 - 20 ?L Filter Barrier Tip Box , Ii. 20 - 200 ?L Filter Barrier Tip Box , Iii. 200 - 1000 ?L Filter Barrier Tip Box , Rt Pcr Grade Water Pack Size Of 20Ml ( 20 Ml * 5 ) , Tip Discard Box ( 1-2 Liter Capacity ) Each , Graduated Measuring Cylinders 50, 100, 500, 1000 Ml Each , Graduated Beakers 50, 100, 500, 1000 Ml Each , Flat Bottom Tube 5Ml ( With Screw Cap ) Pack Size Of 500 Psc. , Tube Stand ( 15Ml Falcon, 5Ml, 2Ml, 0.5Ml, 0.2Ml Mct ) Pack Size Of 10 Psc. , Graduated Conical Flask 50, 100, 500, 1000Ml Pack Size Of 5 Psc. , Test Tube 5, 10 Ml Each Pack Contains 100 Psc. , Slide+Cover Slips ( 25Mm*75Mm ) Each Pack Contains 100 Psc. , Tissue Paper Roll Pack Size Of 12 Psc. , Fine Tissue Cloth Roll Pack Size Of 12 Psc. , Cotton Pack Size Of 10 Psc. , Wash Bottle / Dropping Bottle, 200Ml, 500Ml, 1Ltr Each , Funnels Variable Range Each , Plastic Bottle, 200, 500, 1000Ml Each , Syringe + Needle 2 Ml, 5 Ml Pack Size Of 100 Psc. Each , Nitrile Gloves; Medium And Large Size Box Pack Size Of 1000 Psc. , Dna Isolation Kit { Blood } Per Kit , Rna Isolation Kit Per Kit , Phenol 500 Ml , Hno3 ( Nitric Acid ) 500 Ml , Propionaldehyde Pure ( 97% ) 500 Ml , Phthalic Anhydride 500 Ml , Glacialacetic Acid Ar 500 Ml , Hydrochloric Acid Ar 500 Ml , Sulfuric Acid Ar 500 Ml , 2-Amino Ethanol 500 Ml , Pyridine Ar 500 Ml , Ammonia Solution Ar 500 Ml , Ammonia Chloride Ar 500 Ml , Acetyl Salicylic Acid 500 Ml , Acetone Ar 500 Ml , Anthranilic Acid Ar 500 Ml , Activated Charcoal 500 Ml , Silica Gel G 500 Ml , Benzoicacid Ar 500 Ml , Sds 500 Gm , Colin ( Cleaning Detergent Solution ) 500 Ml , Sterilium ( Hand Sanitizer ) 100 Ml * 5 , Dettol / Lifeboy Alcohol Based Hand Sanitizer 100 Ml * 5 , Floor Cleaner Phenyl 1 L * 5 , Cleaning Mop Per Psc , Broom Per Psc , Microwave Gloves Per Pair , Brown Paper For Autoclaving Per Roll , Liquid Nitrogen 10 / 25 Ltr. , Phosphate Buffer Saline ( 10X; Ph 7.4; Rnase Free ) 500 Ml , Formalin ( Formaldehyde Aqueous Solution; Lab Grade ) 500 Ml , Paraffin Wax ( 58-600C For Histology ) 500 Gm , Xylene ( Molecular Lab Grade ) 500 Ml , Glycerol500 Ml , Ammonia ( Nh4oh; Extra Pure ) 250 Ml / 500 Ml , Methanol ( Methyl Alcohol, Ch3oh ) 500 Ml , Acrylamide / Bis Ar 500 Ml , 10X Tbe Buffer 500 Ml , Urea ( Ultra Pure; Mol-Bio Grade ) 500 Gm / 1Kg , Ammonium Persulfate 100 Gm , Temed ( Ultra Pure; Mol-Bio Grade ) 100 Ml / 250 Ml , 4’, 6-Diamidino-2-Phenylindole 50 Ml , Diethyl Pyrocarbonate 5 Gm / 25 Gm , Tae Buffer , Sybr Gold 100Ul , Restriction Enzyme – Mnl I250 / 300 / 500 Units , Restriction Enzyme – Bcli1000 / 1500 / 2500 / 3000 Units , Restriction Enzyme – Hpych4v100 / 500 Units , Restriction Enzyme – Hpych4iii200 / 250 / 1000 / 1250 Units , Restriction Enzyme – Sau96i 1000 Units , Restriction Enzyme – Sfci200 / 1000 Units , Restriction Enzyme – Bcci1000 Units , Restriction Enzyme – Scrfi500 / 1000 / 2500 Units , Restriction Enzyme – Afliii250 / 1250 Units , Restriction Enzyme – Scai500 / 1000 / 1250 Units , Restriction Enzyme – Avai1000 / 2000 Units , Restriction Enzyme – Bsmi200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Tspri ( Also Share Cleavage Site Withtscai ) 1000 Units , Restriction Enzyme – Mboii250 / 300 / 1250 / 1500 Units , Restriction Enzyme – Bsh1236i500 / 1000 / 2500 Units , Restriction Enzyme – Banii1000 / 1500 / 2000 Units , Restriction Enzyme – Mph1103i1000 / 5000 Units , Restriction Enzyme – Dde I200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Bsmb I ( Also Share Cleavage Site Withesp3i ) 200 / 400 / 1000 Units , Restriction Enzyme – Afa I ( Also Share Cleavage Site Withrsa I ) 1000 / 5000 Units , Restriction Enzyme – Bal I ( Also Share Cleavage Site Withmlu Ni ) 50 / 100 / 200 / 250 Units , Restriction Enzyme – Fspi ( Also Share Cleavage Site Withnsbi ) 400 / 500 / 1000 / 2500 Units , Restriction Enzyme – Hpa Ii ( Also Share Cleavage Site Withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 Units , Restriction Enzyme-Hinf I , Restriction Enzyme- Hpych4 , Restriction Enzyme-Mboii , Restriction Enzyme-Bstui , Restriction Enzyme- Mvai , Primers , Fmr1 Set 1 –F5-Tcaggcgctcagctccgtttcggtttca-3 R5-5 Aagcgccattggagccccgcacttcc-3 , Mecp2 Exon 1 Set 1- F5-Gttatgtctttagtctttgg–3´ R5-Tgtgtttatcttcaaaatgt–3´ , Exon 2Set 1-F5-Cctgcctctgctcacttgtt–3´ R5- Ggggtcatcatacatgggtc–3´ , Exon 2Set 2- F5-Agcccgtgcagccatcagcc–3´ R5-Gttccccccgaccccaccct–3´ , Exon 3 Set 1 –F5-Tttgtcagagcgttgtcacc–3´ R5- Cttcccaggacttttctcca–3´ , Exon 3 Set 2- F5-Aaccacctaagaagcccaaa–3´ R5-Ctgcacagatcggatagaagac–3´ , Exon 3 Set 3- F5-Ggcaggaagcgaaaagctgag–3´, R5- Tgagtggtggtgatggtggtgg–3´ , Exon 3 Set 4 – F5-5´–Tggtgaagcccctgctggt–3´ R5- Ctccctcccctcggtgtttg–3´ , Exon 3 Set 5-F5ggagaagatgcccagaggag–3´ R5- Cggtaagaaaaacatccccaa–3´ , Exon3 ( L100v ) - F5-Aaccacctaagaagcccaaa-3 R5- Gcttaagcttccgtgtccagccttcaggta-3 , Putative Promoter And Exon 1. - F5-Gggtgcaatgaaacgctta-3 R5- Tttaccacagccctctctcc-3 , Mc4r Rs17782313 - F 5-Aagttctacctaccatgttcttgg-3 R 5-Ttccccctgaagcttttcttgtcattttgat-3 Fto Rs9939609-F 5-Aactggctcttgaatgaaataggattcaga-3 R5-Agagtaacagagactatccaagtgcagtac-3 , Adipoqrs2241766 – F5- Tgtgtgtgtggggtctgtct-3 R-5-Tgtgatgaaagaggccagaa-3 , Rs1501299- F5- Ctacactgatataaactatatggag-3 R5-Ccccaaatcacttcaggttg-3 , Pcsk1 Rs155971 – F5’Tatatgcagccaccaatcca 3’ R5’Aaaatgaagggagaagcacaaa3’ , Pomcrs6232- F5- Ttgtgcccttcatctgaaca-3 R5- Tgtagcaactttggcatgga-3 , Rs155971- F5tatatgcagccaccaatcca-3 R5-Aaaatgaagggagaagcacaaa-3 , Ppar-G ( Pro12ala ) -F5gcc Aat Tcaagc Cca Gtc-3R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctttcc G-3 , Kcnj11 ( Rs5219 ) -F5-Gactctgcagtgaggcccta-3’ R5-Acgttgcagttgcctttctt-3’ , Capn10 ( Rs3792267 ) -F5-Cacgcttgctgtgaagtaatgc-3’R5-Tgattcc Catggtctgtagcac-3’Pik3ca-Set 1-Forward-5’-Ggagtatttcatgaaacaaatgaatgatgcg-3’ Reverse- 5’-Gagctttcattttctcagttatctt-3’ , Bat 25-Set 1- F 5’-Tcgcctccaagaatgtaagt-3’R 5’-Tctgcattttaactatggctc-3’Bat 26-Set 1-F5’-Tgactacttttgacttcagcc-3’R5’-Aaccattcaacatttttaaccc-3’ , D2s123-Set 1- F5’-Aaacaggatgcctgccttta-3’ R5’-Ggactttccacctatgggac-3’ , D5s346-Set 1- F 5’-Actcactctagtgataaatcggg-3’ R5-Agcagataagacagtattactagtt-3 , D17s250 – Set 1- F5’-Ggaagaatcaaatagacaat-3’ R5’-Gctggccatatatatatttaaacc-3’ , Impdh2 Set 1- F5- Gtttctgcggtatcccaatc -3 R5- Cgagcaagtccagcctat-3 Bmp6 - Rs73719353- F5’-Gctcctttgcacttcgctgt-3’ , R5’-Aggctctgctg Agctcctac-3’ , Bmp6- Rs73719341- F 5’Tgaacttcccattcccctct-3’ R5’Ataaaattagcattgatcca-3’ , Bmp6- Rs73719318 F5’Caggtgctgtgcaacttctt-3’ R 5’Agagggcaccatggttgcct-3’ , Bmp6-Rs73381662 F 5’-Ctgagattcaattaggccca-3’ R 5’Taaagaacagcaaaagtctg-3’ , Bmp6-Rs73381650 F 5’Cacataaagattgctgcatt-3’ R 5’Tagtaatcctaaaaatggga-3’ , Anxa2- Rs7170178 F 5’-Ttcacagcagttcaaaatac-3’ R 5’-Ctgggtttccagagatggaa-3’ , Anxa2 - Rs73435133 F 5’-Gagtgcaaggtgctgaggat-3’ R 5’-Gatttcagacagcccttgca-3’ , Anxa2- Rs73418020 F 5’-Tctgagagtgaaaggtgcac-3’ R 5’-Tcccatcccctgaatccctg-3’ , Anxa2- Rs72746635 F 5’-Cctgactcattgtcacatca-3’ R 5’-Aagtggctttccactgccc-3’ , Anxa2- Rs73418025 F 5’- Cttctcatcttactttt-3’ R 5’- Agggaaggatacagaggaga-3’ , Hsp-70 Primer Sequence5-Agcgt Aacac Cacca Ttcc-3 ( Forward ) 5-Tggct Cccac Cctat Ctc-3 ( Reverse ) , The Gapdh Sequence Forward Primer 5-Agc Cac Atc Gct Gag Aca C-3, Reverse Primer 5- Gcc Caa Tac Gaccaa Atcc-3. , Mthfr F:5-Tgtggtctcttcatccctcgc-3;R: 5-Ccttttggtgatgcttgttggc-3. , Dpyd F:5-Actcaatatctttactctttcatcaggac-3. R: 5-Acattcaccaacttatgccaattct-3. , Tyms F:5’-Ggtacaatccgcatccaactatta-3’ R:5’-Ctgataggtcacggacagattt-3’ , Imp3 Forward:5’Atgactcctccctacccg3’ Reverse:5’Gaaagctgcttgatgtgc3’ , Cxcl1forward: 5’Ccagacccgcctgctg-3’And Reverse:5’Cctcctcccttctggtcagtt-3’ , Cox-2 Forward: 5- Cagccatacagcaaatcc -3; Reverse: 5-Tcgcacttatactggtcaa-3 , Hmlh1f-5 Ttt Tga Tgt Aga Tgt Ttt Att Agg Gtt Gt 3R-5 Acc Acc Tcatcataa Cta Ccc Aca 3 , Ppar-G ( Pro12ala ) - , F5gcc Aat Tcaagc Cca Gtc-3 , R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctt Tcc G-3 , Methylated ( Hmlh1 ) - F-5 Acg Tagacg Ttt Tat Tag Ggt Cgc 3 R- 5 Cct Catcgtaac Tac Ccg Cg 3 , Hmsh2 - F-5 Ggt Tgt Tgt Ggt Tgg Atg Ttg Ttt 3 R- 5 Caa Cta Caa Cat Ctc Ctt Caa Cta Cac Ca 3 , Methylated ( Hmsh2 ) - F- 5 Tcg Tgg Tcg Gac Gtc Gtt C 3 R-5 Caa Cgt Ctc Ctt Cga Cta Cac Cg 3 , ?-Actin: Forward: 5’-Ctacgtcgccctggacttcgagc-3’ ß-Actin: Reverse: 5’-Gatggagccgccgatccacacgg-3’ , Kras-Forward: 5-Gactgaatataaacttgtggtagttggacct-3.Reverse: 5-Ctattgttggatcatattcgtcc-3. , Braf- Forward: 5-Tcataatgcttgctgatagga-3. Reverse: 5-Ggccaaaaatttaatcagtgga-3. , Mthfr ( C677t ) ‘‘5-Gcacttgaaggagaaggtgtc-3” And Reverse Primer ‘‘5-Aggacggtgcggtgagagtg-3” , Mthfr ( A1298c ) Forward ‘‘5-Ctt Tgg Gga Gct Gaa Gga Cta Cta C-3” And Reverse ‘‘5-Cac Ttt Gtg Acc Att Ccg Gtt Tg-3” Primers. , Total Rna Isolation Mini Kit ( From Human Skin Tissue ) / Rneasy Fibrous Tissue Mini Kit ( For Rna Extraction From Human Skin Tissue ) ( Qiagen ) Per Kit ( Each Kit Pack Is For 50 Reactions ) , Purospin™ Fibrous Tissue Rna Purification Kit ( Luna Nanotech ) ( For Rna Extraction From Human Skin Tissue ) Per Kit ( Each Kit Pack Is For 250 Reactions ) , Aurum™ Total Rna Fatty And Fibrous Tissue Kit ( Biorad ) / Mp Biomedicals Fastrna Pro Green Kitper Kit ( Each Kit Pack Is For 50 Reactions ) , Human Leptin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adiponectin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adipsin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Resistin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Iron Elisa Kit ( Serum Iron ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Ferritin Elisa Kit ( Serum / Ferritin ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Gdf15 Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Spexin Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Pai-1-Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Thyroid Estimation Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Ice Maker Machine For Laboratory Purpose 1 Unit , Microwave Gloves Each Packet Contains One Pair Of Gloves. , Pcr Mini Cooler / Coolcube Microplate And Pcr Tube Cooler Each , Horizontal Gel Apparatus: 18 – 20 Cm ( Length ) X 25 – 30 ( Breadth ) X 5- 7.5 Cm ( Height ) , 40-60 Samples, Multichannel Pipette Compatible Combs And Gel Caste Each , Mini-Horizontal Gel Apparatus: 9 Cm W X 11 Cm L With Grooves ( 8.7 Cm L X 1.2 Cm H ) On The Side For Gripping The Gel Tray. It Should Have Two Comb Slots On The Same Tray Area. Buffer Capacity Should Be 600 Ml For The Buffer Tanks And Optimum Gel Runs With A Fill Line Indicator For Buffer Levels Along The Unit Side Each , Multi Size Forceps Lab Set Each Packet Containsmulti Size Forceps Lab Set , Liquid Nitrogen Sample Storage Tanks Each , Liquid Nitrogen Sample Handling Gloves Each Packet Contains One Pair Of Gloves. , L-Mold Each , Tissue Cassette Steel Each , Electric Tissue Float Bath ( Thermostate ) Each , Coupling Jar Each Pack Contains 2 Psc. , Staining Rack Each , Whatman Filter Paper Grade 1 & 2 Each Packet Contains 50 Psc.. , Harri’S Hematoxylin Powder 25 / 50 / 100 / 250 / 500 Gm , Yellow Eosin Powder 25 / 50 / 100 / 250 / 500 Gm , Coverslip 18X18 ( Microscopic ) Each Packet Contains 100 Psc.. , Dpx Mount 100 Ml / 250 Ml , Hot Plate Each , Mx35 Premier Microtome Blade ( 34 / 80Mm ) 50 Blades Each Box Contains 50 Psc.. , Diamond Point Marker Pen ( Histopathology Use ) Each , Embedding Mold And Embedding Ring Each , Qiamp Dna Ffpe Tissue Kit ( 50 Rxns ) , Genomic Dna Purification Kit ( Promega ) , Rna Extraction Kit From Tissue , Cdna Synthesis Kit , Superscript Ii Rnase Reverse Transcriptase , Sybr Green Pcr Master Mix , Sodium Bisulphite , Page Loading Dye , Formamide , N’N’-Methylene Bisacrylamide , Ammonium Persulfate , Temed , Polyacrylamide , Wizard Dna Clean Up System ( Promega ) , 2-Mercaptoethanol , Silver Stain , Hydroquinone , Urea , Blotting Paper , Dna Ladder 10 Bp , Pas Stain , Histopathology Plastic Cassettes , Poly – L – Lysine Coated Slides , Deep Well Mortar And Pestle Homogenizers ( Medium Size ) , Deep Well Mortar And Pestle ( Small Size ) , Rneasy Minielute Cleanup Kit , Phase – Lock Gel Heavy5 Prime Phase – Lock Gel Heavy5 Prime , Qiazol Lysis Reagent , Rneasy Minielute Cleanup Kit , Cryo-Vial 1 Pkt Contains 50 Psc. , Deep Well Mortar And Pestle ( Small Size )
Contract Date: Jul 24, 2023 Contract Value : 25.00 Lakh
Government Departments No of Bidders 2
Madhya Pradesh View Result →
31.
Educational and Research Institute #1413035 AOC
Supply For Central Lab Consumable And Other Items Supply For Central Lab Consumable And Other Items In Gmc Ratlam , Three Part Automated Cell Counter Model :- Swelab Alfa Plus Basic Close System , Swelab Alfa Plus Diluents , Swelab Alfa Plus Lyser , Boule Control - Normal , Boule Control - Low , Boule Control - High , Automatic Coagulation Analyzer Model :- Sta Compact Max 3 Close System , Stac Cacl20, 0025M (00367) , Sta Cephascreen 10(00310) , Sta Cleanser Solution 6X2500ml(00973) , Sta Coag Control N+P(00679) , Sta Desorb U24x15ml (00975) , Sta Liatest Control N+P (00526) , Sta Liatest D Di (00662) , Sta @- Neoptimal 5. (01163) , Sta Owren Koller 24X15ml(00360) , Chemicals , Xylene (Sulphar Free) , Paraffin Wax (58-60 Temperature) , Acetone , Eosin (2%) , Distyrene Plasticizer Xylene (Dpx Mountant) , Glacial Acetic Acid , Formic Acid (100%) , Nitric Acid (100%) , Propanol (45%) , Sodium Metabisulphate , Sodium Nitroprusside , Liquor Ammonia , Ammonium Sulphate , Sulphosalicilic Acid Solution , Og 6 , Ea 50 , Semen Analysis Diluting Fluid , Formaline , Spirit Alcohol , Sulphuric Acid , Reticulocyte Count Fluid , Distilled Water , Sodium Hypochloride , Methanol , Glucose Pouch , Perls Stain (Long Expiray) , Pas Stain (Long Expiray) , Mpo Sstain (Long Expiray) , Benzidine Solution (Long Expiray) , Alpha Napthol , Copper Acetate , Glucose (Dextrose) 1 , Fructose , Iodine Cristal , Resorcinol , Sprit Lamp (Steel) , Sprit 100% (Flammable) , Sodium Hydroxide , Starch Soluble , Sodium Nitrite , Lead Acetate , Sodium Carbonate , Trichloroacetic Acid , Ammonium Malybdate , Sulphar Powder , Ammonia Solution , Egg Albumin Powder , Fouchets Reagent , Organic Solvent (Sprit) , Funnel Poly Lab , Mercuric Sulphate , Copper Sulphate , Ninhydrin Ar , Bile Salt , Kits , Reticulocyte Count Kit , Field Stain Kit , Giemsa Stain Kit , Pt/Inr Kit , Hbsag Elisa Kit , Hbsag Rapid Cards , Reagent , Benedict Reagent (Long Expiray) , Ehrlich’S Reagent (Long Expiray) , Esbech’S Reagent (Long Expiray) , Fouchet Reagent (Long Expiray) , Other Consumable Items , Casset , Glass Dish Staining Jar , Hand Wash , Bubbler (Plastic Screw) , Volumetric Flask 100Ml , Filter Paper 12.5Dm , Diamond Pencil , Knife (Grossing) , Speciman Jar With Lid (Glass) (200X200x70 Mm) , Speciman Jar With Lid (Glass) (150X150x60mm) , Museum Jar With Lid (Glass) (220X150x100mm) , Museum Jar With Lid (Glass) (220X195x80mm) , Museum Jar With Lid (Glass) (250X165x140mm) , Museum Jar With Lid (Glass) (360X150x100mm) , Museum Jar With Lid (Glass) (150X150x80mm) , Museum Jar With Lid (Glass) (250X250x120mm) , Museum Jar (10X10x15 Inches) , Museum Jar (18X12x12 Inches) , Museum Jar (25X15x10 Inches) , Pippette 1 Ml (Borosilicate) , Pippette 5 Ml (Borosilicate) , Glass Rod (Solid ) , Slide Holder (Steel) , Slide Staining Rack , Application Plastic Stick , Sprit Lamp Glass , Tube Holder , Rbc Pipette , Wbc Pipette , Pasture Pipette , Tissue Embedding Mold , Embedding O Ring , Test Tube 15 Ml , Test Tube 20 Ml , Centrifuge Tube 15Ml , Centrifugr Graduated Tube 15 Ml , Reagent Bottle 100 Ml , Reagent Bottle 250Ml , Measuring Cylinder 100 Ml , Measuring Cylinder 5 Ml , Detergent Powder , Culture Media , Agar Powder , Alkaline Peptone Water , Anhydrous Barium Chloride , Arabinose , Arginine Dihydrolase Powder , Automated Blood Culture Bottle (Adult) Compatible Withbact/Alert 3D 480, Bio Merieux , Automated Blood Culture Bottle (Paediatrics) Compatible Withbact/Alert 3D 480, Bio Merieux , Lowenstein Jansens Medium(Ready Prepared) , Lactose , Lysine Decarboxylase , Macconkey Broth Single Strength (For Water Testing) , Maltose , Mannitol , Pyr Agar , Robertson Cooked Meat Medium Base , Sodium Deoxycholate , Sucrose , Tcbs Agar , Antibiotic Disc , Cefepime 50Ug , Cefoperazone / Sulbactum , Cefotaxime+Clavulanate , Cefpodoxime , Ceftazidime+Clavulanate , Ceftriaxone-Sulbactum 30/15Ug , Colistin (0.016-256 Mcg/Ml) , Cotrimoxazole(25 ?G) , Doripenem(10 ?G) , Ertapenem(10 ?G) , Imipenem 10 Mcg , Meropenam 10Ug , Novobiocin(5 ?G) , Quinopristin-Dalfopristin(15 ?G) , Teicoplanin , Ticarcillin-Clavulanate(75/10 ?G) , Vancomycin (0.016-256 Mcg/Ml) , Bacitracin(0.4 U) , Sterile Disc , V Factor , X Factor , X+V Factor , Optochin(5 ?G) , Kits & Chemical , Acetone Solution , Acid Fast Staining Kit , Albert’S Metachromatic Stain Kit , Andrade’S Indicator , Anti Hav Igm (Elisa Kit) , Anti Hcv Antibody Kits (Elisa Kit) , Aso Kit(25 Test/Packet),Consumable , Basic Carbol Fuchsin For Afb Staining(Powder) , Conc Hcl , Crystal Violet Powder , Formaldehyde Solution , Filarial Antigen Card Test , Ferric Chloride (500 Gm) , Formaldehyde 40% (Conc. Formaline) , Giemsa Stain (Merck / Span) , Glycerol , Gram Iodine , Gram Staining Kit , H2so4 (Sulphuric Acid) 25% , Hbv Elisa Test Kit , Hepatitis E Virus Anti Hev Igm Antibody (Elisa) , Hydrogen Peroxide 6% Solution , India Ink , Kovac’S Reagent (Indole) , Lacto Phenol Cottons Blue Stain , Lead Acetate Strip , Leishman Stain , Liquid Paraffin , Methyl Blue For (Z N) , Methyl Alcohol , Nitrate Reagent A , Nitrate Reagent B , Oxidase Disc , Oxidase Reagent (Tetra Methyl Para Phenylene Di Amine Di-Hydro Chloride) , Phenol Crystals , Pyr Reagent , Urea 40% Supplement (For Urea Agar Base) , Voges Proskauer Reagent-A , Voges Proskauer Reagent-B , Xylene , Zinc Dust , Biological Indicator For Autoclave (Indicator Vial) , Glassware, Plasticware& Other Item , Autoclavable Aluminium Foil , Autoclavable Reusable Transparent Bags , Bcg(1 Ml Each) , Bloting Paper (Paper) , Burning Sprit , Cedar Wood Oil , Concavity Slide , Cover Slip , Cryogenic Vial , Disposable Plastic Loop - 2Mm , Disposable Plastic Loop - 4Mm , Disposable Sharp Collection Containers(5 Ltr) , Dropping Bottle Plastic 100- 120 Ml Capacity , Durham’S Tube , Filter Paper Sheet((Whatmann No 01) , Gaspak (3.5 Liter) , Glass Marking Pen (Diamond ) , Glass Reagent Bottle (5 Litre) , Glass Test Tube 12 X 50 Borocilicate Glass Autoclavable , Metal Loop Holder , Soap , Sterile Disposable/Hypodermic Syringe For Single Use(5Ml ) , Sterile Disposable/Hypodermic Syringe With Needle For Single Use(2Ml ) , Sterile Disposable/Hypodermic Syringe With Needle For Single Use(10Ml ) , Test Tube Stand, Polypropylene, 3 Tier(For Keeping 10 Ml Vtm Vials/ Tier) , Utility Gloves(Medium) , Atcc Strain & Antisera , Acinetobacter Baumannii Nctc 13304 , Enterococcus Faecalis Atcc 29212 , Klebsiella Pneumoniae Atcc 700603 , Pseudomonas Aeruginosa Atcc 27853 , Staphylococcus Aureus 