Paints And Primers Tenders from India

432 Paints And Primers tenders are published by various Tendering Authorities & Private companies. 432 live Tender for Paints And Primers are available in Paints And Primers Tender section You can further filter Paints And Primers tenders by Tender Value, Tender Submission Date or Project Location.

1

Government Departments - Sirsa - Haryana

43191321 bids are invited for synthetic enamel paint synthetic enamel paint black berger , red oxcide primer metal primer berger , tarpin oil for paint purpose , paint brush , emery paper total quantity : 120

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
2

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

43191264 bids are invited for cadmium brilliant brightner no. 1 , in 5 ltr original sealed pack ( q3 ) , ginthox 982l ( metapas yellow ) in 5 ltr pack ( q3 ) , red oxide ( metal primer ) in 4 ltr original sealed pack make: berger, nerolac, asian, utsav ( q3 )

Due Date : Apr 20, 2024
Tender Value : Ref. Document
View Notice
3

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

43191191 bids are invited for hull husbandry tools for grse asw swc project yard nos 3033 to 3036 aluminum step ladder brush cleaning ( watch maker soft ) brush stiff tools paint roller and handle grease gun paint spray painting machine 5 inches angle grinder cup wire brush 70 mm 7 inches angle grinder cup wire brush 100 mm portable welding machine portable exhaust fan aluminum extending ladder vacuum cleaner domestic electric grinder electric needle scaler electric wire brush p...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
4

Government Departments - Chamoli - Uttarakhand

43191131 bids are invited for procurement badrinath hospital overall white goods item plywoood or 12mm on walls fixing plain lining whin necessary screws nuts bolts nails including a coat of approved primer on one face , providing and fixing in wall lining flat presse three layer medium density particle board 6 mm hpl on front plyboard , providing and fixing 18 mm thick gang saw cut mirror polished premoulded and prepolished machine , print media , signages , mural artwork total quantit...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
5

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

43191111 bids are invited for thin client with kiosk , thin client with kiosk , display unit , joystick , desktop pc with kiosk , domain server with os , exam server with os , power backup , battery , hw firewall , interactive panel , enclosure , 24 port giga sw with pp , utp patch cord , data cable box , rj 45 connector box , jack and smb and fp , interface cable set , hdmi splitter , project integration total quantity : 708

Due Date : Apr 20, 2024
Tender Value : Ref. Document
View Notice
6

Government Departments - Srinagar - Jammu And Kashmir

43190713 bids are invited for ms angle iron 1 inch 1 soot rust proof high flexibility isi mark , ms round pipe 1 inch 20 ft rust proof with high flexibility isi mark , ms round pipe 3 by 4 inch rust proof with high flexibility isi mark , ms rectangle pipe 2 inch by 1 inch rust proof with high flexibility isi mark , bolt with nut 1 inch 10 no rust proof stainless steel , bolt with nut 2 into 5 inch 10 no rust proof stainless steel , bolt with nut 12 no rust proof stainless steel , ms tin s...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
7

Government Departments - Tuticorin - Tamil Nadu

43190642 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) , ready mixed paint, air drying, red oxide zinc chrome, priming as per is 2074 ( q3 ) , synthetic enamel exterior finish traffic blue ( isc 169 ) paint as per is 2932 ( q3 ) , synthetic enamel exterior finish brilliant green ( isc 221 ) paint as per is 2932 ( q3 ) , aluminium paint in dual container as per is 2339 ( q3 ) , general purpose thinner ...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - Kanpur - Uttar Pradesh

43190352 supply of anti - tracking varnish .anti - tracking varnish ., anti - tracking varnish for tao-659 t.m. elentas beck india / pune ( f-93 ) or rotomac / new delhi ( re-118 ) , conforming to manufacturers specification approved by rdso [ warra nty period: 30 months after the date of delivery ] => limited

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
9

Government Departments - Izatnagar - Uttar Pradesh

43190327 supply of paint ready mixed, air drying, red oxide zinc chrome, priming to is:2074 ( part-1 ) / 2015 ( reaffirm ed 2020 ) along with rdso amndt. no. 1a ( rev.1.0 effective from june-2020 ) as an additional requirement with a dditional requirement of icf / md / spec. 045 issue status 02, rev. no. 03 dated 14.06.2007. packed in 20 ltrs. ne w and sound non returnable m.s. drum to is:2552 / 1989 with amndt. 1 of april-1999, grade b-1. [ warranty peri od: 30 months after the date of deli...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
10

Government Departments - Mumbai - Maharashtra

43189828 quotation invited only from paint manufacturers for supply of dry dock paints to mt desh shanti at asry bahrain eta 1st week of may 2024 on fob basis. svr percent value for each paint item should be mentioned

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
11

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43189758 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 2052

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
12

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43189752 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 1938

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
13

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43189749 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 1951

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
14

Government Departments - Jammu - Jammu And Kashmir

43189744 bids are invited for paint og duco -paint black duco , paint og duco , primer red oxied duco 1 ltr pack , thinner duco 5 ltr pack , asain paints apcolite premium gloss enamel black paint 1 ltr pack , asain paints apcolite premium gloss enamel bus green paint 1 ltr pack , asain paints apcolite premium gloss enamel white 1 ltr pack , asain paints apcolite premium gloss enamel golden brown paint 1 ltr pack , asain paints apcolite premium gloss enamel dark blue 1 ltr pack , asain p...

Due Date : May 8, 2024
Tender Value : rupee 5 Lakhs
View Notice
15

Statutory Bodies & Commissions/Committees - imphal - Manipur

43189689 bids are invited for thinner thinner , plywood 8x4 12mm , leather cloth black , cloth hussain medium 102 cm wide , gas oxygen industrial , insulation tape elect , white paint , square pipe 3 inch , square pipe 0.5 inch , nails steel wire round , fevicol , black screw 1 inch , black screw 2inch , varnish gold size , washer single coil type b , plywood 4x4x12 , plywood 2x2x18 , welding rod , black paint total quantity : 606

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
16

Government Departments - Dibrugarh - Assam

43189568 bids are invited for paint, rfu, finishing, air drying brushing sprying ( q3 ) , enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) , ready mixed paint, air drying, red oxide - zinc phosphate, priming as per is 12744 ( q3 ) total quantity : 58

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
17

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

43189561 bids are invited for shellac lacquer ( apc-211 ) to specn. jss 8010- 63: 1997 revision no. 1 ( q3 ) total quantity : 151

Due Date : Apr 27, 2024
Tender Value : Ref. Document
View Notice
18

Government Departments - Sultanpur - Uttar Pradesh

43189394 bids are invited for rc for paint and primer and thinner epoxy based zinc phosphate primer to is13238 grey epoxy based finish paint to is14209 smoke grey to shade no 692 of is 5 as per specification aa56131 poly amide cured epoxy based mio tio2 pigmented intermediate coat paint spec aa56112 epoxy based zinc rich primer paint two pack as per specification aa56114 to is14589 gr ii chemical resistant epoxide finishing paint light grey is 14209 spec aa56131 chemical resistant epoxide red...

Due Date : Apr 27, 2024
Tender Value : Ref. Document
View Notice
19

Government Departments - kapurthala - Punjab

43189201 supply of pu paint top coat two packs ( shade to be advise later on ) , as per drawing / spec ification: rdso no. m&c.pcn / 100 / 2018. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
20

Government Departments - mumbai - Maharashtra

43188925 supply of enamel synthetic, exterior brushing, finishing, air craft blue to icf specification: icf / md / spec-0 45 issue states-02, rev-03 and is:8662 / 2004, 2nd revision ( reaffirmed 2019 ) except clause c-3, with rdso a mdt. no. 1a ( rev.1 ) as an additional requirement with rdso amendment no.1 ( rev.0 ) for pigment content as a n additional requirement to is:8662 / 2004 isc shade no.108 to is:5 / 2007 ( reaffirmed-2022 ) . packing condition: p acking in 20 ltrs. new non-returnab...

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
21

Government Departments - Tirupati - Andhra Pradesh

43188910 supply of paint enamel synthetic mid brunswick green finishing exterior isc 226 to is: 8662 ( reaffirmed 20 19 ) , with additional requirement of icf / md / spec-045, issue status 02, rev.03 with amendment dt.22-04-2008. the pigment content shall be 6% minimum ( by mass ) as per rdso letter no.m&c / pcn / i / 64 / i / vol.ii, dt: 12.05. 2016 as rdso amdt. no.1.packing condition : packing in 20ltrs. new non-returnable m.s. drums to is:2 552 / 89 with amendment no.1, grade b2 [ warrant...

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
22

Government Departments - Jodhpur - Rajasthan

43188588 quotation for consumables and non-consumables -1. primer kras exon 2f (gtgtgacatgttctaatatagtca) 2. primer kras exon 2r (gaatggtcctgcaccagtaa) 3. primer kras exon 3f (tcaagtcctttgcccatttt) 4. primer kras exon 3r (tacacaaagaaagccctcccc) 5. primer kras exon 4f (ttgtggacaggttttgaaaga) 6. primer kras exon 4r (agaagcaatgccctctcaag) 7. 2x platinum superfi pcr pcr master 8. highprep pcr – dx (5ml) 9. highprep dtr-dx (5ml) 10. mymag™ 96x magnetic plate

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
23

Boards / Undertakings / PSU - Rupnagar - Punjab

43188412 providing and applying polyurethane resin based protective coating system on the roof of main electrical workshop inside factory area, nfl nangal unit.

Due Date : May 22, 2024
Tender Value : rupee 23.78 Lakhs
View Notice
24

Government Departments - kolkata - West Bengal

43186281 supply of alkyd modified synthetic enamel aircraft blue.alkyd modified synthetic enamel aircraft blue., alkyd modified synthetic enamel uv resistant, high gloss and colour ret ention, aircraft blue, [ isc no-108 ] , exterior finishing to is:8662 / 2004 and icf str no.- icf / md / spec-045, [ issue status02, rev. 03. ] amendment vide ifcs letter no. md / d / pt / policy / 73-a dated 22.04.2008. spec: ( shelf life of this item is 12 months )

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
25

Government Departments - Bhubaneswar - Odisha

43186248 supply of high density fabric construction paint roller.high density fabric construction paint roller., high density fabric construction paint roller with cotton felt type with handle for application on metalli c surface enamel painting, size-6 inch length, and 2-inch dia [ warranty period: 30 months after the date of deliv ery ]

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
26

Government Departments - Bangalore - Karnataka

43185876 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 90

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
27

Government Departments - Mancheswar - Odisha

43185770 supply of epoxy thinner compatible with epoxy paints.epoxy thinner compatible with epoxy paints., epoxy thinner compatible with epoxy paints, to drawing / specification rdso spec. no. m&c / p cn / 100 / 2018 with amendment no. 1b ( rev-2.0 ) as an additional requirement, colour shade: ral-7012. [ warra nty period: 30 months after the date of delivery ] => limited

Due Date : Apr 30, 2024
Tender Value : Ref. Document
View Notice
28

Government Departments - Jharsuguda - Odisha

43185338 bids are invited for enamel paints red oxide metal primer paints , enamel paint blue , enamel orange paint , synthetic enamel paint post office red , enamel green paint , thinner in 20 ltr total quantity : 2620

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
29

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

43185298 bids are invited for varnishes or shellac varnish as per is 347 (q3) total quantity : 70

Due Date : May 1, 2024
Tender Value : Ref. Document
View Notice
30

Government Departments - bangalore - Karnataka

43184872 supply of paint, premium gloss, synthetic, enamel, interior finishing, shade: quick silver ( first quality ) . brand: apcolite to shade no. 8307 of asian color palette, page no 119 or equivalent shade in berger or shal imar or sheenlac or nippon. [ warranty period: 30 months after the date of delivery ]

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - Ernakulam - Kerala

43184771 bids are invited for procurement of paints paint brush 4 inch , paint brush 2 inch , paint brush 1 inch , paint rfu golden yellow , paint rfu signal red , paint rfu azure blue , paint rfu black , paint rfu green , paint exterior rfu finishing white , paint rfu navy blue , paint rfu spraying white total quantity : 1097

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
32

Boards / Undertakings / PSU - Shahjahanpur - Uttar Pradesh

43184499 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) , ready mixed paint, air drying, red oxide zinc chrome, priming as per is 2074 ( q3 ) , thinner for synthetic paints and varnishes-is: 14314 ( q3 ) total quantity : 1810

Due Date : May 1, 2024
Tender Value : rupee 35.71 Lakhs
View Notice
33

Government Departments - lallaguda - Telangana

43184118 supply of paint polyurethanepaint polyurethane, paint polyurethane papyrus white ( metallic finish ) ral 9018 ( two pack ) to rdso spec no. m&c / pc n / 100 / 2018. packing in new steel drums plain ( non-returnable ) 20 liters capacity to is:2552 / 89 grade b2. [ warranty period: 30 months after the date of delivery ]

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
34

Government Departments - Chennai - Tamil Nadu

43184094 supply of paint ready mixed, brushing, bituminous, blackpaint ready mixed, brushing, bituminous, black, paint ready mixed, brushing, bituminous, black, lead free, acid alkali water and heat resistanc e for general purpose to spec.is:158 / 2015 ( ra 2020 ) packing condition- packed in20 liters new, sound and n on-returnable ms drums to is 2552 / 89 ( ra -2018 ) with amdt.no.1 gr.b2. [ warranty period: 30 months after t he date of delivery ] => l...

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - bangalore - Karnataka

43184093 supply of enamel sysnthetic paint for exterior fin [ enamel sysnthetic paint for exterior finishing paint as per is-2932 latest revision to the following specifications: ( a ) colour shade: apple green. ( b ) isc number:281 ( c ) wet opacity ( minimum ) :210 m2 / 10 litre ( d ) packing size:20litre ( e ) packing material: steel drums / metal container as per is 2552 ( f ) paint should be suitably for both brush painting and air spraying thinning ( g ) sur...

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
36

Government Departments - Chennai - Tamil Nadu

43184090 supply of paint ready mixed, `black brushing, finishing exterior semi glosspaint ready mixed, `black brushing, finishing exterior semi gloss, paint ready mixed, `black brushing, finishing exterior semi gloss for general purpose to spec.i s:13607 / 92 ( ra - 2019 ) amdt.no. 2 july 2021. packing condition- packed in20 liters new, sound and non-retu rnable ms drums to is 2552 / 89 ( ra -2018 ) with amdt.no.1 gr.b2 [ warranty period: 30 months after the date o f d...

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Jhajjar - Haryana

43184038 tender for dhandlah block: beri panchayat: dhandlan dist.: jhajjar annual maintenance. work for water supply. 1 building material/ paints job work for scraping old paint and painting with primer and 2 coats of new paint of asian/nerolec brand on delivery pipelines, sluice valves, nrvs, tees, bends, ms covers & other misc items for marking of direction, of flow by skilled painter complete in all respect / job work for painting of p/ chamber and other work complete with all required / at w/w dh...

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
38

Government Departments - BERI - Haryana

43184033 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
39

Government Departments - BERI - Haryana

43184032 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
40

Government Departments - Beri - Haryana

43184031 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
41

Government Departments - Beri - Haryana

43184027 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
42

Government Departments - Beri - Haryana

43184026 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
43

Government Departments - Beri - Haryana

43184018 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
44

Government Departments - Beri - Haryana

43184017 tender for annual maintenance work for water supply -building material/ paints -job work for scraping old paint and painting with primer and 2 coats of new paint of asian/nerolec brand on delivery pipelines, sluice valves, nrvs, tees, bends, ms covers & other misc items for marking of direction, of flow by skilled painter complete in all respect / job work for painting of p/ chamber and other work complete with all required / at w/w dighal (chindran pana)

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
45

Government Departments - Ajmer - Rajasthan

43183871 supply of pu surfacer whitepu surfacer white, pu surfacer white rdso spec. no. m&c / pcn / 100 / 2018 with rdso amendment n o. 1b ( rev 2.0 effective from sept- 2020 ) ( required in 4 ltr. pack ) [ warranty period: 30 month s after the date of delivery ] sr. section engineer rajasthan 64.00 litre => limited

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
46

Boards / Undertakings / PSU - Saharanpur - Uttar Pradesh

43183822 bids are invited for double coat painting work with putty in boys hostel ground floor with material and labour (q3) total quantity : 862

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
47

Cooperative - Tirupathur - Tamil Nadu

43183683 tender for supply of anabond rustlic and insulating varnish; 1 anabond412 ( bearing retainer ) 50 ml 2 rustlic-631250 ml 3 insulating varnishcolor : golden yellow ( container 1 liter ) make: dr.beck 4 insulating varnish color : gray varnish ( container 1 liter ) make: dr.beck 5 insulating varnish color : red oxide ( container 1 liter ) make: dr.beck

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
48

Cooperative - Tirupathur - Tamil Nadu

43183679 paints , golden yellow , synthetic enamel jade green , red oxide primer , acid alkali black , h r white paint , synthetic enamel azure blue , synthetic enamal white , thinner , stainner blue 250 ml each , robin blue powder 1 kg pack

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
49

Government Departments - Dibrugarh - Assam

43183367 bids are invited for thinner for cellulose nitrate based paints and lacquers ( q3 ) total quantity : 20

Due Date : Apr 27, 2024
Tender Value : Ref. Document
View Notice
50

Boards / Undertakings / PSU - Ratnagiri - Maharashtra

43183271 bids are invited for paint for em dept -aluminium industrial paint with aluminium paste two pack air drying synthetic resin based , smoke grey color high glossy industrial polyurethane pu paint with hardner two component , mastic self priming with hardner for steel surface color light grey high glossy two compo , thinner for mixing high glossy industrial polyurethane pu paint technical specifications , light grey color high glossy industrial synthetic enamel ready mixed single pac...

Due Date : Apr 26, 2024
Tender Value : rupee 12.04 Lakhs
View Notice
51

Boards / Undertakings / PSU - Multi State

43183025 procurement of autosurfacer paints

Due Date : May 16, 2024
Tender Value : Ref. Document
View Notice
52

Government Departments - kapurthala - Punjab

43182490 supply of primer and thinner.primer and thinner., primer and thinner for conveyorised painting system, as per drawing / specifica tion: mplconveypt version 6. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
53

Government Departments - rae Bareli - Uttar Pradesh

43182178 supply of paint synthetic enamel finish satin bluepaint synthetic enamel finish satin blue, paint synthetic enamel finish satin blue to shade no. isc-177 of is:5-2007 as p er drg.no. rdso no. m&c / pcn / 120 / 2005 with amendment slip no. 1 of april 2006, packing instructi on - pi042. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 18, 2024
Tender Value : Ref. Document
View Notice
54

Boards / Undertakings / PSU - Raipur - Chhattisgarh

43182016 contract of supply and application of paint on old structural steel in ash handling system, stage i and ii sipat/ntpc.

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
55

Government Departments - kapurthala - Punjab

43180502 supply of paint ready mixed primer zinc chromatepaint ready mixed primer zinc chromate, paint ready mixed primer zinc chromate, as per drawing / specification: is:2074-1992. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
56

Statutory Bodies & Commissions/Committees - kalaikunda - West Bengal

43178684 tender for improvement to certain smq / omq at afs salua; 1 taking down cement plaster of any description on brick or stone walls, etc. including raking out joints, hacking for key, scrubbing down with water etc and removing the debries outside of mod land, complete all as specified and directed. 2 demolition of un-reinforced cement concrete of any description and in any position not otherwise specifically provided for and disposal of unserviceable materials, debris and rubbish to a...

Due Date : Apr 29, 2024
Tender Value : rupee 4.20 Crore
View Notice
57

Government Departments - Bhavnagar - Gujarat

43178359 supply of 33 kv high insulation paint for insulation purpose. di-electric strength 59 kv / mm stable up to 200 deg, excellent resistance to uv radiation, excellent resistan ce to transformer oil, tough and scratch resistant, excellent corrosion resistan ce, quick drying at room temperature. ( adc certificate & past performance certific ate is desirable ) . make: insulect sk-03 / casewell only. [ warranty period: 30 months after the d ate of delivery ] sr.section engineer trd gujarat ...

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
58

Government Departments - Baramulla - Jammu And Kashmir

43178239 tender for building, defence material, sanitary, hardwear items, stationary items, electric items, electronics, furniture, soports items, crockery and printing material for the year 2024 and 25--- 1 building material 2 killen bricks a class 3 bajri crusher 4 bajri nallah 5 sand 6 bolder stone nallah 7 rubber stone 8 black cutting 9 stone dust crusher 10 hollow blocks 8x16 cement 11 empty cement bag fresh 12 polthene sheets blue 13 polthene sheets plain 14 cement 4...

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
59

Statutory Bodies & Commissions/Committees - Daman - Daman And Diu

43177556 bids are invited for lp of consumable naval store items automatic air freshner , super mop , tray paint roller , paint green , paint intergard 251 red oxide , paint navy blue , paint golden yellow , paint fluorescent yellow , paint fluorescent red , paint fluorescent green , paint dark grey , paint black enamel , paint azure blue , feather broom , duster cloth , cloth sponge , cleaner white tolilet harpic , cloth stocknite mutton cloth , broom country , paint terracota red , ...

Due Date : May 7, 2024
Tender Value : rupee 1.86 Lakhs
View Notice
60

Government Departments - Kharagpur - West Bengal

43177015 supply of pu paint, shade: golden yellow ( ral1004 ) .drawing no.icf drg. no. emu / m11 / asr-8-3-101, alt. nil. matl. & spec.: epoxy cum polyurethane painting system ( two pack ) for the exterior painting of railway coa ches as per rdso specn. no.m&c / pcn / 100 / 2018 and rdso amendment no. 1b ( rev. 2.0, effective from sep tember-2020 ) as an additional requirement. ( shelf life of the item is 12 months ) . [ warranty period: 12 months af ter the date of delivery ] workshop carria...

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
61

Government Departments - Jhansi - Uttar Pradesh

43176694 supply of epoxy primer for painting of lhb bogie.epoxy primer for painting of lhb bogie., epoxy primer for painting of lhb bogie frames as per rdso spec.no.rdso / m&c / pcn / 123-06. a s per specn. rdso / m&c / pcn / 123-06. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
62

Government Departments - lallaguda - Telangana

43176598 supply of brushes paints and varnishes ( flat ) size 50mm to conforming to is: 384 / 2002 grade-1 amendme nt no.1 and bristles is: 1844 / 1993. item- heavy duty, type of brush: soft, material of bristle: pigs, shelf life: 2 y ears accepted make: ab composite / climax / champion / royal / sunrise / jyothi / asian. [ warranty period: 30 m onths after the date of delivery ] => limited

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
63

Government Departments - rourkela - Odisha

43176475 supply of paint alluminium for general purpose [ in dual container ] to is: 2339 / 1963 am endment no. 3. ( shelf life of this item is 12 months ) [ warranty period: 30 months after the date of delivery ] electric loco shed stores / bndm, odisha 500.00 litre

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
64

Government Departments - Bhubaneswar - Odisha

43176461 supply of paint synthetic enamel exterior, satin blue finishing., paint synthetic enamel exterior, satin blue finishing, to drawing / specification is:8662 / 04, rdso amendment no.1 ( revision - 0 ) for pigment content as an additional requirement to is:8662-2004 w.e.f. 01.08.20 16, with additional requirements of icf / md / spec-045, issue status - 02, rev-03 dated 14.06.2007 and rdso a mendment no. 1a as an additional requirement. [ warranty period: 30 months after the date of de...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
65

Government Departments - TUTICORIN - Tamil Nadu

43176411 bids are invited for thinner for epoxy paints ( bhel ) ( q3 ) mse total quantity : 100

Due Date : Apr 30, 2024
Tender Value : rupee 11833.0
View Notice
66

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

43176301 bids are invited for paints for external under water areas for ngopv total quantity : 17032

Due Date : Apr 18, 2024
Tender Value : Ref. Document
View Notice
67

Statutory Bodies & Commissions/Committees - KORAPUT - Odisha

43176223 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 80

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
68

Government Departments - Nagpur - Maharashtra

43175975 bids are invited for aluminium paint for general purposes in dual container as per is 2339 ( q3 ) total quantity : 13000

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
69

Government Departments - Gorakhpur - Uttar Pradesh

43175509 supply of structural glazing tape 12 mm wide fully curved, durable, high performance, doublesided, pressure sensitive, acrylic foam type mounted on 30 mm widepvc beading, used for attaching glass panelsto metal frames in curtain wall s ystem, commercialwindow sand doors, sky ligh

Due Date : Apr 30, 2024
Tender Value : Ref. Document
View Notice
70

Government Departments - Bramhapuri - Maharashtra

43175175 eauction for the sale of firewood belongs to pathari sale depot of bramhapuri fpd, fdcm lot code-1 / pathari / misc / firewood / 20 / 30 / 1x1 2x2 / 25 / o w r / n / apr-24 / 138 / 359, lot code-2 / pathari / misc / firewood / 20 / 30 / 1x1 2x2 / 29 / o w r / n / apr-24 / 139 / 368, lot code-3 / pathari / misc / firewood / 20 / 30 / 1x1 2x2 / 29 / o w r / n / apr-24 / 140 / 369, lot code-4 / pathari / misc / firewood / 20 / 30 / 1x1 2x2 / 29 / o w r / n / apr-24 / 141 / 377, lot code-5 / p...

Due Date : Apr 18, 2024
Tender Value : Ref. Document
View Notice
71

Boards / Undertakings / PSU - Moga - Punjab

43175118 tender for purchase of pain & its allied accessoris for various 220/132 kv sub stations under p&m division, pstcl, moga- 1) red oxide metal primer isi marked & in accordance with is (indian standard) make:- berger, asian, nerolac or equivalent packing-1 ltr 2) light grey shade 631 of is:5 isi marked & in accordance with is (indian standard) make:- berger, asian, nerolac or equivalent packing-1 ltr. 3) turpentine oil in accordance with is (indian standard) make:- berger, asian, nerolac or equiva...

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
72

Government Departments - Jhansi - Uttar Pradesh

43175076 supply of paint enamel synthetic exterior brushing.paint enamel synthetic exterior brushing., paint enamel synthetic exterior brushing air craft blue to is: 8662 / 2004, or latest isc no. 108 to is : 5 / 1994, gloss 86 and above, wet opting 18 sq.mtr. per ltr, packing in 20 ltrs new non-returnable drums to is: 25 52 / 89 or latest gr.b-ii [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
73

Government Departments - Kutch - Gujarat

43175008 tender for work of supply & application of anti-corrosive epoxy /metal protective paint on various conveyor structures and equipment of lhp/mhp.

Due Date : Apr 26, 2024
Tender Value : rupee 8.68 Lakhs
View Notice
74

Government Departments - Tirupati - Andhra Pradesh

43174993 supply of paint synthetic enamel post office redpaint synthetic enamel post office red, paint synthetic enamel post office red exterior finishing isc 538 to i.s:8662 / 2004 with rdsoam endment no. 1 ( rev. 0 ) for pigment content as an additional requirement to is: 8662-2004 w.e.f.01.08.2016. we t capacity 6 sq.m / litre packed in new steel drums plain ( non-returnable ) 20 ltrs. conforming to is:2552 / 89.gr.b -2. [ warranty period: 30 months after the date of delivery ...

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
75

Government Departments - Matunga - Maharashtra

43174985 supply of electron beamelectron beam, electron beam irradiated chemically cured cross linked thin walled flex ible elastomeric single core multi stranded copper conductor, size:16 sq.mm. work ing voltage above 750 volts & up to 1.8 / 3.0 kv as per rdso spec. no. elrs / spec / elc / 0019 rev.4 of february 2018. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
76

Government Departments - mumbai - Maharashtra

43174975 supply of full gloss polyurethane enamel paintfull gloss polyurethane enamel paint, full gloss polyurethane enamel paint ( two pack ) colour shade ral- 260 60 35 conf orming to rdso spec. no. m&c / pcn / 100 / 2018 or latest [ warranty period: 30 months after the date of deliver y ]

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
77

Government Departments - Bangalore - Karnataka

43174974 supply of paint, synthetic enamel exterior satin bluepaint, synthetic enamel exterior satin blue, paint, synthetic enamel exterior satin blue finishing isc:177 to specn.no is:8662 / 2004 and colou r to is:94 alongwith additional requirements stipulated in icf specn.icf / m / d specn-045, issue status-02, revisi on-03. dated 14.06.2007, packed in 20 ltrs net in new and sound non-returnable m.s. drums to is:2552 / 89 grade b2. [ warranty period: 12 months after the date o...

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
78

Government Departments - Jhansi - Uttar Pradesh

43174971 supply of paint enamel synthetic dove grey.paint enamel synthetic dove grey., paint enamel synthetic dove grey exterior type-i, finishing to isc:694 to is:8662 / 2004 ( second rc vision ) in 20 ltrs. new non-returnable m.s. drums to is:2552 / 89, gr. b-ii. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
79

Government Departments - Kanpur - Uttar Pradesh

43174960 supply of paint ready mixed brushing finishing.paint ready mixed brushing finishing., paint ready mixed brushing finishing bituminous black lead free acid alkali water and heat resisting for general purpose to is:158, in 20 ltrs. new non-returnable m.s. drums to is:2552 / 89 with.amdt-1. gr.b-ii. [ wa rranty period: 30 months after the date of delivery ] gsd / kanpur, ncr uttar pradesh 4000.00 litre => limited

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
80

Government Departments - vizianagaram - Andhra Pradesh

43174928 tender for safety shoes for workmen 33401246 0001 0001 300884539 shoes,safety,la-lady,dbl-pu-sole,5 technical details name : akula, srikanth - am/ns india - hse (viz contact : 9885542288 email : srikanth.akula@amns.in 3 paa shoes,safety type:low ankle-lady , upper material:buff fine booty print leather thickness (upper material):2.0mm ± 0.2 mm sole material:double density pu sole sole hardness:mid sole hardness 45 ± 5 shore, out sole hardness 55 ± 5 shore process:direct injection process , heig...

Due Date : Apr 21, 2024
Tender Value : Ref. Document
View Notice
81

Boards / Undertakings / PSU - Hyderabad - Telangana

43174747 tender for purchased for following items- acrylic based chemical waterproofing treatment at cnsg building at ecil, hyderabad providing and applying shrinkage crack filler of dr. fixit crack x paste or other equivalent material including opening the loose part of the existing crack, making the same in v-shape in required depth & width, cleaning the groove by removing dust, oil, grass, loose particles etc., press the crack filler into the crack one time only with a spatula or putty knite and lev...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
82

Government Departments - Kanpur Nagar - Uttar Pradesh

43174618 bids are invited for thermal insulation detail specification as per annexure a metal false ceiling detail specification as per annexure a epoxy flooring detail specification as per annexure a 75 mm height epoxy coving detail specification as per annexure a expansion joint by rasin and hardener detail specification as per annexure a earth work in excavation detail specification as per annexure a pcc 1 4 8 detail specification as per annexure a rcc 1 1 5 3 detail specificat...

Due Date : May 6, 2024
Tender Value : rupee 88.94 Lakhs
View Notice
83

Statutory Bodies & Commissions/Committees - Chandrapur - Maharashtra

43174595 bids are invited for cmri tested anti rust paints ( q3 ) mse total quantity : 1350

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
84

Government Departments - Tuticorin - Tamil Nadu

43174470 bids are invited for aluminum paint, heat resistant as per is 13183 ( q3 ) mse total quantity : 100

Due Date : Apr 30, 2024
Tender Value : rupee 27500.0
View Notice
85

Government Departments - Tuticorin - Tamil Nadu

43174442 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) mse total quantity : 40

Due Date : Apr 30, 2024
Tender Value : rupee 13733.0
View Notice
86

Government Departments - Mysore - Karnataka

43174413 bids are invited for enamel paint remover (q2) total quantity : 240

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
87

Government Departments - Kalimpong - West Bengal

43174355 bids are invited for paint black duco and thinner duco black duco paint , black paint asian , olive green paint asian , white paint asian , red paint asian , silver paint asian , red oxide , golden brown paint asian , duco thinner , thinner normal terpine , painting brush half inch , painting brush 3 inch , writing brush set for painter , silica jell , fevicol , kerosene oil , lemon yellow floretion , paint remover , emery paper no 100 and 120 total quantity : 514

Due Date : May 6, 2024
Tender Value : rupee 5 Lakhs
View Notice
88

Boards / Undertakings / PSU - Bokaro - Jharkhand

43174318 bids are invited for paint, heat resistant, al sil base, is: 13183, 1991 ( q3 ) total quantity : 11050

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
89

Government Departments - Bhopal - Madhya Pradesh

43174266 bids are invited for inorganic ethyl zinc silicate primer as per bhel spec. no. aa56113 rev02. aa5610013011 ( q3 ) total quantity : 300

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
90

Statutory Bodies & Commissions/Committees - visakhapatnam - Andhra Pradesh

43174248 bids are invited for procurement of chemicals for electroplating bright nickel salt , bright chrome salt , bright silver salt , argolume silver brightner , lead fluborite , nickel brightner , potasium cyanide , strike silver salt , argolume carrier additve , grow clear gwc , grow clear additive , grow clear flow additive , grow clear gold additive no 1 , grow clear gold additive no 2 , grow clear ra , grow clear es , grow clear stripper , grow clear lacquer , copper bare wire ...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
91

Statutory Bodies & Commissions/Committees - Jorhat - Assam

43174197 bids are invited for distemper weather coat 20 kg (q3) total quantity : 2500

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
92

Boards / Undertakings / PSU - Idukki - Kerala

43173803 tender for bulk purchase of research chemicals/labwares/oligonucleotides primers under various projects at cardamom research station, pampadumpara for the financial year 2024-25.

Due Date : May 3, 2024
Tender Value : Ref. Document
View Notice
93

Government Departments - Tirupati - Andhra Pradesh

43173691 supply of paint enamel exterior blackpaint enamel exterior black, paint enamel exterior black finishing to is: 8662 / 2004 with additional requirements of spec icf / md / spec045 issue status 02, revision 03. [ item packed in 20 ltrs new & sound non returnable m.s. drums to is 25 52 / 89 grade b -ii ]

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - Ponmalai - Tamil Nadu

43173559 supply of paint ready mixed, `black brushingpaint ready mixed, `black brushing, paint ready mixed, `black brushing, finishing exterior semi gloss for general purpose to spec.is:13607 / 92 ( ra - 2019 ) amdt.no. 2 july 2021. packing condition- packed in20 liters new, sound and non-returnable ms drums to is 2552 / 89 ( ra -2018 ) with amdt.no.1 gr.b2 [ warr anty period: 12 months after the date of delivery ] => limited

Due Date : Apr 18, 2024
Tender Value : Ref. Document
View Notice
95

Government Departments - ghaziabad - Uttar Pradesh

43173419 supply of enamel synthetic exterior under coating pale cream spec.is:8662 / 2004 ( second rev. ) and rdso amendment no.1 ( rev. 0 ) for pigment content as an additional requirement to is 8662 / 2004 w.e.f 1.8.2016 with a dditional requirement of icf / md / md / spec.-045, issue status -02, rev- no. 03, dt.14.6.2007 isc:352 with rds o amendment no.1a with fire retardant properties as per rdso spec. m &c / pcn / 120-2011 ( rev.-1 ) dated feb 2011. [ warranty period: 30 months after th...

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
96

Government Departments - Dahod - Gujarat

43173178 supply of antitracking finishing varnish for auxiliary- generator and field coil of traction motor. 4601 / 4603 as per rdso mpmi no.153 / 92 rev.04 sept.2014. acceptable bran ds- 1 ] epoxy gel coat [ red ] [ elantas-beck ] 2 ] bectol ( red ) [ elantas-beck ] 3 ] dc1-2620 [ dow-corni ng ] 4 ] si 620 [ dow-corning ] in single pack. 5 ] ultimeg 2000-372 rh [ prs permacel ] specn: pac [ warranty peri od: 30 months after the date of delivery ]

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
97

Boards / Undertakings / PSU - AMETHI - Uttar Pradesh

43173139 online global and open tender in two-part bid system for purchase of magnetic steel sheet varnish as per bhel specification no. aa27541 rev-01

Due Date : May 13, 2024
Tender Value : Ref. Document
View Notice
98

Government Departments - erode - Tamil Nadu

43172112 supply of anti tracking varnishanti tracking varnish, anti tracking varnish for class b / 130 degree as per rdso smi no elrs / smi / 200 ( revised ) or as per rdso mpmi no 153 / 92 rev 04 of sep 2014. for use in field coil and auxiliary machines i.e, becktol red of m / s elantas beck co, pune or similar. ( the test certificate shoud contain parameters mentioned in annexure to mpmi 153 / 92 rev ( 04 ) of sep 2014 ) . note only varnish is required. firm shoul...

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
99

Government Departments - jhansi - Uttar Pradesh

43172084 supply of paint enamel synthetic exterior brushing finishing oxford blue to is:8662 / 2004, or latest. isc no. 105 to is: 5 / 1994, gloss 86 and above, wet opacity 12 sq. mtrs. per ltr. packing in in 20 ltrs. new non-returnable m.s. drums to is:2552 / 89 or latest. gr. b-ii.paint enamel synthetic exterior brushing finishing oxford blue to is:8662 / 2004, or latest. isc no. 105 to is: 5 / 1994, gloss 86 and above, wet opacity 12 sq. mtrs. per ltr. packing in in 20 ltrs. new n...

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
100

Government Departments - Ghaziabad - Uttar Pradesh

43171939 supply of enamel synthetic exterior finishing mid brunswick greenenamel synthetic exterior finishing mid brunswick green, enamel synthetic exterior finishing mid brunswick green paint isc no. 226, to bis spec. 8662 / 20 04 or latest with fire retardant properties as per rdso spec. m &c / pcn / 120-2011 ( rev.-1 ) dated feb2011 [ wa rranty period: 30 months after the date of delivery ]

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail