Pcr And Rt Pcr Products Tenders from India

103 Pcr And Rt Pcr Products tenders are published by various Tendering Authorities & Private companies. 103 live Tender for Pcr And Rt Pcr Products are available in Pcr And Rt Pcr Products Tender section You can further filter Pcr And Rt Pcr Products tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Boards / Undertakings / PSU - Gautam Buddha Nagar - Uttar Pradesh

49773611 bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) ((3 3 )) 1 lakh (s) total quantity : 100

Due Date : Jul 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kanchipuram - Tamil Nadu

49761164 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 1550

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Coimbatore - Tamil Nadu

49761144 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 1663

Due Date : Jul 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ramanathapuram - Tamil Nadu

49761138 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 650

Due Date : Jul 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - 24 Paraganas North - West Bengal

49760948 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 8 lakh (s) total quantity : 1

Due Date : Jul 4, 2025

Tender Value :

17 Lakhs

View Notice

Government Departments - Thiruvallur - Tamil Nadu

49760898 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 150

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Krishnagiri - Tamil Nadu

49760888 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 1333

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - sevagram - Maharashtra

49759907 tender for annual rate contract for fever multiplex real time pcr kits

Due Date : Jul 5, 2025

Tender Value : Ref. Document

View Notice

Government Departments - WARDHa - Maharashtra

49757541 tender for covid kits

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Tenkasi - Tamil Nadu

49754135 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 2300

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Cuddalore - Tamil Nadu

49754116 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 1550

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Villupuram - Tamil Nadu

49754017 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 2250

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - South Andamans - Andaman And Nicobar Islands

49752614 bids are invited for real time pcr kits (v2) (q2) , anti-hav elisa test kits (v2) (q2) ((3 3 )) 1 lakh (s) total quantity : 1360

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Madurai - Tamil Nadu

49742591 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2800

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Sivaganga - Tamil Nadu

49742119 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 1500

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Namakkal - Tamil Nadu

49741912 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 50

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Himachal Pradesh

49739524 tender for procurement of film array multiplex pcr system on proprietary basis.

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Nagapattinam - Tamil Nadu

49735300 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 1400

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Theni - Tamil Nadu

49735260 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2000

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Salem - Tamil Nadu

49735252 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 2900

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kanniyakumari - Tamil Nadu

49735229 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2250

Due Date : Jul 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Virudhunagar - Tamil Nadu

49735143 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 950

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Erode - Tamil Nadu

49735123 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 2550

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Cuddalore - Tamil Nadu

49735121 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 1550

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Tiruppur - Tamil Nadu

49735031 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2829

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Namakkal - Tamil Nadu

49734973 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 50

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - pune - Maharashtra

49732905 tender for single tender enquiry for agpath-id one step rt pcr and taqpath one step multiplex master mix

Due Date : Jun 24, 2025

Tender Value :

10 Lakhs

View Notice

Government Departments - Tiruvannamalai - Tamil Nadu

49732728 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 236

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49732084 bids are invited for mass spectrometry compatiable magnetic immunoprecipitation kit based on protein ag , mass , pcr amplification kit total quantity : 3

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - bathinda - Punjab

49725826 bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) (( 3 3 1 lakh (s) )) total quantity : 50

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Erode - Tamil Nadu

49721004 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2598

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Perambalur - Tamil Nadu

49721002 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 2508

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Karur - Tamil Nadu

49720993 bids are invited for micro pcr mtb test kit (q3) ((3 3 )) 2 lakh (s) total quantity : 990

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thanjavur - Tamil Nadu

49720977 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2600

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Dharmapuri - Tamil Nadu

49720938 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 1000

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Tiruchirappalli - Tamil Nadu

49720852 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2000

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Tuticorin - Tamil Nadu

49720743 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 1151

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pudukkottai - Tamil Nadu

49720742 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 1860

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Namakkal - Tamil Nadu

49720736 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 360

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Namakkal - Tamil Nadu

49720710 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 500

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Namakkal - Tamil Nadu

49720707 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 200

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Lucknow - Uttar Pradesh

49720571 bids are invited for qualitative pcr machine (thermal cycler) (q2) ((3 3 )) 4 lakh (s) total quantity : 1

Due Date : Jul 3, 2025

Tender Value :

7 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49720424 bids are invited for one step rt qpcr kit for detection and quantitation of rna , opti mem reduced serum medium. 100 ml , rnai transfection reagent 0.75ml , nmm . n methyl mesoporphyrin ix , pyridostatin hydrochloride greater than98percent.hplc . , c

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bengaluru Urban - Karnataka

49712973 bids are invited for , disease specific real time pcr kits total quantity : 1

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Karnal - Haryana

49712578 bids are invited for real time pcr kits (v2) (q2) mse total quantity : 2400

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - South Andamans - Andaman And Nicobar Islands

