Paint Supply Tenders from India

283 Paint Supply tenders are published by various Tendering Authorities & Private companies. 283 live Tender for Paint Supply are available in Paint Supply Tender section You can further filter Paint Supply tenders by Tender Value, Tender Submission Date or Project Location.

1

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

43198000 bids are invited for miscellaneous paints for svl -paint1 synthetic enamel black paint2 synthetic enamel navy blue paint3 synthetic enamel golden yellow paint4 synthetic enamel grass green paint5 synthetic enamel golden brown paint6 commercial aluminum paint paint7 pista green paint8 azure sky paint9 heat resistant phirozi blue / oxford blue paint10 heat resistant mushroom grey paint11 heat resistant phirozi blue / oxford blue paint12 glossy white / milky white paint13 orang...

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
2

Statutory Bodies & Commissions/Committees - BALANGIR - Odisha

43197932 bids are invited for primer electric ia lempty to cqa ( a ) drg. part no. iqx 46ge, dc no. 36662-a, dt. 23.03. 2000. ( q3 ) total quantity : 17876

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - Thiruvananthapuram - Kerala

43197816 bids are invited for painting materials gls enamel po red colour enamel paint , white colour enamel paint , sky blue colour enamel paint , black colour floor paint , white colour floor paint , po red colour floor paint , yellow colour epoxy paint , black colour epoxy paint total quantity : 200

Due Date : May 1, 2024
Tender Value : Ref. Document
View Notice
4

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43197770 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 2381

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
5

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43197769 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 1860

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
6

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43197686 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 3768

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
7

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43197685 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 3499

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - Hazira - Gujarat

43197448 tender for monorail erection & commissioning 020327 10 10 30 dismantling of structure 20 to 20 monorail structure fabricat. & erection. 20 to 80 side sheeting - 0.6mm thk erection 250 m 60 handrailing fabrication & erection 55 m 10 monorail erection & commissioning 3 lo 50 shot blasting and painting (new struc.) 20 to 70 side sheeting - 0.6mm thk dismantling 250 m 40 modification of structure 20 to email : harshesh.aliwala@amns.in contact : name : harshesh aliwala item details : v service provi...

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
9

Boards / Undertakings / PSU - darjeeling - West Bengal

43197227 tender for supply of paint items under hmi darjeeling

Due Date : Apr 30, 2024
Tender Value : rupee 6 Lakhs
View Notice
10

Government Departments - lallaguda - Telangana

43197193 supply of paint mixing mild steel rodpaint mixing mild steel rod, paint mixing mild steel rod with end connection threaded with lock nut. rod dia 12 mm, length 600 mm. make:- avanti or radiant or similar. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : May 2, 2024
Tender Value : Ref. Document
View Notice
11

Government Departments - Srinagar - Jammu And Kashmir

43196843 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 75

Due Date : Apr 30, 2024
Tender Value : Ref. Document
View Notice
12

Statutory Bodies & Commissions/Committees - Porbandar - Gujarat

43196797 bids are invited for naval store marine paints sigmadur 550 green 4199 , sigmadur 550 white , paint silver , paint rfu inter deck , paint red oxide , paint white enamel , paint removal non inflamable , paint signal red , paint pale cream fire resistant , paint rfu priming red lead , paint epoxy alluminium , paint coal tar epoxy black , epoxy red exide primer , paint black heat resistant , paint rfu finishing exterior synthetic dark grey , paint black enamel , paint azure blue , ...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
13

Statutory Bodies & Commissions/Committees - Ahmedabad - Gujarat

43196785 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 4399

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
14

Statutory Bodies & Commissions/Committees - Delhi - Delhi

43196759 bids are invited for src8100600-501, chock set 55pc011a-26-9, wire electrical 464-3-1 / ca142-kt1ga, primer surface hi built epoxy 81235, fines site final finish pr.1422.a2, sealing compound total quantity : 844

Due Date : Apr 20, 2024
Tender Value : Ref. Document
View Notice
15

Boards / Undertakings / PSU - Mumbai - Maharashtra

43196442 rc supply of paints

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
16

Government Departments - lucknow - Uttar Pradesh

43195424 supply of enamel, synthetic, exterior finishingenamel, synthetic, exterior finishing, enamel, synthetic, exterior finishing signal red confirming to is:8662 / 2004 along with rdso amendment no-1a ( rev1.0 ) as an additional requirements. - material shall be packed in 20 ltrs. metal containers confirming to is:2552 / 1989_amend. 1 ( third revision ) ( reaffirmed 2018 ) grade b-1. [ warranty period: 30 months after the date of delivery ]

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
17

Government Departments - Sanpada - Maharashtra

43195366 supply of paint ready mixed, brushing red oxide zinc chrome primingpaint ready mixed, brushing red oxide zinc chrome priming, paint ready mixed, brushing red oxide zinc chrome priming to is:2074:2023 ( fourth revision ) f or exterior with additional requirement of icf / md / spec / 045 issue status 02 rev. 03 dt 14.06.2007 and rdso`s amendment no. 1a ( rev.1.0, effective from june-2020 ) as an additional requirement. wet capacity 22 sq. mtr. p er lt...

Due Date : May 20, 2024
Tender Value : Ref. Document
View Notice
18

Government Departments - hubbali - Karnataka

43194944 supply of supply of paint remover solvent type non flammable.supply of paint remover solvent type non flammable., paint remover solvent type non flammable to is: 430-1972, amdt 1, reaffirme d year 2019.packing in 5 ltrs container only. [ warranty period: 30 months after the date of delivery ] dy.cmm ( gsd ) hubli, swr karnataka 12820.00 litre

Due Date : May 14, 2024
Tender Value : Ref. Document
View Notice
19

Government Departments - liluah - West Bengal

43192524 supply of paint exterior finishing blackpaint exterior finishing black, paint exterior finishing black, pu paint ( two pack ) , rdso spec. no. m&c / pcn / 100 / 2018. [ warranty period: 30 months after the date of delivery ]

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
20

Government Departments - Kurduwadi - Maharashtra

43191980 supply of paint enamel synthetic exterior finishing, %u201ccolour-white%u201d for railway coaches conforming to is:8662 / 2004 ( reaffirmed-2019 ) and rdso amendment no 1 ( revision 0 ) for pigment content as an additional requirement to is:8662 / 2004 w.e.f. 01.08.2016 with additional requirement of icf / md / spec / 045 issue status 02 rev. 03 dt 14.06.2007 and rdso`s amendment no. 1a ( rev.1.0, effective from june-2020 ) as an additional requirement. packing i...

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
21

Government Departments - Sirsa - Haryana

43191321 bids are invited for synthetic enamel paint synthetic enamel paint black berger , red oxcide primer metal primer berger , tarpin oil for paint purpose , paint brush , emery paper total quantity : 120

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
22

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

43191264 bids are invited for cadmium brilliant brightner no. 1 , in 5 ltr original sealed pack ( q3 ) , ginthox 982l ( metapas yellow ) in 5 ltr pack ( q3 ) , red oxide ( metal primer ) in 4 ltr original sealed pack make: berger, nerolac, asian, utsav ( q3 )

Due Date : Apr 20, 2024
Tender Value : Ref. Document
View Notice
23

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

43191191 bids are invited for hull husbandry tools for grse asw swc project yard nos 3033 to 3036 aluminum step ladder brush cleaning ( watch maker soft ) brush stiff tools paint roller and handle grease gun paint spray painting machine 5 inches angle grinder cup wire brush 70 mm 7 inches angle grinder cup wire brush 100 mm portable welding machine portable exhaust fan aluminum extending ladder vacuum cleaner domestic electric grinder electric needle scaler electric wire brush p...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
24

Government Departments - Chamoli - Uttarakhand

43191131 bids are invited for procurement badrinath hospital overall white goods item plywoood or 12mm on walls fixing plain lining whin necessary screws nuts bolts nails including a coat of approved primer on one face , providing and fixing in wall lining flat presse three layer medium density particle board 6 mm hpl on front plyboard , providing and fixing 18 mm thick gang saw cut mirror polished premoulded and prepolished machine , print media , signages , mural artwork total quantit...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
25

Government Departments - Tuticorin - Tamil Nadu

43190642 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) , ready mixed paint, air drying, red oxide zinc chrome, priming as per is 2074 ( q3 ) , synthetic enamel exterior finish traffic blue ( isc 169 ) paint as per is 2932 ( q3 ) , synthetic enamel exterior finish brilliant green ( isc 221 ) paint as per is 2932 ( q3 ) , aluminium paint in dual container as per is 2339 ( q3 ) , general purpose thinner ...

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
26

Government Departments - Izatnagar - Uttar Pradesh

43190327 supply of paint ready mixed, air drying, red oxide zinc chrome, priming to is:2074 ( part-1 ) / 2015 ( reaffirm ed 2020 ) along with rdso amndt. no. 1a ( rev.1.0 effective from june-2020 ) as an additional requirement with a dditional requirement of icf / md / spec. 045 issue status 02, rev. no. 03 dated 14.06.2007. packed in 20 ltrs. ne w and sound non returnable m.s. drum to is:2552 / 1989 with amndt. 1 of april-1999, grade b-1. [ warranty peri od: 30 months after the date of deli...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
27

Government Departments - Mumbai - Maharashtra

43189828 quotation invited only from paint manufacturers for supply of dry dock paints to mt desh shanti at asry bahrain eta 1st week of may 2024 on fob basis. svr percent value for each paint item should be mentioned

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
28

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43189758 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 2052

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
29

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43189752 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 1938

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43189749 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 1951

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - Jammu - Jammu And Kashmir

43189744 bids are invited for paint og duco -paint black duco , paint og duco , primer red oxied duco 1 ltr pack , thinner duco 5 ltr pack , asain paints apcolite premium gloss enamel black paint 1 ltr pack , asain paints apcolite premium gloss enamel bus green paint 1 ltr pack , asain paints apcolite premium gloss enamel white 1 ltr pack , asain paints apcolite premium gloss enamel golden brown paint 1 ltr pack , asain paints apcolite premium gloss enamel dark blue 1 ltr pack , asain p...

Due Date : May 8, 2024
Tender Value : rupee 5 Lakhs
View Notice
32

Government Departments - Dibrugarh - Assam

43189568 bids are invited for paint, rfu, finishing, air drying brushing sprying ( q3 ) , enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) , ready mixed paint, air drying, red oxide - zinc phosphate, priming as per is 12744 ( q3 ) total quantity : 58

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
33

Government Departments - Sultanpur - Uttar Pradesh

43189394 bids are invited for rc for paint and primer and thinner epoxy based zinc phosphate primer to is13238 grey epoxy based finish paint to is14209 smoke grey to shade no 692 of is 5 as per specification aa56131 poly amide cured epoxy based mio tio2 pigmented intermediate coat paint spec aa56112 epoxy based zinc rich primer paint two pack as per specification aa56114 to is14589 gr ii chemical resistant epoxide finishing paint light grey is 14209 spec aa56131 chemical resistant epoxide red...

Due Date : Apr 27, 2024
Tender Value : Ref. Document
View Notice
34

Government Departments - kapurthala - Punjab

43189201 supply of pu paint top coat two packs ( shade to be advise later on ) , as per drawing / spec ification: rdso no. m&c.pcn / 100 / 2018. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - mumbai - Maharashtra

43188925 supply of enamel synthetic, exterior brushing, finishing, air craft blue to icf specification: icf / md / spec-0 45 issue states-02, rev-03 and is:8662 / 2004, 2nd revision ( reaffirmed 2019 ) except clause c-3, with rdso a mdt. no. 1a ( rev.1 ) as an additional requirement with rdso amendment no.1 ( rev.0 ) for pigment content as a n additional requirement to is:8662 / 2004 isc shade no.108 to is:5 / 2007 ( reaffirmed-2022 ) . packing condition: p acking in 20 ltrs. new non-returnab...

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
36

Government Departments - Tirupati - Andhra Pradesh

43188910 supply of paint enamel synthetic mid brunswick green finishing exterior isc 226 to is: 8662 ( reaffirmed 20 19 ) , with additional requirement of icf / md / spec-045, issue status 02, rev.03 with amendment dt.22-04-2008. the pigment content shall be 6% minimum ( by mass ) as per rdso letter no.m&c / pcn / i / 64 / i / vol.ii, dt: 12.05. 2016 as rdso amdt. no.1.packing condition : packing in 20ltrs. new non-returnable m.s. drums to is:2 552 / 89 with amendment no.1, grade b2 [ warrant...

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Jodhpur - Rajasthan

43188588 quotation for consumables and non-consumables -1. primer kras exon 2f (gtgtgacatgttctaatatagtca) 2. primer kras exon 2r (gaatggtcctgcaccagtaa) 3. primer kras exon 3f (tcaagtcctttgcccatttt) 4. primer kras exon 3r (tacacaaagaaagccctcccc) 5. primer kras exon 4f (ttgtggacaggttttgaaaga) 6. primer kras exon 4r (agaagcaatgccctctcaag) 7. 2x platinum superfi pcr pcr master 8. highprep pcr – dx (5ml) 9. highprep dtr-dx (5ml) 10. mymag™ 96x magnetic plate

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
38

Boards / Undertakings / PSU - Rupnagar - Punjab

43188412 providing and applying polyurethane resin based protective coating system on the roof of main electrical workshop inside factory area, nfl nangal unit.

Due Date : May 22, 2024
Tender Value : rupee 23.78 Lakhs
View Notice
39

Government Departments - kolkata - West Bengal

43186281 supply of alkyd modified synthetic enamel aircraft blue.alkyd modified synthetic enamel aircraft blue., alkyd modified synthetic enamel uv resistant, high gloss and colour ret ention, aircraft blue, [ isc no-108 ] , exterior finishing to is:8662 / 2004 and icf str no.- icf / md / spec-045, [ issue status02, rev. 03. ] amendment vide ifcs letter no. md / d / pt / policy / 73-a dated 22.04.2008. spec: ( shelf life of this item is 12 months )

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
40

Government Departments - Bhubaneswar - Odisha

43186248 supply of high density fabric construction paint roller.high density fabric construction paint roller., high density fabric construction paint roller with cotton felt type with handle for application on metalli c surface enamel painting, size-6 inch length, and 2-inch dia [ warranty period: 30 months after the date of deliv ery ]

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
41

Government Departments - Bangalore - Karnataka

43185876 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 90

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
42

Government Departments - Mancheswar - Odisha

43185770 supply of epoxy thinner compatible with epoxy paints.epoxy thinner compatible with epoxy paints., epoxy thinner compatible with epoxy paints, to drawing / specification rdso spec. no. m&c / p cn / 100 / 2018 with amendment no. 1b ( rev-2.0 ) as an additional requirement, colour shade: ral-7012. [ warra nty period: 30 months after the date of delivery ] => limited

Due Date : Apr 30, 2024
Tender Value : Ref. Document
View Notice
43

Government Departments - Jharsuguda - Odisha

43185338 bids are invited for enamel paints red oxide metal primer paints , enamel paint blue , enamel orange paint , synthetic enamel paint post office red , enamel green paint , thinner in 20 ltr total quantity : 2620

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
44

Government Departments - bangalore - Karnataka

43184872 supply of paint, premium gloss, synthetic, enamel, interior finishing, shade: quick silver ( first quality ) . brand: apcolite to shade no. 8307 of asian color palette, page no 119 or equivalent shade in berger or shal imar or sheenlac or nippon. [ warranty period: 30 months after the date of delivery ]

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
45

Government Departments - Ernakulam - Kerala

43184771 bids are invited for procurement of paints paint brush 4 inch , paint brush 2 inch , paint brush 1 inch , paint rfu golden yellow , paint rfu signal red , paint rfu azure blue , paint rfu black , paint rfu green , paint exterior rfu finishing white , paint rfu navy blue , paint rfu spraying white total quantity : 1097

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
46

Boards / Undertakings / PSU - Shahjahanpur - Uttar Pradesh

43184499 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) , ready mixed paint, air drying, red oxide zinc chrome, priming as per is 2074 ( q3 ) , thinner for synthetic paints and varnishes-is: 14314 ( q3 ) total quantity : 1810

Due Date : May 1, 2024
Tender Value : rupee 35.71 Lakhs
View Notice
47

Government Departments - lallaguda - Telangana

43184118 supply of paint polyurethanepaint polyurethane, paint polyurethane papyrus white ( metallic finish ) ral 9018 ( two pack ) to rdso spec no. m&c / pc n / 100 / 2018. packing in new steel drums plain ( non-returnable ) 20 liters capacity to is:2552 / 89 grade b2. [ warranty period: 30 months after the date of delivery ]

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
48

Government Departments - Chennai - Tamil Nadu

43184094 supply of paint ready mixed, brushing, bituminous, blackpaint ready mixed, brushing, bituminous, black, paint ready mixed, brushing, bituminous, black, lead free, acid alkali water and heat resistanc e for general purpose to spec.is:158 / 2015 ( ra 2020 ) packing condition- packed in20 liters new, sound and n on-returnable ms drums to is 2552 / 89 ( ra -2018 ) with amdt.no.1 gr.b2. [ warranty period: 30 months after t he date of delivery ] => l...

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
49

Government Departments - bangalore - Karnataka

43184093 supply of enamel sysnthetic paint for exterior fin [ enamel sysnthetic paint for exterior finishing paint as per is-2932 latest revision to the following specifications: ( a ) colour shade: apple green. ( b ) isc number:281 ( c ) wet opacity ( minimum ) :210 m2 / 10 litre ( d ) packing size:20litre ( e ) packing material: steel drums / metal container as per is 2552 ( f ) paint should be suitably for both brush painting and air spraying thinning ( g ) sur...

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
50

Government Departments - Chennai - Tamil Nadu

43184090 supply of paint ready mixed, `black brushing, finishing exterior semi glosspaint ready mixed, `black brushing, finishing exterior semi gloss, paint ready mixed, `black brushing, finishing exterior semi gloss for general purpose to spec.i s:13607 / 92 ( ra - 2019 ) amdt.no. 2 july 2021. packing condition- packed in20 liters new, sound and non-retu rnable ms drums to is 2552 / 89 ( ra -2018 ) with amdt.no.1 gr.b2 [ warranty period: 30 months after the date o f d...

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
51

Government Departments - Jhajjar - Haryana

43184038 tender for dhandlah block: beri panchayat: dhandlan dist.: jhajjar annual maintenance. work for water supply. 1 building material/ paints job work for scraping old paint and painting with primer and 2 coats of new paint of asian/nerolec brand on delivery pipelines, sluice valves, nrvs, tees, bends, ms covers & other misc items for marking of direction, of flow by skilled painter complete in all respect / job work for painting of p/ chamber and other work complete with all required / at w/w dh...

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
52

Government Departments - BERI - Haryana

43184033 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
53

Government Departments - BERI - Haryana

43184032 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
54

Government Departments - Beri - Haryana

43184031 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
55

Government Departments - Beri - Haryana

43184027 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
56

Government Departments - Beri - Haryana

43184026 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
57

Government Departments - Beri - Haryana

43184018 tender for annual maintenance work for water supply -building material/ paints

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
58

Government Departments - Beri - Haryana

43184017 tender for annual maintenance work for water supply -building material/ paints -job work for scraping old paint and painting with primer and 2 coats of new paint of asian/nerolec brand on delivery pipelines, sluice valves, nrvs, tees, bends, ms covers & other misc items for marking of direction, of flow by skilled painter complete in all respect / job work for painting of p/ chamber and other work complete with all required / at w/w dighal (chindran pana)

Due Date : Apr 23, 2024
Tender Value : rupee 19500.0
View Notice
59

Government Departments - Ajmer - Rajasthan

43183871 supply of pu surfacer whitepu surfacer white, pu surfacer white rdso spec. no. m&c / pcn / 100 / 2018 with rdso amendment n o. 1b ( rev 2.0 effective from sept- 2020 ) ( required in 4 ltr. pack ) [ warranty period: 30 month s after the date of delivery ] sr. section engineer rajasthan 64.00 litre => limited

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
60

Boards / Undertakings / PSU - Saharanpur - Uttar Pradesh

43183822 bids are invited for double coat painting work with putty in boys hostel ground floor with material and labour (q3) total quantity : 862

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
61

Cooperative - Tirupathur - Tamil Nadu

43183679 paints , golden yellow , synthetic enamel jade green , red oxide primer , acid alkali black , h r white paint , synthetic enamel azure blue , synthetic enamal white , thinner , stainner blue 250 ml each , robin blue powder 1 kg pack

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
62

Boards / Undertakings / PSU - Ratnagiri - Maharashtra

43183271 bids are invited for paint for em dept -aluminium industrial paint with aluminium paste two pack air drying synthetic resin based , smoke grey color high glossy industrial polyurethane pu paint with hardner two component , mastic self priming with hardner for steel surface color light grey high glossy two compo , thinner for mixing high glossy industrial polyurethane pu paint technical specifications , light grey color high glossy industrial synthetic enamel ready mixed single pac...

Due Date : Apr 26, 2024
Tender Value : rupee 12.04 Lakhs
View Notice
63

Boards / Undertakings / PSU - Multi State

43183025 procurement of autosurfacer paints

Due Date : May 16, 2024
Tender Value : Ref. Document
View Notice
64

Government Departments - kapurthala - Punjab

43182490 supply of primer and thinner.primer and thinner., primer and thinner for conveyorised painting system, as per drawing / specifica tion: mplconveypt version 6. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
65

Boards / Undertakings / PSU - Raipur - Chhattisgarh

43182016 contract of supply and application of paint on old structural steel in ash handling system, stage i and ii sipat/ntpc.

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
66

Government Departments - kapurthala - Punjab

43180502 supply of paint ready mixed primer zinc chromatepaint ready mixed primer zinc chromate, paint ready mixed primer zinc chromate, as per drawing / specification: is:2074-1992. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
67

Statutory Bodies & Commissions/Committees - kalaikunda - West Bengal

43178684 tender for improvement to certain smq / omq at afs salua; 1 taking down cement plaster of any description on brick or stone walls, etc. including raking out joints, hacking for key, scrubbing down with water etc and removing the debries outside of mod land, complete all as specified and directed. 2 demolition of un-reinforced cement concrete of any description and in any position not otherwise specifically provided for and disposal of unserviceable materials, debris and rubbish to a...

Due Date : Apr 29, 2024
Tender Value : rupee 4.20 Crore
View Notice
68

Government Departments - Baramulla - Jammu And Kashmir

43178239 tender for building, defence material, sanitary, hardwear items, stationary items, electric items, electronics, furniture, soports items, crockery and printing material for the year 2024 and 25--- 1 building material 2 killen bricks a class 3 bajri crusher 4 bajri nallah 5 sand 6 bolder stone nallah 7 rubber stone 8 black cutting 9 stone dust crusher 10 hollow blocks 8x16 cement 11 empty cement bag fresh 12 polthene sheets blue 13 polthene sheets plain 14 cement 4...

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
69

Statutory Bodies & Commissions/Committees - Daman - Daman And Diu

43177556 bids are invited for lp of consumable naval store items automatic air freshner , super mop , tray paint roller , paint green , paint intergard 251 red oxide , paint navy blue , paint golden yellow , paint fluorescent yellow , paint fluorescent red , paint fluorescent green , paint dark grey , paint black enamel , paint azure blue , feather broom , duster cloth , cloth sponge , cleaner white tolilet harpic , cloth stocknite mutton cloth , broom country , paint terracota red , ...

Due Date : May 7, 2024
Tender Value : rupee 1.86 Lakhs
View Notice
70

Government Departments - Kharagpur - West Bengal

43177015 supply of pu paint, shade: golden yellow ( ral1004 ) .drawing no.icf drg. no. emu / m11 / asr-8-3-101, alt. nil. matl. & spec.: epoxy cum polyurethane painting system ( two pack ) for the exterior painting of railway coa ches as per rdso specn. no.m&c / pcn / 100 / 2018 and rdso amendment no. 1b ( rev. 2.0, effective from sep tember-2020 ) as an additional requirement. ( shelf life of the item is 12 months ) . [ warranty period: 12 months af ter the date of delivery ] workshop carria...

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
71

Government Departments - Jhansi - Uttar Pradesh

43176694 supply of epoxy primer for painting of lhb bogie.epoxy primer for painting of lhb bogie., epoxy primer for painting of lhb bogie frames as per rdso spec.no.rdso / m&c / pcn / 123-06. a s per specn. rdso / m&c / pcn / 123-06. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
72

Government Departments - rourkela - Odisha

43176475 supply of paint alluminium for general purpose [ in dual container ] to is: 2339 / 1963 am endment no. 3. ( shelf life of this item is 12 months ) [ warranty period: 30 months after the date of delivery ] electric loco shed stores / bndm, odisha 500.00 litre

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
73

Government Departments - Bhubaneswar - Odisha

43176461 supply of paint synthetic enamel exterior, satin blue finishing., paint synthetic enamel exterior, satin blue finishing, to drawing / specification is:8662 / 04, rdso amendment no.1 ( revision - 0 ) for pigment content as an additional requirement to is:8662-2004 w.e.f. 01.08.20 16, with additional requirements of icf / md / spec-045, issue status - 02, rev-03 dated 14.06.2007 and rdso a mendment no. 1a as an additional requirement. [ warranty period: 30 months after the date of de...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
74

Government Departments - TUTICORIN - Tamil Nadu

43176411 bids are invited for thinner for epoxy paints ( bhel ) ( q3 ) mse total quantity : 100

Due Date : Apr 30, 2024
Tender Value : rupee 11833.0
View Notice
75

Statutory Bodies & Commissions/Committees - KORAPUT - Odisha

43176223 bids are invited for enamel, synthetic, exterior ( a ) under coating ( b ) finishing paint ( v2 ) as per is 2932 ( q3 ) total quantity : 80

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
76

Government Departments - Nagpur - Maharashtra

43175975 bids are invited for aluminium paint for general purposes in dual container as per is 2339 ( q3 ) total quantity : 13000

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
77

Boards / Undertakings / PSU - Moga - Punjab

43175118 tender for purchase of pain & its allied accessoris for various 220/132 kv sub stations under p&m division, pstcl, moga- 1) red oxide metal primer isi marked & in accordance with is (indian standard) make:- berger, asian, nerolac or equivalent packing-1 ltr 2) light grey shade 631 of is:5 isi marked & in accordance with is (indian standard) make:- berger, asian, nerolac or equivalent packing-1 ltr. 3) turpentine oil in accordance with is (indian standard) make:- berger, asian, nerolac or equiva...

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
78

Government Departments - Jhansi - Uttar Pradesh

43175076 supply of paint enamel synthetic exterior brushing.paint enamel synthetic exterior brushing., paint enamel synthetic exterior brushing air craft blue to is: 8662 / 2004, or latest isc no. 108 to is : 5 / 1994, gloss 86 and above, wet opting 18 sq.mtr. per ltr, packing in 20 ltrs new non-returnable drums to is: 25 52 / 89 or latest gr.b-ii [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
79

Government Departments - Tirupati - Andhra Pradesh

43174993 supply of paint synthetic enamel post office redpaint synthetic enamel post office red, paint synthetic enamel post office red exterior finishing isc 538 to i.s:8662 / 2004 with rdsoam endment no. 1 ( rev. 0 ) for pigment content as an additional requirement to is: 8662-2004 w.e.f.01.08.2016. we t capacity 6 sq.m / litre packed in new steel drums plain ( non-returnable ) 20 ltrs. conforming to is:2552 / 89.gr.b -2. [ warranty period: 30 months after the date of delivery ...

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
80

Government Departments - mumbai - Maharashtra

43174975 supply of full gloss polyurethane enamel paintfull gloss polyurethane enamel paint, full gloss polyurethane enamel paint ( two pack ) colour shade ral- 260 60 35 conf orming to rdso spec. no. m&c / pcn / 100 / 2018 or latest [ warranty period: 30 months after the date of deliver y ]

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - Bangalore - Karnataka

43174974 supply of paint, synthetic enamel exterior satin bluepaint, synthetic enamel exterior satin blue, paint, synthetic enamel exterior satin blue finishing isc:177 to specn.no is:8662 / 2004 and colou r to is:94 alongwith additional requirements stipulated in icf specn.icf / m / d specn-045, issue status-02, revisi on-03. dated 14.06.2007, packed in 20 ltrs net in new and sound non-returnable m.s. drums to is:2552 / 89 grade b2. [ warranty period: 12 months after the date o...

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
82

Government Departments - Jhansi - Uttar Pradesh

43174971 supply of paint enamel synthetic dove grey.paint enamel synthetic dove grey., paint enamel synthetic dove grey exterior type-i, finishing to isc:694 to is:8662 / 2004 ( second rc vision ) in 20 ltrs. new non-returnable m.s. drums to is:2552 / 89, gr. b-ii. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
83

Government Departments - Kanpur - Uttar Pradesh

43174960 supply of paint ready mixed brushing finishing.paint ready mixed brushing finishing., paint ready mixed brushing finishing bituminous black lead free acid alkali water and heat resisting for general purpose to is:158, in 20 ltrs. new non-returnable m.s. drums to is:2552 / 89 with.amdt-1. gr.b-ii. [ wa rranty period: 30 months after the date of delivery ] gsd / kanpur, ncr uttar pradesh 4000.00 litre => limited

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
84

Boards / Undertakings / PSU - Hyderabad - Telangana

43174747 tender for purchased for following items- acrylic based chemical waterproofing treatment at cnsg building at ecil, hyderabad providing and applying shrinkage crack filler of dr. fixit crack x paste or other equivalent material including opening the loose part of the existing crack, making the same in v-shape in required depth & width, cleaning the groove by removing dust, oil, grass, loose particles etc., press the crack filler into the crack one time only with a spatula or putty knite and lev...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
85

Government Departments - Kanpur Nagar - Uttar Pradesh

43174618 bids are invited for thermal insulation detail specification as per annexure a metal false ceiling detail specification as per annexure a epoxy flooring detail specification as per annexure a 75 mm height epoxy coving detail specification as per annexure a expansion joint by rasin and hardener detail specification as per annexure a earth work in excavation detail specification as per annexure a pcc 1 4 8 detail specification as per annexure a rcc 1 1 5 3 detail specificat...

Due Date : May 6, 2024
Tender Value : rupee 88.94 Lakhs
View Notice
86

Statutory Bodies & Commissions/Committees - Chandrapur - Maharashtra

43174595 bids are invited for cmri tested anti rust paints ( q3 ) mse total quantity : 1350

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
87

Government Departments - Tuticorin - Tamil Nadu

43174470 bids are invited for aluminum paint, heat resistant as per is 13183 ( q3 ) mse total quantity : 100

Due Date : Apr 30, 2024
Tender Value : rupee 27500.0
View Notice
88

Government Departments - Tuticorin - Tamil Nadu

43174442 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) mse total quantity : 40

Due Date : Apr 30, 2024
Tender Value : rupee 13733.0
View Notice
89

Government Departments - Mysore - Karnataka

43174413 bids are invited for enamel paint remover (q2) total quantity : 240

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
90

Boards / Undertakings / PSU - Bokaro - Jharkhand

43174318 bids are invited for paint, heat resistant, al sil base, is: 13183, 1991 ( q3 ) total quantity : 11050

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
91

Government Departments - Bhopal - Madhya Pradesh

43174266 bids are invited for inorganic ethyl zinc silicate primer as per bhel spec. no. aa56113 rev02. aa5610013011 ( q3 ) total quantity : 300

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
92

Statutory Bodies & Commissions/Committees - Jorhat - Assam

43174197 bids are invited for distemper weather coat 20 kg (q3) total quantity : 2500

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
93

Boards / Undertakings / PSU - Idukki - Kerala

43173803 tender for bulk purchase of research chemicals/labwares/oligonucleotides primers under various projects at cardamom research station, pampadumpara for the financial year 2024-25.

Due Date : May 3, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - Tirupati - Andhra Pradesh

43173691 supply of paint enamel exterior blackpaint enamel exterior black, paint enamel exterior black finishing to is: 8662 / 2004 with additional requirements of spec icf / md / spec045 issue status 02, revision 03. [ item packed in 20 ltrs new & sound non returnable m.s. drums to is 25 52 / 89 grade b -ii ]

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
95

Government Departments - ghaziabad - Uttar Pradesh

43173419 supply of enamel synthetic exterior under coating pale cream spec.is:8662 / 2004 ( second rev. ) and rdso amendment no.1 ( rev. 0 ) for pigment content as an additional requirement to is 8662 / 2004 w.e.f 1.8.2016 with a dditional requirement of icf / md / md / spec.-045, issue status -02, rev- no. 03, dt.14.6.2007 isc:352 with rds o amendment no.1a with fire retardant properties as per rdso spec. m &c / pcn / 120-2011 ( rev.-1 ) dated feb 2011. [ warranty period: 30 months after th...

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
96

Government Departments - jhansi - Uttar Pradesh

43172084 supply of paint enamel synthetic exterior brushing finishing oxford blue to is:8662 / 2004, or latest. isc no. 105 to is: 5 / 1994, gloss 86 and above, wet opacity 12 sq. mtrs. per ltr. packing in in 20 ltrs. new non-returnable m.s. drums to is:2552 / 89 or latest. gr. b-ii.paint enamel synthetic exterior brushing finishing oxford blue to is:8662 / 2004, or latest. isc no. 105 to is: 5 / 1994, gloss 86 and above, wet opacity 12 sq. mtrs. per ltr. packing in in 20 ltrs. new n...

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
97

Government Departments - Ghaziabad - Uttar Pradesh

43171939 supply of enamel synthetic exterior finishing mid brunswick greenenamel synthetic exterior finishing mid brunswick green, enamel synthetic exterior finishing mid brunswick green paint isc no. 226, to bis spec. 8662 / 20 04 or latest with fire retardant properties as per rdso spec. m &c / pcn / 120-2011 ( rev.-1 ) dated feb2011 [ wa rranty period: 30 months after the date of delivery ]

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
98

Statutory Bodies & Commissions/Committees - Jorhat - Assam

43170754 bids are invited for terracotta 20 ltr pack ( q3 ) total quantity : 1200

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
99

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

43170707 bids are invited for protector right qty 20 nos -aluminium sheet 3 mm thick x 900 x 1800mm is 737 gde 54300 , aluminium sheet 1 25 mm thick x 900 x 150mm is 737 gde 54300 , aluminium tube 25 mm od x2 mm thick x 3 6 mtr length738 gde nts condition 1by2 hard , single layer nylon impregated rubber sheet 4 mm thick x130 mm width x 1750 mm length shore a 66by75 , stainless steel hammer drive screw type u 1 5 mm dia x 6 mm long , aluminium rivet csk head 4 mm dia 15 mm long , aluminium...

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
100

Government Departments - Vijayawada - Andhra Pradesh

43170301 supply of paint synthetic enamel exterior light biscuit finishing, isc - 385 to is:8662 / 04 or latest and icf s pecn no.icf / md / spec-45 issue -02 revision no.03. packed in new steel drums plain ( non-returnable ) 20 ltrs c apacity to is:2552 / 1979 gr.b2 to pl.no 77034570. make: asian / dulux / berger / nerolac / shalimar / indigo / pr olite / karbonn. note: ( 1 ) date of mfg and net weight to printed on the drum. ( 2 ) green-co objectives: this sh ed is certified green...

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail