Laboratory Item Tenders from India

90 Laboratory Item tenders are published by various Tendering Authorities & Private companies. 90 live Tender for Laboratory Item are available in Laboratory Item Tender section You can further filter Laboratory Item tenders by Tender Value, Tender Submission Date or Project Location.

1

Army Public School - Punjab

29558607 purchase of items for geog lab.

Due Date : Oct 26, 2021
Tender Value : Ref. Document
GeM Tender
2

Kendriya Vidyalaya Sangathan - Tamil Nadu

29558329 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools total quantity : 1

Due Date : Oct 29, 2021
Tender Value : Ref. Document
GeM Tender
3

Kendriya Vidyalaya Sangathan - Tamil Nadu

29558295 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment total quantity : 1

Due Date : Oct 25, 2021
Tender Value : Ref. Document
4

North Western Railway - Rajasthan

29557707 supply of procurement ofprocurement of,procurement of "sterile connecting device with all standard accessories" detailed specification document 60215074 attached. , camc for two years after completion of 5 year warranty period. warranty period: 5 years, a

Due Date : Nov 2, 2021
Tender Value : Ref. Document
5

Department Of Atomic Energy - Jammu And Kashmir

29557618 supply of laboratory type freeze drier

Due Date : Nov 15, 2021
Tender Value : Ref. Document
6

Indian Council Of Medical Research - Uttar Pradesh

29557185 supply of chemicals / glassware / reagents and other laboratory item ( s ) , - ( a ) molecular biology chemicals / routine chemicals & reagents / kits ( b ) glassware items ( c ) plastic ware items ( d ) filter paper / needles ( e ) dna

Due Date : Nov 5, 2021
Tender Value : rupee 10 Lakhs
GeM Tender
7

National Institution for Transforming India Aayog - Tamil Nadu

29557150 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools (pac only ) total quantity : 1

Due Date : Oct 22, 2021
Tender Value : Ref. Document
GeM Tender
8

National Institution for Transforming India Aayog - Tamil Nadu

29557022 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 22, 2021
Tender Value : Ref. Document
GeM Tender
9

National Institution for Transforming India Aayog - Tamil Nadu

29551678 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 22, 2021
Tender Value : Ref. Document
10

Department Of Medical Education - Rajasthan

29549262 supply of laboratory consumables 1 laboratory consumables 2 micropipette tips filtered, sterile, sterile, rnase/dnase 3 a. 20 ul(10x96) 4 b. 100ul (10x96) 5 c. 200ul(10x96) 6 d. 1000ul(10x96) 7 eppendorf tubes-rnase\dnase free. free pyrogen free (

Due Date : Nov 1, 2021
Tender Value : rupee 20 Lakhs
11

National Thermal Power Corporation Limited - Chhattisgarh

29547811 construction of co analyzers for ntpc stage ii korba co analyzers for ntpc stage ii korba , co analyser;0-1000ppm / 0-500ppm / 0-200ppm , supervision of erection and commissionin

Due Date : Nov 10, 2021
Tender Value : Ref. Document
GeM Tender
12

Department of School Education - Andhra Pradesh

29537760 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1--arduino mega or equipment , raspberry pi 3 mode b+ , general p

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
13

Department of School Education - Andhra Pradesh

29537746 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment ( paconly ) total quantity : 1--glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adapto

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
14

Department of School Education - Telangana

29537740 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
15

Department of School Education - Andhra Pradesh

29537737 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1--arduino mega or equipment , raspberry pi 3 mode b+ , general p

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
16

National Institution for Transforming India Aayog - Karnataka

29537441 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment ( paconly ) total quantity : 1--glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb ho

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
17

National Institution for Transforming India Aayog - Maharashtra

29537195 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1--arduino mega or equipment , raspberry pi 3 mode b+ , general purpose solderable bo

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
18

National Institution for Transforming India Aayog - Karnataka

29537139 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1--3 d printer kit and tools, dedicated ups / power back up, filament storage box, , set of arts and crafts accessor

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
19

National Institution for Transforming India Aayog - Tamil Nadu

29536825 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1--3 d printer kit and tools, dedicated ups /power back up, filament storage box, , set of arts and crafts accessories - e.g stat

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
20

National Institution for Transforming India Aayog - Rajasthan

29536799 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools ( pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
21

National Institution for Transforming India Aayog - Tamil Nadu

29536793 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1--arduino mega or equipment , raspberry pi 3 mode b+ , general purpose soldera

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
22

National Institution for Transforming India Aayog - Karnataka

29530220 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
23

Jawahar Navodaya Vidyalaya - Tripura

29530204 authorized registered deler/manufacturer firm/ suppliers for supply if mess wet ration, mess non veg items, sweet and confectionery, uniform stitching, daily use and cleaning items, medicene items, sports items, laboratory item, m and r items, furniture a

Due Date : Nov 1, 2021
Tender Value : Ref. Document
GeM Tender
24

Department of School Education - Andhra Pradesh

29530182 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
25

National Institution for Transforming India Aayog - Gujarat

29530048 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
26

National Institution for Transforming India Aayog - Chhattisgarh

29529757 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
27

National Institution for Transforming India Aayog - Tamil Nadu

29529745 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
28

Department of School Education - Andhra Pradesh

29529562 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment ( paconly ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
29

Department of School Education - Andhra Pradesh

29529457 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools (pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
30

National Institution for Transforming India Aayog - Tamil Nadu

29529441 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment ( paconly ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
31

National Institution for Transforming India Aayog - Gujarat

29529066 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
32

National Institution for Transforming India Aayog - Tamil Nadu

29528878 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools (pac only ) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
33

National Institution for Transforming India Aayog - Tamil Nadu

29528812 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
34

Technical Education and Training Department - West Bengal

29528158 e-tender for procurement of equipments, instruments, machineries, tools etc. related to laboratories and workshops of physics, chemistry, civil engineering, of darjeeling polytechnic, kurseong, dist. darjeeling, 734203 e-tender for procu

Due Date : Nov 3, 2021
Tender Value : Ref. Document
GeM Tender
35

National Institution for Transforming India Aayog - Gujarat

29527696 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 20, 2021
Tender Value : Ref. Document
36

Madhya Pradesh Police Department - Madhya Pradesh

29527328 supply of forensic science laboratory items , genetic analyzer with all accessories , pcr machine , real time -pcr machine withaccessories , table top refrigerated high speed centrifuges , table top refrigerated centrifuges , table top refrig

Due Date : Nov 15, 2021
Tender Value : Ref. Document
GeM Tender
37

Department of School Education - Jammu And Kashmir

29517891 bids are invited for mobile science lab - mobile science lab total quantity : 1

Due Date : Oct 28, 2021
Tender Value : rupee 1 Crore
GeM Tender
38

National Institution for Transforming India Aayog - Gujarat

29507393 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools ( pac only ) total quantity : 1--hacksaw frame , hacksaw blades, mini hacksaw blades, pliers 4.5 inch size, tweezer set , ball pein

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
39

National Institution for Transforming India Aayog - Gujarat

29507355 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
40

National Institution for Transforming India Aayog - Karnataka

29507276 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools (pac only ) total quantity : 1--hacksaw frame , hacksaw blades, mini hacksaw blades, pliers 4.5 inch size, tweezer set , ball pein hamme

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
41

National Institution for Transforming India Aayog - Gujarat

29507215 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment ( paconly ) total quantity : 1--glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bul

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
42

National Institution for Transforming India Aayog - Gujarat

29507205 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
43

National Institution for Transforming India Aayog - Tamil Nadu

29507161 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment total quantity : 1-glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electric

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
44

National Institution for Transforming India Aayog - Tamil Nadu

29507157 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors total quantity : 1

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
45

National Institution for Transforming India Aayog - Tamil Nadu

29507123 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools total quantity : 1-hacksaw frame , hacksaw blades, mini hacksaw blades, pliers 4.5 inch size, tweezer set , ball pein hammer, c-clamp,

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
46

National Institution for Transforming India Aayog - Tamil Nadu

29507081 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools total quantity : 1

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
47

National Institution for Transforming India Aayog - Rajasthan

29506161 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment total quantity : 1--glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb holders , electri

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
48

National Institution for Transforming India Aayog - Rajasthan

29505562 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools total quantity : 1

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
49

National Institution for Transforming India Aayog - Karnataka

29505330 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
50

National Institution for Transforming India Aayog - Karnataka

29505236 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment ( paconly ) total quantity : 1--glue sticks , nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb ho

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
51

National Institution for Transforming India Aayog - Gujarat

29505178 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 19, 2021
Tender Value : Ref. Document
GeM Tender
52

National Institution for Transforming India Aayog - Gujarat

29505175 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1--3 d printer kit and tools, dedicated ups / power back up, filament storage box, , set of arts and crafts accessories

Due Date : Oct 19, 2021
Tender Value : Ref. Document
53

Department Of Animal Husbandry - Kerala

29489619 primers for molecular biology purchase of primers for molecular biology , - primers , lepltospirosis 1(lipl32-45f)5′ aag cat tac cgc ttg tgg tg 3′ , leptospirosis 2( lipl32-286r)5′ gaa ctc cca ttt cag cga tt 3′ , leptospirosis 3 (lipl32-189p)fam-5′ aa ag

Due Date : Oct 28, 2021
Tender Value : rupee 3.50 Lakhs
54

Dr. Balasaheb Sawant Konkan Krishi Vidyapeeth - Maharashtra

29480483 quotations for soxhlet apparatus and complete accessories

Due Date : Oct 20, 2021
Tender Value : Ref. Document
GeM Tender
55

Department Of Atomic Energy - Rajasthan

29479500 bids are invited for laboratory beakers-is:2619 total quantity : 50

Due Date : Oct 29, 2021
Tender Value : rupee 4000
56

Nagar Palika Nigam - Madhya Pradesh

29470366 e-tender of shops in atal shopping complex of nagar palika parishad khurai , shop no.45 in first floor ( ur )

Due Date : Nov 8, 2021
Tender Value : rupee 32.68 Lakhs
57

Nagar Palika Nigam - Madhya Pradesh

29470349 e-tender of shops in atal shopping complex of nagar palika parishad khurai , shop no.35 in first floor ( ur )

Due Date : Nov 8, 2021
Tender Value : rupee 24.23 Lakhs
58

Nagar Palika Nigam - Madhya Pradesh

29470344 e-tender of shops in atal shopping complex of nagar palika parishad khurai

Due Date : Nov 8, 2021
Tender Value : rupee 15.57 Lakhs
59

Nagar Palika Nigam - Madhya Pradesh

29470338 e-tender of shops in atal shopping complex of nagar palika parishad khurai , shop no.47 in first floor ( ur )

Due Date : Nov 8, 2021
Tender Value : rupee 24.14 Lakhs
60

Nagar Palika Nigam - Madhya Pradesh

29470335 e-tender of shops in atal shopping complex of nagar palika parishad khurai , shop no.34 in ground floor ( ur )

Due Date : Nov 8, 2021
Tender Value : rupee 27.38 Lakhs
GeM Tender
61

National Institution for Transforming India Aayog - Orissa

29470327 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1---3 d printer kit and tools, dedicated ups / power back up , filament for 3d printer , set of arts and crafts accessori

Due Date : Oct 19, 2021
Tender Value : Ref. Document
62

Nagar Palika Nigam - Madhya Pradesh

29470321 , e-tender of shops in atal shopping complex of nagar palika parishad khurai , shop no.33 in ground floor ( ur )

Due Date : Nov 8, 2021
Tender Value : rupee 28.29 Lakhs
GeM Tender
63

National Institution for Transforming India Aayog - Orissa

29470161 bids are invited for package no. 4 - atal tinkering lab of niti aayog power supply and accessories and safety equipment ( paconly ) total quantity : 1--glue sticks, nuts and bolts and screw, cable tie, sand paper, power strip adaptors, bulb h

Due Date : Oct 19, 2021
Tender Value : Ref. Document
64

Jawahar Navodaya Vidyalaya - Assam

29469461 supply of various store items like bedding, daily used items, grocery items, vegetable, non-veg items(fresh items), sweets & bakery items, stationeries, sports items, laboratory items, building materials, electrical items, uniform stitching, medicine e

Due Date : Oct 20, 2021
Tender Value : Ref. Document
65

Jawahar Navodaya Vidyalaya - Orissa

29466329 supply of rice, hostel equipments, furniture, band and music items audio visual aids students and computer stationeries and office stationeries laboratory items

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
66

Ministry Of Petroleum And Natural Gas - Maharashtra

29464583 bids are invited for water double distillation unit ongc total quantity : 2

Due Date : Oct 28, 2021
Tender Value : Ref. Document
GeM Tender
67

Department Of Education - Chandigarh

29457529 bids are invited for rotary shaker total quantity : 1

Due Date : Oct 26, 2021
Tender Value : Ref. Document
68

College Of Agriculture - Tripura

29449695 purchase of laboratory items under ipm in rice and horticulture crop in neh region

Due Date : Oct 25, 2021
Tender Value : Ref. Document
69

Naya Raipur Development Authority - Chhattisgarh

29447834 selection of a facility management services provider for paryavas bhawan (composite building) integrated command and control centre buildings its campus at sector-19, nava raipur atal nagar dist. raipur (c.g.)

Due Date : Oct 20, 2021
Tender Value : Ref. Document
70

Jawahar Navodaya Vidyalaya - Sikkim

29438641 tender for supply of grocery items, daily used items, uniform and bedding items, furniture, bakery and confectionery office and students stationeries sports items, ncc, scout and guide, laboratory items, hardware, plumbing and electrical items.

Due Date : Oct 22, 2021
Tender Value : Ref. Document
GeM Tender
71

Indian Oil Corporation Limited - Haryana

29424636 bids are invited for potentiometric titration system for tan & tbn with auto sampler total quantity : 1

Due Date : Oct 25, 2021
Tender Value : Ref. Document
72

Indian Institute Of Technology - Chhattisgarh

29421345 supply of dna oligomer sequence at iit bhilai supply of dna oligomer sequence at iit bhilai , str1 [amc12]aatgctcttagatgctagtat , str2 [amc12]ctaagagcattatactagcat

Due Date : Oct 20, 2021
Tender Value : Ref. Document
73

Department Of Agriculture - Rajasthan

29389261 rate contract for supply of laboratory items from distributors / dealers / suppliers for use in “government pesticide residue testing laboratory, durgapura, jaipur under department of agriculture, government of rajasthan crms ( certified refer

Due Date : Oct 21, 2021
Tender Value : rupee 16.78 Lakhs
GeM Tender
74

Home Department - Bihar

29388562 bids are invited for mobile forensic tools (hw+ sw) total quantity : 1

Due Date : Oct 21, 2021
Tender Value : Ref. Document
GeM Tender
75

National Institution for Transforming India Aayog - Tamil Nadu

29384294 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 30, 2021
Tender Value : Ref. Document
76

Department Of Agriculture - Rajasthan

29379911 supply of laboratory items from manufacturers or their authorised distributors dealers suppliers for use in government pesticide residue testing laboratory durgapura jaipur under department of agriculture gor , group a crms ( certified reference mater

Due Date : Oct 21, 2021
Tender Value : rupee 16.78 Lakhs
77

Birla Institute Of Technology - Jharkhand

29341487 supply and installation of automated flash chromatography system with uv and els detection in bit mesra, ranchi

Due Date : Oct 21, 2021
Tender Value : Ref. Document
78

Central Institute Of Tool Design - Telangana

29330325 supply installation and commissioning of virtual reality vr lab setup supply installation and commissioning of virtual reality vr lab setup ,

Due Date : Oct 20, 2021
Tender Value : Ref. Document
79

Jawahar Navodaya Vidyalaya - Uttaranchal

29310088 supply of food items, vegetable, fruits, stationary, electrical and plumbing items, white washing and painting of building, repair of building, maintenance of computer, computer peripherals, sports items, bakery items, bakery items, uniform items, uniform

Due Date : Oct 23, 2021
Tender Value : Ref. Document
GeM Tender
80

Ministry Of Labour And Employment - Karnataka

29309688 bids are invited for skill lab set-up total quantity : 1

Due Date : Oct 25, 2021
Tender Value : Ref. Document
GeM Tender
81

National Institution for Transforming India Aayog - Tamil Nadu

29293191 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 30, 2021
Tender Value : Ref. Document
GeM Tender
82

National Institution for Transforming India Aayog - Tamil Nadu

29259075 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 30, 2021
Tender Value : Ref. Document
GeM Tender
83

National Institution for Transforming India Aayog - Tamil Nadu

29258922 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools ( pac only ) total quantity : 1

Due Date : Oct 30, 2021
Tender Value : Ref. Document
84

Rail Coach Factory - Punjab

29242737 supply of biological indicating roll

Due Date : Nov 12, 2021
Tender Value : Ref. Document
GeM Tender
85

National Institution for Transforming India Aayog - Tamil Nadu

29231830 bids are invited for package no.2: atal tinkering lab of niti aayog rapid prototyping tools ( pac only ) total quantity : 1

Due Date : Oct 30, 2021
Tender Value : Ref. Document
GeM Tender
86

National Institution for Transforming India Aayog - Tamil Nadu

28665977 bids are invited for package no.3 atal tinkering lab of niti aayog mechanical, electrical and measurement tools (pac only ) total quantity : 1

Due Date : Oct 22, 2021
Tender Value : Ref. Document
GeM Tender
87

National Institution for Transforming India Aayog - Tamil Nadu

28665895 bids are invited for package no. - atal tinkering lab of niti aayog electronics development, robotics, internet ofthings and sensors ( pac only ) total quantity : 1

Due Date : Oct 22, 2021
Tender Value : Ref. Document
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2021 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail