30 Hand Pieces tenders in Meghalaya 2024

Get latest Hand Pieces related Tenders, online published by Government Of Meghalaya, Meghalaya Administrative Training Institute, Meghalaya Basin Management Agency from Meghalaya state. Participate online through e-Procurement website for Hand Pieces tenders in Meghalaya. Download Tender Documents, BOQ, Technical Bids for Hand Pieces related Tenders from Meghalaya. Get Bidding support for etenders related to Hand Pieces Tenders in Meghalaya. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Hand Pieces tenders published from Meghalaya. Also get daily email alerts for Hand Pieces related tender notices published by Government of Meghalaya.

1

Statutory Bodies & Commissions/Committees - East Khasi hills - Meghalaya

41633723 bids are invited for echs non expendable items body meter for height measure 300 x 3 x 40 mm measuring range 0 , mattress foam rubber 198cm x 91.5 cm x .2cm with tapestry cover , mattress foam rubber 198cm x 91.5 cm x .2cm cover for , wheel chair folding with removable arm rest and swinging foot rests complete , stethoscope folding with flat diaphragm type chest piece , torch hand chromium plated brass standard cells fitted with a bulb of 6.2v without cell , auriscope fibre optic light tr...

Due Date : Jan 23, 2024
Tender Value : rupee 28430.0
View Notice
2

Government Departments - East Khasi Hills - Meghalaya

38279655 Corrigendum : bids are invited for thunderbeat thunderbeat hand piece. open extended jaw. long 31cm , thunderbeat hand piece. open extended jaw. medium 20cm , thunderbeat hand piece. open extended jaw. small 9cm , thunderbeat forcep 9.7mm 20cm open extended jaw , thunderbeat forcep 5.5mm 35cm front actuated grip , thunderbeat forcep open fine jaw total quantity : 60

Due Date : Jul 28, 2023
Tender Value : rupee 5.08 Lakhs
View Notice
3

Statutory Bodies & Commissions/Committees - East Khasi Hills - Meghalaya

35406933bids are invited for dental equipment cotton roll dispenser , bp handle no 11, 12,15 , air rotor hand piece , rct endo box , manual scalar set of 06 , pmt set , tray kidney shaped medium , tray impression edentulous metal full set , suction unit , filling instrument , spirit lamp brass with screw cap 60 ml , spatula tarno bland end , hypodermic syringe total quantity : 119

Due Date : Jan 11, 2023
Tender Value : Ref. Document
View Notice
4

Government Departments - East Khasi Hills - Meghalaya

35071933 Corrigendum : bids are invited for tools for biomedical engg section and gas plant 550w corded electric mechanic kit professional drill , 12 pieces hand tool kit , cordless drill driver with 12v battery , laser distance measurer , multi tool set with multimeter and micro tools , multi tool set , circlip pliers bent , protable temp and humidity data logger , precision screwdriver kit electronics toolkit , mini vacuum cleaner , blower , clamp meter , pipe wrench total quantity : 19

Due Date : Dec 20, 2022
Tender Value : rupee 5 Lakhs
View Notice
5

Government Departments - East Khasi Hills - Meghalaya

33074804 Corrigendum : bids are invited for fibre optic sensor , hand piece 1 , hand piece 2 , scaler tip total quantity : 7

Due Date : Aug 26, 2022
Tender Value : rupee 5.10 Lakhs
View Notice
6

Statutory Bodies & Commissions/Committees - East Khasi Hills - Meghalaya

32911566bids are invited for cotton roll dispenser , bp handle no 11, 12,15 , air rotor hand piece , rct endo box , manual scalar set of 06 , digital autoclave , pmt set , tray kidney shaped medium , tray impression edentulous metal full set , suction unit , fillinginstrument , spirit lamp brass with screw cap 60 ml ,spatula tarno bland end , hypodermic syringe total quantity : 122

Due Date : Jul 22, 2022
Tender Value : Ref. Document
View Notice
7

Statutory Bodies & Commissions/Committees - East Khasi Hills - Meghalaya

32843832bids are invited for sphygmomanometer , dental air rotor air compressor , blow torch , endodotic hand piece , lead apron with colar , articulator , lab articulator , suction unit , dental x ray developer and processor. , bowl rubber , bowl plastic ,amalgam carrier , crwon and bridge remover , micro motor ,hand piece , ultra sonic scaler , metal guage , wax guage ,soldering torch , micro motor total quantity : 58

Due Date : Jul 18, 2022
Tender Value : Ref. Document
View Notice
8

Government Departments - East Khasi Hills - Meghalaya

32342871 Corrigendum : bids are invited for attachment angled sd pd series , duraguard 57 tapered router , duraguard 59 tapered router , diamond burr 5mm , perforator bit , diamond burr 4mm , diamond burr 3mm , diamond burr 2mm , fluted burr 3mm , fluted burr 4mm , fluted burr 6mm , adult shunt tumoller , angular mediumhand piece sd pc , straight long hand piece sd pc ,angular long hand piece , d 58 , d 57 , d 59 , watsonchyme disector total quantity : 58

Due Date : Jun 18, 2022
Tender Value : Ref. Document
View Notice
9

Government Departments - Shillong - Meghalaya

30706585bids are invited for air rotor hand pieceboq title air rotor hand piece for dental procedureoem total quantity : 3

Due Date : Jan 31, 2022
Tender Value : rupee 25000.0
View Notice
10

Statutory Bodies & Commissions/Committees - Meghalaya

29809361 Corrigendum : bids are invited for ti max z45l with two couplings (45 degreecontra angle hand piece) 1. head 45° angle head2. gear ratio 1:4.2 increasing3. for fg burs (ø1.6)4. head size ø9.6 x h 14.5 mm 5. water spray quattro spray (water jet / mist) 6. body material titanium 7. body coating duragrip8. max speed 168,000 per min total quantity : 1

Due Date : Nov 24, 2021
Tender Value : Ref. Document
View Notice
11

Statutory Bodies & Commissions/Committees - Meghalaya

29334541 bids are invited for portable x ray machine (ez ray air) weight 1.5 kgfocal spot 0.4 mmvoltage 60 kv(fixed)current 2.5 ma (fixed)exposure time range 0.05 0.5 sectotal filtration min. 1.5 mm aimaximum duty cycle 1:60power input 22.2 vbattery replaceableline voltage 100 240 v + 10% , rvg with all accessories kodak/carestream rvg 6200 digital radiography system kodak/carestream with compatible dell laptop rvg with all accessorieskodak/carestream rvg 6200 digital radiograp...

Due Date : Oct 4, 2021
Tender Value : rupee 16.37 Lakhs
View Notice
12

Statutory Bodies & Commissions/Committees - Meghalaya

29328691 Corrigendum : bids are invited for hand pieces open extended jaw hand pieces open extended jaw, 9 mm, 20 cm, front actuated grip , hand pieces 5 mm, 35 cm hand pieces 5 mm, 35 cm, front actuated grip hand pieces total quantity : 1

Due Date : Oct 21, 2021
Tender Value : rupee 6 Lakhs
View Notice
13

Statutory Bodies & Commissions/Committees - NEIGRIHMS, Shillong, Meghalaya - Meghalaya

22947207 Corrigendum : open e tender for processing of chemicals, reagents, glassware, instruments, surgicals, contrast, etc for the institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 1 albumin 2 microalbumin 3 gamma glutamyl tranferase 4 ( ?? ggt ) 5 amylase 6 lipase 7 ck 8 ck mb 9 ldh 10 total cholesterol 11 triglyceride 12 hdl 13 ldl 14 calcium ...

Due Date : Dec 4, 2020
Tender Value : rupee 30 Lakhs
View Notice
14

Statutory Bodies & Commissions/Committees - NEIGRIHMS, Shillong, Meghalaya - Meghalaya

22946535 Corrigendum : open e tender for processing of chemicals, reagents, glassware, instruments, surgicals, contrast, etc for the institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 1 intravenous extension tube with male and female lock connector 200 cm 2 intravenous extension tube with male and female lock connector 100 cm 3 intravenous extension tube with male and female lock connector 150 cm 4 intr...

Due Date : Dec 4, 2020
Tender Value : rupee 25 Lakhs
View Notice
15

Statutory Bodies & Commissions/Committees - Assam Rifles Godown Happy Valley Shillong - Meghalaya

19270711 procurement of dental equipment : 1.01 ultra sonic scalar with 6 tips ( led ) 1.02 sand blasting machine 1.03 air rotor hand piece ( fiber optic ) 1.04 air rotor hand piece ( nsk ) 1.05 mircro motor ( supreme ) contra angle hand piece 1.06 steriliser drum 1.07 impression trays metallic perforated complete set ( u0 too u4 & l0 to l4 ) 1.08 spoon excavator ( small ) 1.09 hand saw for plaster caste 1.10 extraction force set of 12 ( set of precise instruments for removal of tee...

Due Date : Mar 4, 2019
Tender Value : rupee 4.29 Lakhs
View Notice
16

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13531308processing of equipments for neurosurgery: 1.01 molecular resonance generator 1.02 air mattress 1.03 neurosurgical beds with cervical traction accessories 1.04 neurosurgical beds 1.05 motor with hand piece for existing stryker drill console

Due Date : Oct 5, 2017
Tender Value : rupee 81 Lakhs
View Notice
17

Statutory Bodies & Commissions/Committees - Arasu Happy Valley Godown Shillong-07 - Meghalaya

13508531tender for supply of dental equipment : 54. stethoscope 55. digital weighing machine 56. x ray film holder 57. cheek retractor 58. gas blow torch 59. rechargeable battery for apex locator tr zx ( gp 3.6v 250mah ) 60. micro motor ( supreme ) contra angle hand piece

Due Date : Sep 18, 2017
Tender Value : rupee 1.74 Crore
View Notice
18

Statutory Bodies & Commissions/Committees - Arasu Happy Valley Godown Shillong-07 - Meghalaya

13508523 tender for supply of dental equipment : 1. dental chair ( surgery ) 2. dental chair ( hygienist ) 3. rvg with all accessories 4. digital autoclave 5. lathe 6. light cure machine 7. ceramic furnace 8. portable x ray machine 9. acrylizer pecho bath 10. vita easy shade advance 4.0 digital 11. ultra sonic scalar with 6 tips ( led ) 12. sand blasting machine 13. air rotor hand piece ( fiber optic ) ( kavo – 02, gnatus – 02 ) 14. air rotor hand piece ( nsk ) 15. micro motor ( heavy duty )...

Due Date : Sep 18, 2017
Tender Value : rupee 1.74 Crore
View Notice
19

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

13439436open e tender for processing of molecular resonance generator 01 nos and air mattress 03 nos. neurosurgical beds with cervical traction accessories 5 nos, neurosurgical beds 5 nos and motor with hand piece for existing stryker drill console for department of neurosurgery.

Due Date : Oct 5, 2017
Tender Value : Ref. Document
View Notice
20

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13114253 78.29 nsk push button airotor handpiece 78.3 apex locator pixi dentsply 78.31 lightcure michine coltene 78.32 sealer machine with pouch 78.33 scaller tips satellec 78.34 ultrasonic cleaner 78.35 smart burs 78.36 anti fog mouth mirror 78.37 flouride solution with applicator 78.38 luting cement 78.39 silicon base impression materials 78.4 base putty impression materials 78.41 light body impression materials 78.42 re cap 78.43 dvi self 78.44 propopar band kit 21 / 25ml 78.45 ghofu crown & bridge...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
21

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13114235 77.59 dycal 77.6 suction tips 77.61 acrylic teeth set 77.62 polishing paste 77.63 polishing rubber cups and bristle 77.64 disposable glass 77.65 abrasive strips for polishing proximal areas of teeth 77.66 cellophene matrix strips for lc restoration 77.67 applicator tips for lc 77.68 desensitizing varnish 77.69 burs for tooth reduction set 77.7 dental stone cutting burs ( small size ) 77.71 h files for both anterior and posterior 77.72 k file for both anterior and posterior 77.73 broaches 77....

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
22

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13114230 76.89 il 2 76.9 procalcitonin 76.91 5acagcgtcatggcagagcaggtggc3’ 76.92 5aaaagctcttcccgcaggatcccgc3’ 76.93 5gtggctgttccgggatggccttctg3’ 76.94 5cttgaagaagggctcactctgtttg3’ 76.95 5cagtacgatgatgcagc3’ 76.96 5caggtagaagaggcggt3’ 76.97 amikacin ,neomycin & 76.98 tobramycin standard (hplc grade) 76.99 edta gel (15%) 77 acrylic heat cure clear 77.01 acrylic heat cure pink 77.02 acrylic self cure clear 77.03 acrylic self cure pink 77.04 agate spatula 77.05 alginate impression material ( dustless...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
23

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

11931886supply of motor with hand piece for existing stryker drill console

Due Date : Apr 6, 2017
Tender Value : Ref. Document
View Notice
24

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

11896168tender for processing of low end electric drill, bone scalpel for laminectomy, micro vascular set and motor with hand piece for existing striker drill console for department of neurosurgery.

Due Date : Apr 6, 2017
Tender Value : Ref. Document
View Notice
25

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

11431283 rate contract for processing of chemicals, reagents, glassware, instruments, surgicals, contrast: 77.74 reamers for both anterior and posterior 77.75 gutta percha 77.76 absorbant paper point 77.77 titanium post (all sizes) 77.78 protapper gutta parcha all size 77.79 alveogel 77.8 rc cal (intra canal dressing paste) 77.81 fiber optics air rotor hand pieces with coupling unit 77.82 gp cutter 77.83 tungsten carbide burs for air rotor and micro motor handpieces 77.84 sectional ...

Due Date : Jan 24, 2017
Tender Value : Ref. Document
View Notice
26

Statutory Bodies & Commissions/Committees - Assam Rifles Godown, Happy Valley, Shillong - Meghalaya

10838245 tender for supply of dental equipments, ( 1. light cure machine ( for light cured composite filling machine ) 2. u v chamber ( for storage of surgical instruments after autoclaving ) 3. modal ( cast ) trimer 4. periosteal elevator ( thin ) 5. hot air over with digital temp, control alarm system, timer & blower 6. glass bead sterilizer 7. dental flask gunmetal size 3 8. dental flask gunmetal size 4 9. gas blow torch 10. heavy duty micro motor with hand piece ( 35000 / 45000 rpm ) ...

Due Date : Nov 22, 2016
Tender Value : Ref. Document
View Notice
27

Statutory Bodies & Commissions/Committees - Shilong - Meghalaya

5133269 supply of dental equipments upper molar cowhorn forcep r & l , scaler hand piece fujinova, light cure machine (for light cured composite filling material), u v chamber (for storage of surgical instruments after autocalving), extraction forcep set (set of precise instruments for removal of teeth), plastic perforated trays set, wire cutter, metallic syringe self aspirating, warmig james elevator (set of 3) (r, lt strakht), pedo extraction forcep set ( u & l), impression trays metallic perforated...

Due Date : Nov 11, 2013
Tender Value : Ref. Document
View Notice
28

Statutory Bodies & Commissions/Committees - shillong - Meghalaya

4112771 supply of molt’s periosteal elevator,upper molar cowhorn forcep r & l,bayonet forcep,micro motor straight hand piece for use in dental lab),light cure machine for light cured composite filling material),dental lathe for finishing of acrylicdentures),high speed lathe for ceramic for cutting metal in lab work),plastic perforated trays set,wire cutter,lead barriers.

Due Date : Dec 31, 2012
Tender Value : Ref. Document
View Notice
29

Government Departments - shillong - Meghalaya

2384166supply of miracle mix,g cavit,osram bulb,twizeer,scaler tips,endowash,cryers elevator,periostal elevator,straight elevator,reamers,silver powder,mortar & pestle,kidney tray,surgical tray with cover,lower molar forcep,apex elevator,bur full set,needle holder,rubber bowl,spatula,dental stone,wire cutter,hanging motor with arm, hand piece &burs.clamp& flask.green sticky wax,occusal plane indicator,base plate,lath motor & buff.

Due Date : May 14, 2011
Tender Value : rupee 1.20 Lakhs
View Notice
30

Statutory Bodies & Commissions/Committees - SHILLONG - Meghalaya

1917235supply of micro motor with hand piece for dental lab

Due Date : Aug 11, 2010
Tender Value : Ref. Document
View Notice

Tenders By City

Tenders By Authority

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail