94 Rechargeable Battery tenders in Himachal Pradesh 2025

Get latest Rechargeable Battery related Tenders, online published by Central University Of Himachal Pradesh, Government Of Himachal Pradesh, Himachal Pradesh Agriculture Development Society from Himachal Pradesh state. Participate online through e-Procurement website for Rechargeable Battery tenders in Himachal Pradesh. Download Tender Documents, BOQ, Technical Bids for Rechargeable Battery related Tenders from Himachal Pradesh. Get Bidding support for etenders related to Rechargeable Battery Tenders in Himachal Pradesh. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Rechargeable Battery tenders published from Himachal Pradesh. Also get daily email alerts for Rechargeable Battery related tender notices published by Government of Himachal Pradesh.

Search Result

Statutory Bodies & Commissions/Committees - Solan - Himachal Pradesh

49085916 bids are invited for gel pen (v3) (q4) , rollerball pen (v3) (q4) , black lead pencils (v2) as per is 1375 (q4) , desk pads writing (v2) (q4) , knife blades (q4) , markers for white board (v2) (q4) , glue stick (v2) (q4) , report cover (q4) , metri

Due Date : Jun 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

49027678 Corrigendum : bids are invited for double sided tape (q4) , register (v2) (q4) , fountain pens (v2) (q4) , glue stick (v2) (q4) , rollerball pen (v3) (q4) , metric steel scales (v2) as per is 1481 (q4) , tags for files (v2) as per is 8499 (q4) , read write compact

Due Date : May 24, 2025

Tender Value :

20960.0

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

48937330 bids are invited for double sided tape (q4) , toner cartridges ink cartridges consumables for printers (q2) , register (v2) (q4) , fountain pens (v2) (q4) , glue stick (v2) (q4) , rollerball pen (v3) (q4) , metric steel scales (v2) as per is 1481 (q4

Due Date : May 10, 2025

Tender Value :

39760.0

View Notice

Government Departments - Shimla - Himachal Pradesh

48767409 bids are invited for portable sealed rechargeable single cells nickel metal hydride (rechargeable batteries) as per is 16048, 16046 (q3) , rain coat & suit (q4) total quantity : 1530

Due Date : May 10, 2025

Tender Value :

36000.0

View Notice

Government Departments - Shimla - Himachal Pradesh

47939954 Corrigendum : bids are invited for chemical alt r crispr cas9crrna , alt r crispr cas9 crrna , alt r crispr cas9crrna , alt r crispr cas9 tracr rna , alt r s.p.hifi cas9 nuclease v3 , nuclease free duplex buffer , idtx 1xte solution , portable sealed rechargeable

Due Date : Mar 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47667835 tender for supply of ets machines

Due Date : Mar 6, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

47569056 bids are invited for h3 5510 00361 timber softwood coniferous sleeper , z7 rp 124 france 0018 10491490 lithium cell 3.5 dc size aa ls 6 saft , y3 6135 000030 battry inert 1.05v no 1 , z7 rp5855 000717 dummy cell size aa with 33 ohms resis , z7 6640 0

Due Date : Feb 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - SHIMLa - Himachal Pradesh

47382375 tender for plant protection equipments (sprayer) isi marked

Due Date : Feb 13, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - palampur - Himachal Pradesh

47225976 tender for global etender for supply and installation of leaf area meter

Due Date : Feb 13, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

47136550 bids are invited for portable sealed rechargeable single cells nickel metal hydride (rechargeable batteries) as per is 16048, 16046 (q3) total quantity : 90

Due Date : Jan 20, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - palampur - Himachal Pradesh

47133821 Corrigendum : etender for supply and installation of portable and handheld uv pam fluorometer

Due Date : Jan 30, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

46835474 Corrigendum : bids are invited for portable sealed rechargeable single cells nickel metal hydride (rechargeable batteries) as per is 16048, 16046 (q3) mse total quantity : 3

Due Date : Jan 27, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

46255157 Corrigendum : bids are invited for portable sealed rechargeable single cells nickel metal hydride (rechargeable batteries) as per is 16048, 16046 (q3) total quantity : 105

Due Date : Jan 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kinnaur - Himachal Pradesh

46096537 bids are invited for portable sealed rechargeable single cells nickel cadmium (rechargeable batteries) as per is:1604 total quantity : 80

Due Date : Nov 12, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kinnaur - Himachal Pradesh

45618489 bids are invited for scrapper seal type a actylonitrile butadiene rubber, part no. wa0201100 for sft gate scrapper seal puf seal, heat seal sterilization roll with chemical indicator, oil seal, non sparking scraper is:4595, plastic grip seal, bolt

Due Date : Oct 30, 2024

Tender Value :

4.63 Lakhs

View Notice

Government Departments - Kinnaur - Himachal Pradesh

45545142 Corrigendum : bids are invited for portable sealed rechargeable single cells nickel cadmium (rechargeable batteries) as per is:16048 (part 1)iec:61951 1 (q3) total quantity : 80

Due Date : Nov 7, 2024

Tender Value :

12800.0

View Notice

Government Departments - Shimla - Himachal Pradesh

45540154 bids are invited for alt r crispr cas9 sgrna , alt r crispr cas9 crrna (fla_ g1: ctaggaggtgaatctctcgt) , alt r crispr cas9 crrna (fla_ g2: ttagaggtgtcacgaaacta) , alt r crispr cas9 crrna (fla_ g3: ataacgatacagttgcaagt) , alt r crispr cas9 crrna (dvt_ g1:

Due Date : Oct 24, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

44285185 tender for left out plant protection equipments (sprayer)

Due Date : Aug 1, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

43758770 tender for plant protection equipments (sprayer) isi marked

Due Date : Jul 2, 2024

Tender Value : Ref. Document

View Notice

Government Departments - KINNAUR - Himachal Pradesh

43603486 bids are invited for portable sealed rechargeable single cells nickel metal hydride (rechargeable batteries) as per is 16048, 16046 (q3) total quantity : 600

Due Date : Jun 10, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA - Himachal Pradesh

43451511 bids are invited for 1 10533433/ism/29a/pull through 1a jute/hemp 2 10162422/6140 005208/bty secy lith ion (sealed cylind 3 10163029/6140 005205/bty sec portable li ion scaled cylind 4 10162464/rp 6135 000288/battery non rechargeable lithium sulp

Due Date : May 25, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Kinnaur - Himachal Pradesh

43333716 bids are invited for portable sealed rechargeable single cells nickel metal hydride (rechargeable batteries) as per is 16048, 16046 (q3) mse total quantity : 600

Due Date : May 20, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - MANDI - Himachal Pradesh

43310459 bids are invited for providing and installation of wireless communication system at various site of bsl project total quantity : 93

Due Date : May 9, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

43253067 bids are invited for (a) 10533433/ism/29a/pull through 1a (jute/hemp) nos 269 item should be match as per specification/ depot sample (b) 10162422/6140 005208/bty secy lith ion (sealed cylindnos 78 (c) 10163029/6140 005205/bty sec portable li io

Due Date : May 18, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

42918794 bids are invited for lithium ion cells and batteries for portable application (rechargeable batteries) as per is 16047 iec 61960 (q3) total quantity : 1

Due Date : Mar 26, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Kangra - Himachal Pradesh

42866092 bids are invited for purchase of consumable items for atal extension board wooden , arduino uno , breadboards 400pin , xbee bluetooth wireless module , xbee adapter , 10k ohm potentiometer , digital multimeter , soldering wire , soldering iron , sold

Due Date : Mar 23, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - MANDI - Himachal Pradesh

42602826 sanchar stc 700 handheld walkie talkie , sanchar base station scm 910 hv , sanchar repeater scr 910 , high gain diamond 6 db antenna with reflectors , rf low zero loss half inch copper cable roll 300 meter , sanchar bm 315 psu cum inverter , sanchar b

Due Date : Mar 11, 2024

Tender Value :

29.96 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

42383554 bids are invited for atg items dslr camera with lens , camera bag , power cell aa rechargeable , aa battery charger , portable projector total quantity : 8

Due Date : Mar 2, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

42185243 tender for supply of items

Due Date : Feb 26, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

42151374 bids are invited for battery charger cell 1.2 v , rechargeable bty 3.6v , battery charger , battery 1.2volt , rechargeable bty 3.6 total quantity : 62

Due Date : Feb 21, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

42124655 bids are invited for rechargeable battery rechargeable cell , aa cell , cell charger , battery charger , fuel pipe total quantity : 74

Due Date : Feb 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Hamirpur - Himachal Pradesh

41914883 bids are invited for arduino uno , arduino nano , arduino mega , flame sensor , 37 in 1 sensor kit , infrated sensor , ultrasonic sensor , led red , led green , led white , led yellow , led rgb , power bank , 9v battery , 12v rechargeable battery , a

Due Date : Feb 10, 2024

Tender Value :

5.50 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

41894204 bids are invited for cell aa cell 1.2 v , rechargeable bty 3.6v , battery charger , battery 1.2volt , rechargeable cell 3.6v total quantity : 62

Due Date : Feb 10, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

41692392 Corrigendum : tender for plant protection equipments (sprayers)

Due Date : Feb 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Hamirpur - Himachal Pradesh

41569418 bids are invited for arduino uno , raspberry pi 5 , 9v battery , 9v rechargeable battery , 9v battery charger , filament , otto bot , copper wire , flame sensor , drone , 3d pen , jumper cable male to male , jumper cable male to female , jumper cable

Due Date : Jan 22, 2024

Tender Value :

5.50 Lakhs

View Notice

Government Departments - Kinnaur - Himachal Pradesh

40730970 repair & providing spares of motorola handie talkie, rechargeable batteries and antenna of 3x40mw svp bhaba power house. b) providing repair and replacement of dc connector of cctv camera, media converter, chargers for media converter and 2 nos. ptz camer

Due Date : Nov 25, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - shahpur - Himachal Pradesh

40550620 tender for supply of tools equipments

Due Date : Nov 16, 2023

Tender Value :

10 Lakhs

View Notice

Boards / Undertakings / PSU - Paonta Sahib - Himachal Pradesh

40337506 supply of led handheld spot light specification power 7w distance minimum 50 mtr battery rechargeable

Due Date : Nov 5, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Mandi - Himachal Pradesh

40269519 bids are invited for master boffin , diy drone , small cardboard drone , glue gun , glue stick , otto bot , makey makey , microbit , ml kit arduino , outside flex , 9v rechargeable battery , 9v battery charger , 11.1v battery rechargeable , 3d pen ,

Due Date : Oct 28, 2023

Tender Value :

5.50 Lakhs

View Notice

Government Departments - Kinnaur - Himachal Pradesh

40046663 Corrigendum : bids are invited for portable sealed rechargeable single cells nickel cadmium (rechargeable batteries) as per is:16048 (part 1)iec:61951 1 (q3) total quantity : 30

Due Date : Dec 25, 2023

Tender Value : Ref. Document

View Notice

Government Departments - palampur - Himachal Pradesh

39810719 auction for unserviceable store articles willingness of acquisition thereof.

Due Date : Oct 8, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - dharamshala - Himachal Pradesh

39170781 Corrigendum : tender for special repair to road and path in mil stn dharamshala

Due Date : Sep 13, 2023

Tender Value :

16.06 Lakhs

View Notice

Boards / Undertakings / PSU - paonta sahib - Himachal Pradesh

38097583 tender for led handheld spot light specification power 7w battery rechargeable distance minimum 50 mtr

Due Date : Jun 20, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Mandi - Himachal Pradesh

36384533 bids are invited for procurement for atal tinkering lab equipments mse arduino uno , arduino nano , breadboard solderless 400 pin , breadboard solderless 800 pin , jumper cable male to male , jumper cable male to female , jumper cable female to female , p

Due Date : Mar 3, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Una - Himachal Pradesh

35866762 bids are invited for arduino uno , arduino mega , arduino nano , led red , led green , led blue , led yellow , led white , led rgb , node mcu , moter driver l293d , moter driver l298n , drone battery 2200 mah , arduino uno proto shield , drone propel

Due Date : Jan 31, 2023

Tender Value :

5.50 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

35486041 Corrigendum : bids are invited for oxygen cylinder oxygen filling , rechargeable batteries and charger , go pro hero battery and charger total quantity : 154

Due Date : Jan 13, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

35239009 bids are invited for boq bid oxygen filling , rechargeable batteries and charger , go pro hero battery and charger total quantity : 154

Due Date : Dec 23, 2022

Tender Value :

1.40 Lakhs

View Notice

Government Departments - Hamirpur - Himachal Pradesh

34628752 tender for atl additional items

Due Date : Nov 12, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

33811424 bids are invited for supply of 1 7.2 v 1450 mah li mh rechargeable battery 2 single unit battery charger for radio set motorola total quantity : 60

Due Date : Sep 16, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Mandi - Himachal Pradesh

33747729 bids are invited for boffin 1 , boffin 2 , amusement park , blix junior , e circuits , logic blocks , discovering motions , gear box , power screw , rack and pinion , coin cell , copper tape , battery 9v , rechargeable battery , battery charger , aa size

Due Date : Sep 10, 2022

Tender Value :

5.50 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - palampur - Himachal Pradesh

33109928 supply of medical stores to military hospital palampur as per tender document , medicines : , inj lorazepam 2mg / ml, 2 ml , inj methylcobalamine 100 mcg+vit b6, 100 mg +nicotamide 100 mg 2 ml amp , inj succinylchloline chloride 50 mg / ml, 2 ml ,

Due Date : Jul 27, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Mandi - Himachal Pradesh

32894199 bids are invited for boffin 1 , boffin 2 , amusement park , blix junior , e circuits , logic blocks , discovering motions , gear box , power screw , rack and pinion , coin cell , copper tape , battery 9v , rechargeable battery ,

Due Date : Jul 11, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Mandi - Himachal Pradesh

32539150 supplying, installation testing and commissioning of 10 passenger machine room less elevator at sub tehsil building at chattri district mandi hp 1 supplying, installation, testing& commissioing of 1 no.electric traction 10passenger of standard makeco

Due Date : Jun 10, 2022

Tender Value :

21.50 Lakhs

View Notice

Government Departments - Mandi - Himachal Pradesh

32539133 supplying, installation testing and commissioning of 6 passenger machine room less elevator at seri culture building at balichowki district mandi hp 1 supplying, installation, testing& commissioing of 1 no.electric traction 6 passenger of standard ma

Due Date : Jun 10, 2022

Tender Value :

20.53 Lakhs

View Notice

Boards / Undertakings / PSU - Chamba - Himachal Pradesh

32460478 bids are invited for air freshener (q4) , laundry soap is 285 (q4) , toothbrush is: 3387 (q4) , insecticides for mosquitoes cockroaches and other insects (liquid vaporizer and spray) (q3) , portable sealed rechargeable single cells nickel metal hydride

Due Date : Jun 11, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Shimla - Himachal Pradesh

30535787 bids are invited for item 1 plier 255 mm , item 2 phase tester , item 3 screw driver set , item 4 allen and key set , item 5 wire cutter , item 6 tool bal polyster , item 7 adjustable type pipe wrench , item 8 hammer with handle claw type

Due Date : Jan 12, 2022

Tender Value :

3.52 Lakhs

View Notice

Government Departments - Kullu - Himachal Pradesh

30457805 bids are invited for smartstick stungun, rechargeable battery, 3 zone lighting, panic button, usbphonecharging point, wilderness survival kit total quantity : 1

Due Date : Jan 3, 2022

Tender Value :

86000.0

View Notice

Government Departments - Hamirpur - Himachal Pradesh

30270991 bids are invited for camera type: compact digital camera, image sensor cmos, sensor size for fixed lens camera ( inch ) 1 / 2.3, pixels 16 mega pixels, sensitivity of image sensor 6400 max, lens mounting – fixed, focal length 16 mm ( mini.

Due Date : Dec 30, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

30252210 bids are invited for item 1 plier 255 mm , item 2 phase tester , item 3 screw driver set , item 4 allen and key set , item 5 wire cutter , item 6 tool bal polyster , item 7 adjustable type pipe wrench , item 8 hammer with handle claw type

Due Date : Dec 22, 2021

Tender Value :

3.52 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

29974865 bids are invited for y3 6135 001398 battery non rechargeable lithium coin cel , y3 6135 001362 battery non rechargeable lithium sulpher total quantity : 1

Due Date : Dec 1, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu -> Himachal Pradesh - Himachal Pradesh

29308615 bids are invited for memory card , memory card reader , portable sealed rechargeable single cells nickel metal hydride ( rechargeable batteries ) is:16048, 16046 , allen key , wilfit spares , line tester , m seal is 9197 , bit driv

Due Date : Oct 4, 2021

Tender Value : Ref. Document

View Notice

Government Departments - Himachal Pradesh

28475635 purchase of automatic weather station at hfri shimla under two bid systems

Due Date : Jul 26, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

28329156 bids are invited forlithium ion rechargeable batteries 72 volt (for e rickshaws) total quantity : 37

Due Date : Jul 5, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

28279078 bids are invited forlithium ion rechargeable batteries 72 volt ( for e rickshaws ) , lithium ion rechargeble batteries, 60 volt, fore rickshaws total quantity : 505

Due Date : Jul 2, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

28264973 bids are invited for lithium ion rechargeable batteries 72 volt ( for e rickshaws ) total quantity : 17367

Due Date : Jun 30, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27407250 bids are invited for lithium ion rechargeable batteries 72 volt ( for e rickshaws ) years of past experience required 3 year ( s ) total quantity : 1902

Due Date : Mar 29, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27407217 bids are invited for lithium ion rechargeable batteries 72 volt (for e rickshaws)years of past experience required 3 year (s) total quantity : 45

Due Date : Mar 29, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27406986 bids are invited for lithium ion rechargeable batteries, 48 volt, for e rickshawsyears of past experience required 3 year (s) total quantity : 141

Due Date : Mar 29, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27197645 bids are invited for lithium ion rechargeable batteries 72 volt ( for e rickshaws ) years of past experience required 3 year ( s ) total quantity : 33

Due Date : Mar 12, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27197548 bids are invited for lithium ion rechargeable batteries 72 volt ( for e rickshaws ) , lithium ion rechargeable batteries, 48 volt, for e rickshawsyears of past experience required 3 year ( s ) total quantity : 3650

Due Date : Mar 11, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27168713 bids are invited for lithium ion rechargeable batteries 72 volt ( for e rickshaws ) years of past experience required 3 year ( s ) total quantity : 752

Due Date : Mar 8, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27168034 bids are invited for portable sealed rechargeable single cells nickel metal hydride ( rechargeable batteries ) is:16048, years of past experience required 3 year ( s ) total quantity : 16591

Due Date : Mar 8, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

27120955 bids are invited for lithium ion rechargeble batteries, 60 volt, for e rickshaws ,lithium ion rechargeable batteries, 48 volt, for e rickshaws ,lithium ion rechargeable batteries 72 volt (for e rickshaws) total quantity : 1133

Due Date : Mar 6, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA -> Himachal Pradesh - Himachal Pradesh

27065083 bids are invited for portable sealed rechargeable single cells nickel cadmium ( rechargeable batteries ) as per is:16048 total quantity : 114

Due Date : Mar 2, 2021

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - KANGRA -> Himachal Pradesh - Himachal Pradesh

27024505 bids are invited for portable sealed rechargeable single cells nickel cadmium ( rechargeable batteries ) as per is:16048 total quantity : 339

Due Date : Feb 27, 2021

Tender Value : Ref. Document

View Notice

Government Departments - Shimla HQ - Himachal Pradesh

26009304 non modular elecrical switches and accessories flush type , pvc copper cable 1 core and multi core circular sheathed cable with rigid conductor , pvc copper cable, single core, unsheathed cables with flexible conductor for working voltages up to , pvc cop

Due Date : Dec 1, 2020

Tender Value : Ref. Document

View Notice

Government Departments - dharamshala - Himachal Pradesh

25812808 wqm and sp sub head providing supplying demonstration and installation of laboratory instruments

Due Date : Nov 7, 2020

Tender Value :

6.82 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

25601020 lithium ion cells and batteries for portable application (rechargeable batteries)

Due Date : Oct 10, 2020

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Una BP - Himachal Pradesh

25265373 supply of vhf walkie talkie sets and vhf licence amendement for una bp supply of motorola xir p8600i ( fkp ) make digital vhf set inclusive of intrinsically safe rechargeable batteries of at least 2150 mah capacity and chargerandliaisoning with dot

Due Date : Sep 3, 2020

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - None - Himachal Pradesh

25193770 portable sealed rechargeable single cells nickel metal hydride (rechargeable batteries)

Due Date : Aug 28, 2020

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - None - Himachal Pradesh

23204462 lithium ion rechargeable batteries 72 volt (for e rickshaws)

Due Date : Jan 20, 2020

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Shimla HQ - Himachal Pradesh

22748220 lithium ion rechargeable batteries 72 volt (for e rickshaws)

Due Date : Dec 14, 2019

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Koldam Hydro Project P.O JAMTHAL DISTT. BILASPUR 1 - Himachal Pradesh

18109853 procurement of rechargeable battery operated welding machine at ntpckoldam,

Due Date : Nov 16, 2018

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Himachal Pradesh

18023047 machinery and tools, manufacturing machinery, soldering and welding machinery

Due Date : Nov 8, 2018

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Himachal Pradesh

18014060 machinery and tools, manufacturing machinery, soldering and welding machinery

Due Date : Nov 8, 2018

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Himachal Pradesh

18003563 machinery and tools, manufacturing machinery, soldering and welding machinery

Due Date : Nov 7, 2018

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Koldam Hydro Project P.O JAMTHAL DISTT. BILASPUR 1 - Himachal Pradesh

17978742 machinery and tools, manufacturing machinery, soldering and welding machinery

Due Date : Nov 8, 2018

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

17426167 electrical industry, battery and cell, dry cell batteries, rechargeable batteries, electronic products and appliances, audio visual equipments, camera

Due Date : Sep 26, 2018

Tender Value :

2.33 Lakhs

View Notice

Boards / Undertakings / PSU - Jhakri - Himachal Pradesh

16612459 electrical industry, battery and cell, dry cell batteries, generators, diesel generators, circuit protection device, mccb, light and bulbs, halogen light

Due Date : Jul 25, 2018

Tender Value :

3.54 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - At Sec Trg Branch Hq Artrac - Himachal Pradesh

11578830 scientific instrument, viewing and observing instruments, binoculars, electrical industry, battery and cell, battery chargers, medical related equipment and supplies, patient care and treatment, first aid box, electronic products and appliances, audio vis

Due Date : Feb 7, 2017

Tender Value :

5.98 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - 2Nd Bn Itbp Babeli Camp Kullu Hp - Himachal Pradesh

11291786 medical related equipment and supplies, medical equipments, medical equipment, medical sterilization products, autoclave and sterilizer equipment, it and telecommunications, other equipments, audio video equipment, scientific instrument, universal testing

Due Date : Jan 9, 2017

Tender Value :

3.98 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Himachal Pradesh

9814981 furniture, furniture items, mattresses, apparel and personal care, clothing, coats and jackets, electronic products and appliances, audio visual equipments, camera, medical related equipment and supplies, patient care and treatment, first aid box

Due Date : Jun 16, 2016

Tender Value :

5.98 Lakhs

View Notice

Boards / Undertakings / PSU - shimla - Himachal Pradesh

3690139 supply of smf batteries rechargeable sealed lead acid batteries) for ups

Due Date : Aug 8, 2012

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - shimla - Himachal Pradesh

2569574 “supply, installation & monitoring of geotechnical instruments for power house of rhep at bayal.(piezometer,readout unit for piezometer,electro mechenical load cell (ribs) specifications: sensor: potentiometric display: lcd battery: rechargeable,cable for load cells, steel armoured & jelly filled (4 core ),cable for piezometer steel armoured (4 core ,electrical readout unit for load cells,mechanical readout unit for load cells,readout unit for inclinometer,) and drilling ,installation and mo...

Due Date : Aug 12, 2011

Tender Value : Ref. Document

View Notice

Tenders By City

Top