PCR And RT PCR Products Tenders from India

40 PCR And RT PCR Products tenders are published by various Tendering Authorities & Private companies. 40 live Tender for PCR And RT PCR Products are available in PCR And RT PCR Products Tender section You can further filter PCR And RT PCR Products tenders by Tender Value, Tender Submission Date or Project Location.

1

Statutory Bodies & Commissions/Committees - Karnal - Haryana

43216257 bids are invited for real time pcr kits ( v2 ) ( q2 ) total quantity : 1920

Due Date : May 2, 2024
Tender Value : Ref. Document
View Notice
2

Government Departments - MUMBAI - Maharashtra

43214826 bids are invited for pcr master mix (q3) ( pac only ) total quantity : 2

Due Date : May 13, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - Gorakhpur - Uttar Pradesh

43204656 bids are invited for real time micro pcr ( q3 ) ( pac only ) total quantity : 1

Due Date : May 11, 2024
Tender Value : Ref. Document
View Notice
4

Government Departments - Pune - Maharashtra

43203434 bids are invited for thermo scientific products sybr nucleic acid , accuprime taq dna polymerase , glycerol purified , dna zap , pcr kit taqmantm gene expression master mix total quantity : 17

Due Date : May 10, 2024
Tender Value : rupee 5.56 Lakhs
View Notice
5

Government Departments - Chandigarh - Chandigarh

43197695 bids are invited for automated nucleic acid extraction system automated nucleic acid purification system 6 well and high throughput real time pcr instrument for viral load quantification on buy back basis , hbv viral load , hcv viral load , cmv viral load , cmc for first year , cmc for second year , cmc for third year , cmc for forth year , cmc for fifth year total quantity : 9

Due Date : May 14, 2024
Tender Value : rupee 2.45 Crore
View Notice
6

Government Departments - Pune - Maharashtra

43195410 tender for 1. superscript iii one step rt-pcr system with platinum taq high fidelity dna polymerase 30 to 10 degree c, catalog no.12574035, thermo scientific, qty. 01 no.

Due Date : Apr 30, 2024
Tender Value : Ref. Document
View Notice
7

Government Departments - jodhpur - Rajasthan

43194699 tender for outsourcing of dna methylation by sequencing at all india institute of medical sciences, jodhpur-1. quality check analysis of dna 2. sanger sequencing & data analysis 3. pcr product purification

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - Leh - Jammu And Kashmir

43191406 bids are invited for cbnaat mtb rif pcr test kit ( q3 ) total quantity : 2000

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
9

Government Departments - Jodhpur - Rajasthan

43188588 quotation for consumables and non-consumables -1. primer kras exon 2f (gtgtgacatgttctaatatagtca) 2. primer kras exon 2r (gaatggtcctgcaccagtaa) 3. primer kras exon 3f (tcaagtcctttgcccatttt) 4. primer kras exon 3r (tacacaaagaaagccctcccc) 5. primer kras exon 4f (ttgtggacaggttttgaaaga) 6. primer kras exon 4r (agaagcaatgccctctcaag) 7. 2x platinum superfi pcr pcr master 8. highprep pcr – dx (5ml) 9. highprep dtr-dx (5ml) 10. mymag™ 96x magnetic plate

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
10

Government Departments - raipur - Chhattisgarh

43188051 gte for supply and installation of real time pcr system for department of biochemistry at aiims raipur

Due Date : May 15, 2024
Tender Value : Ref. Document
View Notice
11

Government Departments - Dibrugarh - Assam

43185433 bids are invited for pcr master mix (q3) total quantity : 30

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
12

Boards / Undertakings / PSU - Kolkata - West Bengal

43183764 tender for supply of the following items - adenovirus rt-pcr kit. (100 reaction) along with adenovirus dna extraction kit. (100 reaction) (specification attached here with)

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
13

Local Bodies - Delhi - Delhi

43183248 bids are invited for rt pcr machine ( q3 ) total quantity : 1

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
14

Local Bodies - Bhopal - Madhya Pradesh

43182969 bids are invited for real time pcr (icmr specs) (q3) total quantity : 1

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
15

Local Bodies - Srinagar - Jammu And Kashmir

43181689 bids are invited for biotechnology chemicals bacterial dna isolation kit , rna isolation kit , dna , plant dna isolation kit , restriction digestion kit , blue white screening kit , dna loading dye , multiplex pcr kit , ethanol , tlc kit , plant growth regulator bap , plant growth regulator naa , plant growth regulator 2, 4 d , plant growth regulator iaa , tris-base , edta , agarose , blood grouping kit , paranitrophenyl phosphate , agar bacteriological grade , mercuric chlo...

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
16

Government Departments - Thiruvananthapuram - Kerala

43178363 supply of pcr master mix , pcr master mix, 250 reactions => limited

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
17

Government Departments - raipur - Chhattisgarh

43171617 tender for supply of scrub typhus rt pcr kit (3rd call) for molecular laboratory of microbiology department , consumables items for microbiology department: , scrub typhus rt pcr kit pack size : (1 x 96 rxn)

Due Date : May 2, 2024
Tender Value : Ref. Document
View Notice
18

Government Departments - Khordha - Odisha

43161884 bids are invited for 5 6 chemical lhdcp ph-indicator strips ph 0 - 14 universal indicator , parafilmr m , hotstartaq dna polymerase , qiaamp viral rna mini kit , qiaquick gel extraction kit , m-mlv reverse transcriptase, rnase h minus , pfu dna polymerase , dntp mix 10 mm each, 5 x 1 ml , generulertm 1 kb dna ladder ready-to-use , generuler 100 bp dna ladder , generuler 50 bp dna ladder , tritrack dna loading dye total quantity : 80

Due Date : May 6, 2024
Tender Value : rupee 16.48 Lakhs
View Notice
19

Government Departments - Deoghar - Jharkhand

43161630 bids are invited for pcr machine (semi quantitative) (q3) total quantity : 1

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
20

Government Departments - Khordha - Odisha

43141318 bids are invited for 5 1 chemical lhdcp citric acid anhydrous , ezdetecttm pcr kit , ezkilltm mycoplasma , glasgow minimum essential , tryptose phosphate broth , sodium bicarbonate , trypsin-edta solution , sure fetal bovine sera , agarose , agarose, low melting , dreamtaqtm hot start green pcr total quantity : 118

Due Date : May 1, 2024
Tender Value : rupee 20.34 Lakhs
View Notice
21

Statutory Bodies & Commissions/Committees - Patna - Bihar

43139373 tender for supply of group: h- pharmacology pcr machine uv vis spectrophotometer

Due Date : Jul 15, 2024
Tender Value : Ref. Document
View Notice
22

Statutory Bodies & Commissions/Committees - Patna - Bihar

43139329 tender for group: g- pathology real-time pcr system with accessories chemidocumentation imaging system electrophoresis unit with power pac – ( universal power supply ) block cabinet 25000 capacity liquid based cytology automated urine chemistry analyser automated urine sediment analyser automated semen analyzer cold plate ( cooling plate ) fluorescent microscope with fish software digital slide scanner fish work - station automatic rotary microtome cytocentifuge ( cytospin ) ...

Due Date : Jul 9, 2024
Tender Value : Ref. Document
View Notice
23

Government Departments - Bhopal - Madhya Pradesh

43134700 bids are invited for laboratory chemicals centrifuge tube , 10 ul normal tips , 200 ul normal tips , racked low retention sterile filter tips , storage cryo box , blue nitrile gloves , pcr tubes , micro centrifuge tubes , tissue roll , histopaque-1077 , nuclease free water , bisphenol s , bisphenol f , microsatellite multiplex pcr kit , 50 bp dna ladder total quantity : 19192

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
24

Government Departments - Kozhikode - Kerala

43128999 Corrigendum : purchase of measles pcr primer and aprobe , measles pcr primer & probe , 5 tgg cat ctg aac tcg gta tca c 3 standard desalting , 5 tgtcct cag tag tat gca ttg caa 3 standard desalting , 5 fam ccg agg atgcaa ggc ttg ttt cag a bhqi 3- hplc purified , 5 hex-ttc tga cct gaa ggc tct gcg cg bhqi 3 - hplc purified

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
25

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

43128032 bids are invited for pcr machine (semi quantitative) (q3) total quantity : 10

Due Date : May 8, 2024
Tender Value : Ref. Document
View Notice
26

Government Departments - Delhi - Delhi

43122329 bids are invited for pcr master mix (q3) total quantity : 8

Due Date : Apr 27, 2024
Tender Value : Ref. Document
View Notice
27

Statutory Bodies & Commissions/Committees - Patna - Bihar

43119788 group: h- pharmacology pcr machine uv vis spectrophotometer

Due Date : May 10, 2024
Tender Value : Ref. Document
View Notice
28

Government Departments - mysore - Karnataka

43117847 supply of chemicals supply of chemical as per rfp part v , chemicals , ethidium bromide solution, bir reagent for molecular biology, 10mg/ml in h20 , l-tyrosine hydrochloride, <98% (tlc) , l-phenylalanine methyl ester hydrochloride, 98% , 2-mercaptoethanol for molecular biology suitable for electrophoresis, suitable for cell culture, bioreagent, 99% (gc/titration) , 10x pcr buffer without mgcl2, optimized for routine pcr without mgcl2 , magnesium chloride solution, pcr reagent, 25 mm mgcl2 solu...

Due Date : Apr 24, 2024
Tender Value : rupee 4.96 Lakhs
View Notice
29

Government Departments - Delhi - Delhi

43117536 bids are invited for taq dna polymerase ( q3 ) total quantity : 4

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
30

Government Departments - S.a.s Nagar - Punjab

43103804 bids are invited for real time pcr instrument with accessories ( q3 ) total quantity : 1

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - Jabalpur - Madhya Pradesh

43103369 bids are invited for taqman universal pcr master mix 5ml ( q3 ) total quantity : 1

Due Date : May 4, 2024
Tender Value : Ref. Document
View Notice
32

Government Departments - S.a.s Nagar - Punjab

43095864 bids are invited for q5 high fidelity dna polymerase 100units ( q3 ) total quantity : 1

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
33

Government Departments - noida - Uttar Pradesh

43091816 tender for procurement of lab. misc. items; thermal calibration for cf x 96 bio-rad real-time pcr machine; optical calibration for cf x 96 bio-rad real-time pcr machine;

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
34

Statutory Bodies & Commissions/Committees - Patna - Bihar

43084597 group: g- pathology real-time pcr system with accessories chemidocumentation imaging system electrophoresis unit with power pac – (universal power supply) block cabinet 25000 capacity liquid based cytology automated urine chemistry analyser automated urine sediment analyser automated semen analyzer cold plate (cooling plate) fluorescent microscope with fish software digital slide scanner fish work - station automatic rotary microtome cytocentifuge (cytospin ) flow cytometry slide cabinet (verti...

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - Delhi - Delhi

43083745 tender for purchase of real time pcr system

Due Date : May 6, 2024
Tender Value : rupee 15 Lakhs
View Notice
36

Government Departments - Shimla - Himachal Pradesh

43001862 Corrigendum : bids are invited for rt-pcr calibration kit (q3) total quantity : 1

Due Date : Apr 25, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Kamrup Metro - Assam

42873871 Corrigendum : bids are invited for equipment for biochemistry and pharmacology department 1 45 analytical balance , hot air oven , digital colorimeters , student microscopes , glucometer with strips for poct , thermometer , semi autoanalyzer , boiling water baths , centrifuge , ph meters , fixed and variable volume micro pipettes , bottle dispensers , pcr machine , abg machine , complete chromatographic unit for paper and tlc , complete electrophoresis apparatus with power supply , vortex mixers , incubators...

Due Date : Apr 30, 2024
Tender Value : rupee 6.80 Crore
View Notice
38

Boards / Undertakings / PSU - bikaner - Rajasthan

42817594 Corrigendum : supply of various type of test kits and consumables for microbiology dept. , dengue rapid test for detecting ns1 antigen & igg & igm antibody. • should be capable of detecting dengue infection from day-1 & should be preferably capable of detecting all 04 serotypes of dengue virus. • should have high sensitivity and specificity and positive control. , ra ( latex agglutination test ) - • should be preferably ce marked / certified. • reagent should be calibrated against who international standar...

Due Date : May 20, 2024
Tender Value : rupee 1.20 Crore
View Notice
39

Local Bodies - Mumbai - Maharashtra

42798680 Corrigendum : supply of laboratory articles, glassware, etc , laboratory articles glasswares , microscopic glass coverslips no.1 english glass 22 × 22 × 0.1mm with isi mark. , microscopic glass coverslipsno.1 english glass 22 × 60 × 0.1mmwith isi mark , pencils, glass marking superior red, heat resisting indelible. , pencils, glass marking superior blue, heat resisting indelible. , petri dishes 10 cm diameter and1.7 cm. height.with flat even base and even wall thickness, made of 3.3 borosilicate g...

Due Date : May 3, 2024
Tender Value : Ref. Document
View Notice
40

Government Departments - jammu - Jammu And Kashmir

41533255 Corrigendum : tender for supply of pcr thermocycler

Due Date : May 4, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail