|
| 1 | Custom DNA Synthesis of Primers 25 nmol | BK 5419 08 |
| 2 | Prime Script 1st strand cDNA Synthesis Kit 50 reactions | 6110A |
| 3 | TB Green Pre Mix Ex Taq II Tli RNAse H Plus | RR820A |
| 4 | RNAiso plus Total RNA extraction reagent | NA |
| 5 | Amylase from Bacillus licheniforms | 9000 85 5 |
| 6 | Amyloglucosidase from Aspergillus niger lyophilized Powder 70 U mg | 9032 08 0 |
| 7 | Glucose Oxidase form Aspergillus niger type VII lyophilized powder 100000 units g solid without added oxygen | 9001 37 0 |
| 8 | Peroxidase from horseradish type II essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol | 9003 99 0 |
| 9 | Primers Forward Revers Total Base 1249 | NA |
| 10 | Fish Immunoglobulin M Ig ELISA kit 96T | CSB E12045Fh |
| 11 | Superoxide Dismutase SOD ELISA kit | CSB E15929Fh 96T |
| 12 | Fish lysozyme renal amyloidosis LZM ELISA kit | CSB E17296Fh 96T |
| 13 | Fish Interleukin 6 IL 6 ELISA Kit | CSB E13258Fh 96T |
| 14 | Fish Cortisol ELISA Kit | CSB E08487f 96T |
| 15 | Forward Primers | Concentration 100 pmol primer 192 bp |
| 16 | Reverse Primer | Concentration 100 pmol primer 256bp |
| 17 | Taq DNA Polymerase | recombinant 500U |
| 18 | EZAssay Antioxidant activity estimation kit CUPRAC 200 tests | na |
| 19 | Azo M Protein Azo Casein | NA |
| 20 | EZdetect PCR kit for Mycoplasma detection Based on 16S 23S rRNA spacer region | na |
| 21 | Trypsin inhibitor powder source Soyabean Cell culture tested Activity 7000BAEE units of inhibition mg | TC251 25MG |
| 22 | COIF1 5TCAACCAACCACAAGACATTGGCAC3 26 nucleotides | 30nmole |
| 23 | COIR1 5TAGACTTCTGGGTGCCAAAGAATCA3 26 nucleotides | 30nmole |
| 24 | M151 5AACCCGGCTTTCGGCAGCA3 20 nucleotides | 20nmole |
| 25 | M152 5CGGGGCGGGGTTGTGAGAT3 20 nucleotides | 30nmole |
| 26 | IHN UP F 5AGAGATCCCTACACCAGAGAC 3 21 nucleotides | 30nmole |
| 27 | IHN UP R 5AGAGATCCCTACACAGAGAC 3 21 nucleotides | 30nmole |
| 28 | VN F 5ATGGAAGGAGGAATCGTGAAGCG 3 24 nucleotides | 30nmole |
| 29 | VN R 5 GCGGTGAAGTGCTCAGTTCCC 3 22 nucleotides | 30nmole |
| 30 | IPN F 5 GTGCTGGCCACAACGACAAC 3 21 nucleotides | 30nmole |
| 31 | IPN R 5 AATTGGTCTGCCGTTCCTA 3 19 nucleotides | 30nmole |
| 32 | ISAoic F 5 GGCTATCTACCAT AACGAAT 3 21 nucleotides | 30nmole |
| 33 | ISAoic R 5 GCCAAGTGTAAGTGCACTCC 3 21 nucleotides | 30nmole |
| 34 | Bench Top 1kb DNA Ladder | na |
| 35 | Bench Top 100bp DNA Ladder | na |
| 36 | Bench Top PCR Marker | na |
| 37 | Taq DNA Polymerase recombinant 5U uL | na |
| 38 | Quick CIP 1000 units with buffer | M0525S |
| 39 | T4 DNA Ligase 20000 units | M0202S |
| 40 | ProtoScript II First Strand cDNA Synthesis Kit 30 reactions | E6560S |
| 41 | Q5 High Fidelity 2X Master Mix 100 reactions | M0492S |
| 42 | OneTaq 2X Master Mix with Standard Buffer 100 reactions | M0482S |
| 43 | Synthetic peptides | na |
| 44 | SpectraDrop 24 Kit | na |
| 45 | Easy Yeast Plasmid Isolation Kit 50 rxns | 630467 |
| 46 | Quick Easy Yeast Transformation Mix 20rxn | 631851 |
| 47 | Western BLoT Immuno Booster PF 250ml | T7115A |
| 48 | Western BLoT Blocking Buffer Protein Free 500ml | T7132A |
| 49 | FastDigest ApaI 300rxn | FD1414 |
| 50 | FastDigest BamHI 800rxn | FD0054 |
| 51 | FastDigest BgIII 100rxn | FD0083 |
| 52 | FastDigest EcoRI 800rxn | FD0274 |
| 53 | FastDigest EcoRV Eco32I 200 rxn | FD0303 |
| 54 | FastDigest HindIII 800rxn | FD0504 |
| 55 | FastDigest KpnI 300rxn | FD0524 |
| 56 | FastDigest NcoI 20rxn | FD0573 |
| 57 | FastDigest Ndel 100 rxn | FD0583 |
| 58 | FastDigest Nhel 50 rxn | FD0973 |
| 59 | FastDigest Notl 50 rxn | FD0594 |
| 60 | FastDigest SaII 200rxn | FD0644 |
| 61 | FastDigest SmaI 100 rxn | FD0663 |
| 62 | FastDigest SacI 100 rxn | FD1133 |
| 63 | FastDigest XbaI 300 rxn | FD0684 |
| 64 | FastDigest XhoI 400 rxn | FD0694 |
| 65 | FastDigest value pack | K1991 |
| 66 | Synthetic peptide | na |
| 67 | MRGSH 011FW | 5 AAAGGTCGGGGGTTTGGACTAATG 3 24 nucleotides |
| 68 | MRGSH 011RV | 5 CCAGACATACTGACACAGCCCTTC 3 24 nucleotides |
| 69 | SHRV 1 F | 5 GTATGGGTCGAAATACATCTCG 3 22 nucleotides |
| 70 | SHRV 1 R | 5 GTCTCCAATCCAGTAGAGCT 3 20 nucleotides |
| 71 | SHRV 2 F | 5 AGCGGTCACAGAATG CGATA 3 20 nucleotides |
| 72 | SHRV 2 R | 5 CTGCGATCCAAAAAC CTTGG 3 20 nucleotides |
| 73 | SHRV IPC2 fwd | 5 TGGATTCAGTGTAAAGGAGGTTC 3 23 nucleotides |
| 74 | SHRV IPC2 rev | 5 CAGTCTCGGGCTTGACTAATG 3 21 nucleotides |
| 75 | Bacterial Genome Sequencing | gDNA QC gDNA shotgun Library Preparation Sequencing Illumina HiSEQ 2x150 base Q30 80 10 12 Gb data Data QC & reporting |
