20 Microcentrifuges tenders in Meghalaya 2024

Get latest Microcentrifuges related Tenders, online published by Government Of Meghalaya, Meghalaya Administrative Training Institute, Meghalaya Basin Management Agency from Meghalaya state. Participate online through e-Procurement website for Microcentrifuges tenders in Meghalaya. Download Tender Documents, BOQ, Technical Bids for Microcentrifuges related Tenders from Meghalaya. Get Bidding support for etenders related to Microcentrifuges Tenders in Meghalaya. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Microcentrifuges tenders published from Meghalaya. Also get daily email alerts for Microcentrifuges related tender notices published by Government of Meghalaya.

1

Local Bodies - East Khasi Hills - Meghalaya

41208005 bids are invited for list of consumables trizol , tris free base , diluent for dna extration , cdna synthesis kit , taq polymerse , 100bp dna ladder , ultrapure agarose , molecular biology grade water , rnase zap , 1x te buffer , gel extration kit , rneasy plant mini kit , dneasy plant mini kit , rnase a , depc , 2 propanol , chloroform , petridish , dimethyl , hpall , mspl , methanol , t4 dna ligase , urea , sodium thiosulphate anhydrous , microcentrifuge tube , micro tips 0.2ul , maxiamp pcr ...

Due Date : Jan 4, 2024
Tender Value : Ref. Document
View Notice
2

Local Bodies - East Khasi Hills - Meghalaya

40941554 bids are invited for list of consumables trizol , tris free base , diluent for dna extration , cdna synthesis kit , taq polymerse , 100bp dna ladder , ultrapure agarose , molecular biology grade water , rnase zap , 1x te buffer , gel extration kit , rneasy plant mini kit , dneasy plant mini kit , rnase a , depc , 2 propanol , chloroform , petridish , dimethyl , hpall , mspl , methanol , t4 dna ligase , urea , sodium thiosulphate anhydrous , microcentrifuge tube , micro tips 0.2ul , maxiamp pcr ...

Due Date : Dec 20, 2023
Tender Value : Ref. Document
View Notice
3

Government Departments - East Khasi Hills - Meghalaya

33706866 Corrigendum : bids are invited for 1x phosphate buffered saline , graduated centrifuge tube 15 ml , 2x pcr master mix , agarose powder low eeo molecular biology grade , ethidium bromide etbr , primers 2 sets oligonucleotide primers desalted. first set my09 5 cgt ccm arr gga wac tga tc 3 and my11 5 gcm cag ggw cat aay aat gg 3 , primers 2 sets oligonucleotide primers desalted. second set gp5 plus 5 tttgttactgtggtagatacta 3 and gp6 plus 5 gaaaaataaactgtaaatcata 3 , nuclease free water pcr grade water. molecula...

Due Date : Sep 12, 2022
Tender Value : rupee 5.05 Lakhs
View Notice
4

Boards / Undertakings / PSU - Meghalaya

28958236 supplying, installation & commissioning of equipments, computer peripherals and electrical instruments 1 temperature controlled shaker incubator 2 deep freezer ( 80°c) 3 refrigerated/cold centrifuge 4 microcentrifuge 5 7.5 l fermenter bioreactor 6 lyophilizer/ freeze dryer 7 rotary vacuum evaporator 8 water bath 9 uv/visible spectrophotomer 10 alcohol measuring instrument i 11 alcohol measuring instrument ii 12 bod incubator 13 horizontal laminar air flow cabinet 14 vertical autoc...

Due Date : Sep 3, 2021
Tender Value : Ref. Document
View Notice
5

Boards / Undertakings / PSU - Meghalaya

28706976 supply of fenvaleratepestanal®analytical standard carbofuran 98% 3 phenoxy benzoic acid (98%) ammonium chloride ammonium hydroxide buffer solution in h20 pepstatin a tpck e64 sigma marker, low range, mol. wt. 6,500 6,6000 da 1,10 phenanthroline monohydrate carbon nanofibers chaps (3 3 cholaamidopropyl dimethylammonio propanes uiphonate) pepstatin a microbial > 75% (hplc) 1, 4 dithiothreitol glybenclamide l glutathione oxidized (gssg) 2,4 dichiorophenol (100 g) met...

Due Date : Aug 20, 2021
Tender Value : Ref. Document
View Notice
6

Local Bodies - Meghalaya

25017407 online quotation for supply of laboratory chemicals/consumables 1 dns reagent 2 sodium potassium tartarate 3 sulfuric acid 4 hydrochloric acid 6 diosgenin 8 tannic aicd 9 coomassie brilliant blue g 20 10 phosphoric acid 11 bradford solution 12 bovine serum albumin (bsa) 13 copper sulfate pentahydrate 14 ninhydrin 15 abts 16 dpph 17 dimethyl sulphate 18 whatman syringe filter 0.45 um 19 amber color bottle (500 ml) 20 acetonitrile (hplc grade) 21 methanol (hplc grade) 22 hplc grade water 23 asco...

Due Date : Aug 7, 2020
Tender Value : Ref. Document
View Notice
7

Statutory Bodies & Commissions/Committees - NEIGRIHMS, Shillong, Meghalaya - Meghalaya

22947207 Corrigendum : open e tender for processing of chemicals, reagents, glassware, instruments, surgicals, contrast, etc for the institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 1 albumin 2 microalbumin 3 gamma glutamyl tranferase 4 ( ?? ggt ) 5 amylase 6 lipase 7 ck 8 ck mb 9 ldh 10 total cholesterol 11 triglyceride 12 hdl 13 ldl 14 calcium ...

Due Date : Dec 4, 2020
Tender Value : rupee 30 Lakhs
View Notice
8

Statutory Bodies & Commissions/Committees - NEIGRIHMS, Shillong, Meghalaya - Meghalaya

22946564 Corrigendum : open e tender for processing of chemicals, reagents, glassware, instruments, surgicals, contrast, etc for the institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 1 abciximab ( reopro ) gp ii b, iiia, black 2 ab neurofilament protein 3 ab synaptophysin 4 abrassive 5 abru precatorius 6 abru seed ( white & red ) 7 absolute alcohol ( ar ) 8 absolute alcohol 90...

Due Date : Dec 4, 2020
Tender Value : rupee 30 Lakhs
View Notice
9

Government Departments - ICAR Research Complex for NEH Region, Umiam - 793 - Meghalaya

15348259procurement of refrigerated microcentrifuge under dbt project.

Due Date : Mar 13, 2018
Tender Value : Ref. Document
View Notice
10

Government Departments - Icar Res. Complex For Neh Region, Umaim, Meghalaya - Meghalaya

13965478procurement of scientific equipments under dbt project 1. gel doc system 2. electrophoresis unit 3. refrigerated microcentrifuge 4. dep freezer minus 20 c 5. heating block

Due Date : Nov 2, 2017
Tender Value : rupee 10 Lakhs
View Notice
11

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13114182 72.34 ast kit 72.35 alt kit 72.36 ise wash 2 solution 72.37 ise cal 3 solution 72.38 ise cal 4 solution 72.39 microcentrifuge tube 2ml 72.4 sp kit 72.41 rep prep solution 72.42 sample applicator 72.43 disposable sample cup 72.44 ast 72.45 alt 72.46 creatinine 72.47 albumin 72.48 glucose 72.49 ggt 72.5 bun 72.51 hdl cholesterol 72.52 ldl cholesterol 72.53 cholesterol 72.54 uibc 72.55 rf rtg latex 72.56 crp 72.57 uric acid 72.58 triglyceride 72.59 alp 72.6 total bilirubin 72.61 igg 72.62 direct ...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
12

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13114179 72.34 ast kit 72.35 alt kit 72.36 ise wash 2 solution 72.37 ise cal 3 solution 72.38 ise cal 4 solution 72.39 microcentrifuge tube 2ml 72.4 sp kit 72.41 rep prep solution 72.42 sample applicator 72.43 disposable sample cup 72.44 ast 72.45 alt 72.46 creatinine 72.47 albumin 72.48 glucose 72.49 ggt 72.5 bun 72.51 hdl cholesterol 72.52 ldl cholesterol 72.53 cholesterol 72.54 uibc 72.55 rf rtg latex 72.56 crp 72.57 uric acid 72.58 triglyceride 72.59 alp 72.6 total bilirubin 72.61 igg 72.62 direct ...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
13

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13114176 processing of reagents and consumables : 72.01 100 200 μl microtips 72.02 5 50 μl microtips 72.03 1 5 ml microtips 72.04 200 1000 μl micropipette 72.05 100 200 μl micropipette 72.06 5 50 μl micropipette 72.07 2 20 μl micropipette 72.08 microcentrifuge tube 1.5ml 72.09 ammonium persulphate ar 72.1 potassium iodate ( kio3 ) 72.11 toluene ar 72.12 arsenous acid ( as2o3 ) 72.13 arsenic trioxide 72.14 ceric ammonium sulphate 72.15 20bp dna ladder 72.16 tris – base ar grade 72.17 fok i & nlaiii r...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
14

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

11431268 rate contract for processing of chemicals, reagents, glassware, instruments, surgicals, contrast: 72.34 ast kit 72.35 alt kit 72.36 ise wash 2 solution 72.37 ise cal 3 solution 72.38 ise cal 4 solution 72.39 microcentrifuge tube 2ml 72.4 sp kit 72.41 rep prep solution 72.42 sample applicator 72.43 disposable sample cup 72.44 ast 72.45 alt 72.46 creatinine 72.47 albumin 72.48 glucose 72.49 ggt 72.5 bun 72.51 hdl cholesterol 72.52 ldl cholesterol 72.53 cholesterol 72.54 uibc ...

Due Date : Jan 24, 2017
Tender Value : Ref. Document
View Notice
15

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

11431267 rate contract for processing of chemicals, reagents, glassware, instruments, surgicals, contrast: 72.01 100 200 μl microtips 72.02 5 50 μl microtips 72.03 1 5 ml microtips 72.04 200 1000 μl micropipette 72.05 100 200 μl micropipette 72.06 5 50 μl micropipette 72.07 2 20 μl micropipette 72.08 microcentrifuge tube 1.5ml 72.09 ammonium persulphate annual/repair 72.1 potassium iodate (kio3) 72.11 toluene annual/repair 72.12 arsenous acid(as2o3) 72.13 arsenic trioxide 72.14 ceric ammoni...

Due Date : Jan 24, 2017
Tender Value : Ref. Document
View Notice
16

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

11418504 processing of reagents, surgicals, disposables, consumables, etc for the institute. 72.01 100 200 μl microtips 72.02 5 50 μl microtips 72.03 1 5 ml microtips 72.04 200 1000 μl micropipette 72.05 100 200 μl micropipette 72.06 5 50 μl micropipette 72.07 2 20 μl micropipette 72.08 microcentrifuge tube 1.5ml 72.09 ammonium persulphate ar 72.1 potassium iodate ( kio3 ) 72.11 toluene ar 72.12 arsenous acid ( as2o3 ) 72.13 arsenic trioxide 72.14 ceric ammonium sulphate 72.15 20bp d...

Due Date : Jan 24, 2017
Tender Value : rupee 98 Lakhs
View Notice
17

Government Departments - Meghalaya

5775961supply of thermal cycler, geldocumentationsystem, microcentrifuge,

Due Date : Mar 24, 2014
Tender Value : Ref. Document
View Notice
18

Government Departments - Shillong - Meghalaya

5761149procurement of thermal cycler, geldocumentationsystem, microcentrifuge(refrigerated),

Due Date : Mar 24, 2014
Tender Value : Ref. Document
View Notice
19

Government Departments - Shillong - Meghalaya

5755526procurement of thermal cycler, geldocumentationsystem, microcentrifuge(refrigerated),

Due Date : Mar 24, 2014
Tender Value : Ref. Document
View Notice
20

Government Departments - Shillong - Meghalaya

5740593procurement of thermal cycler, gel documentation system, and microcentrifuge (refrigerated).

Due Date : Mar 24, 2014
Tender Value : Ref. Document
View Notice

Tenders By City

Tenders By Authority

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail