Kits Tenders from India

26 Kits tenders are published by various Tendering Authorities & Private companies. 26 live Tender for Kits are available in Kits Tender section You can further filter Kits tenders by Tender Value, Tender Submission Date or Project Location.

1

Government Departments - Thiruvananthapuram - Kerala

50010025 bids are invited for human identification - dna kit autosomal str (forensic use) (q3) total quantity : 40

Due Date : Jul 15, 2025
Tender Value : rupee 32 Lakhs
View Notice
2

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025
Tender Value : rupee 38 Lakhs
View Notice
3

Boards / Undertakings / PSU - Amritsar - Punjab

49989705 tender for quick-rna miniprep plus kit (200 preps) w/zymo-spin iiicg columns (capped) & spin-away filters cat. no. r1058-qty 01, zymobiomics dna miniprep kit (50 preps) cat. no. d4300 - qty 04

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
4

Government Departments - Amreli - Gujarat

49987414 bids are invited for plasmid kits (q3) ((3 3 )) 2 lakh (s) total quantity : 1

Due Date : Jul 25, 2025
Tender Value : Ref. Document
View Notice
5

Government Departments - South Andamans - Andaman And Nicobar Islands

49985523 bids are invited for forensic dna extraction kit (q3) ( pac only ) ((3 3 )) 1 lakh (s) total quantity : 3

Due Date : Jul 14, 2025
Tender Value : Ref. Document
View Notice
6

Government Departments - kolkata - West Bengal

49964546 tender for adenovirus rt-pcr kit. (100 reaction) along with dna extraction kit. (100 reaction)

Due Date : Jul 15, 2025
Tender Value : Ref. Document
View Notice
7

Government Departments - Mumbai - Maharashtra

49954375 bids are invited for bdt v3 1 rr-100 , pop7-3730 by 3730xl dna analyzers , genescan tm 500 liz dye size standard 800 rnxs , hidi formamide 25ml , tube-5x seq buffer small total quantity : 5

Due Date : Jul 24, 2025
Tender Value : Ref. Document
View Notice
8

Local Bodies - Mahendragarh - Haryana

49949959 bids are invited for title2 - cuvette , title3 - resazurin sodium , title5 - alamarblue hs cell viability reagents , title6 - dimethyl sulphoxide , title7 - carbinol hplc , title8 - mtt , title9 - 96 well plate , title10 - todd hewitt broth , title11

Due Date : Jul 23, 2025
Tender Value : Ref. Document
View Notice
9

Government Departments - Asansol - West Bengal

49908558 supply of supply of earth tester ...etc

Due Date : Jul 22, 2025
Tender Value : Ref. Document
View Notice
10

Local Bodies - Balaghat - Madhya Pradesh

49876860 bids are invited for abbes refractometer , binocular microscope with led isi mark , bod incubatordigital , cro 30mhzdual channel2 trac , digital hb meter , digital tds meter table model , digital turbidity meter , dissecting microscope , e m by thoms

Due Date : Jul 12, 2025
Tender Value : Ref. Document
View Notice
11

Government Departments - Ratlam - Madhya Pradesh

49869347 supply of analog earth tester hand operated type

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
12

Government Departments - Khordha - Odisha

49861273 bids are invited for genejet viral rna dna purification kit 50 prep , genomic dna purification kit 100 prep , revertaid h minus first strand cdna synthesis kit , top vision agarose 100 gm , proteinase k recombinant pcr grade 1 ml , water nuclease fre

Due Date : Jul 17, 2025
Tender Value : rupee 5.39 Lakhs
View Notice
13

Government Departments - Mumbai Suburban - Maharashtra

49860786 bids are invited for addgene lenticrispr v2 - addgene lenticrispr v2 plasmid52961 as bacterial stab , addgene lenticas9 blast - addgene lenticas9 blast plasmid 52962 as bacterial stab , addgene lentiguide puro - addgene lentiguide puro plasmid 52963

Due Date : Jul 17, 2025
Tender Value : Ref. Document
View Notice
14

Government Departments - Mumbai - Maharashtra

49853070 bids are invited for t4 dna ligase 500 units cat no 15224 025 a , ia019 10 alkaline stabilized recombinant protein a , t4 dna ligase 500 units cat no 15224 025 b , t4 dna ligase 500 units cat no 15224 025 c , t4 dna ligase 500 units cat no 15224 025

Due Date : Jul 18, 2025
Tender Value : Ref. Document
View Notice
15

Government Departments - Mumbai Suburban - Maharashtra

49838577 bids are invited for antibody_1 , antibody_2 , antibody_3 , reagent , antibody_4 - anti-phospho rpa32 (s33) antibody, affinity purified as per item 5 of specification , antibody_5 - monoclonal anti-rpa2 antibody produced in mouse as per item 6 of spe

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
16

Government Departments - Khordha - Odisha

49829176 bids are invited for nucleospin plasmid 250 rxn1 - nucleospin plasmid 250 rxn 1 , tb green advantage qpcr premix 200 rxns , advantage 2 pcr kit 100 rxns , solid baffle for larvae for 1l 5ml , breeding tank , nucleospin gel and pcr clean up 250 rxn 1

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
17

Government Departments - Sheikhpura - Bihar

49815468 tender for rate contract and supply of medical devices/consumables for different healthcare facilities of state of bihar

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
18

Boards / Undertakings / PSU - Multi State

49808499 tender for selection of technically competent bidders to develop and implement the technology for processing of monazite rich tailings / residue to obtain the mixed rare earth (re)compounds and separation of rare earth elements (rees) like neodymium (nd),

Due Date : Jul 10, 2025
Tender Value : Ref. Document
View Notice
19

Government Departments - birbhum - West Bengal

49787633 tender for supply of tools and equipment for vtc

Due Date : Jul 12, 2025
Tender Value : rupee 18 Lakhs
View Notice
20

Government Departments - Bengaluru Urban - Karnataka

49741519 bids are invited for , viral rna extraction kit viral rna extraction kits total quantity : 1

Due Date : Jul 10, 2025
Tender Value : Ref. Document
View Notice
21

Government Departments - Mumbai Suburban - Maharashtra

49732068 bids are invited for supply of recombinant plasmids with codon optimised custom gene( , custom gene( total quantity : 8

Due Date : Jul 11, 2025
Tender Value : Ref. Document
View Notice
22

Government Departments - Visakhapatnam - Andhra Pradesh

49712308 bids are invited for , mil-std digital grounding system total quantity : 3

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
23

Government Departments - Jamnagar - Gujarat

49693612 bids are invited for automated rna extraction kit qiaamp dsp pathogen mini , forensic dna extraction kit total quantity : 2432

Due Date : Jul 8, 2025
Tender Value : Ref. Document
View Notice
24

Government Departments - lucknow - Uttar Pradesh

49623629 Corrigendum : tender for supply of viral rna extraction kit

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
25

Government Departments - Mumbai Suburban - Maharashtra

49585672 Corrigendum : bids are invited for human identification - dna kit autosomal str (forensic use) (q3) ((3 3 )) 13 lakh (s) total quantity : 13

Due Date : Jul 8, 2025
Tender Value : Ref. Document
View Notice
26

Government Departments - Chhindwara - Madhya Pradesh

49585619 Corrigendum : bids are invited for human identification - dna kit autosomal str (forensic use) (q3) ((3 3 )) 190 lakh (s) total quantity : 200

Due Date : Jul 8, 2025
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail