PCR And RT PCR Products Tenders from India

81 PCR And RT PCR Products tenders are published by various Tendering Authorities & Private companies. 81 live Tender for PCR And RT PCR Products are available in PCR And RT PCR Products Tender section You can further filter PCR And RT PCR Products tenders by Tender Value, Tender Submission Date or Project Location.

1

Government Departments - Mumbai Suburban - Maharashtra

49950229 bids are invited for cbnaat mtbrif ultra pcr test kit (q3) ( pac only ) mse total quantity : 200

Due Date : Jul 12, 2025
Tender Value : Ref. Document
View Notice
2

Government Departments - Nabarangpur - Odisha

49950146 bids are invited for automated real time micro pcr machine (q2) ( pac only ) ((3 3 )) 147 lakh (s) total quantity : 33

Due Date : Jul 12, 2025
Tender Value : Ref. Document
View Notice
3

Government Departments - Amreli - Gujarat

49950077 bids are invited for pcr master mix (q3) ((3 3 )) 1 lakh (s) total quantity : 1

Due Date : Jul 22, 2025
Tender Value : Ref. Document
View Notice
4

Government Departments - Thiruvarur - Tamil Nadu

49949964 bids are invited for micro pcr mtb test kit (q3) ((3 3 )) 2 lakh (s) total quantity : 750

Due Date : Jul 12, 2025
Tender Value : Ref. Document
View Notice
5

Local Bodies - Mahendragarh - Haryana

49949959 bids are invited for title2 - cuvette , title3 - resazurin sodium , title5 - alamarblue hs cell viability reagents , title6 - dimethyl sulphoxide , title7 - carbinol hplc , title8 - mtt , title9 - 96 well plate , title10 - todd hewitt broth , title11

Due Date : Jul 23, 2025
Tender Value : Ref. Document
View Notice
6

Statutory Bodies & Commissions/Committees - delhi - Delhi

49945607 tender for supply of coumbales

Due Date : Jul 7, 2025
Tender Value : Ref. Document
View Notice
7

Government Departments - Ernakulam - Kerala

49934431 bids are invited for rt pcr kit - one step primescript , microamp 8-tube strip - stepone plus , pcr plate - abi semiskirted plate , optical 8 cap strip - abi qs3 rt pcr , pcr plate 0.1 ml - abi stepone plus , 8 tube strip 0.2 ml - abi qs3 rt pcr tota

Due Date : Jul 22, 2025
Tender Value : Ref. Document
View Notice
8

Government Departments - Valsad - Gujarat

49929534 bids are invited for automated real time micro pcr machine (q2) ((3 3 )) 4 lakh (s) total quantity : 1

Due Date : Jul 16, 2025
Tender Value : rupee 9.50 Lakhs
View Notice
9

Government Departments - Raipur - Chhattisgarh

49926828 bids are invited for real time pcr kits (v2) total quantity : 400

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
10

Government Departments - uppal - Telangana

49925566 tender for procurement of chemical products

Due Date : Jul 7, 2025
Tender Value : rupee 2.50 Lakhs
View Notice
11

Boards / Undertakings / PSU - Thiruvananthapuram - Kerala

49925308 tender for all prep dna rna protein mini kit 50 , mircury lna mirna focus pcr panels etc

Due Date : Jul 17, 2025
Tender Value : rupee 4.32 Lakhs
View Notice
12

Government Departments - kolkata - West Bengal

49922914 tender for e- tender notice inviting for purchase of respiratory viral pathogen panel rt-pcr kit for microbiology department , respiratoryviral pathogen panel rt-pcr kit

Due Date : Jul 18, 2025
Tender Value : Ref. Document
View Notice
13

Statutory Bodies & Commissions/Committees - Rajouri - Jammu And Kashmir

49917349 bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) (( 3 3 4 lakh (s) )) total quantity : 100

Due Date : Jul 21, 2025
Tender Value : Ref. Document
View Notice
14

Government Departments - Thiruvananthapuram - Kerala

49916843 bids are invited for , real time pcr system total quantity : 1

Due Date : Jul 21, 2025
Tender Value : Ref. Document
View Notice
15

Local Bodies - S.a.s Nagar - Punjab

49908733 bids are invited for , qualitative pcr machine (thermal cycler) total quantity : 1

Due Date : Jul 21, 2025
Tender Value : Ref. Document
View Notice
16

Boards / Undertakings / PSU - kolkata - West Bengal

49904725 supply of 1. recombinant ribonuclease inhibitor 2. m-m-mlv reverse transcriptase (200u/microlit) 3. green master mix for q pcr

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
17

Local Bodies - Parbhani - Maharashtra

49899392 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 7 lakh (s) total quantity : 1

Due Date : Jul 14, 2025
Tender Value : rupee 15 Lakhs
View Notice
18

Government Departments - Kolkata - West Bengal

49898787 tender for supply of the items

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
19

Government Departments - Bengaluru Urban - Karnataka

49880839 bids are invited for , real time pcr machine (v2) total quantity : 1

Due Date : Jul 18, 2025
Tender Value : Ref. Document
View Notice
20

Government Departments - Hyderabad - Telangana

49876736 bids are invited for real time pcr kits (v2) (q2) 2 year (s) total quantity : 960

Due Date : Jul 7, 2025
Tender Value : rupee 5.95 Lakhs
View Notice
21

Government Departments - Bhubaneswar - Odisha

49873036 tender for nucleospin plasmid 250 rxn 1, tb green advantage qpcr premix 200 rxns, advantage 2 pcr kit 100 rxns, solid baffle for larvae for 1l 5ml, breeding tank, nucleospin gel and pcr clean up 250 rxn 1

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
22

Statutory Bodies & Commissions/Committees - pune - Maharashtra

49872070 tender for rt-pcr master mix

Due Date : Jul 4, 2025
Tender Value : rupee 7.97 Lakhs
View Notice
23

Government Departments - roorkee - Uttarakhand

49865644 tender for end-point thermal cycler

Due Date : Jul 17, 2025
Tender Value : Ref. Document
View Notice
24

Government Departments - delhi - Delhi

49865525 tender for supply, installation, testing and commissioning of pcr machine at nipgr

Due Date : Jul 23, 2025
Tender Value : rupee 6 Lakhs
View Notice
25

Government Departments - Karur - Tamil Nadu

49861307 bids are invited for micro pcr mtb test kit (q3) ((3 3 )) 2 lakh (s) total quantity : 990

Due Date : Jul 11, 2025
Tender Value : Ref. Document
View Notice
26

Local Bodies - Ranga Reddy - Telangana

49861043 bids are invited for real time pcr machine (v2) (q2) mse total quantity : 1

Due Date : Jul 17, 2025
Tender Value : Ref. Document
View Notice
27

Government Departments - Delhi - Delhi

49860741 bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) ((3 3 )) 3 lakh (s) total quantity : 500

Due Date : Jul 7, 2025
Tender Value : Ref. Document
View Notice
28

Government Departments - Thiruvananthapuram - Kerala

49858658 bids are invited for all prep dna rna protein mini kit 50 - attached , mircury lna mirna focus pcr panels - attached , mirneasy ffpe kit - attached , mircury lna rt kit - attached , mircury lna sybr green pcr kit - attached total quantity : 5

Due Date : Jul 17, 2025
Tender Value : Ref. Document
View Notice
29

Local Bodies - Delhi - Delhi

49855692 bids are invited for automated real time micro pcr machine (q2) ( pac only ) ((3 3 )) 9 lakh (s) total quantity : 1

Due Date : Jul 8, 2025
Tender Value : Ref. Document
View Notice
30

Boards / Undertakings / PSU - Medinipur - West Bengal

49853048 tender for the reputed manufacturers, servicing centre for the repairing and maintenance of himedia* thermal cycler (eco-96) at department of microbiology, vidyasagar university, paschim medinipur- 72tt02

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
31

Government Departments - Mumbai - Maharashtra

49850899 bids are invited for , pcr tubes total quantity : 1

Due Date : Jul 18, 2025
Tender Value : Ref. Document
View Notice
32

Government Departments - delhi - Delhi

49848147 tender for sitc of pcr machine thermal cycler at nipgr

Due Date : Jul 22, 2025
Tender Value : rupee 6.48 Lakhs
View Notice
33

Boards / Undertakings / PSU - Amritsar - Uttarakhand

49846974 tender for the service of sanger sequencing 550bp with one primer for 123 samples (unpurified pcr products)

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
34

Government Departments - jhajjar - Haryana

49846227 tender for sitc of digital pcr

Due Date : Jul 14, 2025
Tender Value : rupee 90 Lakhs
View Notice
35

Local Bodies - Aligarh - Uttar Pradesh

49835610 bids are invited for , real time pcr kits (v2) total quantity : 1

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
36

Statutory Bodies & Commissions/Committees - Udhampur - Jammu And Kashmir

49835127 bids are invited for real time pcr kit for detection of helicobacter pylori 96 test including extraction kit & controle , real time pcr hpv , disease specific real time pcr kits total quantity : 4

Due Date : Jul 17, 2025
Tender Value : Ref. Document
View Notice
37

Government Departments - Kokrajhar - Assam

49833350 tender for supply, installation and commissioning of thermal cycler (pcr machine)

Due Date : Jul 12, 2025
Tender Value : Ref. Document
View Notice
38

Government Departments - Mumbai Suburban - Maharashtra

49833197 bids are invited for , taq dna polymerase total quantity : 50

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
39

Government Departments - Kendujhar - Odisha

49820933 bids are invited for automated real time micro pcr machine (q2) ( pac only ) ((3 3 )) 134 lakh (s) total quantity : 30

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
40

Government Departments - Dharmapuri - Tamil Nadu

49813769 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 1000

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
41

Government Departments - Imphal West - Manipur

49813554 bids are invited for molecular diagnostic extraction kits (q3) , real time pcr kits (v2) (q2) ((3 3 )) 10 lakh (s) total quantity : 2880

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
42

Government Departments - Dibrugarh - Assam

49813464 bids are invited for , pcr amplification kit total quantity : 2

Due Date : Jul 15, 2025
Tender Value : Ref. Document
View Notice
43

Government Departments - Chennai - Tamil Nadu

49798819 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 746

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
44

Government Departments - Chennai - Tamil Nadu

49795823 bids are invited for micro pcr mtb test kit (q3) 2 year (s) total quantity : 6850

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
45

Government Departments - Kokrajhar - Assam

49794954 tender for procurement of thermal cycler (pcr machine), solar hybrid power set up, lc-qtof- instru-ment and consumables etc under bongaigaon refinery, iocl sponsored project for diverse mushroom and value added mushroom product at bodoland university, kok

Due Date : Jul 8, 2025
Tender Value : Ref. Document
View Notice
46

Government Departments - Chennai - Tamil Nadu

49791251 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 746

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
47

Government Departments - Delhi - Delhi

49791026 bids are invited for , disease specific real time pcr kits total quantity : 2

Due Date : Jul 15, 2025
Tender Value : Ref. Document
View Notice
48

Government Departments - Mumbai - Maharashtra

49790692 bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) ((3 3 )) 1 lakh (s) total quantity : 100

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
49

Statutory Bodies & Commissions/Committees - Kamrup - Assam

49790452 bids are invited for , real time pcr machine total quantity : 3

Due Date : Jul 14, 2025
Tender Value : Ref. Document
View Notice
50

Boards / Undertakings / PSU - Ghazipur - Uttar Pradesh

49777269 bids are invited for automated real time micro pcr machine (q2) ((3 3 )) 20 lakh (s) total quantity : 2

Due Date : Jul 5, 2025
Tender Value : rupee 40 Lakhs
View Notice
51

Government Departments - Thiruvananthapuram - Kerala

49776873 bids are invited for real star hsv pcr kit 10 96t - altona , real star influenza sand t rtpcr kit 40 96t - altona , real star cmv pcr kit 10 96t - altona , real star dengue rtpcr kit 30 96t - altona , real star ebv pcr kit 1096t - altona , real star

Due Date : Jul 12, 2025
Tender Value : Ref. Document
View Notice
52

Government Departments - 24 Paraganas North - West Bengal

49760948 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 8 lakh (s) total quantity : 1

Due Date : Jul 4, 2025
Tender Value : rupee 17 Lakhs
View Notice
53

Boards / Undertakings / PSU - sevagram - Maharashtra

49759907 tender for annual rate contract for fever multiplex real time pcr kits

Due Date : Jul 5, 2025
Tender Value : Ref. Document
View Notice
54

Government Departments - Kanniyakumari - Tamil Nadu

49735229 bids are invited for micro pcr mtb test kit (q3) mse total quantity : 2250

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
55

Government Departments - Namakkal - Tamil Nadu

49734973 Corrigendum : bids are invited for micro pcr mtb test kit (q3) mse total quantity : 50

Due Date : Jul 2, 2025
Tender Value : Ref. Document
View Notice
56

Government Departments - Mumbai Suburban - Maharashtra

49732084 bids are invited for mass spectrometry compatiable magnetic immunoprecipitation kit based on protein ag , mass , pcr amplification kit total quantity : 3

Due Date : Jul 11, 2025
Tender Value : Ref. Document
View Notice
57

Government Departments - Karur - Tamil Nadu

49720993 bids are invited for micro pcr mtb test kit (q3) ((3 3 )) 2 lakh (s) total quantity : 990

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
58

Boards / Undertakings / PSU - Lucknow - Uttar Pradesh

49720571 bids are invited for qualitative pcr machine (thermal cycler) (q2) ((3 3 )) 4 lakh (s) total quantity : 1

Due Date : Jul 3, 2025
Tender Value : rupee 7 Lakhs
View Notice
59

Government Departments - Mumbai Suburban - Maharashtra

49720424 bids are invited for one step rt qpcr kit for detection and quantitation of rna , opti mem reduced serum medium. 100 ml , rnai transfection reagent 0.75ml , nmm . n methyl mesoporphyrin ix , pyridostatin hydrochloride greater than98percent.hplc . , c

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
60

Government Departments - Bengaluru Urban - Karnataka

49712973 bids are invited for , disease specific real time pcr kits total quantity : 1

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
61

Government Departments - delhi - Delhi

49707503 tender for real time pcr system

Due Date : Jul 8, 2025
Tender Value : Ref. Document
View Notice
62

Government Departments - Narmada - Gujarat

49699667 bids are invited for automated real time micro pcr machine (q2) ((3 3 )) 17 lakh (s) total quantity : 3

Due Date : Jul 2, 2025
Tender Value : rupee 33.75 Lakhs
View Notice
63

Government Departments - Narmada - Gujarat

49697591 bids are invited for automated real time micro pcr machine (q2) ((3 3 )) 16 lakh (s) total quantity : 2

Due Date : Jul 2, 2025
Tender Value : rupee 31 Lakhs
View Notice
64

Statutory Bodies & Commissions/Committees - Ernakulam - Kerala

49697537 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 15 lakh (s) total quantity : 1

Due Date : Jul 2, 2025
Tender Value : Ref. Document
View Notice
65

Government Departments - Mumbai Suburban - Maharashtra

49693556 bids are invited for , real time pcr kits (v2) total quantity : 100

Due Date : Jul 11, 2025
Tender Value : Ref. Document
View Notice
66

Boards / Undertakings / PSU - Delhi - Delhi

49673477 Corrigendum : bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 10 lakh (s) total quantity : 1

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
67

Government Departments - jhajjar - Haryana

49658507 tender for supply, installation, testing and commissioning of multiblock high throughput real time pcr

Due Date : Jul 14, 2025
Tender Value : rupee 20 Lakhs
View Notice
68

Government Departments - Chennai - Tamil Nadu

49646776 bids are invited for , real time pcr kits (v2) total quantity : 20

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
69

Government Departments - lucknow - Uttar Pradesh

49623180 Corrigendum : tender for supply of real time pcr kit

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
70

Government Departments - Mumbai Suburban - Maharashtra

49622999 bids are invited for l-buthionine-sulfoximine , ferrostatin-1 , mito-trfs , fast- , oligonucleotides pcr primer total quantity : 8

Due Date : Jul 2, 2025
Tender Value : Ref. Document
View Notice
71

Government Departments - Thiruvananthapuram - Kerala

49603844 bids are invited for primers desalted oligonucleotides mse primers dedalted oligonucleotides , tri-glycine sds running , oligonucleotides pcr primer total quantity : 521

Due Date : Jul 2, 2025
Tender Value : Ref. Document
View Notice
72

Government Departments - Mumbai - Maharashtra

49598715 bids are invited for consumables mse quagen multiplex pcr kit100 cat.no 206143 , dimethyl sulfoxide molecular grade cat.no d8418-50 ml. sigma , primer lis-f 5ataccatgg tta ccc cat tgagc3 , primer lis-r 5agggctcattacatgtggaccc3 , primer 4.2-f 5ggtttac

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
73

Government Departments - Jamnagar - Gujarat

49585011 bids are invited for covid-19 rtpcr test kit , influenza abh1n1h3n2 multiplex rt-pcr kit , viral transport medium kit , viral , anti - sars cov - 2 / covid - 19 elisa testing kit total quantity : 36960

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
74

Government Departments - bhopal - Madhya Pradesh

49573258 Corrigendum : tender for online rate contract tender for supply of covid consumables and kits to various hospitals of government of madhya pradesh for a period of 18 months , consumables items , 0.2 ml pcr tube with attached cap (sterile, rnase/ dnase free, flat-c

Due Date : Jul 7, 2025
Tender Value : Ref. Document
View Notice
75

Statutory Bodies & Commissions/Committees - Rajouri - Jammu And Kashmir

49568424 Corrigendum : bids are invited for micro pcr mtb test kit (q3) (( 3 3 3 lakh (s) )) total quantity : 150

Due Date : Jul 7, 2025
Tender Value : Ref. Document
View Notice
76

Government Departments - Bengaluru Urban - Karnataka

49568007 Corrigendum : bids are invited for , qualitative pcr machine (thermal cycler) total quantity : 2

Due Date : Jul 7, 2025
Tender Value : Ref. Document
View Notice
77

Statutory Bodies & Commissions/Committees - South Andamans - Andaman And Nicobar Islands

49418516 Corrigendum : bids are invited for customized amc/cmc for pre-owned products - camc of true lab quattro real time quantitative micro pcr analyser; true lab; comprehensive maintenance contract (cmc); half yearly; yes total quantity :

Due Date : Jul 2, 2025
Tender Value : Ref. Document
View Notice
78

Government Departments - Gautam Buddha Nagar - Uttar Pradesh

49239193 Corrigendum : bids are invited for thermal cycler , qualitative pcr machine (thermal cycler) total quantity : 2

Due Date : Jul 8, 2025
Tender Value : rupee 10 Lakhs
View Notice
79

Government Departments - Gautam Buddha Nagar - Uttar Pradesh

49239191 Corrigendum : bids are invited for real time pcr machine (v2) (q2) total quantity : 1

Due Date : Jul 8, 2025
Tender Value : rupee 25 Lakhs
View Notice
80

Government Departments - Delhi - Delhi

47878823 Corrigendum : bids are invited for real time pcr machine , real time pcr kits (v2) total quantity : 3

Due Date : Jul 7, 2025
Tender Value : Ref. Document
View Notice
81

Government Departments - Jodhpur - Rajasthan

47515310 Corrigendum : bids are invited for real time pcr machine (q2) total quantity : 1

Due Date : Jul 10, 2025
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail