Animal Resources Development Department has published Procurement Of Laboratory Consumables Under The Serb Dst Sponsored Research Projects For The Department Of Veterinary Pathology, College Of Veterinary Sciences And Ah, Rk Nagar, West Tripura For The Year 2022 Procurement Of Laboratory Consumables Under. Submission Date for this Tender is 06-10-2022. Clothing Accessories Tenders in West Tripura Tripura. Bidders can get complete Tender details and download the document.
Sl. No. | Item Description |
1 | Micro glass slide, Frosted-50nos/box, Brand: Blue star/Merck/Thermo Fisher Scientific |
2 | Cover slip-100 pc/box, Brand: Generic /Merck/Blue star |
3 | Test tubes with cork lid - 15 ml-pack of 10pc, Brand: Generic /Merck/Thermo Fisher Scientific |
4 | Test tube holder-brass-Brand: Harpal son/Merck |
5 | Volumetric flask with cap- 1000ml, Brand: EISCO/Merck |
6 | Volumetric flask with cap--250ml, Brand: EISCO/Merck |
7 | Tissue Specimen Jar, Clear transparent glass with lid--Vol:1.2 L, Brand: Borosil/S Science |
8 | Glass Beaker (graduated) -- 250ml, Brand: WitegScientific/EISKO/Glassco/Thermo Fisher Scientific |
9 | Glass Beaker --500ml, 6pc/pack, Brand: LFAS/Glassco/Thermo Fisher Scientific |
10 | Glass Beaker -1000ml, 6 pc/pack, LFAS/Glassco/Thermo Fisher Scientific |
11 | Glass Beaker –2000ml, 2pc/pack, LFAS/Glassco/Thermo Fisher Scientific |
12 | Conical flask—250 ml, 6pc/pack, LFAS/Glassco/Thermo Fisher Scientific |
13 | Polycarbonate aluminum anaerobic culture Jar—3.5 lits, Brand: ALPHA CHEM/Glassco/Thermo Fisher Scientific |
14 | Metalic anaerobic culture Jar—3.5 lits, ALPHACHEM/Glassco/Thermo Fisher Scientific |
15 | Candle Jar –5 liters, BOROSIL/Glassco/Thermo Fisher Scientific |
16 | Homogenizer—100 to 1000 ml, Bionicsscientific/REMI/Glassco/BR Biochem |
17 | Magnetic stirrer—Capacity-1liter, REMI/Glassco/Thermo Fisher Scientific |
18 | Measuring cylinder –1000ml, LABIFIE/Glassco/Thermo Fisher Scientific |
19 | Screw Blue Caped Glass reagent bottle—100 ml, 4 pc/pack, Brand: WitegBorosilicated/ABG/Generic |
20 | Diamond Pencil—Brand: Micare India Inc/Glassco/Thermo Fisher Scientific |
21 | WintrobesHaematocrit tube –10pc/pack, Brand: MLABS/Glassco/Thermo Fisher Scientific |
22 | Haemometer—Brand: MLABS/Glassco/Thermo Fisher Scientific |
23 | Haemocytometer—Generic/WKM |
24 | Fresh wrap aluminum foil –6mtr Pkt, Brand: Fresh wrap/FRESHMETZ |
25 | Micropipette Tips—Capacity /Vol.- 1000 µl, Brand:Tarson/Genaxy/Himedia/Glassco |
26 | Micropipette Tips—Neutral Colour Vol.- 200 µl, Brand: Tarson/Genaxy/Himedia/Glassco |
27 | MicropipetteTips—Neutral Colour Vol.- 100 µl, Brand: Tarson/Genaxy/Himedia/Glassco |
28 | 1-20 µl natural bulk non sterilized Micropipette Tips—1000 tips/pkt, Brand:Genaxy/Thermo Fisher Scientific /Avantor |
29 | Micropipette Tips—Vol.:1-10 µl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor |
30 | Micropipette Tips—Neutral Colour*Vol.- 0.5-10 µl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor |
31 | 100-1000 µl natural bulk beveled non sterilized Micropipette Tips—500 tips/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
32 | 0.5-10µl natural racked low retention non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
33 | 0.5-20µl natural racked non sterilized—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
34 | 1-200µl yellow racked beveled non sterilized—10 racks/pk, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
35 | 100-1000µl Blue racked Beveled Non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
36 | Empty racks for Gen tips 200µl—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
37 | Empty racks for tips –1000µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
38 | Empty racks for tips –5ml to 10ml, 10 /pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
39 | Empty Racks for Eppendorf Style Tips—200µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
40 | Click seal Micro Centrifuge –B- Tube-0.6ml pre sterilized, 10×100, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
41 | Click seal Micro Centrifuge Tube –B non-sterilized, Attached hinged cap, autoclavable, 1.5 ml, 500/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
42 | Click seal Micro Centrifuge Tube—G*Pre sterilized Attached hinged cap, air tight autoclavable, 2.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor |
43 | Click seal Micro Centrifuge Tube—non sterilized, conical bottom, Attached hinged cap, autoclavable, 5.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor |
44 | Centrifuge Tube—15 ml, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
45 | Centrifuge Tube—50ml, Orange Cap,Non sterile, Autoclavable, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor |
46 | Sterile Disposable Petri Plates*--Polystyrene, Optically clear, size : 90 mm x 15 mm, 600pc per Pkt, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor |
47 | Cryo tubes –vol.1.8 ML(50/Pkt) , Brand: Genaxy/Thermo Fisher Scientific /Avantor |
48 | Blue purple nitrile gloves—medium size, 100per pkt, Brand: Kimberly-clark/Ansell |
49 | Micropipette 6-Pack Bundle—Single channel, variable, 0.1-2.5µl/0.5-10µl/2-20µl/10-100µl/20-200µl/100-1000µl and Pipette Caousel, Brand: ThermoFisher Scientific/ Eppendorf/Gilson |
50 | Parafilm M Roll—125" Length x 4 width,Brand: Parafilm/Lablink/WKM/Himedia |
51 | Parafilm dispenser—Brand: LFAS/Genaxy/Himedia/Glassco |
52 | Brown Packaging Paper Roll –0 Inch * 5 Mtr 120 gsm Paper Roll (Set of 1, Brown), Brand: Eco Kraft/Himedia/Glassco |
53 | Rubber gloves—00 pcs per box, Brand: Urban Haat/TWENOZ/Himedia |
54 | Laboratory mask –100 nos. per box, Brand: KNYA MED/Himedia/Glassco |
55 | Test tube stand—3 tier, pc/pack, Brand: Genaxy/Himedia/Glassco |
56 | Sample bags (Zipped)—7×10,100 bags per packet, Brand: Bibhu/Genaxy/Himedia/Glassco |
57 | Non-absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech |
58 | Absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech |
59 | Labeling sticker—A4 size, 100 /pack, Brand: Genaxy/Himedia/Glassco |
60 | Filter paper, Students grade—100c, Brand: Genaxy/Himedia/Glassco |
61 | Syringe—5 ml,100pc/pack, Brand: Glassco/Meark/BD India Pvt. Ltd/Dispovan |
62 | Syringe—2 ml, 100pc/pack, Brand: Glassco/Meark /BD India Pvt. Ltd/Dispovan |
63 | Embedding cassettes, Plastic—100 nos./pack,Brand: Harpal sons/Genaxy/Himedia/Glassco |
64 | Swab stick—100 pc/Pkt, Brand: Apex International/Himedia/Glassco |
65 | Tissue roll—12/Pkt, Brand:Premier/Solimo/ Origami |
66 | Kim-wipes—Brand: Kimtech science/BD India Pvt. Ltd |
67 | Beaker Tong –12” long , made of Stainless Steel, Brand: COMET/Himedia/Glassco |
68 | Autoclavable bio hazardous bag—100pc/pack, Brand: Tarson/Himedia/Glassco |
69 | Ice box with chiller—4.7liter, blue lid, Brand: Coleman/Cello/Milton |
70 | Spirit lamp, stand and wire combo—Brand: Sciencolab/Genaxy/Glassco |
71 | Slide tray—6pc/pack, Brand: Tarson/Genaxy/Himedia/Glassco |
72 | Laboratory head caps—50 nos. per box, Brand:Vinayakamart/Genaxy |
73 | Sample container –Plastic, 100 pc/box, Brand: Welton/Genaxy/Glassco |
74 | Polypropylene wash bottle—250 ml, 2pc/unit, Brand: LABIFIE/Genaxy/Glassco |
75 | Cryo- cube box—100 places, 4 pc/pack, Brand: LFAS/Genaxy/Glassco |
76 | Inoculation loops—Ni-Cr alloy, 10 Pc/pack, Brand: Generic/Genaxy/Glassco |
77 | Slide box—Plastic, 100 slide capacity, Brand: Generic/Glassco |
78 | Slide dispenser—Plastic, 50 place, 2 pc/pack,Brand: Tarsons/Glassco |
79 | Blood collection tube—With anti-coagulant, blue cap1.8 ml, 100pc/pack, Brand: Next tube/Tar son/BD India Pvt. Ltd. |
80 | Mini cooler—For keeping reagents and enzymes. Freeze 00C mini cooler for 24 hours at -50C to -100C, 32 places and capacity 1.5 ml, material- polycarbonate Brand: Borosil/Riviera/Tarson |
81 | Sample carrying self-sealing /zip lock poly pouches –600gm (100Pc/Pkt) , Brand: BVSLF |
82 | Gloves for OTG/Microwave—One Pair |
83 | Silicon Microwave pinch grip—One Pair |
84 | Bio Hazard Pedal Dustbin—Green, Yellow and RED, |
85 | Romanosky-Giemsa"sstaining solution—500ml, Brand: Himedia/Sigma-Aldrich |
86 | Methylene blue—125 ml bottle, Brand: Merck/Thermo Fisher Scientific/Himedia |
87 | Formalin—5liter jar, Brand: ISOCHEM/LABOGEN |
88 | Leishmen’sstain—125 ml,Brand: APL/Himedia/Merck |
89 | Ethanol—5lit jar, Brand: LABOGENS/Himedia/Merck |
90 | Methanol—500 ml, Brand: Quali-Tech/Himedia/Merck |
91 | Paraffin wax—Melting temperature:56-60°C, 500 gm container, Brand: LABOGEN/Himedia/Merck |
92 | Glycerine—200 gm bottle, Brand: Bhumija Life Sciences/Himedia/Merck |
93 | DPX—500ml, Brand: Quali-Tech/Merck/Qualigens |
94 | Cedar Wood Oil—250 ml,Brand: AlphaChemika/Himedia/LABOGENS |
95 | Xylene—500 ml amber glass bottle,Brand: Himedia/Merck/Glassco |
96 | WBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck |
97 | RBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck |
98 | Platelet diluting fluid—125ml,Brand: LABOGENS/Himedia/Merck |
99 | Mayer"s Haematoxyline stain—125ml, Brand: Himedia/Merck/BD India Pvt. Ltd. |
100 | Harri"sHaematoxyline stain—125ml,Brand: Himedia/Merck/BD India Pvt. Ltd. |
101 | Eosin—2%w/v-125 ml, Brand: Himedia/Merck/BD India Pvt. Ltd. |
102 | Eosin Yellow water soluble—25 gram,Brand: Himedia/Merck/BD India Pvt. Ltd. |
103 | Hand Sanitizer, liquid hand rub—500ml,X10pc/pkt, Brand: Himedia/Merck/BD India Pvt. Ltd. |
104 | Phenyle—5lit jar, Brand: Entergent/Himedia/Merck |
105 | Isopropyl alcohol—500 ml,Brand: LABOGENS/Himedia/Merck |
106 | Hydrogen peroxide—400ml, Brand: LABOGENS/Himedia/Merck |
107 | N/10 Hydrochloric acid—500ml, Brand: ThermoFisher Scientific/Himedia/Merck |
108 | Nutrient agar—500gm, Brand:Himedia/Merck/ThermoFisher Scentific |
109 | Nutrient broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
110 | Agar powder, Bacteriological—100gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
111 | Blood agar base—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
112 | Brain Heart Infusion(BHI) broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
113 | Brain Heart Infusion(BHI) agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
114 | Mueller Hinton Agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
115 | Gram’s staining kit With allreagents of Gram’s staining -Brand: Himedia/ Merck/Thermo Fisher Scentific |
116 | Capsule Staining Kit—Brand:Himedia/Merck/Thermo Fisher Scentific |
117 | Anaerobic blood agar plate—50 plates/Pkt, Himedia/Genaxy/Merck |
118 | Ornithine decarboxylase broth—100 gm, Brand:Himedia/Genaxy/Borosil |
119 | Carbohydrate fermentation kit-Phenol Red Broth Base—100gms,Sucrose– 25gms, Lactose – 25gms, Maltose – 10gms, Inositol – 10gms, Mannitol – 10gms,Galactose – 10gms, Sorbitol – 10gms, Brand: SRL Pvt. Ltd./Himedia/Merck |
120 | IMVIC test kit—5 kits/Pkt Each kit performs 10 tests, Himedia/Merck/Thermo Fisher Scientific |
121 | Nitrate reagent discs—Twin pack, 1 vial, 50discs/vial, test Brand:Himedia/Thermo Fisher Scientific /Sigma-Aldrich |
122 | Rapid Urease test broth—100gm, Brand: Himedia/Thermo Fisher Scientific /Sigma-Aldrich |
123 | Oxidase—100 strips, Brand:Merck/Himedia/S Science |
124 | Nutrient Gelatin—100gm, Brand: Himedia/Merck/Thermo Fisher Scientific |
125 | Sterile glycerol—(40%) AR grade (500ml), Himedia/Merck/Thermo Fisher Scientific |
126 | Peptone water—(25×5ml), Himedia/Merck/Thermo Fisher Scientific |
127 | Nitrate broth AR grade—100gm, Himedia/Merck/Thermo Fisher Scientific |
128 | PenicillinG—10U/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
129 | Amoxycillin/Clavulenic acid –20/10 mcg per disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
130 | Cefotaxime –30 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
131 | Cefotaxime—5 mcg/disc,100/vial, Himedia/Merck/Thermo Fisher Scientific |
132 | Piperacillin / Tazobactam—30/6 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
133 | Amoxicillin/ Sulbactam—30/15 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
134 | Ceftriaxone/Tazobactam –30/10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
135 | Amoxycillin/clauvalenic acid—20/10 mcg/Disc,100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific |
136 | Amikacin –30 mcg/disc 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
137 | Gentamicin –10 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
138 | Streptomycin –10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
139 | Azithromycin –15 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
140 | Tylosine—15 mcg/dusc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
141 | Sulphamethoxazole—25 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
142 | Tetracycline –30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
143 | Doxycyclinhydrophloride—30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
144 | Oxytetracyclin—30 mcg/disc, 100disc/vial, Brand: Himedia/Merck/Thermo Fisher Scientific |
145 | Levofloxacin –5mcg/disc, 100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific |
146 | Ofloxacin –5 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
147 | Ciprofloxacin –5mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
148 | Enrofloxacin—5mcg/disc100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
149 | EmeraldAmp® GT PCR Master Mix—800 Rxns(Reactions), Dss Takara/Qiagen/Thermo Fisher Scientific/GCC Biotech |
150 | 1 kb DNA Ladder—200Rxns, Brand: Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
151 | 100 bp DNA Ladder (Dye Plus)—Brand: Qiagen/Biorad/Thermo Fisher Scientific/ GCC Biotech |
152 | Ethidium bromide solution—(10mg/ml), 500 µl/pack, Brand: Himedia/Merck/BD Ind Pvt Ltd./ GCC Biotech |
153 | Agarose special, High EEO—100gm, Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
154 | Diluent for DNA Extraction—500ML, Brand:Himedia/Merck/Thermo Fisher Scientific |
155 | Molecular Biology Grade Water(NFW)—500ml, Brand:Himedia/Thermo Fisher Scientific/Qiagen |
156 | Magnesium chloride for molecular biology—Molecular work, Brand:Sigma-Aldrich/Calbiochem |
157 | Gel loading dye(single)—1ml×5/ pkt, Brand:Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
158 | Taq DNA polymerase—1U/ µl, Brand:Qiagen/Biorad/Thermo Fisher Scientific |
159 | 16SrRNA gene Primer For RA--Forward primer—CAGCTTAACTGTAGAACTGC, Reverse primer-- IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
160 | gyrB Gene primer for RA--Forward primer -- GGCTAAGGCAAGACAAGCTG , Reverse primer—GCAGTTCCTCCTGCAGAGTC, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
161 | Ribonuclease Z gene primer--Forward primer—TTACCGACTGATTGCCTTCTAG, Reverse primer--, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
162 | TE Buffer 10x—1 Lit,Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
163 | 16SrRNA gene PCR product sequencing—IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
164 | Serotype specific strains types serotype—India/ abroad-microbiology Lab |
165 | Tris-EDTA buffersolution(pH-8)—100 mL, Sigma-Aldrich/Himedia |
166 | GSure® Bacterial Isolation Kit—50 Preparartions, GCC Biotech |
167 | 10mM dNTP mix, ultrapure—1000 µl, GCC Biotech |
Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy
For Tender Information Services Visit : TenderDetail