Paint Tenders from India

266 Paint tenders are published by various Tendering Authorities & Private companies. 266 live Tender for Paint are available in Paint Tender section You can further filter Paint tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Local Bodies - rajendranagar - Telangana

50028200 tender for acrylic synthetic & colour layer.-1.primer (1 layer):- providing and laying one coat of acrylic primer which makes bond between surface and the resurfacer layers.2.course (1 layer):- providing and laying one coat of acrylic resurfacer blended w

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Mumbai - Maharashtra

50028011 supply of ecofriendly paint for idol makers (murtikars) of ganapati idols on pilot basis for ganesh festival 2025

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Gujarat

50027734 corrigendum : supply of supply, installation and commissioning of airless spray-painting machine.

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50027606 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) (( 3 3 2 lakh (s) )) total quantity : 214

Due Date : Jul 16, 2025

Tender Value :

50000.0

View Notice

Government Departments - Harnaut - Bihar

50026996 supply of paint remover solvent type non flammable is: 430 1972 (re-affirmed 2009).

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - hubbali - Karnataka

50026443 supply of spray gun suitable for high pressure

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

50025480 supply of paint enamel synthetic exterior- post office red finishing(isc no-538), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requireme

Due Date : Jul 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

50021962 bids are invited for chlorinated rubber based primer,chlorinated rubber based finish paint total quantity : 640

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mumbai - Maharashtra

50021915 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) , ready mixed paint, air drying, red oxide - zinc phosphate, priming as per is 12744 (q3) total quantity : 709980

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - udaipur - Rajasthan

50019022 tender for supply of paint material for msrgy (mukhyamantri shehri rojgaar guarantee yojana) work (municipal corporation udaipur) (e_14 / nirman_02) - supply of sandpaper( at nagar nigam msrgy store including loading , unloading , transportation in all re

Due Date : Jul 14, 2025

Tender Value :

30 Lakhs

View Notice

Government Departments - Jhansi - Uttar Pradesh

50017262 bids are invited for pu paint to shade 697 of is: 5 as per spec. tre-165 rev. 01 in packing size of 20 litre,matching th total quantity : 320

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhubaneswar - Odisha

50015853 supply of phiroza blue paint.

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jamshedpur - Jharkhand

50015778 supply of alkyd modified synthetic enamel, uv resistant, high gloss and colour retention, grass gr een (isc no. 218),

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Harnaut - Bihar

50015704 supply of paint black japan ...............

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhopal - Madhya Pradesh

50015673 supply of paint spray gun top feed stainless steel [paint spray gun top feed stainless steel cup including hose coupling as per attached technical specification annexure-a make pilot p-80 or similar.]

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mysore - Karnataka

50015518 corrigendum : supply of paint enamel, synthetic exterior finishing to is: 8662: 2024 with rdso amendment no. 1 (rev.0) for pigment content as an additional requirement to is: 8662-2024. colour shade to ral 070 80 40 (apricot yellow) with additional r

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Alwar - Rajasthan

50011198 bids are invited for fig 11 tin sheet , paint og , paint blue , paint yellow , chuna total quantity : 690

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chandigarh - Chandigarh

50011173 bids are invited for paint deep orange , putty c base , thinner ac antichell , pu paint black , pu paint mint green , epoxy grey paint , thinner for epoxy paints (bhel) total quantity : 118

Due Date : Jul 29, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Amreli - Gujarat

50011144 bids are invited for paint roller 4 inch , paint roller 12 inch , distemper white , paint roller 6 inch , paint brush 4 inch , paint roller 7 inch 177 8 mm c w artificial fur and handle , paint roller 9 inch , spray hand liquid insecticide , paint br

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Belgaum - Karnataka

50010722 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) , geru red ochre (q4) total quantity : 825

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jhansi - Uttar Pradesh

50010519 bids are invited for epoxy orange brown paint - refer attached document for detailed reference , epoxy light biscuit paint - refer attached document for detailed reference , epoxy yellow golden paint - refer attached document for detailed reference ,

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jhansi - Uttar Pradesh

50009626 supply of paint enamel synthetic exterior signal red finishing to is : 8662/2004 with additional requirements to spec icf/md/spec-045,issue status 02 revision 03

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Chamba - Himachal Pradesh

50008459 tender for supply of rod, gi sheet, tiles, angle, pvc pipe, cement,brick,gravel, ceiling sheet, electrical wiring items, jcb cutting, sanitary hardware, paint.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mancheswar - Odisha

50008435 supply of exterior paint finishing - grass green (isc no.218), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requirements of icf/md/spec-

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

50007353 bids are invited for paint readymixed air drying white semiglossy finish for generalpurpose brushing to specn. is: 168-1993 paint ready mixed air drying white semiglossy finish for , paint ready mixed air drying white total quantity : 830

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

50007280 bids are invited for bs2x34 light grey gloss , bs381c-103 , electrical insulating paint total quantity : 60

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025

Tender Value :

38 Lakhs

View Notice

Government Departments - ajmer - Rajasthan

50006895 supply of paint ready mixed white finish to is:13607/1992 with amndt. 2, packing in 20 litres non returnable new ms drum.

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50003709 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) (( 3 3 2 lakh (s) )) total quantity : 214

Due Date : Jul 16, 2025

Tender Value :

50000.0

View Notice

Statutory Bodies & Commissions/Committees - Rajauri - Jammu And Kashmir

50002327 bids are invited for synthetic enamel paint ist quality white colour,synthetic enamel paint ist quality black colour,syn total quantity : 431

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jhansi - Uttar Pradesh

50002294 bids are invited for paint finishing matt rfu air drying sand , paint rfu syn spr white , paint rfu green for armoured vehicles , paint air dry br spr syn ena dark grey , paint rfu blue for armoured vehicles , zink paste for armoured vehicles , paint

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

50002092 bids are invited for paint red , paint black , paint white , paint blue , paint yellow , terracotta , lime , geru total quantity : 21700

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Palghar - Maharashtra

50001719 bids are invited for intrguard 263 faj 034 a light grey , interguard 403 red aluminium , interthane 990 signal green phl 549a , interguard 262 red kha 304a , intertuf 262 kha 303a red as a tie coat , interswift 6800 black , interswift 6800 hs bma 684

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

50001316 bids are invited for paint signal red , paint navy blue , paint rfu finishing exterior synthetic dark grey , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 80

Due Date : Jul 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Chhattisgarh

49999611 wooden court and artistic paint in indoor hall at distirct sports complex,seepat road,bilaspur c.g

Due Date : Jul 16, 2025

Tender Value :

22.31 Lakhs

View Notice

Cooperative - baghpat - Uttar Pradesh

49999460 tender for supply of industrial and decorative burger/universal make paints for year, 2025-26 supply of industrial and decorative burger/universal make paints for year, 2025-26 , synthetic enamelled smoke gray , bus green , black , azure blue , golden yel

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - mumbai - Maharashtra

49998331 tender for supply of eco-friendly paint for idol makers (murtikars) of ganapati idols on pilot basis for ganesh festival 2025 tender id 2025_mcgm_1197133_1

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - gwalior - Madhya Pradesh

49994802 supply of ready mixed paint

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kalyan - Maharashtra

49992769 supply of spray paint aerosol can

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989769 supply of pu paint black (two packs)

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989682 supply of pu paint pale cream

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Valsad - Gujarat

49989541 supply of pu paint signal white ral-9003 as per rdso

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989529 supply of pu post office red paint

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989393 supply of pu white paint to ral-9010

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kharagpur - West Bengal

49989379 supply of paint gentian blue (ral-5010) pu based. matl.& specn : rdso specification no. m&c pc n/109/2020 with amendment no. 1b (rev. 2.0) as an additional requirement.

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - cuttack - Odisha

49988501 supply of paint red oxide zinc chrome primer, to drawing / specification is:2074/(part-1)/2015, along with icf spec. icf/m/d spec.045, issue status 02, rev.03 dated 14.06.2007 and rdso amendment no. 1a as an additional requirement.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

49988442 supply of paint enamel synthetic exterior - white finishing, to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requirements of icf/md/spec-04

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - raiwala - Uttarakhand

49988056 tender for periodical services in zone a under age (i) raiwala

Due Date : Jul 26, 2025

Tender Value :

10 Lakhs

View Notice

Government Departments - Chamoli - Uttarakhand

49986101 bids are invited for supply of paints & primer to vishnugad project in , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 1

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Amritsar - Punjab

49985833 bids are invited for paint - duco paint olive green , paint - duco paint black , paint - duco paint red oxide metal primer , paint - duco thinner , paint - asian bus green , paint - asian black , paint - asian paint golden brown , paint - asian paint

Due Date : Jul 22, 2025

Tender Value :

5 Lakhs

View Notice

Government Departments - Visakhapatnam - Andhra Pradesh

49985503 bids are invited for steel polish liquid , acrylic liquid , glossy polish , shoe polish liquid as per is 12010 total quantity : 930

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kanpur - Uttar Pradesh

49984044 tender for paint supply and application of paint on chimney shell, construction of cems room, external platforms, effluent tank and other miscellaneous civil works in chimney

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

49982256 bids are invited for paint rfu finishing stoving amnsc finish spraying , ready mixed paint, finishing, interior for general purposes - is 3537 total quantity : 1383

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - GARHARA - Bihar

49981704 supply of paint enamel synthetic exterior finishing signal red.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bilaspur - Uttar Pradesh

49981475 tender for supply of industrial and decorative paints for season 2025-26 - supply of industrial and decorative paints 2 primmer (red oxide) 3 thinner 4 aluminium (paste+ thinner) 5 black head resistance paint 6 bus green 7 post office red 8

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Cooperative - Palakkad - Kerala

49978546 tender for construction of a partitioning room in fpg for storage of milmamin packets and ksheeravardhini buckets

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jagadhri - Haryana

49974589 supply of synthetic enamel finish coat shade

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Harnaut - Bihar

49974515 supply of paint enamel synthetic golden yellow.........

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Medinipur East - West Bengal

49973750 bids are invited for interthane 990 grey light grey , turpentine oil solvent , paint signal red , paint red oxide , paint yellow zinc chromate , paint golden yellow , paint dark grey , paint black enamel , paint azure blue , distemper white total qua

Due Date : Jul 14, 2025

Tender Value :

1.83 Lakhs

View Notice

Government Departments - Mancheswar - Odisha

49972314 supply of paint synthetic enamel brushing exterior, signal red finishing (isc no-537), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requ

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jaipur - Rajasthan

49971509 tender for supply of colour paint roller blind with motor & remote, glass fixing etc

Due Date : Jul 8, 2025

Tender Value :

2 Lakhs

View Notice

Government Departments - secUNDERABAD - Telangana

49971216 supply of insulation paint-42kv high insulation paint for insulation purpose. as per rdso specification-ti0lko/78/2020. :make:- insulect sk-03/ casewell or similar

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ponmalai - Tamil Nadu

49969046 supply of paint enamel synthetic exterior

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - ajmer - Rajasthan

49966627 supply of pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/2018 & amendment no. 1b as an additional requirement . colour shade cream ral 9001.

Due Date : Sep 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jabalpur - Madhya Pradesh

49965972 bids are invited for paint ready mixed ammunation stoving semi-glossy , ready mixed paint, finishing, interior for general total quantity : 553

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Rupnagar - Punjab

49965856 bids are invited for washable distemper-is:428 (q3) , white cement based polymeric putty as per is 17545 (q3) , bitumen primer for use in waterproofing and damp - proofing as per is 3384 (q3) mse total quantity : 55

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Indore - Madhya Pradesh

49965580 bids are invited for ready mixed paint, air drying, red oxide zinc chrome, priming (v2) as per is 2074 (q3) , emery cloth (q3) mse total quantity : 135

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jodhpur - Rajasthan

49964859 supply of paint enamel synthetic exterior brushing undercoat colour blood red/maroon ral shade card no. 0303045 to is -8662/2024 , with additional requirements stipulated in icf spec. icf/md/spec.-045, status 02 rev.-03

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhavnagar - Gujarat

49964021 supply of paint alluminium

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pithoragarh - Uttarakhand

49963016 bids are invited for supply of 3d printed reinforced concrete panels along with steel lintels - supply of 3d printed reinforced concrete panels along with steel lintels as per specifications and drawings mentioned in technical specification document

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chennai - Tamil Nadu

49963013 bids are invited for interthane 990 (phb 000pha 046) white , paint interguard , marine paints total quantity : 180

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jalgaon - Maharashtra

49963010 bids are invited for , washable distemper-is:428 total quantity : 1000

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962939 bids are invited for epoxy based anti corr paint for application in ballast tank(n8010-p009679) , intumescent fire retardant paint(n8010-p009745) , penguard , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 293

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962905 bids are invited for paint, rfu, priming aluminium, water resistant, brushingspray(n8010-000114) , varnish black japan(n8010-000270) , epoxy red oxide primer(n8010- 001009) , paint rfu finishing gen. ser. synth. semi , epoxy grout total quantity : 39

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962900 bids are invited for paint non slip epoxy d. a grey with hardner (n8010- , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 24060

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - delhi - Delhi

49960310 tender for misc civil repair work in qtr no. 713 at p and t colony rk puram.

Due Date : Jul 8, 2025

Tender Value :

2.95 Lakhs

View Notice

Government Departments - kagithapuram - Tamil Nadu

49959797 tender for reconditioning of black liquor spray gun at recovery boiler 3 in srp - mechanical at tnpl unit-i

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

49955108 supply of (for vande bharat trainset) supply of pr [(for vande bharat trainset) supply of primer for vb coaches (suitable between 5 to 48 deg.celcius temp) in packing of 1000ml make brand sika primer 210 of m/s sika or teroson pu 8517h of m/s henkel

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Prayagraj - Uttar Pradesh

49954272 bids are invited for h1 a8010-007494 paint rfu fin syn ena br spr gold yellow - paint rfu fin syn ena br/spr gold yellow , g1 5340-003617 seals metallic lead 10mm - seals metallic lead 10mm , g2 9520-000004 steel angles 30x30x3 mm - steel angles 30x3

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

49952607 bids are invited for r600159200 - epoxy primer , r605111408 - hardener for epoxy primer , r600136700 - epoxy thinner for primer , r605159500 - pu finish paint , r605111410 - hardener for finish paint , r605112800 - polyurethane thinner , r608009000 -

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Tiruchirappalli - Tamil Nadu

49952478 bids are invited for spray guns for painting type 64m with 0.34 ltr with , paint spray gun total quantity : 20

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Durg - Chhattisgarh

49952462 bids are invited for yellow paint 4 letre pack , red paint 4 letre pack , smoke grey paint 4 letre pack , black paint 4 letre pack , aluminium paint 4 letre pack , blue paint 4 letre pack , red oxide primer 20 letre pack total quantity : 24

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Vijayawada - Andhra Pradesh

49950790 supply of 1) salmon pink paint isc-443 to is :8662/2001 or latest. & 2) sky blue paint isc-101 to is:8662/2004 or latest.

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

49949919 bids are invited for paint white , paint gray , paint red , paint epoxy , paint black , paint yellow , paint blue , mek , glycerin , window shield was liquid , teflon tape , paint remover , araldite , corrosion prevention spray , white sprit , thinne

Due Date : Jul 9, 2025

Tender Value :

80240.0

View Notice

Boards / Undertakings / PSU - Rampur - Uttar Pradesh

49949656 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing , gum spirit of turpentine oil as per is 533 total quantity : 9213

Due Date : Jul 16, 2025

Tender Value :

44.10 Lakhs

View Notice

Government Departments - lucknow - Uttar Pradesh

49947341 supply of enamel synthetic, exterior, finishing, middle brunswick green

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Parel - Maharashtra

49947222 supply and application of paint with fleet graphic film for all types of lhb coaches at loco workshop, parel

Due Date : Jul 22, 2025

Tender Value :

4.13 Crore

View Notice

Government Departments - kolkata - West Bengal

49947188 supply of polypropylene blue - monofilament 7/0 etc.

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Pune - Maharashtra

49946615 tender for purchase of paint and paint material for pmc vehicles , synthetic enamel golden yellow 1st quality , 4 litre pack , 20 litre pack , black japan (chota jawan) 20 ltr , synthetic enamel black 1st quality4 ltr pack , synthetic enamel white 1st qua

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - malda - West Bengal

49946403 supply of supply of paint.

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - lallaguda - Telangana

49946380 supply of paint enamel smoke grey

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - narela - Delhi

49941247 tender for m/o completed scheme under narela zone.

Due Date : Jul 9, 2025

Tender Value :

38.54 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Porbandar - Gujarat

49937328 bids are invited for , marine paints total quantity : 40

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - perambur - Tamil Nadu

49935113 supply of paint.

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhopal - Madhya Pradesh

49934861 supply of black japan paint type b packing in 20 liters new non-returnable m.s. drum to is specn. no. 341/2016 second revision.

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Cuddapath - Andhra Pradesh

49934089 bids are invited for synthetic enamel signal red paint - synthetic enamel signal red paint conforming to is 29322003 of signal red colour , synthetic enamel oxford blue paint - synthetic enamel oxford blue paint conforming to is 29322003 of oxford bl

Due Date : Jul 15, 2025

Tender Value :

1.68 Crore

View Notice

Government Departments - bhavnagar - Gujarat

49932397 supply of r/m paint synthetic enamel, exterior.

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bikaner - Rajasthan

49930111 supply of gum astringent paint

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhopal - Madhya Pradesh

49927773 supply of paint ready mixed brushing zinc chrome primer to is: 104/1979, packing in 20 ltrs new non returnable m.s drum to is: 2552/89 gr.b-h.

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

100

Government Departments - Raisen - Madhya Pradesh

49927511 tender for supply of materials, distemper, paint, oil, exterior emulsion, cement primer, profile gi sheet, vitrified tiles.

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Top