Procurement Of Laboratory Consumables Under The Serb Dst Sponsored Research Projects For The Department Of Veterinary Pathology, College Of Veterinary Sciences And Ah, Rk Nagar, West Tripura For The Year 2022 Procurement Of Laboratory Consumables Under, West Tripura-Tripura

Procurement Of Laboratory Consumables Under The Serb Dst Sponsored Research Projects For The Department Of Veterinary Pathology, College Of Veterinary Sciences And Ah, Rk Nagar, West Tripura For The Year 2022 Procurement Of Laboratory Consumables Under The Serb Dst Sponsored Research Projects For The Department Of Veterinary Pathology, College Of Veterinary Sciences And Ah, Rk Nagar, West Tripura For The Year 2022 , Micro Glass Slide, Frosted-50Nos / Box, Brand: Blue Star / Merck / Thermo Fisher Scientific , Cover Slip-100 Pc / Box, Brand: Generic / Merck / Blue Star , Test Tubes With Cork Lid - 15 Ml-Pack Of 10Pc, Brand: Generic / Merck / Thermo Fisher Scientific , Test Tube Holder-Brass-Brand: Harpal Son / Merck , Volumetric Flask With Cap- 1000Ml, Brand: Eisco / Merck , Volumetric Flask With Cap--250Ml, Brand: Eisco / Merck , Tissue Specimen Jar, Clear Transparent Glass With Lid--Vol:1.2 L, Brand: Borosil / S Science , Glass Beaker ( Graduated ) -- 250Ml, Brand: Witegscientific / Eisko / Glassco / Thermo Fisher Scientific , Glass Beaker --500Ml, 6Pc / Pack, Brand: Lfas / Glassco / Thermo Fisher Scientific , Glass Beaker -1000Ml, 6 Pc / Pack, Lfas / Glassco / Thermo Fisher Scientific , Glass Beaker –2000Ml, 2Pc / Pack, Lfas / Glassco / Thermo Fisher Scientific , Conical Flask—250 Ml, 6Pc / Pack, Lfas / Glassco / Thermo Fisher Scientific , Polycarbonate Aluminum Anaerobic Culture Jar—3.5 Lits, Brand: Alpha Chem / Glassco / Thermo Fisher Scientific , Metalic Anaerobic Culture Jar—3.5 Lits, Alphachem / Glassco / Thermo Fisher Scientific , Candle Jar –5 Liters, Borosil / Glassco / Thermo Fisher Scientific , Homogenizer—100 To 1000 Ml, Bionicsscientific / Remi / Glassco / Br Biochem , Magnetic Stirrer—Capacity-1Liter, Remi / Glassco / Thermo Fisher Scientific , Measuring Cylinder –1000Ml, Labifie / Glassco / Thermo Fisher Scientific , Screw Blue Caped Glass Reagent Bottle—100 Ml, 4 Pc / Pack, Brand: Witegborosilicated / Abg / Generic , Diamond Pencil—Brand: Micare India Inc / Glassco / Thermo Fisher Scientific , Wintrobeshaematocrit Tube –10Pc / Pack, Brand: Mlabs / Glassco / Thermo Fisher Scientific , Haemometer—Brand: Mlabs / Glassco / Thermo Fisher Scientific , Haemocytometer—Generic / Wkm , Fresh Wrap Aluminum Foil –6Mtr Pkt, Brand: Fresh Wrap / Freshmetz , Micropipette Tips—Capacity / Vol.- 1000 ?L, Brand:Tarson / Genaxy / Himedia / Glassco , Micropipette Tips—Neutral Colour Vol.- 200 ?L, Brand: Tarson / Genaxy / Himedia / Glassco , Micropipettetips—Neutral Colour Vol.- 100 ?L, Brand: Tarson / Genaxy / Himedia / Glassco , 1-20 ?L Natural Bulk Non Sterilized Micropipette Tips—1000 Tips / Pkt, Brand:Genaxy / Thermo Fisher Scientific / Avantor , Micropipette Tips—Vol.:1-10 ?L, Brand: Himedia / Tarson / Genaxy / Thermo Fisher Scientific / Avantor , Micropipette Tips—Neutral Colour*Vol.- 0.5-10 ?L, Brand: Himedia / Tarson / Genaxy / Thermo Fisher Scientific / Avantor , 100-1000 ?L Natural Bulk Beveled Non Sterilized Micropipette Tips—500 Tips / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , 0.5-10?L Natural Racked Low Retention Non Sterilized—10 Racks / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , 0.5-20?L Natural Racked Non Sterilized—0 Racks / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , 1-200?L Yellow Racked Beveled Non Sterilized—10 Racks / Pk, Brand: Genaxy / Thermo Fisher Scientific / Avantor , 100-1000?L Blue Racked Beveled Non Sterilized—10 Racks / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Empty Racks For Gen Tips 200?L—0 Racks / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Empty Racks For Tips –1000?L, 10 Racks / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Empty Racks For Tips –5Ml To 10Ml, 10 / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Empty Racks For Eppendorf Style Tips—200?L, 10 Racks / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Click Seal Micro Centrifuge –B- Tube-0.6Ml Pre Sterilized, 10×100, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Click Seal Micro Centrifuge Tube –B Non-Sterilized, Attached Hinged Cap, Autoclavable, 1.5 Ml, 500 / Pkt, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Click Seal Micro Centrifuge Tube—G*Pre Sterilized Attached Hinged Cap, Air Tight Autoclavable, 2.0 Ml, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Click Seal Micro Centrifuge Tube—Non Sterilized, Conical Bottom, Attached Hinged Cap, Autoclavable, 5.0 Ml, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Centrifuge Tube—15 Ml, Brand: Genaxy / Thermo Fisher Scientific / Avantor , Centrifuge Tube—50Ml, Orange Cap, Non Sterile, Autoclavable, Brand: Himedia / Genaxy / Thermo Fisher Scientific / Avantor , Sterile Disposable Petri Plates*--Polystyrene, Optically Clear, Size : 90 Mm X 15 Mm, 600Pc Per Pkt, Brand: Himedia / Genaxy / Thermo Fisher Scientific / Avantor , Cryo Tubes –Vol.1.8 Ml ( 50 / Pkt ) , Brand: Genaxy / Thermo Fisher Scientific / Avantor , Blue Purple Nitrile Gloves—Medium Size, 100Per Pkt, Brand: Kimberly-Clark / Ansell , Micropipette 6-Pack Bundle—Single Channel, Variable, 0.1-2.5?L / 0.5-10?L / 2-20?L / 10-100?L / 20-200?L / 100-1000?L And Pipette Caousel, Brand: Thermofisher Scientific / Eppendorf / Gilson , Parafilm M Roll—125 Length X 4 Width, Brand: Parafilm / Lablink / Wkm / Himedia , Parafilm Dispenser—Brand: Lfas / Genaxy / Himedia / Glassco , Brown Packaging Paper Roll –0 Inch * 5 Mtr 120 Gsm Paper Roll ( Set Of 1, Brown ) , Brand: Eco Kraft / Himedia / Glassco , Rubber Gloves—00 Pcs Per Box, Brand: Urban Haat / Twenoz / Himedia , Laboratory Mask –100 Nos. Per Box, Brand: Knya Med / Himedia / Glassco , Test Tube Stand—3 Tier, Pc / Pack, Brand: Genaxy / Himedia / Glassco , Sample Bags ( Zipped ) —7×10, 100 Bags Per Packet, Brand: Bibhu / Genaxy / Himedia / Glassco , Non-Absorbent Cotton Wool—Brand: Himedia / Glassco / Sr Biotech , Absorbent Cotton Wool—Brand: Himedia / Glassco / Sr Biotech , Labeling Sticker—A4 Size, 100 / Pack, Brand: Genaxy / Himedia / Glassco , Filter Paper, Students Grade—100C, Brand: Genaxy / Himedia / Glassco , Syringe—5 Ml, 100Pc / Pack, Brand: Glassco / Meark / Bd India Pvt. Ltd / Dispovan , Syringe—2 Ml, 100Pc / Pack, Brand: Glassco / Meark / Bd India Pvt. Ltd / Dispovan , Embedding Cassettes, Plastic—100 Nos. / Pack, Brand: Harpal Sons / Genaxy / Himedia / Glassco , Swab Stick—100 Pc / Pkt, Brand: Apex International / Himedia / Glassco , Tissue Roll—12 / Pkt, Brand:Premier / Solimo / Origami , Kim-Wipes—Brand: Kimtech Science / Bd India Pvt. Ltd , Beaker Tong –12” Long , Made Of Stainless Steel, Brand: Comet / Himedia / Glassco , Autoclavable Bio Hazardous Bag—100Pc / Pack, Brand: Tarson / Himedia / Glassco , Ice Box With Chiller—4.7Liter, Blue Lid, Brand: Coleman / Cello / Milton , Spirit Lamp, Stand And Wire Combo—Brand: Sciencolab / Genaxy / Glassco , Slide Tray—6Pc / Pack, Brand: Tarson / Genaxy / Himedia / Glassco , Laboratory Head Caps—50 Nos. Per Box, Brand:Vinayakamart / Genaxy , Sample Container –Plastic, 100 Pc / Box, Brand: Welton / Genaxy / Glassco , Polypropylene Wash Bottle—250 Ml, 2Pc / Unit, Brand: Labifie / Genaxy / Glassco , Cryo- Cube Box—100 Places, 4 Pc / Pack, Brand: Lfas / Genaxy / Glassco , Inoculation Loops—Ni-Cr Alloy, 10 Pc / Pack, Brand: Generic / Genaxy / Glassco , Slide Box—Plastic, 100 Slide Capacity, Brand: Generic / Glassco , Slide Dispenser—Plastic, 50 Place, 2 Pc / Pack, Brand: Tarsons / Glassco , Blood Collection Tube—With Anti-Coagulant, Blue Cap1.8 Ml, 100Pc / Pack, Brand: Next Tube / Tar Son / Bd India Pvt. Ltd. , Mini Cooler—For Keeping Reagents And Enzymes. Freeze 00C Mini Cooler For 24 Hours At -50C To -100C, 32 Places And Capacity 1.5 Ml, Material- Polycarbonate Brand: Borosil / Riviera / Tarson , Sample Carrying Self-Sealing / Zip Lock Poly Pouches –600Gm ( 100Pc / Pkt ) , Brand: Bvslf , Gloves For Otg / Microwave—One Pair , Silicon Microwave Pinch Grip—One Pair , Bio Hazard Pedal Dustbin—Green, Yellow And Red, , Romanosky-Giemsasstaining Solution—500Ml, Brand: Himedia / Sigma-Aldrich , Methylene Blue—125 Ml Bottle, Brand: Merck / Thermo Fisher Scientific / Himedia , Formalin—5Liter Jar, Brand: Isochem / Labogen , Leishmen’Sstain—125 Ml, Brand: Apl / Himedia / Merck , Ethanol—5Lit Jar, Brand: Labogens / Himedia / Merck , Methanol—500 Ml, Brand: Quali-Tech / Himedia / Merck , Paraffin Wax—Melting Temperature:56-60°C, 500 Gm Container, Brand: Labogen / Himedia / Merck , Glycerine—200 Gm Bottle, Brand: Bhumija Life Sciences / Himedia / Merck , Dpx—500Ml, Brand: Quali-Tech / Merck / Qualigens , Cedar Wood Oil—250 Ml, Brand: Alphachemika / Himedia / Labogens , Xylene—500 Ml Amber Glass Bottle, Brand: Himedia / Merck / Glassco , Wbc Diluting Fluid—500Ml, Brand: Labogens / Himedia / Merck , Rbc Diluting Fluid—500Ml, Brand: Labogens / Himedia / Merck , Platelet Diluting Fluid—125Ml, Brand: Labogens / Himedia / Merck , Mayers Haematoxyline Stain—125Ml, Brand: Himedia / Merck / Bd India Pvt. Ltd. , Harrishaematoxyline Stain—125Ml, Brand: Himedia / Merck / Bd India Pvt. Ltd. , Eosin—2%W / V-125 Ml, Brand: Himedia / Merck / Bd India Pvt. Ltd. , Eosin Yellow Water Soluble—25 Gram, Brand: Himedia / Merck / Bd India Pvt. Ltd. , Hand Sanitizer, Liquid Hand Rub—500Ml, X10pc / Pkt, Brand: Himedia / Merck / Bd India Pvt. Ltd. , Phenyle—5Lit Jar, Brand: Entergent / Himedia / Merck , Isopropyl Alcohol—500 Ml, Brand: Labogens / Himedia / Merck , Hydrogen Peroxide—400Ml, Brand: Labogens / Himedia / Merck , N / 10 Hydrochloric Acid—500Ml, Brand: Thermofisher Scientific / Himedia / Merck , Nutrient Agar—500Gm, Brand:Himedia / Merck / Thermofisher Scentific , Nutrient Broth—500Gm, Brand:Himedia / Merck / Thermo Fisher Scentific , Agar Powder, Bacteriological—100Gm, Brand:Himedia / Merck / Thermo Fisher Scentific , Blood Agar Base—500Gm, Brand:Himedia / Merck / Thermo Fisher Scentific , Brain Heart Infusion ( Bhi ) Broth—500Gm, Brand:Himedia / Merck / Thermo Fisher Scentific , Brain Heart Infusion ( Bhi ) Agar—500Gm, Brand:Himedia / Merck / Thermo Fisher Scentific , Mueller Hinton Agar—500Gm, Brand:Himedia / Merck / Thermo Fisher Scentific , Gram’S Staining Kit With Allreagents Of Gram’S Staining -Brand: Himedia / Merck / Thermo Fisher Scentific , Capsule Staining Kit—Brand:Himedia / Merck / Thermo Fisher Scentific , Anaerobic Blood Agar Plate—50 Plates / Pkt, Himedia / Genaxy / Merck , Ornithine Decarboxylase Broth—100 Gm, Brand:Himedia / Genaxy / Borosil , Carbohydrate Fermentation Kit-Phenol Red Broth Base—100Gms, Sucrose– 25Gms, Lactose – 25Gms, Maltose – 10Gms, Inositol – 10Gms, Mannitol – 10Gms, Galactose – 10Gms, Sorbitol – 10Gms, Brand: Srl Pvt. Ltd. / Himedia / Merck , Imvic Test Kit—5 Kits / Pkt Each Kit Performs 10 Tests, Himedia / Merck / Thermo Fisher Scientific , Nitrate Reagent Discs—Twin Pack, 1 Vial, 50Discs / Vial, Test Brand:Himedia / Thermo Fisher Scientific / Sigma-Aldrich , Rapid Urease Test Broth—100Gm, Brand: Himedia / Thermo Fisher Scientific / Sigma-Aldrich , Oxidase—100 Strips, Brand:Merck / Himedia / S Science , Nutrient Gelatin—100Gm, Brand: Himedia / Merck / Thermo Fisher Scientific , Sterile Glycerol— ( 40% ) Ar Grade ( 500Ml ) , Himedia / Merck / Thermo Fisher Scientific , Peptone Water— ( 25×5Ml ) , Himedia / Merck / Thermo Fisher Scientific , Nitrate Broth Ar Grade—100Gm, Himedia / Merck / Thermo Fisher Scientific , Penicilling—10U / Disc, 100 / Vial, Himedia / Merck / Thermo Fisher Scientific , Amoxycillin / Clavulenic Acid –20 / 10 Mcg Per Disc, 100 / Vial, Himedia / Merck / Thermo Fisher Scientific , Cefotaxime –30 Mcg / Disc, 100 / Vial, Himedia / Merck / Thermo Fisher Scientific , Cefotaxime—5 Mcg / Disc, 100 / Vial, Himedia / Merck / Thermo Fisher Scientific , Piperacillin / Tazobactam—30 / 6 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Amoxicillin / Sulbactam—30 / 15 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Ceftriaxone / Tazobactam –30 / 10 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Amoxycillin / Clauvalenic Acid—20 / 10 Mcg / Disc, 100Discs / Vial, Brand: Himedia / Merck / Thermo Fisher Scientific , Amikacin –30 Mcg / Disc 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Gentamicin –10 Mcg / Disc, 100 / Vial, Himedia / Merck / Thermo Fisher Scientific , Streptomycin –10 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Azithromycin –15 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Tylosine—15 Mcg / Dusc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Sulphamethoxazole—25 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Tetracycline –30 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Doxycyclinhydrophloride—30 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Oxytetracyclin—30 Mcg / Disc, 100Disc / Vial, Brand: Himedia / Merck / Thermo Fisher Scientific , Levofloxacin –5Mcg / Disc, 100Discs / Vial, Brand: Himedia / Merck / Thermo Fisher Scientific , Ofloxacin –5 Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Ciprofloxacin –5Mcg / Disc, 100Discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Enrofloxacin—5Mcg / Disc100discs / Vial, Himedia / Merck / Thermo Fisher Scientific , Emeraldamp® Gt Pcr Master Mix—800 Rxns ( Reactions ) , Dss Takara / Qiagen / Thermo Fisher Scientific / Gcc Biotech , 1 Kb Dna Ladder—200Rxns, Brand: Qiagen / Biorad / Thermo Fisher Scientific / Gcc Biotech , 100 Bp Dna Ladder ( Dye Plus ) —Brand: Qiagen / Biorad / Thermo Fisher Scientific / Gcc Biotech , Ethidium Bromide Solution— ( 10Mg / Ml ) , 500 ?L / Pack, Brand: Himedia / Merck / Bd Ind Pvt Ltd. / Gcc Biotech , Agarose Special, High Eeo—100Gm, Qiagen / Biorad / Thermo Fisher Scientific / Gcc Biotech , Diluent For Dna Extraction—500Ml, Brand:Himedia / Merck / Thermo Fisher Scientific , Molecular Biology Grade Water ( Nfw ) —500Ml, Brand:Himedia / Thermo Fisher Scientific / Qiagen , Magnesium Chloride For Molecular Biology—Molecular Work, Brand:Sigma-Aldrich / Calbiochem , Gel Loading Dye ( Single ) —1Ml×5 / Pkt, Brand:Qiagen / Biorad / Thermo Fisher Scientific / Gcc Biotech , Taq Dna Polymerase—1U / ?L, Brand:Qiagen / Biorad / Thermo Fisher Scientific , 16Srrna Gene Primer For Ra--Forward Primer—Cagcttaactgtagaactgc, Reverse Primer-- Idt / Bioserve / Thermo Fisher Scientific / Gcc Biotech , Gyrb Gene Primer For Ra--Forward Primer -- Ggctaaggcaagacaagctg , Reverse Primer—Gcagttcctcctgcagagtc, Idt / Bioserve / Thermo Fisher Scientific / Gcc Biotech , Ribonuclease Z Gene Primer--Forward Primer—Ttaccgactgattgccttctag, Reverse Primer--, Idt / Bioserve / Thermo Fisher Scientific / Gcc Biotech , Te Buffer 10X—1 Lit, Qiagen / Biorad / Thermo Fisher Scientific / Gcc Biotech , 16Srrna Gene Pcr Product Sequencing—Idt / Bioserve / Thermo Fisher Scientific / Gcc Biotech , Serotype Specific Strains Types Serotype—India / Abroad-Microbiology Lab , Tris-Edta Buffersolution ( Ph-8 ) —100 Ml, Sigma-Aldrich / Himedia , Gsure® Bacterial Isolation Kit—50 Preparartions, Gcc Biotech , 10Mm Dntp Mix, Ultrapure—1000 ?L, Gcc Biotech

INR 1000 /-

INR 22757.0 /-

INR 7.58 Lakhs /-

Name of Work: e-Tender for Procurement of laboratory consumables under the SERB-DST sponsored research projects entitled “Molecular epidemiology, pathology and antibiogram of Riemerella anatipestifer of ducks in Tripura”for the Department of Veterinary Pathology, College of Veterinary Sciences &A.H., R.K.Nagar, West Tripura, forthe year 2022.

Sl. No.	Item Description
1	Micro glass slide, Frosted-50nos/box, Brand: Blue star/Merck/Thermo Fisher Scientific
2	Cover slip-100 pc/box, Brand: Generic /Merck/Blue star
3	Test tubes with cork lid - 15 ml-pack of 10pc, Brand: Generic /Merck/Thermo Fisher Scientific
4	Test tube holder-brass-Brand: Harpal son/Merck
5	Volumetric flask with cap- 1000ml, Brand: EISCO/Merck
6	Volumetric flask with cap--250ml, Brand: EISCO/Merck
7	Tissue Specimen Jar, Clear transparent glass with lid--Vol:1.2 L, Brand: Borosil/S Science
8	Glass Beaker (graduated) -- 250ml, Brand: WitegScientific/EISKO/Glassco/Thermo Fisher Scientific
9	Glass Beaker --500ml, 6pc/pack, Brand: LFAS/Glassco/Thermo Fisher Scientific
10	Glass Beaker -1000ml, 6 pc/pack, LFAS/Glassco/Thermo Fisher Scientific
11	Glass Beaker –2000ml, 2pc/pack, LFAS/Glassco/Thermo Fisher Scientific
12	Conical flask—250 ml, 6pc/pack, LFAS/Glassco/Thermo Fisher Scientific
13	Polycarbonate aluminum anaerobic culture Jar—3.5 lits, Brand: ALPHA CHEM/Glassco/Thermo Fisher Scientific
14	Metalic anaerobic culture Jar—3.5 lits, ALPHACHEM/Glassco/Thermo Fisher Scientific
15	Candle Jar –5 liters, BOROSIL/Glassco/Thermo Fisher Scientific
16	Homogenizer—100 to 1000 ml, Bionicsscientific/REMI/Glassco/BR Biochem
17	Magnetic stirrer—Capacity-1liter, REMI/Glassco/Thermo Fisher Scientific
18	Measuring cylinder –1000ml, LABIFIE/Glassco/Thermo Fisher Scientific
19	Screw Blue Caped Glass reagent bottle—100 ml, 4 pc/pack, Brand: WitegBorosilicated/ABG/Generic
20	Diamond Pencil—Brand: Micare India Inc/Glassco/Thermo Fisher Scientific
21	WintrobesHaematocrit tube –10pc/pack, Brand: MLABS/Glassco/Thermo Fisher Scientific
22	Haemometer—Brand: MLABS/Glassco/Thermo Fisher Scientific
23	Haemocytometer—Generic/WKM
24	Fresh wrap aluminum foil –6mtr Pkt, Brand: Fresh wrap/FRESHMETZ
25	Micropipette Tips—Capacity /Vol.- 1000 µl, Brand:Tarson/Genaxy/Himedia/Glassco
26	Micropipette Tips—Neutral Colour Vol.- 200 µl, Brand: Tarson/Genaxy/Himedia/Glassco
27	MicropipetteTips—Neutral Colour Vol.- 100 µl, Brand: Tarson/Genaxy/Himedia/Glassco
28	1-20 µl natural bulk non sterilized Micropipette Tips—1000 tips/pkt, Brand:Genaxy/Thermo Fisher Scientific /Avantor
29	Micropipette Tips—Vol.:1-10 µl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor
30	Micropipette Tips—Neutral Colour*Vol.- 0.5-10 µl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor
31	100-1000 µl natural bulk beveled non sterilized Micropipette Tips—500 tips/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
32	0.5-10µl natural racked low retention non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
33	0.5-20µl natural racked non sterilized—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
34	1-200µl yellow racked beveled non sterilized—10 racks/pk, Brand: Genaxy/Thermo Fisher Scientific /Avantor
35	100-1000µl Blue racked Beveled Non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
36	Empty racks for Gen tips 200µl—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
37	Empty racks for tips –1000µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
38	Empty racks for tips –5ml to 10ml, 10 /pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
39	Empty Racks for Eppendorf Style Tips—200µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
40	Click seal Micro Centrifuge –B- Tube-0.6ml pre sterilized, 10×100, Brand: Genaxy/Thermo Fisher Scientific /Avantor
41	Click seal Micro Centrifuge Tube –B non-sterilized, Attached hinged cap, autoclavable, 1.5 ml, 500/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
42	Click seal Micro Centrifuge Tube—G*Pre sterilized Attached hinged cap, air tight autoclavable, 2.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor
43	Click seal Micro Centrifuge Tube—non sterilized, conical bottom, Attached hinged cap, autoclavable, 5.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor
44	Centrifuge Tube—15 ml, Brand: Genaxy/Thermo Fisher Scientific /Avantor
45	Centrifuge Tube—50ml, Orange Cap,Non sterile, Autoclavable, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor
46	Sterile Disposable Petri Plates*--Polystyrene, Optically clear, size : 90 mm x 15 mm, 600pc per Pkt, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor
47	Cryo tubes –vol.1.8 ML(50/Pkt) , Brand: Genaxy/Thermo Fisher Scientific /Avantor
48	Blue purple nitrile gloves—medium size, 100per pkt, Brand: Kimberly-clark/Ansell
49	Micropipette 6-Pack Bundle—Single channel, variable, 0.1-2.5µl/0.5-10µl/2-20µl/10-100µl/20-200µl/100-1000µl and Pipette Caousel, Brand: ThermoFisher Scientific/ Eppendorf/Gilson
50	Parafilm M Roll—125" Length x 4 width,Brand: Parafilm/Lablink/WKM/Himedia
51	Parafilm dispenser—Brand: LFAS/Genaxy/Himedia/Glassco
52	Brown Packaging Paper Roll –0 Inch * 5 Mtr 120 gsm Paper Roll (Set of 1, Brown), Brand: Eco Kraft/Himedia/Glassco
53	Rubber gloves—00 pcs per box, Brand: Urban Haat/TWENOZ/Himedia
54	Laboratory mask –100 nos. per box, Brand: KNYA MED/Himedia/Glassco
55	Test tube stand—3 tier, pc/pack, Brand: Genaxy/Himedia/Glassco
56	Sample bags (Zipped)—7×10,100 bags per packet, Brand: Bibhu/Genaxy/Himedia/Glassco
57	Non-absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech
58	Absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech
59	Labeling sticker—A4 size, 100 /pack, Brand: Genaxy/Himedia/Glassco
60	Filter paper, Students grade—100c, Brand: Genaxy/Himedia/Glassco
61	Syringe—5 ml,100pc/pack, Brand: Glassco/Meark/BD India Pvt. Ltd/Dispovan
62	Syringe—2 ml, 100pc/pack, Brand: Glassco/Meark /BD India Pvt. Ltd/Dispovan
63	Embedding cassettes, Plastic—100 nos./pack,Brand: Harpal sons/Genaxy/Himedia/Glassco
64	Swab stick—100 pc/Pkt, Brand: Apex International/Himedia/Glassco
65	Tissue roll—12/Pkt, Brand:Premier/Solimo/ Origami
66	Kim-wipes—Brand: Kimtech science/BD India Pvt. Ltd
67	Beaker Tong –12” long , made of Stainless Steel, Brand: COMET/Himedia/Glassco
68	Autoclavable bio hazardous bag—100pc/pack, Brand: Tarson/Himedia/Glassco
69	Ice box with chiller—4.7liter, blue lid, Brand: Coleman/Cello/Milton
70	Spirit lamp, stand and wire combo—Brand: Sciencolab/Genaxy/Glassco
71	Slide tray—6pc/pack, Brand: Tarson/Genaxy/Himedia/Glassco
72	Laboratory head caps—50 nos. per box, Brand:Vinayakamart/Genaxy
73	Sample container –Plastic, 100 pc/box, Brand: Welton/Genaxy/Glassco
74	Polypropylene wash bottle—250 ml, 2pc/unit, Brand: LABIFIE/Genaxy/Glassco
75	Cryo- cube box—100 places, 4 pc/pack, Brand: LFAS/Genaxy/Glassco
76	Inoculation loops—Ni-Cr alloy, 10 Pc/pack, Brand: Generic/Genaxy/Glassco
77	Slide box—Plastic, 100 slide capacity, Brand: Generic/Glassco
78	Slide dispenser—Plastic, 50 place, 2 pc/pack,Brand: Tarsons/Glassco
79	Blood collection tube—With anti-coagulant, blue cap1.8 ml, 100pc/pack, Brand: Next tube/Tar son/BD India Pvt. Ltd.
80	Mini cooler—For keeping reagents and enzymes. Freeze 00C mini cooler for 24 hours at -50C to -100C, 32 places and capacity 1.5 ml, material- polycarbonate Brand: Borosil/Riviera/Tarson
81	Sample carrying self-sealing /zip lock poly pouches –600gm (100Pc/Pkt) , Brand: BVSLF
82	Gloves for OTG/Microwave—One Pair
83	Silicon Microwave pinch grip—One Pair
84	Bio Hazard Pedal Dustbin—Green, Yellow and RED,
85	Romanosky-Giemsa"sstaining solution—500ml, Brand: Himedia/Sigma-Aldrich
86	Methylene blue—125 ml bottle, Brand: Merck/Thermo Fisher Scientific/Himedia
87	Formalin—5liter jar, Brand: ISOCHEM/LABOGEN
88	Leishmen’sstain—125 ml,Brand: APL/Himedia/Merck
89	Ethanol—5lit jar, Brand: LABOGENS/Himedia/Merck
90	Methanol—500 ml, Brand: Quali-Tech/Himedia/Merck
91	Paraffin wax—Melting temperature:56-60°C, 500 gm container, Brand: LABOGEN/Himedia/Merck
92	Glycerine—200 gm bottle, Brand: Bhumija Life Sciences/Himedia/Merck
93	DPX—500ml, Brand: Quali-Tech/Merck/Qualigens
94	Cedar Wood Oil—250 ml,Brand: AlphaChemika/Himedia/LABOGENS
95	Xylene—500 ml amber glass bottle,Brand: Himedia/Merck/Glassco
96	WBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck
97	RBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck
98	Platelet diluting fluid—125ml,Brand: LABOGENS/Himedia/Merck
99	Mayer"s Haematoxyline stain—125ml, Brand: Himedia/Merck/BD India Pvt. Ltd.
100	Harri"sHaematoxyline stain—125ml,Brand: Himedia/Merck/BD India Pvt. Ltd.
101	Eosin—2%w/v-125 ml, Brand: Himedia/Merck/BD India Pvt. Ltd.
102	Eosin Yellow water soluble—25 gram,Brand: Himedia/Merck/BD India Pvt. Ltd.
103	Hand Sanitizer, liquid hand rub—500ml,X10pc/pkt, Brand: Himedia/Merck/BD India Pvt. Ltd.
104	Phenyle—5lit jar, Brand: Entergent/Himedia/Merck
105	Isopropyl alcohol—500 ml,Brand: LABOGENS/Himedia/Merck
106	Hydrogen peroxide—400ml, Brand: LABOGENS/Himedia/Merck
107	N/10 Hydrochloric acid—500ml, Brand: ThermoFisher Scientific/Himedia/Merck
108	Nutrient agar—500gm, Brand:Himedia/Merck/ThermoFisher Scentific
109	Nutrient broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
110	Agar powder, Bacteriological—100gm, Brand:Himedia/Merck/Thermo Fisher Scentific
111	Blood agar base—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
112	Brain Heart Infusion(BHI) broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
113	Brain Heart Infusion(BHI) agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
114	Mueller Hinton Agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
115	Gram’s staining kit With allreagents of Gram’s staining -Brand: Himedia/ Merck/Thermo Fisher Scentific
116	Capsule Staining Kit—Brand:Himedia/Merck/Thermo Fisher Scentific
117	Anaerobic blood agar plate—50 plates/Pkt, Himedia/Genaxy/Merck
118	Ornithine decarboxylase broth—100 gm, Brand:Himedia/Genaxy/Borosil
119	Carbohydrate fermentation kit-Phenol Red Broth Base—100gms,Sucrose– 25gms, Lactose – 25gms, Maltose – 10gms, Inositol – 10gms, Mannitol – 10gms,Galactose – 10gms, Sorbitol – 10gms, Brand: SRL Pvt. Ltd./Himedia/Merck
120	IMVIC test kit—5 kits/Pkt Each kit performs 10 tests, Himedia/Merck/Thermo Fisher Scientific
121	Nitrate reagent discs—Twin pack, 1 vial, 50discs/vial, test Brand:Himedia/Thermo Fisher Scientific /Sigma-Aldrich
122	Rapid Urease test broth—100gm, Brand: Himedia/Thermo Fisher Scientific /Sigma-Aldrich
123	Oxidase—100 strips, Brand:Merck/Himedia/S Science
124	Nutrient Gelatin—100gm, Brand: Himedia/Merck/Thermo Fisher Scientific
125	Sterile glycerol—(40%) AR grade (500ml), Himedia/Merck/Thermo Fisher Scientific
126	Peptone water—(25×5ml), Himedia/Merck/Thermo Fisher Scientific
127	Nitrate broth AR grade—100gm, Himedia/Merck/Thermo Fisher Scientific
128	PenicillinG—10U/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
129	Amoxycillin/Clavulenic acid –20/10 mcg per disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
130	Cefotaxime –30 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
131	Cefotaxime—5 mcg/disc,100/vial, Himedia/Merck/Thermo Fisher Scientific
132	Piperacillin / Tazobactam—30/6 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific
133	Amoxicillin/ Sulbactam—30/15 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific
134	Ceftriaxone/Tazobactam –30/10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
135	Amoxycillin/clauvalenic acid—20/10 mcg/Disc,100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific
136	Amikacin –30 mcg/disc 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
137	Gentamicin –10 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
138	Streptomycin –10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
139	Azithromycin –15 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
140	Tylosine—15 mcg/dusc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
141	Sulphamethoxazole—25 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
142	Tetracycline –30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
143	Doxycyclinhydrophloride—30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
144	Oxytetracyclin—30 mcg/disc, 100disc/vial, Brand: Himedia/Merck/Thermo Fisher Scientific
145	Levofloxacin –5mcg/disc, 100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific
146	Ofloxacin –5 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
147	Ciprofloxacin –5mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
148	Enrofloxacin—5mcg/disc100discs/vial, Himedia/Merck/Thermo Fisher Scientific
149	EmeraldAmp® GT PCR Master Mix—800 Rxns(Reactions), Dss Takara/Qiagen/Thermo Fisher Scientific/GCC Biotech
150	1 kb DNA Ladder—200Rxns, Brand: Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
151	100 bp DNA Ladder (Dye Plus)—Brand: Qiagen/Biorad/Thermo Fisher Scientific/ GCC Biotech
152	Ethidium bromide solution—(10mg/ml), 500 µl/pack, Brand: Himedia/Merck/BD Ind Pvt Ltd./ GCC Biotech
153	Agarose special, High EEO—100gm, Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
154	Diluent for DNA Extraction—500ML, Brand:Himedia/Merck/Thermo Fisher Scientific
155	Molecular Biology Grade Water(NFW)—500ml, Brand:Himedia/Thermo Fisher Scientific/Qiagen
156	Magnesium chloride for molecular biology—Molecular work, Brand:Sigma-Aldrich/Calbiochem
157	Gel loading dye(single)—1ml×5/ pkt, Brand:Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
158	Taq DNA polymerase—1U/ µl, Brand:Qiagen/Biorad/Thermo Fisher Scientific
159	16SrRNA gene Primer For RA--Forward primer—CAGCTTAACTGTAGAACTGC, Reverse primer-- IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
160	gyrB Gene primer for RA--Forward primer -- GGCTAAGGCAAGACAAGCTG , Reverse primer—GCAGTTCCTCCTGCAGAGTC, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
161	Ribonuclease Z gene primer--Forward primer—TTACCGACTGATTGCCTTCTAG, Reverse primer--, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
162	TE Buffer 10x—1 Lit,Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
163	16SrRNA gene PCR product sequencing—IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
164	Serotype specific strains types serotype—India/ abroad-microbiology Lab
165	Tris-EDTA buffersolution(pH-8)—100 mL, Sigma-Aldrich/Himedia
166	GSure® Bacterial Isolation Kit—50 Preparartions, GCC Biotech
167	10mM dNTP mix, ultrapure—1000 µl, GCC Biotech