1426 Tyre tenders in Himachal Pradesh 2025

Get latest Tyre related Tenders, online published by Central University Of Himachal Pradesh, Government Of Himachal Pradesh, Himachal Pradesh Agriculture Development Society from Himachal Pradesh state. Participate online through e-Procurement website for Tyre tenders in Himachal Pradesh. Download Tender Documents, BOQ, Technical Bids for Tyre related Tenders from Himachal Pradesh. Get Bidding support for etenders related to Tyre Tenders in Himachal Pradesh. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Tyre tenders published from Himachal Pradesh. Also get daily email alerts for Tyre related tender notices published by Government of Himachal Pradesh.

Search Result

Private Organizations - Himachal Pradesh

49874864 auction sale of scrap conveyor belt, scrap & discarded scarpio, scrap ms rail line, used and scrap tyres, rubber scrap conveyor belt .

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - pangi - Himachal Pradesh

49837012 auction sale of materials.

Due Date : Jul 4, 2025

Tender Value : Ref. Document

View Notice

Private Organizations - Himachal Pradesh

49808694 auction sale of scrap conveyor belt, scrap & discarded scarpio, scrap ms rail line, used and scrap tyres, rubber scrap conveyor belt .

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Himachal Pradesh

49797864 tender for mushroom rac ks size: 5x3 and height 18 cycle plough size: length 40, widlh 20 with tube less tyre and dandalti

Due Date : Jul 3, 2025

Tender Value : Ref. Document

View Notice

Private Organizations - Solan - Himachal Pradesh

49788743 auction sale of fire affected stock items (crane tyres, rims and other parts etc.) on lump sum basis

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Private Organizations - Solan - Himachal Pradesh

49788723 auction for fire affected approx. 3,018 kg of electric cables and fire affected stock items (crane tyres, rims and other parts etc.) on per kg basis

Due Date : Jun 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - SOLAN - Himachal Pradesh

49784141 bids are invited for pvc wire 2.5 sqmm copper isi mark , pvc wire 1.5 sqmmisi mark , tape roll isi mark , service wire 10 sqmm twin core aluminum isi mark , led bulbs 15 watt isi mark , heat pillar isi mark , gi wire 4 sqmm isi mark , exhaust fan 6 i

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kinnaur - Himachal Pradesh

49601249 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) , automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) 1 year

Due Date : Jun 21, 2025

Tender Value :

3.11 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

49567613 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) mse total quantity : 24

Due Date : Jun 30, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

49563098 bids are invited for otr tyres (v2),otr tyres (v2) total quantity : 52

Due Date : Jun 11, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

49546394 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) mse total quantity : 4

Due Date : Jun 28, 2025

Tender Value :

34000.0

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

49488030 bids are invited for otr tyres (v2) (q3) total quantity : 52

Due Date : Jun 6, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

49392620 bids are invited for lv7 t 815 443 612 015 807 air pressure governer , lv7 t 815 442 070 710 024 fuel pump bosch , lv7 t 815 443 614 002 800 compressor 4102 , lv7 t 815 150 200 004 004 hydraulic cylinder hm 50 25 400 111 111 , lv7 t 815 443 312 804

Due Date : Jun 19, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

49388899 bids are invited for lv7 t 815 4x4 443 115 187 340 starter motor 24v 8kw waterproof , lv7 t 815 4x4 443 614 029 000 compressor 4192 , lv7 t 815 4x4 443 415 035 000 revolution counter 380 245 130 01 , lv7 t 815 4x4 443 655 032 000 high pressure hose

Due Date : Jun 19, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

49335858 bids are invited for lv7 t 815 482 eg0 401 5 jump start cable ve 5 meter , lv7 t 815 130 072 610 104 cross pin , lv7 t 815 443 612 370 802 closing cock , lv7 t 815 443 400 345 000 air horn 3 pa 004 206 051 , lv7 t 815 443 930 132 640 minus plate , l

Due Date : Jun 17, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

49239357 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) , automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total

Due Date : May 31, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mandi - Himachal Pradesh

49200264 tender for supply of items

Due Date : May 27, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kinnaur - Himachal Pradesh

49194457 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) , automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total

Due Date : May 29, 2025

Tender Value :

3.35 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

49111196 Corrigendum : bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 , automotive vehicles pneumatic tyres for 2 and 3 wheeled motor vehicles, quadricycles and e rickshaw e carts as per is 1

Due Date : Jun 16, 2025

Tender Value :

85000.0

View Notice

Statutory Bodies & Commissions/Committees - Solan - Himachal Pradesh

49082669 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) , automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total

Due Date : May 26, 2025

Tender Value :

1.48 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

49016546 bids are invited for nitrogen tyre inflators (q3) total quantity : 1

Due Date : May 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

48979474 bids are invited for nitrogen tyre inflators (q3) total quantity : 1

Due Date : Jun 2, 2025

Tender Value :

80000.0

View Notice

Government Departments - shimla - Himachal Pradesh

48848596 tyres, tubes and batteries etc. expression of interest (eoi) for empanelment of original manufacturer of high quality tyres, tubes and batteries etc. (only isi certified) for fulfilling the needs of govt. departments/psus/other customers through hpaic sal

Due Date : May 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

48652393 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per i total quantity : 565

Due Date : Apr 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

48404546 expression of interest (eoi) for empanelment of original manufacturer of high quality tyres, tubes and batteries (only isi certified) for fulfilling the needs of govt. departments/psus/other customers through hpaic sales/field outlets.

Due Date : Apr 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Chamba - Himachal Pradesh

48399936 bids are invited for purchase of spares of flowmore make cooling water pumps 1 17 key for impeller, model f5823a , seal housing, model f5823a , cover for bearing housing, model f5823a , pump shaft, model f5823a , key for pump half coupling, model f

Due Date : Apr 8, 2025

Tender Value :

40.83 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

48334566 bids are invited for solid cushion tyres (v3) (q3) total quantity : 4

Due Date : Mar 29, 2025

Tender Value : Ref. Document

View Notice

Government Departments - dalhousie - Himachal Pradesh

48153589 tender for tender for auction /dispose off various type of scrap materials as is where is bases lying at hpsebl, divisional stores chamba, dalhousie, jawali and pangi at bhuntar under the control of (op) circle hpsebl, dalhousie.

Due Date : Mar 17, 2025

Tender Value :

24.20 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

48074498 Corrigendum : bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) , automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total

Due Date : Mar 31, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kullu - Himachal Pradesh

47364665 Corrigendum : bids are invited for custom bid for services comprehensive annual maintenance contract amc service work of hydraulic boom barrier integrated with tyre killer and boom bollard at sjvn rampur hps bayal for one year amc of integrated security and survei

Due Date : Apr 30, 2025

Tender Value :

2.73 Lakhs

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

47345200 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 1 total quantity : 16

Due Date : Jan 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47210702 bids are invited for otr tyres for hemms total quantity : 5

Due Date : Jan 18, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

47025671 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) , automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total

Due Date : Jan 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

47001273 e auction sale of lpg petromex, alluminium wall supporting ladder 20 a scar computer dell make with accessories computer table computer chair printer tube voice sand washing machine easy chair with canned back seat table with self 3 x 1½ dust

Due Date : Jan 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

46953840 bids are invited for tyre tube flap rust items cover outer 235 65r17 radialtubeless , cover outer 23575 r15 , cover outer 25565 r18radialtubeless , cover outer 7pt50 x16 , coverouter295x95d20ribtype26noslugtype65 , cover outer 11pt00 x20 16pr , cover

Due Date : Jan 20, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

46741809 bids are invited for 1 towel 2 hand towel 3 tyre polish 4 dash board polish 5 air freshner 6 car flag ce 7 car flag adgbr 8 car flag dgbr 9 body polish 10 micro fibre cloth 11 kit kat fuse 12 insulation tape 13 alumunium thimble

Due Date : Dec 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

46653930 bids are invited for otr tyres for hemms (q3) mse total quantity : 5

Due Date : Jan 2, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Fatehpur - Himachal Pradesh

46652027 auction disposal of condemned/unserviceable of furnitures tyres , fire places etc

Due Date : Dec 17, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

46628981 bids are invited for lv6 mt2 4910 000003 gauge tyre pressure master type 70kpa to,lv7 maruti 17700m83112 radiator assy,l total quantity : 701

Due Date : Dec 13, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

46386127 auction sale of lot no: 4 lot name: tyre and spare parts as per lot annexure

Due Date : Nov 29, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

46384698 auction sale of lot no: 4 lot name: tyre and spare parts as per lot annexure

Due Date : Nov 28, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

46384502 auction sale of lot no: 3 lot name: tyre and spare parts as per lot annexure

Due Date : Nov 30, 2024

Tender Value : Ref. Document

View Notice

Government Departments - gohar - Himachal Pradesh

46376965 Corrigendum : tender for tender for auction dispose off unserviceablecondemned iron scrap condemned aluminium scarp with insulating material sale of condemened scrap of 33kv and 11kvdismantled outgoing incoming panel trivector meter with boxes sale of tyres of var

Due Date : Dec 9, 2024

Tender Value :

4.84 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

46341366 bids are invited for tyre tube and battery coverouter23565r17radialtubeless , coverouter23565 r15 , coverouter255 65r18radial tubeless , cover outer 7 pt 50 x 16 , coverouter295x95d20rib26noslug65nos , cover outer 11 pt 00 x 20 16pr , coverouter10pt0

Due Date : Dec 16, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

46305022 auction sale of lot no: 4 lot name: tyre, tubes and spare parts as per lot annexure

Due Date : Nov 28, 2024

Tender Value : Ref. Document

View Notice

Government Departments - kangra - Himachal Pradesh

46251688 tender for auction /dispose off (through forward auction mode) various type of scrap materials lying at hpsebl, divisional stores at dharamshala, kangra, dehra, palampur, baijnath, lambagaon andshahpurunder (op) circle hpsebl, kangra (seop 23/2024 25)

Due Date : Nov 27, 2024

Tender Value :

32.05 Lakhs

View Notice

Government Departments - Himachal Pradesh

46243679 auction sale of lot no: 3 lot name: tyre and spare parts as per lot annexure

Due Date : Nov 27, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

46243429 auction sale of lot no: 4 lot name: tyre and spare parts as per lot annexure

Due Date : Nov 27, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

46243421 auction sale of lot no: 4 lot name: tyre and spare parts as per lot annexure

Due Date : Nov 27, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

46236430 bids are invited for boom barrier , tyre killer spike barrier , dfmds , bp mobile morchas mobile morchas , binoculars , night vision device , safety jackets , floating tubes , dragon search light , walkie talkie set , bp jackets , life jacket , rope ,

Due Date : Nov 20, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

46234966 bids are invited for lv7 t 815 4x4 443 113 632 000 wheel disc nut m22 1.5 din 74361 10 , lv7 t 815 4x4 443 859 020 810 vehicle fuse 5a , lv7 t 815 443 853 210 040 multi function switch , lv7 t 815 4x4 442 052 381 784 wheel screw , lv7 t 815 5306 72 0

Due Date : Dec 9, 2024

Tender Value : Ref. Document

View Notice

Government Departments - dalhousie - Himachal Pradesh

46214806 tender for auction /dispose off various type of scrap materials as is where is bases lying at hpsebl, divisional stores chamba, dalhousie, jawali and pangi at bhuntar under the control of (op) circle hpsebl, dalhousie.

Due Date : Nov 25, 2024

Tender Value :

23.60 Lakhs

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

46163174 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total quantity : 14

Due Date : Nov 25, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

46149124 auction sale of lot no: 4 lot name: tyre and spare parts as per lot annexure

Due Date : Nov 20, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Himachal Pradesh

46094142 auction sale of condemned tyres, batteries and scrap of vehicles.

Due Date : Nov 18, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

46093292 Corrigendum : bids are invited for 1 towel 2 hand towel 3 tyre polish 4 dash board polish 5 air freshner 6 car flag ce 7 car flag adgbr 8 car flag dgbr 9 body polish 10 micro fibre cloth 11 kit kat fuse 12 insulation tape 13 alumunium thimble

Due Date : Dec 16, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

46077164 bids are invited for lv6 mt2 4910 000003 gauge tyre pressure master type 70kpa to , lv7 maruti 17700m83112 radiator assy , lv7 maruti 22100m83060 cover assy clutch , lv7 t 815 442 170 505 139 releasing mechanism mfz 420 , lv7 t 815 442 900 501 000 fu

Due Date : Nov 30, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

46076034 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) , automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) total

Due Date : Nov 18, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

46073279 bids are invited for lv6 mt1 8465 002867 wallet water proof for vehicle publicati , lv6 mt13 2540 008837 chock stowage vehicular metallic large , lv6 mt14 x 3806750 flap code 20v for tyre size 355 90 20 , lv7 maruti 27101m83110 shaft assy propeller no

Due Date : Nov 29, 2024

Tender Value : Ref. Document

View Notice

Government Departments - KINNAUR - Himachal Pradesh

45954452 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) , automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) total qu

Due Date : Oct 30, 2024

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

45935284 tender cum auction of un serviceable tyres, tubes and flaps.

Due Date : Nov 27, 2024

Tender Value : Ref. Document

View Notice

Government Departments - kangra - Himachal Pradesh

45807153 Corrigendum : tender for seop 23/2024 25 tender for auction , tender for auction /dispose off un serviceable material , the condemned material/damaged equipments un serviceable i.e. aaac 7/4.26 dismantled, aa/aac off size dismantled, dtr meter dismantled off size

Due Date : Nov 19, 2024

Tender Value :

31.92 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

45648645 bids are invited for upgradation of guard room size 30x20 feet upgradation of guard room size 30x20 feet classroom chairs, trichoderma viride 1% wp, mobile toilet, trichoderma harzianum 2% wp, cast iron bench, bitumen emulsion for roads cationic ty

Due Date : Oct 30, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

45644860 bids are invited for cctv cameras with dvr set cctv cameras with dvr set video recorder for cctv system (v2), camera for cctv system (v2), geological compass, combo unit fire fighting with scba set, bit driver set with screw driver bits, stud remov

Due Date : Oct 30, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

45644844 bids are invited for boom barrier , tyre killer spike barrier , dfmds , bp mobile morchas mobile morchas , binoculars , night vision device , safety jackets , floating tubes , dragon search light , walkie talkie set , bp jackets , life jacket , rope

Due Date : Oct 30, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

45618812 Corrigendum : bids are invited for sprinkler 32mm hdpe pipe , 32mm lldpe , sprinkler , 32mm filter , 32mm gi tee , 32mm mta , 32mm end cap , 1 inch raingun with stand , 32mm jointer , 32mm gate valve , pressure release valve , 2 inch nrv , 1 pt 5 hp centrifugal pu

Due Date : Nov 4, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

45540154 bids are invited for alt r crispr cas9 sgrna , alt r crispr cas9 crrna (fla_ g1: ctaggaggtgaatctctcgt) , alt r crispr cas9 crrna (fla_ g2: ttagaggtgtcacgaaacta) , alt r crispr cas9 crrna (fla_ g3: ataacgatacagttgcaagt) , alt r crispr cas9 crrna (dvt_ g1:

Due Date : Oct 24, 2024

Tender Value : Ref. Document

View Notice

Government Departments - rohru - Himachal Pradesh

45520344 tender for sale of condemned material lot 3

Due Date : Oct 10, 2024

Tender Value : Ref. Document

View Notice

Government Departments - jubbal - Himachal Pradesh

45520343 tender for sale of condemned material lot 4

Due Date : Oct 10, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

45509553 bids are invited for tyre 25560 r 18 total quantity : 5

Due Date : Oct 3, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

45508580 Corrigendum : bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total quantity : 10

Due Date : Oct 23, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

45502272 bids are invited for welding rod welding rod , plywood for gen ply , avr ces , sheet cellular , matting rubber , anabond , profile sheet , gasket cyl head welding rod, plywood for gen ply, avr ces, sheet cellular , matting rubber, anabond, profile sh

Due Date : Oct 22, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Kinnaur - Himachal Pradesh

45493649 Corrigendum : bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) , automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) total

Due Date : Oct 25, 2024

Tender Value :

5.48 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

45488423 bids are invited for 9 w led bulb , aggregate 20 mm , angle holder , bricks , casing and caping , celling rose , cement , distribution box 2 way with neutral , distribution box 6 way apn 240 volt with copper bush bar and neutral link , exhaust fan ,

Due Date : Sep 30, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

45483932 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total quantity : 7

Due Date : Oct 10, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

45483806 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 15636 (q2) total quantity : 6

Due Date : Oct 10, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - solan - Himachal Pradesh

45386361 bids are invited for supply of engineer inventory total quantity : 2127

Due Date : Sep 26, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

45384664 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) total quantity : 9

Due Date : Sep 26, 2024

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

45365662 auction for sale/disposal as per condemned/unserviceable material ie iron, plastic & wooden scraps

Due Date : Sep 30, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

45300120 Corrigendum : bids are invited for spare parts of vehicle sensor , fog light set , filter kit cummunis bs iii partno 885418032516 , filter kit cummunis bs iv fuel filter f002h22095bosch oil filter 252518130164 tata , air filter element set 278609139908 , pressure

Due Date : Oct 18, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Sirmaur - Himachal Pradesh

45269119 Corrigendum : tender for online electronic bids through electronic tendering system (ets) in two bid system are inviting the tenderers to participate in the tender for procurement of nylon tyre (dia 200 mm) and nylon side roller lining (dia130mm)

Due Date : Oct 9, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

45253580 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 1 total quantity : 58

Due Date : Sep 17, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

45253572 bids are invited for automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial ply as per is 1 total quantity : 54

Due Date : Sep 17, 2024

Tender Value : Ref. Document

View Notice

Government Departments - rajgarh - Himachal Pradesh

45198950 tender for ocn/db 27/nit no 04/2024 25 e tender for the sale of condemned material viz. aluminium scrap, iron scrap, copper scrap, other scraped material i.e. tyre, battery/cable box in the store located at rajgarh under electrical division hpsebl ra

Due Date : Sep 18, 2024

Tender Value :

12.01 Lakhs

View Notice

Government Departments - mandi - Himachal Pradesh

45129230 Corrigendum : tender for tender for auction dispose off unserviceable condemned iron scrap instrument transformers of various makes and capacities scrap of copper brass alluminum hv lv rods pvc ab xlpe control cables of various sizes electromechanical meters trive

Due Date : Sep 17, 2024

Tender Value :

28.40 Lakhs

View Notice

Government Departments - sundernagar - Himachal Pradesh

45129163 Corrigendum : tender for tender for auction dispose off unserviceable condemned iron scrap instrument transformers of various makes and capacities scrap of copper brass alluminum hv lv rods pvc conductor ab control cables of various sizes rail pole rs joist elect

Due Date : Sep 17, 2024

Tender Value :

19.20 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Solan - Himachal Pradesh

45080000 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) , solid cushion tyres (v2) (q3) , automotive vehicles pneumatic tyres for commercial vehicles diagonal and radial

Due Date : Sep 21, 2024

Tender Value :

1.34 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

45050056 bids are invited for requirment of mta bolt 19 nos , big end bearing set , bty 12 v 110 ahc , cable 25 sq mm 2 core , cable 25 sq mm 4 core , cable 50 sq mm 4 core , coolant , cooling fan , copper washer 17 and 19 nos , crank shaft cutting , cyl head

Due Date : Sep 26, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Sirmaur - Himachal Pradesh

45048227 e tender (ch 2 new building) for the construction of assistant engineer office (ground floor) located in electricity board badripur under district sirmaur hp esd paonta sahib. uesd sataun e/s kafota tehsil kamrau district sirmaur (hp) ct/pt for provisio

Due Date : Sep 17, 2024

Tender Value :

35.62 Lakhs

View Notice

Government Departments - mandi - Himachal Pradesh

45028136 tender for tender for auction dispose off unserviceable condemned iron scrap instrument transformers of various makes and capacities scrap of copper brass alluminum hv lv rods pvc ab xlpe control cables of various sizes electromechanical meters trive

Due Date : Sep 9, 2024

Tender Value :

24.11 Lakhs

View Notice

Government Departments - sundernagar - Himachal Pradesh

45028126 tender for auction /dispose off unserviceable/condemned iron scrap, ias is where is bases lying at store location under o/o sr. executive engineers electrical division, hpsebl, sunder nagar under the control of (op) circle hpsebl,mandi.

Due Date : Sep 9, 2024

Tender Value :

16.09 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

45010051 bids are invited for lv6 mt4 6140 005364 bty sec lead acid 12v 130 ah , lv7 maruti 33370 83011 igniter assy , lv6 mt7 2667 3375 0104 bearing wheel hub outer , lv6 mt1 4030 000003 anchor shackles complete , lv7 stln x 3988100 starter motor 7m14 , lv7

Due Date : Sep 3, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

45004174 auction sale of lot no: 13 lot name: tyre tubes (assorted size) 23 nos

Due Date : Sep 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

45004171 auction sale of lot no: 3 lot name: tyre tubes and flaps etc

Due Date : Sep 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - mandi - Himachal Pradesh

44993402 tender for unserviceable/condemned iron scrap instrument transformers of various makes and capacities, scrap of (copper/ brass/ alluminum hv/lv rods), pvc, conductor, ab/control cables of various sizes, rail pole, rs joist, electromechanical meters/trivec

Due Date : Sep 9, 2024

Tender Value :

16.09 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

44960232 bids are invited for tyre 25560 r 18 mse total quantity : 5

Due Date : Sep 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

44940977 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) total quantity : 9

Due Date : Sep 9, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - MANDI - Himachal Pradesh

44894451 bids are invited for automotive vehicles pneumatic tyres for passenger car vehicles diagonal and radial ply as per is 15633 (q2) total quantity : 36

Due Date : Aug 26, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

44787222 bids are invited for lv7 tata 2198 4110 0101 assy propeller shaft front from aux g , lv7 maruti 11110m52g12 head assy cylinder , lv6 mt12 2910 000006 secondary fuel filter 1 liter star type , lv7 t 815 443 312 803 109 direction lamp , lv6 mt1 5120 000

Due Date : Aug 19, 2024

Tender Value : Ref. Document

View Notice

100

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

44783806 bids are invited for lv7 maruti 1385 83000 seal air inatake case , lv7 stln vf 5120 424035 p 2610347 puller mechanical , lv7 stln 4720 015665 x 1913850 rubber hose air intake , lv7 maruti 11360m71c00 cover timing belt inside , lv6 mt1 4320 000080 pump

Due Date : Aug 19, 2024

Tender Value : Ref. Document

View Notice

Tenders By City

Top