25923 , Escheriachia Coli 25922 , Staphylococcus Aureus Atcc43300 (Mrsa) , Shigella Boydii Polyvalent C Antisera , Shigella Dysentriae Polyvalent A Antisera , Shigella Flexneri Polyvalent B Antisera , Shigella Sonnei Polyvalent D Antisera , Vibrio Cholera O1(Ogawa)Antisera , Vibrio Cholera O1( Inaba)Antisera , Vibrio Cholera (O139 )Antisera , Salmonella Typhi Poly O Antisera , Salmonella Typhi O-2 Antisera , Salmonella Typhi O-7 Antisera , Salmonella Typhi O-9 Antisera , Rt-Pcr Kits, Chemical & Consumable , 0.2 Ml Pcr Tube (Sterile, Flat-Cap Shaped) Dnase/Rnase Free , 15 Ml Polypropylene Centrifuge Tubes, Sterile, {Certified Nonpyrogenic And Dnase-/Rnase-Free, Disposable Conical Bottom With Seal Caps(The Tubes Should Have Printed Graduations And A Large White Marking Spots)} , Alcohol 70% (Laboratory Grade) , Bio Medical Waste Bins Red (15 Ltr) , Bio Medical Waste Bins Red (25 Ltr) , Bio Medical Waste Bins Red (40 Ltr) , Bio Medical Waste Bins Yellow (15 Ltr) , Bio Medical Waste Bins Yellow (25 Ltr) , Bio Medical Waste Bins Yellow (40 Ltr) , Bmw Polybags Red Colour (18 Kg Capacity) , Bmw Polybags Red Colour (28 Kg Capacity) , Bmw Polybags Red Colour(45 Kg Capacity) , Bmw Polybags Red Colour (05 Kg Capacity) , Bmw Polybags Yellow Colour (18 Kg Capacity) , Bmw Polybags Yellow Colour (28 Kg Capacity) , Bmw Polybags Yellow Colour (45 Kg Capacity) , Cryotags / Freezer Labels, For 1.5- 2.0 Ml Cryovials {Ability To Withstand Cryogenic Temperatures Upto Minus 80 Degree C For A Wide Variety Of Plastic And Glass Vials, Test Tubes, Cryogenic Boxes And Plates} , Diluent For Dna Extraction/ Ethanol, Molecular(Biology Grade) , Filter Barrier Tips 20 Ul (In Box Packing, Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 10 Ul (Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 1000 Ul (Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Filter Barriertips 200 Ul (Sterile Dnase Rnase Pyrogenfree Compatible With Nichipet Ex2 Pipette (Make Nichiriyo)) , Micro Centrifuge Tube 0.5 Ml (Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Micro Centrifuge Tube 1.5 Ml(Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Micro Centrifuge Tube 2 Ml(Polypropylene Tubes, Resistance To Chemicals, Mechanical Stress And Temperature Extremes,(Autoclavable, Dnase, Rnase/Endotoxin Free)) , Micro Pipette Tips 5-300Ul , Microcentrifuge Tube Rack (20 Tube/24 Tube Capacity)(For 1.5/2Ml Tube) , Microcentrifuge Tube Rack (80 Tube/96 Tube Capacity) Reversible One Side For 1.5Ml Tube And Other( Side With 0.2 Ml Pcr Tubes) , Non-Latex Purple Nitrile Gloves (Large) (Sterile Dnase Rnase Pyrogenfree ) , Non-Latex Purple Nitrile Gloves (Medium) (Sterile Dnase Rnase Pyrogenfree ) , Optical Adhesive Covers For Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Biorad Cfx 97 Dx Opm) , Optical Adhesive Covers For Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Thermo Fisher A28574 Quant Studiort-Pcr Machine) , Parafilm Roll (Size Approx 2 Inch Width And 250 Inch Length) , Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Biorad Cfx 97 Dx Opm) , Pcr 96 Well Rxn Plates 0.2Ml (Compatible With Thermo Fisher A28574 Quant Studiort-Pcr Machine) , Pcr Strips 0.1 Ml (Strip Of 4) (Compatible With Qiagen 5Plex Rotorgene Rt-Pcr Machine) , Pcr Strips 0.2 Ml With Attached Cap (Strip Of 8) (Compatible With Thermo Fisher A28574 Quant Studiort-Pcr Machine) , Pcr Strips 0.2 Ml With Attached Cap (Strip Of 8) (Compatible With Biorad Cfx 97 Dx Opm) , Rnase/ Dnase Away Solution (For Complete Removal Of Rnase/ Dnase Contamination From Work Surfaces, Pipettes And Equipments(Should Be Stable At Room Temperature)) , Sterile Pasteurppipettes 3Ml , Viral Transport Media With Swabs (3Ml Vial With 2 Regular Swabs I.E. One Nasal Swab And One Throat Swab (1.Viral Transport Medium (Vtm) With Swab With Complete Directions For Collection, Storage, Transport And Carrying. 2.Sterile Dacron, Polyester Or Rayon Sterile Swabs With Plastic Shafts)) , Aluminium Foil (9 Meters Length) Thickness - 11 Microns, Width - 30 Cm , Compertable With Transasia Xl 1000Fully Automated Biochemistry Analyser , Erba Gamma Gt Kit (5X44ml/5X11 Ml ) , Compertable With Transasia Semi Auto Analyzer Erbachem 5X , Ldh Kit , Ck-Mb Kit , Hdl Kit , Micropippte((0.5-50 Ul)) , External Quality Control Vial For Routine Biochemistry (Erba Chem 5X) , Protein Csf Kit , Lamp. (Erba Chem 5X) , Calcium (50X1 Ml) , Ada , Compertable With Gelmatrix System Model :- Tulip , Ahg (Coombs) Test Card , Complete Grouping Card , Diluent-2 Liss , Ngl Xcf 3000 Blood Component Separator Machine , Platelet Apheresis Bag
Contract Date: Jul 20, 2023 Contract Value : 1.00 Crore
Government Departments No of Bidders 3
Madhya Pradesh View Result →
32.
Health and Family Welfare #1366117 AOC
Tender For Supply Of Chemical And Reagent For Mdru Department Third Call , Mdru Kits And Reagents , Ammonium Chloride 500Gm , Potassium Bi Carbonate 500Gm , Sodium Chloride 500Gm , Tris Hcl 500Gm , Sds 500Gm , Saturated Phenol 500Ml , Chloroform 500Ml , Sodium Acetate 250Gm , Isoamyl Alcohol 500Ml / 1Ltr , Glacial Acetic Acid 500Ml / 1Ltr , Molecular Biology Grade Agarose Powder 250Gm , Bromophenol Blue Dye 2Ml*5=1Pack , Ethidium Bromide 10Ml , Molecular Weight ( Dna Ladder ) 100Bp & 1Kb 1 Vial , Molecular Weight ( Dna Ladder ) 50Bp 1 Vial , Molecular Weight ( Dna Ladder ) 25Bp 1 Vial , Taq Polymerase 500Units / Vial , Amplitaq Gold Dna Polymerase Master Mix 500Units / Vial , Mgcl2 5Ml , Dntp Mix 1Ml , Dnase 1000 Unit , Rnase 1000 Unit , Proteinase K 1000 Unit , Tris-Edta 500 Gm , Edta 250Gm / 500Gm , Boric Acid 250Gm / 500Gm , Teepol5 Liter , Xylene Cynol 10 Gm , Dmso 50 Ml , Tips I. 0.2 - 20 ?L Tips , Tips Ii. 20 - 200 ?L Tips , Tips Iii. 200 - 1000 ?L Tips , Superscript Ii Rnase Reverse Transcriptase / Episcript™ Rnase H- Reverse Transcriptase ( Episcript Rt ) 400 / 500 Reaction Pack. , Power Sybrgreen Pcr Master Mix 5 Ml , Power Sybrgreen Rt Pcr Reagent Kit 5 Ml , Oligo ( Dt ) 12-18 Primer25ug ( 0.5Ug / Ul ) , Absolute Ethanol 500Ml , Pcr Plates ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Sealing Foil ( Rt Pcr / Qpcr Grade ) ( Light Cycler 480 Compatible ) Pack Of 50 / Pack Of 100 , Filter Tips Each Pack Contains 1000 Psc. , I. 0.2 - 20 ?L Filter Barrier Tips , Ii. 20 - 200 ?L Filter Barrier Tips , Iii. 200 - 1000 ?L Filter Barrier Tips , Mct Variable Tubes Each Pack Contains 1000 Psc. , I. 20 -200?L Tubes , Ii. 200 - 600 ?L Tubes , Iii. 500 - 2000 ?L Tubes , Nitrile Autodextorous Gloves Each Pack Contains 1000 Psc. , Mctstands For Variable Tubes Sizes Each Pack Contains 10 Psc. , I. 20 -200?L Tubes Stand , Ii. 200 - 600 ?L Tubes Stand , Iii. 500 - 2000 ?L Tubes Stand , Filter Tip Boxes Each Pack Contains 10 Psc. , I. 0.2 - 20 ?L Filter Barrier Tip Box , Ii. 20 - 200 ?L Filter Barrier Tip Box , Iii. 200 - 1000 ?L Filter Barrier Tip Box , Rt Pcr Grade Water Pack Size Of 20Ml ( 20 Ml * 5 ) , Tip Discard Box ( 1-2 Liter Capacity ) Each , Graduated Measuring Cylinders 50, 100, 500, 1000 Ml Each , Graduated Beakers 50, 100, 500, 1000 Ml Each , Flat Bottom Tube 5Ml ( With Screw Cap ) Pack Size Of 500 Psc. , Tube Stand ( 15Ml Falcon, 5Ml, 2Ml, 0.5Ml, 0.2Ml Mct ) Pack Size Of 10 Psc. , Graduated Conical Flask 50, 100, 500, 1000Ml Pack Size Of 5 Psc. , Edta Blood Collection Tube 5Ml Each Pack Contains 100 Psc. , Plain Vial ( For Clot Activator ) Each Pack Contains 100 Psc. , Fluoride Vial Each Pack Contains 100 Psc. , Test Tube 5, 10 Ml Each Pack Contains 100 Psc. , Slide+Cover Slips ( 25Mm*75Mm ) Each Pack Contains 100 Psc. , Tissue Paper Roll Pack Size Of 12 Psc. , Fine Tissue Cloth Roll Pack Size Of 12 Psc. , Cotton Pack Size Of 10 Psc. , Wash Bottle / Dropping Bottle, 200Ml, 500Ml, 1Ltr Each , Funnels Variable Range Each , Plastic Bottle, 200, 500, 1000Ml Each , Syringe + Needle 2 Ml, 5 Ml Pack Size Of 100 Psc. Each , Nitrile Gloves; Medium And Large Size Box Pack Size Of 1000 Psc. , Dna Isolation Kit { Blood } Per Kit , Rna Isolation Kit Per Kit , Phenol 500 Ml , Hno3 ( Nitric Acid ) 500 Ml , Propionaldehyde Pure ( 97% ) 500 Ml , Phthalic Anhydride 500 Ml , Glacialacetic Acid Ar 500 Ml , Hydrochloric Acid Ar 500 Ml , Sulfuric Acid Ar 500 Ml , 2-Amino Ethanol 500 Ml , Pyridine Ar 500 Ml , Ammonia Solution Ar 500 Ml , Ammonia Chloride Ar 500 Ml , Acetyl Salicylic Acid 500 Ml , Acetone Ar 500 Ml , Anthranilic Acid Ar 500 Ml , Activated Charcoal 500 Ml , Silica Gel G 500 Ml , Benzoicacid Ar 500 Ml , Sds 500 Gm , Colin ( Cleaning Detergent Solution ) 500 Ml , Sterilium ( Hand Sanitizer ) 100 Ml * 5 , Dettol / Lifeboy Alcohol Based Hand Sanitizer 100 Ml * 5 , Hypo 4% 5 L , Floor Cleaner Phenyl 1 L * 5 , Serum Separator Vial 3.5 Ml ( Vacutainer Tube, 3.5Ml, 13 X 75Mm, Plastic, Additive: Clot Activator / Polymer Gel, Gold Hemogard Closure, Paper Label ) Pack Size Of 100 Psc. Each , Labolene 1 L / 5 L , Cleaning Mop Per Psc , Broom Per Psc , Microwave Gloves Per Pair , Brown Paper For Autoclaving Per Roll , Liquid Nitrogen 10 / 25 Ltr. , Phosphate Buffer Saline ( 10X; Ph 7.4; Rnase Free ) 500 Ml , Formalin ( Formaldehyde Aqueous Solution; Lab Grade ) 500 Ml , Paraffin Wax ( 58-600C For Histology ) 500 Gm , Xylene ( Molecular Lab Grade ) 500 Ml , Glycerol500 Ml , Ammonia ( Nh4oh; Extra Pure ) 250 Ml / 500 Ml , Methanol ( Methyl Alcohol, Ch3oh ) 500 Ml , Acrylamide / Bis Ar 500 Ml , 10X Tbe Buffer 500 Ml , Urea ( Ultra Pure; Mol-Bio Grade ) 500 Gm / 1Kg , Ammonium Persulfate 100 Gm , Temed ( Ultra Pure; Mol-Bio Grade ) 100 Ml / 250 Ml , 4’, 6-Diamidino-2-Phenylindole 50 Ml , Diethyl Pyrocarbonate 5 Gm / 25 Gm , Tae Buffer , Sybr Gold 100Ul , Restriction Enzyme – Mnl I250 / 300 / 500 Units , Restriction Enzyme – Bcli1000 / 1500 / 2500 / 3000 Units , Restriction Enzyme – Hpych4v100 / 500 Units , Restriction Enzyme – Hpych4iii200 / 250 / 1000 / 1250 Units , Restriction Enzyme – Sau96i 1000 Units , Restriction Enzyme – Sfci200 / 1000 Units , Restriction Enzyme – Bcci1000 Units , Restriction Enzyme – Scrfi500 / 1000 / 2500 Units , Restriction Enzyme – Afliii250 / 1250 Units , Restriction Enzyme – Scai500 / 1000 / 1250 Units , Restriction Enzyme – Avai1000 / 2000 Units , Restriction Enzyme – Bsmi200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Tspri ( Also Share Cleavage Site Withtscai ) 1000 Units , Restriction Enzyme – Mboii250 / 300 / 1250 / 1500 Units , Restriction Enzyme – Bsh1236i500 / 1000 / 2500 Units , Restriction Enzyme – Banii1000 / 1500 / 2000 Units , Restriction Enzyme – Mph1103i1000 / 5000 Units , Restriction Enzyme – Dde I200 / 500 / 1000 / 2500 Units , Restriction Enzyme – Bsmb I ( Also Share Cleavage Site Withesp3i ) 200 / 400 / 1000 Units , Restriction Enzyme – Afa I ( Also Share Cleavage Site Withrsa I ) 1000 / 5000 Units , Restriction Enzyme – Bal I ( Also Share Cleavage Site Withmlu Ni ) 50 / 100 / 200 / 250 Units , Restriction Enzyme – Fspi ( Also Share Cleavage Site Withnsbi ) 400 / 500 / 1000 / 2500 Units , Restriction Enzyme – Hpa Ii ( Also Share Cleavage Site Withmspi ) 1000 / 2000 / 4000 / 5000 / 10000 Units , Restriction Enzyme-Hinf I , Restriction Enzyme- Hpych4 , Restriction Enzyme-Mboii , Restriction Enzyme-Bstui , Restriction Enzyme- Mvai , Primers , Fmr1 Set 1 –F5-Tcaggcgctcagctccgtttcggtttca-3 R5-5 Aagcgccattggagccccgcacttcc-3 , Mecp2 Exon 1 Set 1- F5-Gttatgtctttagtctttgg–3´ R5-Tgtgtttatcttcaaaatgt–3´ , Exon 2Set 1-F5-Cctgcctctgctcacttgtt–3´ R5- Ggggtcatcatacatgggtc–3´ , Exon 2Set 2- F5-Agcccgtgcagccatcagcc–3´ R5-Gttccccccgaccccaccct–3´ , Exon 3 Set 1 –F5-Tttgtcagagcgttgtcacc–3´ R5- Cttcccaggacttttctcca–3´ , Exon 3 Set 2- F5-Aaccacctaagaagcccaaa–3´ R5-Ctgcacagatcggatagaagac–3´ , Exon 3 Set 3- F5-Ggcaggaagcgaaaagctgag–3´, R5- Tgagtggtggtgatggtggtgg–3´ , Exon 3 Set 4 – F5-5´–Tggtgaagcccctgctggt–3´ R5- Ctccctcccctcggtgtttg–3´ , Exon 3 Set 5-F5ggagaagatgcccagaggag–3´ R5- Cggtaagaaaaacatccccaa–3´ , Exon3 ( L100v ) - F5-Aaccacctaagaagcccaaa-3 R5- Gcttaagcttccgtgtccagccttcaggta-3 , Putative Promoter And Exon 1. - F5-Gggtgcaatgaaacgctta-3 R5- Tttaccacagccctctctcc-3 , Mc4r Rs17782313 - F 5-Aagttctacctaccatgttcttgg-3 R 5-Ttccccctgaagcttttcttgtcattttgat-3 Fto Rs9939609-F 5-Aactggctcttgaatgaaataggattcaga-3 R5-Agagtaacagagactatccaagtgcagtac-3 , Adipoqrs2241766 – F5- Tgtgtgtgtggggtctgtct-3 R-5-Tgtgatgaaagaggccagaa-3 , Rs1501299- F5- Ctacactgatataaactatatggag-3 R5-Ccccaaatcacttcaggttg-3 , Pcsk1 Rs155971 – F5’Tatatgcagccaccaatcca 3’ R5’Aaaatgaagggagaagcacaaa3’ , Pomcrs6232- F5- Ttgtgcccttcatctgaaca-3 R5- Tgtagcaactttggcatgga-3 , Rs155971- F5tatatgcagccaccaatcca-3 R5-Aaaatgaagggagaagcacaaa-3 , Ppar-G ( Pro12ala ) -F5gcc Aat Tcaagc Cca Gtc-3R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctttcc G-3 , Kcnj11 ( Rs5219 ) -F5-Gactctgcagtgaggcccta-3’ R5-Acgttgcagttgcctttctt-3’ , Capn10 ( Rs3792267 ) -F5-Cacgcttgctgtgaagtaatgc-3’R5-Tgattcc Catggtctgtagcac-3’Pik3ca-Set 1-Forward-5’-Ggagtatttcatgaaacaaatgaatgatgcg-3’ Reverse- 5’-Gagctttcattttctcagttatctt-3’ , Bat 25-Set 1- F 5’-Tcgcctccaagaatgtaagt-3’R 5’-Tctgcattttaactatggctc-3’Bat 26-Set 1-F5’-Tgactacttttgacttcagcc-3’R5’-Aaccattcaacatttttaaccc-3’ , D2s123-Set 1- F5’-Aaacaggatgcctgccttta-3’ R5’-Ggactttccacctatgggac-3’ , D5s346-Set 1- F 5’-Actcactctagtgataaatcggg-3’ R5-Agcagataagacagtattactagtt-3 , D17s250 – Set 1- F5’-Ggaagaatcaaatagacaat-3’ R5’-Gctggccatatatatatttaaacc-3’ , Impdh2 Set 1- F5- Gtttctgcggtatcccaatc -3 R5- Cgagcaagtccagcctat-3 Bmp6 - Rs73719353- F5’-Gctcctttgcacttcgctgt-3’ , R5’-Aggctctgctg Agctcctac-3’ , Bmp6- Rs73719341- F 5’Tgaacttcccattcccctct-3’ R5’Ataaaattagcattgatcca-3’ , Bmp6- Rs73719318 F5’Caggtgctgtgcaacttctt-3’ R 5’Agagggcaccatggttgcct-3’ , Bmp6-Rs73381662 F 5’-Ctgagattcaattaggccca-3’ R 5’Taaagaacagcaaaagtctg-3’ , Bmp6-Rs73381650 F 5’Cacataaagattgctgcatt-3’ R 5’Tagtaatcctaaaaatggga-3’ , Anxa2- Rs7170178 F 5’-Ttcacagcagttcaaaatac-3’ R 5’-Ctgggtttccagagatggaa-3’ , Anxa2 - Rs73435133 F 5’-Gagtgcaaggtgctgaggat-3’ R 5’-Gatttcagacagcccttgca-3’ , Anxa2- Rs73418020 F 5’-Tctgagagtgaaaggtgcac-3’ R 5’-Tcccatcccctgaatccctg-3’ , Anxa2- Rs72746635 F 5’-Cctgactcattgtcacatca-3’ R 5’-Aagtggctttccactgccc-3’ , Anxa2- Rs73418025 F 5’- Cttctcatcttactttt-3’ R 5’- Agggaaggatacagaggaga-3’ , Hsp-70 Primer Sequence5-Agcgt Aacac Cacca Ttcc-3 ( Forward ) 5-Tggct Cccac Cctat Ctc-3 ( Reverse ) , The Gapdh Sequence Forward Primer 5-Agc Cac Atc Gct Gag Aca C-3, Reverse Primer 5- Gcc Caa Tac Gaccaa Atcc-3. , Mthfr F:5-Tgtggtctcttcatccctcgc-3;R: 5-Ccttttggtgatgcttgttggc-3. , Dpyd F:5-Actcaatatctttactctttcatcaggac-3. R: 5-Acattcaccaacttatgccaattct-3. , Tyms F:5’-Ggtacaatccgcatccaactatta-3’ R:5’-Ctgataggtcacggacagattt-3’ , Imp3 Forward:5’Atgactcctccctacccg3’ Reverse:5’Gaaagctgcttgatgtgc3’ , Cxcl1forward: 5’Ccagacccgcctgctg-3’And Reverse:5’Cctcctcccttctggtcagtt-3’ , Cox-2 Forward: 5- Cagccatacagcaaatcc -3; Reverse: 5-Tcgcacttatactggtcaa-3 , Hmlh1f-5 Ttt Tga Tgt Aga Tgt Ttt Att Agg Gtt Gt 3R-5 Acc Acc Tcatcataa Cta Ccc Aca 3 , Ppar-G ( Pro12ala ) - , F5gcc Aat Tcaagc Cca Gtc-3 , R5gat Atgttt Gca Gac Agt Gta Tca Gtg Aaggaa Tcg Ctt Tcc G-3 , Methylated ( Hmlh1 ) - F-5 Acg Tagacg Ttt Tat Tag Ggt Cgc 3 R- 5 Cct Catcgtaac Tac Ccg Cg 3 , Hmsh2 - F-5 Ggt Tgt Tgt Ggt Tgg Atg Ttg Ttt 3 R- 5 Caa Cta Caa Cat Ctc Ctt Caa Cta Cac Ca 3 , Methylated ( Hmsh2 ) - F- 5 Tcg Tgg Tcg Gac Gtc Gtt C 3 R-5 Caa Cgt Ctc Ctt Cga Cta Cac Cg 3 , ?-Actin: Forward: 5’-Ctacgtcgccctggacttcgagc-3’ ß-Actin: Reverse: 5’-Gatggagccgccgatccacacgg-3’ , Kras-Forward: 5-Gactgaatataaacttgtggtagttggacct-3.Reverse: 5-Ctattgttggatcatattcgtcc-3. , Braf- Forward: 5-Tcataatgcttgctgatagga-3. Reverse: 5-Ggccaaaaatttaatcagtgga-3. , Mthfr ( C677t ) ‘‘5-Gcacttgaaggagaaggtgtc-3” And Reverse Primer ‘‘5-Aggacggtgcggtgagagtg-3” , Mthfr ( A1298c ) Forward ‘‘5-Ctt Tgg Gga Gct Gaa Gga Cta Cta C-3” And Reverse ‘‘5-Cac Ttt Gtg Acc Att Ccg Gtt Tg-3” Primers. , Total Rna Isolation Mini Kit ( From Human Skin Tissue ) / Rneasy Fibrous Tissue Mini Kit ( For Rna Extraction From Human Skin Tissue ) ( Qiagen ) Per Kit ( Each Kit Pack Is For 50 Reactions ) , Purospin™ Fibrous Tissue Rna Purification Kit ( Luna Nanotech ) ( For Rna Extraction From Human Skin Tissue ) Per Kit ( Each Kit Pack Is For 250 Reactions ) , Aurum™ Total Rna Fatty And Fibrous Tissue Kit ( Biorad ) / Mp Biomedicals Fastrna Pro Green Kitper Kit ( Each Kit Pack Is For 50 Reactions ) , Human Leptin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adiponectin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Adipsin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Resistin Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Iron Elisa Kit ( Serum Iron ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Ferritin Elisa Kit ( Serum / Ferritin ) Per Kit ( Each Kit Pack Is For 96 Reactions ) , Gdf15 Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Spexin Human Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Human Pai-1-Elisa Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Thyroid Estimation Kit Per Kit ( Each Kit Pack Is For 96 Reactions ) , Ice Maker Machine For Laboratory Purpose 1 Unit , Microwave Gloves Each Packet Contains One Pair Of Gloves. , Pcr Mini Cooler / Coolcube Microplate And Pcr Tube Cooler Each , Pipette 0.5-10Ul, 02-20Ul, 10-100Ul, 20-200Ul And 100-1000Ul. Each , Horizontal Gel Apparatus: 18 – 20 Cm ( Length ) X 25 – 30 ( Breadth ) X 5- 7.5 Cm ( Height ) , 40-60 Samples, Multichannel Pipette Compatible Combs And Gel Caste Each , Mini-Horizontal Gel Apparatus: 9 Cm W X 11 Cm L With Grooves ( 8.7 Cm L X 1.2 Cm H ) On The Side For Gripping The Gel Tray. It Should Have Two Comb Slots On The Same Tray Area. Buffer Capacity Should Be 600 Ml For The Buffer Tanks And Optimum Gel Runs With A Fill Line Indicator For Buffer Levels Along The Unit Side Each , Multi Size Forceps Lab Set Each Packet Containsmulti Size Forceps Lab Set , Liquid Nitrogen Sample Storage Tanks Each , Liquid Nitrogen Sample Handling Gloves Each Packet Contains One Pair Of Gloves. , Slide Tray / Rack Each , L-Mold Each , Tissue Cassette Steel Each , Electric Tissue Float Bath ( Thermostate ) Each , Coupling Jar Each Pack Contains 2 Psc. , Staining Rack Each , Whatman Filter Paper Grade 1 & 2 Each Packet Contains 50 Psc.. , Harri’S Hematoxylin Powder 25 / 50 / 100 / 250 / 500 Gm , Yellow Eosin Powder 25 / 50 / 100 / 250 / 500 Gm , Coverslip 18X18 ( Microscopic ) Each Packet Contains 100 Psc.. , Dpx Mount 100 Ml / 250 Ml , Hot Plate Each , Mx35 Premier Microtome Blade ( 34 / 80Mm ) 50 Blades Each Box Contains 50 Psc.. , Diamond Point Marker Pen ( Histopathology Use ) Each , Embedding Mold And Embedding Ring Each , Qiamp Dna Ffpe Tissue Kit ( 50 Rxns ) , Genomic Dna Purification Kit ( Promega ) , Rna Extraction Kit From Tissue , Cdna Synthesis Kit , Superscript Ii Rnase Reverse Transcriptase , Sybr Green Pcr Master Mix , Sodium Bisulphite , Page Loading Dye , Formamide , N’N’-Methylene Bisacrylamide , Ammonium Persulfate , Temed , Polyacrylamide , Wizard Dna Clean Up System ( Promega ) , 2-Mercaptoethanol , Silver Stain , Hydroquinone , Urea , Blotting Paper , Dna Ladder 10 Bp , Pas Stain , Histopathology Plastic Cassettes , Poly – L – Lysine Coated Slides , Deep Well Mortar And Pestle Homogenizers ( Medium Size ) , Deep Well Mortar And Pestle ( Small Size ) , Rneasy Minielute Cleanup Kit , Phase – Lock Gel Heavy5 Prime Phase – Lock Gel Heavy5 Prime , Qiazol Lysis Reagent , Rneasy Minielute Cleanup Kit , Cryo-Vial 1 Pkt Contains 50 Psc. , Deep Well Mortar And Pestle ( Small Size )
Contract Date: Jul 21, 2023 Contract Value : 25.00 Lakh
Government Departments No of Bidders 2
Madhya Pradesh View Result →
TenderDetail
Loading tenders