49712461 bids are invited for real time pcr kits (v2) (q2) ((3 3 )) 1 lakh (s) total quantity : 100

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - South Andamans - Andaman And Nicobar Islands

49712458 bids are invited for real time pcr kits (v2) (q2) (( 3 3 1 lakh (s) )) total quantity : 200

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - South Andamans - Andaman And Nicobar Islands

49712457 bids are invited for real time pcr kits (v2) (q2) (( 3 3 1 lakh (s) )) total quantity : 100

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - delhi - Delhi

49707503 tender for real time pcr system

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Narmada - Gujarat

49699667 bids are invited for automated real time micro pcr machine (q2) ((3 3 )) 17 lakh (s) total quantity : 3

Due Date : Jul 2, 2025

Tender Value :

33.75 Lakhs

View Notice

Government Departments - Narmada - Gujarat

49697591 bids are invited for automated real time micro pcr machine (q2) ((3 3 )) 16 lakh (s) total quantity : 2

Due Date : Jul 2, 2025

Tender Value :

31 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Ernakulam - Kerala

49697537 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 15 lakh (s) total quantity : 1

Due Date : Jul 2, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kolkata - West Bengal

49694769 tender for develop novel test for pkdl/leprosy diagnosis. project no: inv-048694; collaborator reference no: r8291, department of pharmacology. [cn/146]

Due Date : Jun 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49693556 bids are invited for , real time pcr kits (v2) total quantity : 100

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Karnal - Haryana

49681193 bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) mse total quantity : 960

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jammu - Jammu And Kashmir

49679739 tender for supply of automated viral rna extraction kits

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Delhi - Delhi

49673477 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 10 lakh (s) total quantity : 1

Due Date : Jun 27, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jhajjar - Haryana

49658507 tender for supply, installation, testing and commissioning of multiblock high throughput real time pcr

Due Date : Jul 14, 2025

Tender Value :

20 Lakhs

View Notice

Government Departments - Chennai - Tamil Nadu

49646776 bids are invited for , real time pcr kits (v2) total quantity : 20

Due Date : Jul 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ahmedabad - Gujarat

49645403 bids are invited for automated real time micro pcr machine (q2) ( pac only ) mse total quantity : 180

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - lucknow - Uttar Pradesh

49623180 tender for supply of real time pcr kit

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49622999 bids are invited for l-buthionine-sulfoximine , ferrostatin-1 , mito-trfs , fast- , oligonucleotides pcr primer total quantity : 8

Due Date : Jul 2, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Pondicherry - Puducherry

49610683 supply of evaluation of real-time pcr assay for detection of vancomycin resistant enterococcus species directly from positively flagged blood culture bottle

Due Date : Jun 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

49603844 bids are invited for primers desalted oligonucleotides mse primers dedalted oligonucleotides , tri-glycine sds running , oligonucleotides pcr primer total quantity : 521

Due Date : Jul 2, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

49598715 bids are invited for consumables mse quagen multiplex pcr kit100 cat.no 206143 , dimethyl sulfoxide molecular grade cat.no d8418-50 ml. sigma , primer lis-f 5ataccatgg tta ccc cat tgagc3 , primer lis-r 5agggctcattacatgtggaccc3 , primer 4.2-f 5ggtttac

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - new Delhi - Delhi

49590836 procurement of consumables make m/s qiagen gmbh, germany , 1. therascreen kras rgq pcr kit (24) v1 (cat. no. #874011) 2. qiaamp dna ffpe kit (50) (cat. no. # 56404) 3. qiaamp rna blood mini kit (50) (cat. no. 52304) 4. quanti nova sybr gree

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jamnagar - Gujarat

49585011 bids are invited for covid-19 rtpcr test kit , influenza abh1n1h3n2 multiplex rt-pcr kit , viral transport medium kit , viral , anti - sars cov - 2 / covid - 19 elisa testing kit total quantity : 36960

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

49579662 bids are invited for rt2 first strand kit , rt2 sybr green qpcr mastermix , rt2 , real time pcr kits (v2) total quantity : 4

Due Date : Jul 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhopal - Madhya Pradesh

49573258 Corrigendum : tender for online rate contract tender for supply of covid consumables and kits to various hospitals of government of madhya pradesh for a period of 18 months , consumables items , 0.2 ml pcr tube with attached cap (sterile, rnase/ dnase free, flat-c

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - egmore - Tamil Nadu

49571395 Corrigendum : tender for online tender for fixing rate contract for supply of multiplex rtpcr kits (respiratory panel) to various govt. institutions

Due Date : Jun 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - trombay - Maharashtra

49571045 tender for supply, installation, warranty and training of multiplex, nested pcr filmarray system as per detailed specifications given in annexure -1 (technical specifications)

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Rajouri - Jammu And Kashmir

49568425 bids are invited for naat based pcr test kit (q2) (( 3 3 3 lakh (s) )) total quantity : 150

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Rajouri - Jammu And Kashmir

49568424 bids are invited for micro pcr mtb test kit (q3) (( 3 3 3 lakh (s) )) total quantity : 150

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bengaluru Urban - Karnataka

49568007 bids are invited for , qualitative pcr machine (thermal cycler) total quantity : 2

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jorhat - Assam

49567605 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 5 lakh (s) total quantity : 1

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - delhi - Delhi

49567428 tender for procurement of consumables make ms qiagen gmbh germany

Due Date : Jun 30, 2025

Tender Value :

7.70 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49560365 bids are invited for biorad items mse 4 to 15 percent mini protean tgx precast protein gels, 12 well, 20 microliter biorad 4561085 , 4 to 15 percent mini protean tgx precast protein gels, 15 well, 15 microliter biorad 4561086 , immun blot pvdf membra

Due Date : Jul 1, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jalandhar - Punjab

49547972 bids are invited for right ear cap assy , dynamic microphone , left earcap , automated real time micro pcr machine total quantity : 36

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Gandhinagar - Gujarat

49535350 bids are invited for , automated real time micro pcr machine total quantity : 1

Due Date : Jun 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Lucknow - Uttar Pradesh

49513205 Corrigendum : bids are invited for real time pcr kits (v2) (q2) ((3 3 )) 5 lakh (s) total quantity : 200000

Due Date : Jun 21, 2025

Tender Value :

15.10 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49507519 bids are invited for , micro pcr mtb test kit total quantity : 2

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Solapur - Maharashtra

49502427 bids are invited for , real time pcr machine total quantity : 1

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Gorakhpur - Uttar Pradesh

49494254 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 9 lakh (s) total quantity : 1

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - delhi - Delhi

49470191 tender for procurement of go taq qpcr master mix cat no a6001 make ms promega corporation usa

Due Date : Jun 23, 2025

Tender Value :

1.47 Lakhs

View Notice

Government Departments - Delhi - Delhi

49447571 bids are invited for naat based pcr test kit (q2) ( pac only ) total quantity : 500

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

49447570 bids are invited for micro pcr mtb test kit (q3) ( pac only ) , micro pcr mtb rif dx test kit (q3) ( pac only ) total quantity : 800

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - South Andamans - Andaman And Nicobar Islands

49418516 Corrigendum : bids are invited for customized amc/cmc for pre-owned products - camc of true lab quattro real time quantitative micro pcr analyser; true lab; comprehensive maintenance contract (cmc); half yearly; yes total quantity :

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Samba - Jammu And Kashmir

49415794 bids are invited for real time pcr machine (v2) (q2) total quantity : 1

Due Date : Jun 27, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jammu - Jammu And Kashmir

49375285 Corrigendum : tender for supply of respiratory pathogen panel pcr kit

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jammu - Jammu And Kashmir

49375279 Corrigendum : tender for supply of adenovirus pcr kit

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jammu - Jammu And Kashmir

49375174 Corrigendum : tender for supply of qualitative rt-pcr kits

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jammu - Jammu And Kashmir

49375169 Corrigendum : tender for supply of viral transport medium ,2 viral rna extraction kit, qualitative rt-pcr kits

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - South Andamans - Andaman And Nicobar Islands

49346929 Corrigendum : bids are invited for real time pcr kits (v2) (q2) total quantity : 1

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Dehradun - Uttarakhand

49346858 Corrigendum : bids are invited for automated real time micro pcr machine (q2) total quantity : 30

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Chandigarh - Chandigarh

49298503 Corrigendum : bids are invited for stomacher 400 , real time pcr machine (v2) total quantity : 1

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Gautam Buddha Nagar - Uttar Pradesh

49239193 Corrigendum : bids are invited for thermal cycler , qualitative pcr machine (thermal cycler) total quantity : 2

Due Date : Jun 24, 2025

Tender Value :

10 Lakhs

View Notice

Government Departments - Gautam Buddha Nagar - Uttar Pradesh

49239191 Corrigendum : bids are invited for real time pcr machine (v2) (q2) total quantity : 1

Due Date : Jun 24, 2025

Tender Value :

25 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49157893 Corrigendum : bids are invited for fast sybr green mix, abi code: 4385610 , pcr master mix real time pcr kits (v2) total quantity : 1

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49157885 Corrigendum : bids are invited for vetmax plus one-step rt-pcr kit, abi cat. no: 4415328 , pcr master mix real time pcr kits (v2) total quantity : 2

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

100

Government Departments - Mumbai Suburban - Maharashtra

49157857 Corrigendum : bids are invited for taqman fast universal pcr master mix, abi cat. no: 4352042 , pcr master mix real time pcr kits (v2) total quantity : 2

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Top