Nucleic Acid Extraction Kits Tenders from India

2766 Nucleic Acid Extraction Kits tenders are published by various Tendering Authorities & Private companies. 2766 live Tender for Nucleic Acid Extraction Kits are available in Nucleic Acid Extraction Kits Tender section You can further filter Nucleic Acid Extraction Kits tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Government Departments - Thiruvananthapuram - Kerala

50881924 tender for supply of rna blood mini kit & rnase free dnase set

Due Date : Sep 2, 2025

Tender Value :

41293.0

View Notice

Statutory Bodies & Commissions/Committees - Gwalior - Madhya Pradesh

50862207 bids are invited for guide rna for c2c1 nuclease, yield-05nmole , c2c1 nuclease, yield 100ug purity 95% , ssdna oligonucleotide, 5-6-fam-t-bhq-2-3- yield -100nmole-hplc purified total quantity : 7

Due Date : Aug 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kharagpur - West Bengal

50833112 tender for purchase of automated dna/rna oligonucleotide synthesizer

Due Date : Sep 22, 2025

Tender Value :

90 Lakhs

View Notice

Government Departments - Thiruvananthapuram - Kerala

50831771 tender for supply of endotoxin plasmid maxi kit (10 reactions)

Due Date : Sep 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Panchkula - Haryana

50793412 bids are invited for turbo molecular pumping station with accessories , adapter straight, dn 40 iso-k dn 40 iso-k/25 kf, ss, l= 40mm , corrugated hose, dn 25 iso-kf ss, flexible, l= 500mm , trolley workstation , molecular diagnostic extraction kits t

Due Date : Sep 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Gaya - Bihar

50793088 tender for supply and installation of long read dna sequencer

Due Date : Sep 11, 2025

Tender Value :

1.10 Crore

View Notice

Government Departments - kolkata - West Bengal

50762725 supply of manual rna extraction kit for dengue serotyping test

Due Date : Aug 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

50747590 tender for supply of dna & rna extraction kit

Due Date : Aug 27, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - New Delhi - Delhi

50731813 bids are invited for hbv dna , hcv rna , hiv-1 rna , sars- cov-2 , multiplex respiratory virus panel total quantity : 5660

Due Date : Sep 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Khordha - Odisha

50728979 bids are invited for dna consumable kit for promega genetic analyser , forensic dna extraction kit total quantity : 1

Due Date : Sep 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Khordha - Odisha

50728978 bids are invited for dna consumable kit for applied bio system , forensic dna extraction kit total quantity : 1

Due Date : Sep 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kolkata - West Bengal

50710009 tender for re e tender for procurement prenatal diagnosis and routine mutation analysis of thalassemia patients in the molecular biology laboratory for department of haematology nrs medical college hospital

Due Date : Sep 9, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - agartala - Tripura

50695211 tender for procurement of dna kits and consumables

Due Date : Sep 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ranga Reddy - Telangana

50645872 bids are invited for gene bank mts automation modules and accessories , forensic dna extraction kit total quantity : 1

Due Date : Sep 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - PALNADU - Andhra Pradesh

50643447 repairs and renovation works for stolen items within premises of the dna finger printing transgenic crops monitoring laboratory dftcml building at state seed farm amaravathi guntur district(2nd call)

Due Date : Aug 18, 2025

Tender Value :

35.77 Lakhs

View Notice

Government Departments - Delhi - Delhi

50624879 bids are invited for invivofectamine 3.0 1ml kit (cat no. ivf3005) , mirna inhb 2.0-5n std each (cat no. 4464084) , plasmid kits total quantity : 3

Due Date : Aug 22, 2025

Tender Value :

6.08 Lakhs

View Notice

Boards / Undertakings / PSU - Shillong - Meghalaya

50618741 tender for supply of consumables/chemicals

Due Date : Aug 18, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - pune - Maharashtra

50581920 tender for qiaamp viral rna mini kit-250 rxn

Due Date : Aug 18, 2025

Tender Value :

3.60 Lakhs

View Notice

Local Bodies - Thiruvananthapuram - Kerala

50580121 bids are invited for plasmid kits (q3) ( pac only ) total quantity : 2

Due Date : Aug 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kaithal - Haryana

50572605 tender for purchase of diagnostic/lab items for molecular lab distt kaithal

Due Date : Aug 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Purnia - Bihar

50568139 bids are invited for investigation kit , forensic dna extraction kit total quantity : 1

Due Date : Aug 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Balangir - Odisha

50560310 tender for supply of reagents and kits

Due Date : Aug 13, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

50558784 tender for supply of plasmid midiprep and plasmid maxiprep kit

Due Date : Aug 16, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - kozhikode - Kerala

50540963 supply of the following dna isolation kit for the research project-newborn screening for severe inborn errors of immunity: a pilot study- phase i to multidisciplinary research unit (mru), government medical college, kozhikkode

Due Date : Aug 8, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Aizawl - Mizoram

50518696 bids are invited for automated dna & rna extraction system for medical laboratory sciences department , automated bacterial identification and susceptibility testing system total quantity : 1

Due Date : Aug 20, 2025

Tender Value :

59 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Karnal - Haryana

50478666 bids are invited for forensic dna extraction kit (q3) total quantity : 100

Due Date : Aug 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Karnal - Haryana

50476328 bids are invited for forensic dna extraction kit (q3) total quantity : 100

Due Date : Aug 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

50461849 Corrigendum : tender for supply of automated dna extraction device

Due Date : Sep 10, 2025

Tender Value :

9.30 Lakhs

View Notice

Government Departments - Coimbatore - Tamil Nadu

50460577 bids are invited for transcriptome sequencing through ngs , bacterial dna isolation kit total quantity : 1

Due Date : Aug 22, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - parel - Maharashtra

50438829 Corrigendum : tender for supply of viral rna automated extraction combi kit (with specification ) qty:-3840tests

Due Date : Aug 25, 2025

Tender Value :

2.15 Lakhs

View Notice

Government Departments - Pondicherry - Puducherry

50424278 bids are invited for q5 mastermix 500rxn - neb, m0492l , magmax dna ultra 2point0 kit , dna extraction kit 96 rxn - thermo, a36570 , magmax mirvanc rna isolation lit - thermo, a27828 , microamp clear adhesive film 100pc - thermo, 4306311 , deepwell 9

Due Date : Aug 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

50404326 bids are invited for varianttm ii b-thalassemia short program pack- 500 tests , d10 dual reorder pack , flexigen dna kit -pack size 250 preps , cd45 clone 2d1 apc h7 100 tests , lysing buffer -10x concentrate -100 ml , cytokeratin clone cam 5.2 pe cf

Due Date : Aug 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Khordha - Odisha

50385408 bids are invited for dna consumable kit , forensic dna extraction kit total quantity : 1

Due Date : Aug 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

50384648 bids are invited for advance mirna assay , fg-gt master mix -10 ml , snp genotyping assay , advance mirna c dna synthesis kit , fast advance master mix 10x5ml total quantity : 36

Due Date : Aug 18, 2025

Tender Value :

23.68 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

50377473 tender for qiaamp viral rna mini kit, (250) make- qiagen, catalog no-ld 52906

Due Date : Jul 29, 2025

Tender Value :

5.50 Lakhs

View Notice

Government Departments - Cuttack - Odisha

50312260 Corrigendum : bids are invited for forensic dna extraction kit (q3) total quantity : 2000

Due Date : Aug 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Cuttack - Odisha

50312259 Corrigendum : bids are invited for forensic dna extraction kit (q3) total quantity : 4000

Due Date : Aug 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Puducherry - Puducherry

50278784 tender for bottle detection kit for vancomycin resistance enteroeoccus species detecting vana h directly from blood culture broth and colony with endogenous control with minimum lod ol 10 copies reaction with bacterial dna extraction kit column based.rapi

Due Date : Aug 6, 2025

Tender Value : Ref. Document

View Notice

Government Departments - thiruvananthapuram - Kerala

50277603 tender for purchase of consumables for multi disciplinary reseach unit,gmct

Due Date : Aug 6, 2025

Tender Value :

11.37 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - hyderabad - Telangana

50275540 Corrigendum : tender for supply and installation of dna fragmentor for long read sequencing

Due Date : Aug 25, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Rajarhat - West Bengal

50228308 tender for supply of the under-mentioned goods

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bengaluru Urban - Karnataka

50172708 bids are invited for primescrip 1st strand cdna synthesis kit , premix ex taq probe qpcr , primescript one step rt pcr kit ver point 2 dye plus , emeraldamp gt pcr master mix , tb green premix ex taq ii tli rnase h plus , rnaiso plus , 1 kb dna ladde

Due Date : Aug 5, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Multi State

50148838 tender for supply of item

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jamnagar - Gujarat

50130022 bids are invited for automated rna extraction kit qiaamp dsp pathogen mini kit , 1500âµ l qiagen compatible tip , 200âµ l qiagen compatible tip , viral rna extraction kit total quantity : 2432

Due Date : Aug 2, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

50099432 bids are invited for k 1081 dream taq green pcr master mix 2x 200x 50 microliter rxns , qubit dsdna br assay kit 100 1 kit , qubitirna br assay kit , sigma oligos 50d dry desalted , high capacity cdna reverse transcription kit 200rxn , whole exome se

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhopal - Madhya Pradesh

50083604 Corrigendum : tender for tender for purchase of dna sequencer 2025

Due Date : Aug 13, 2025

Tender Value :

1.10 Crore

View Notice

Government Departments - Rewari - Haryana

50080338 tender for supply of item

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

50061447 bids are invited for mission plko.1-puro non-target shrna control plasmid dna , inducible p62 shrna plasmid custom cloned 2 sequences , 2-5-phenyl-1h-indol-3-yl acetic acid 5-ph-iaa , doxycycline hyclate cat no d5207-10g , streptavidin, horseradish p

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

50050438 bids are invited for fetal bovine serum sterile filtered , deoxyribonuclease1 dnase1 rnase free , pipes buffer , dna extraction kit , n acetyl l cysteine total quantity : 9

Due Date : Jul 29, 2025

Tender Value :

1.61 Lakhs

View Notice

Government Departments - Amreli - Gujarat

50044868 bids are invited for forensic dna extraction kit (q3) total quantity : 1

Due Date : Jul 28, 2025

Tender Value :

5 Lakhs

View Notice

Government Departments - Anand - Gujarat

50044530 bids are invited for forensic dna extraction kit (q3) total quantity : 40

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Aizawl - Mizoram

50042431 bids are invited for automated dna & rna extraction system for medical laboratory sciences department , forensic dna extraction kit total quantity : 1

Due Date : Jul 22, 2025

Tender Value :

59 Lakhs

View Notice

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025

Tender Value :

38 Lakhs

View Notice

Boards / Undertakings / PSU - Amritsar - Punjab

49989705 tender for quick-rna miniprep plus kit (200 preps) w/zymo-spin iiicg columns (capped) & spin-away filters cat. no. r1058-qty 01, zymobiomics dna miniprep kit (50 preps) cat. no. d4300 - qty 04

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Amreli - Gujarat

49987414 bids are invited for plasmid kits (q3) ((3 3 )) 2 lakh (s) total quantity : 1

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - South Andamans - Andaman And Nicobar Islands

49985523 bids are invited for forensic dna extraction kit (q3) ( pac only ) ((3 3 )) 1 lakh (s) total quantity : 3

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kolkata - West Bengal

49964546 tender for adenovirus rt-pcr kit. (100 reaction) along with dna extraction kit. (100 reaction)

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

49954375 bids are invited for bdt v3 1 rr-100 , pop7-3730 by 3730xl dna analyzers , genescan tm 500 liz dye size standard 800 rnxs , hidi formamide 25ml , tube-5x seq buffer small total quantity : 5

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Mahendragarh - Haryana

49949959 bids are invited for title2 - cuvette , title3 - resazurin sodium , title5 - alamarblue hs cell viability reagents , title6 - dimethyl sulphoxide , title7 - carbinol hplc , title8 - mtt , title9 - 96 well plate , title10 - todd hewitt broth , title11

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Raipur - Chhattisgarh

49897611 procurement of diluent for dna extraction (1st call) at microbiology department of aiims raipur

Due Date : Jul 2, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Khordha - Odisha

49861273 bids are invited for genejet viral rna dna purification kit 50 prep , genomic dna purification kit 100 prep , revertaid h minus first strand cdna synthesis kit , top vision agarose 100 gm , proteinase k recombinant pcr grade 1 ml , water nuclease fre

Due Date : Jul 17, 2025

Tender Value :

5.39 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49860786 bids are invited for addgene lenticrispr v2 - addgene lenticrispr v2 plasmid52961 as bacterial stab , addgene lenticas9 blast - addgene lenticas9 blast plasmid 52962 as bacterial stab , addgene lentiguide puro - addgene lentiguide puro plasmid 52963

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - purba medinipur - West Bengal

49857930 tender for supply of automatic rna extraction kit.

Due Date : Jul 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

49853070 bids are invited for t4 dna ligase 500 units cat no 15224 025 a , ia019 10 alkaline stabilized recombinant protein a , t4 dna ligase 500 units cat no 15224 025 b , t4 dna ligase 500 units cat no 15224 025 c , t4 dna ligase 500 units cat no 15224 025

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Amritsar - Uttarakhand

49846553 tender for the consumables/teaching kits

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

49832197 tender for supply of plasmid maxi kit

Due Date : Jul 2, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Khordha - Odisha

49829176 Corrigendum : bids are invited for nucleospin plasmid 250 rxn1 - nucleospin plasmid 250 rxn 1 , tb green advantage qpcr premix 200 rxns , advantage 2 pcr kit 100 rxns , solid baffle for larvae for 1l 5ml , breeding tank , nucleospin gel and pcr clean up 250 rxn 1

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Sheikhpura - Bihar

49815468 tender for rate contract and supply of medical devices/consumables for different healthcare facilities of state of bihar

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

49808760 Corrigendum : tender for supply of dna kits item for lab of mp - extraction kit for hid nimbus presto automated dna extraction system (routine forensic sample) dna extraction kit for hid nimbus presto automated dna extraction system (difficult forensic sample) kits f

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bengaluru Urban - Karnataka

49741519 bids are invited for , viral rna extraction kit viral rna extraction kits total quantity : 1

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49732068 bids are invited for supply of recombinant plasmids with codon optimised custom gene( , custom gene( total quantity : 8

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jaipur - Rajasthan

49714512 tender for rate contract of viral manual rna extraction kit (nit 34)

Due Date : Jun 28, 2025

Tender Value :

5 Lakhs

View Notice

Boards / Undertakings / PSU - jaipur - Rajasthan

49710243 Corrigendum : rate contract of viral manual rna extraction kit

Due Date : Jun 28, 2025

Tender Value :

5 Lakhs

View Notice

Government Departments - Jamnagar - Gujarat

49693612 bids are invited for automated rna extraction kit qiaamp dsp pathogen mini , forensic dna extraction kit total quantity : 2432

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kolkata - West Bengal

49687063 tender for supply of items

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

49668078 tender for supply of dna and rna extraction kit

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Aizawl - Mizoram

49646344 Corrigendum : bids are invited for forensic dna extraction kit (q3) ((3 3 )) 4 lakh (s) total quantity : 14

Due Date : Jun 27, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kolkata - West Bengal

49636566 tender for ez dna melhylalion tm kit catalogue no.*- d5002, pack size- 200 rxns, company- 2ym

Due Date : Jun 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

49626723 bids are invited for consumables for medical research mse camp assay kit competitive elisa fluorometric 96 wells x1 , pertussis toxin-50ug, , recombinant cabyr 25ug , recombinant akap 4-20ug , nunc tm microwell tm 96-well nunclon delta treated flat b

Due Date : Jul 3, 2025

Tender Value :

4.70 Lakhs

View Notice

Government Departments - lucknow - Uttar Pradesh

49623629 Corrigendum : tender for supply of viral rna extraction kit

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - lucknow - Uttar Pradesh

49623298 tender for supply of hospital medicines

Due Date : Jun 14, 2025

Tender Value :

2 Lakhs

View Notice

Boards / Undertakings / PSU - Bharatpur - Rajasthan

49612042 tender for purchase of covid -19 rna extraction kits (as per doc)

Due Date : Jun 13, 2025

Tender Value :

2 Lakhs

View Notice

Government Departments - egmore - Tamil Nadu

49571393 Corrigendum : online tender for fixing rate contract for supply of rna extraction kits (for automated methods-magnetic beads) and rna extraction kits (for manual methods- spin column base method) to various govt. institutions

Due Date : Jun 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

49560945 bids are invited for consumables mse quick rna whole blood rna extraction kit zymo cat no r1201 , rifn alpha 2a 0ug cat no 130 093 874 , 130 098 645 cd169siglec 1antibody anti human apc 0 test hsn , consumables for digital duplicators total quantity

Due Date : Jul 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

49529010 tender for supply of dna & rna extraction kit

Due Date : Jun 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49514989 Corrigendum : bids are invited for forensic dna extraction kit (q3) ((3 3 )) 10 lakh (s) total quantity : 60

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49514942 Corrigendum : bids are invited for forensic dna extraction kit (q3) ((3 3 )) 50 lakh (s) total quantity : 359

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

49514870 Corrigendum : bids are invited for forensic dna extraction kit (q3) ((3 3 )) 50 lakh (s) total quantity : 228

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Lucknow - Uttar Pradesh

49513208 Corrigendum : bids are invited for viral rna extraction kit (q2) ((3 3 )) 9 lakh (s) total quantity : 200000

Due Date : Jun 21, 2025

Tender Value :

30 Lakhs

View Notice

Government Departments - Gandhinagar - Gujarat

49513121 Corrigendum : bids are invited for viral rna extraction kit (q2) ((3 3 )) 3 lakh (s) total quantity : 50000

Due Date : Jun 17, 2025

Tender Value :

7 Lakhs

View Notice

Government Departments - Meerut - Uttar Pradesh

49478582 tender for supply of plant genomic dna miniprep purification kit make hi-media for one year

Due Date : Jun 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

49458285 bids are invited for verso c dna synthesis kit 100 rxn , rna extraction kit for plant , viral rna extraction kit total quantity : 2

Due Date : Jun 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhiwani - Haryana

49458046 bids are invited for viral rna extraction kit total quantity : 400

Due Date : Jun 4, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

49443021 tender for 286-native barcoding expansion 2. 685-purified mouse antibody 3. 933-vecta stain elite abc kit 4. 295-magmax express tip comb, 96 well plate, magmax rna extraction kit

Due Date : Jun 5, 2025

Tender Value :

9.70 Lakhs

View Notice

Boards / Undertakings / PSU - Udaipur - Rajasthan

49426392 tender for supply of automated rna extraction system make perkin elmer model chemagic 360

Due Date : Jun 3, 2025

Tender Value :

10 Lakhs

View Notice

Government Departments - mumbai - Maharashtra

49411953 Corrigendum : tender for supply of dna kits for dna extraction kit supply of dna kits fordna extraction kit for bone, hard tissue compatible for automate express system-52reaction , dna kits , dna extraction kit for bone, hard tissue compatible for automate express sys

Due Date : Jun 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

49411925 Corrigendum : tender for supply of dna kit for prefiler express dna extraction kit for extraction of blood compatible for automate express system - 52 reaction

Due Date : Jun 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jammu - Jammu And Kashmir

49374940 Corrigendum : tender for supply of viral rna extraction kit

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Patna - Bihar

49367645 bids are invited for viral rna extraction kit (q2) total quantity : 100000

Due Date : Jun 7, 2025

Tender Value : Ref. Document

View Notice

100

Government Departments - Chennai - Tamil Nadu

49352846 Corrigendum : bids are invited for lab items mgit960 panta supplement , gene xpert cartridge , syringe with neelde , syringe without needle , rif 50 xpert tb rif , plasmid kits total quantity : 63

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Top