}

Laboratory Equipment and Supplies, Laboratory Equipments, Libraries and Related Materials, Nucleic Acid Extraction Kits, Laboratory Equipment, Laboratory Filtering Equipment, Laboratory Supplies, Laboratory Plasticware, NEW Delhi-Delhi

Indian Council Of Medical Research has published Laboratory Equipment and Supplies, Laboratory Equipments, Libraries and Related Materials, Nucleic Acid Extraction Kits, Laboratory Equipment, Laboratory Filtering Equipment, Laboratory Supplies, Laboratory Plasticware. Submission Date for this Tender is 12-12-2018. Libraries and Related Materials Tenders in NEW Delhi Delhi. Bidders can get complete Tender details and download the document.




Tender Notice

18311312
Laboratory Equipment and Supplies, Laboratory Equipments, Libraries and Related Materials, Nucleic Acid Extraction Kits, Laboratory Equipment, Laboratory Filtering Equipment, Laboratory Supplies, Laboratory Plasticware
Tender
Indian
Delhi
New Delhi
12-12-2018

Tender Details

Tender For Quotation For Supply Of Laboratory Chemicals/ Monoclonal Antibodies/Kits! Primers/ Lab. Plasticware, Etc. - AEC Mountant Connexin 43 Smooth muscle actin Connexin 40 N-cadherin - TNF-alpha Fibronectin Serological pipettes 1 ml Serological pipettes 2 ml Serological pipettes 5 ml Serological pipettes 10 ml , Cell Culture dish. 1OOx2Omm 6-well culture plate, TC treated Microcentrifugc tubes l.7ml DMEM media Antibiotic- Antirnycotic solution PBS. pH7.4 IX Falcon tube 15 ml Falcon tube 50 ml Microtip 1Oul Microtip 200u1 Microtip 1000ul Syringe Filter, 0.22 urn Syringe filter, 0.45urn , immuno Non-sterile 96 Well Plates TaqMan Gene Expression Assay (FAM) Fetal Bovine Serum lrypsin-EDTA Clandin 4 Antibody (Monoclonal) 50X TAF buffer, ultra pure grade lox ViBufferA 50mM MgCI2 10mM dNTP mix GF-1 Tissue DNA extraction kit ViPrime PLUS gPCR master mix with Rox cDNA synthesis kit Ehedium Bromide Hi G9 Tag DNA polymerase 6X gel loading dye 2X RNA gel loading dye Sodium dodecyl sulläte Hi grade nuclease free water 5’ CAGGGTGGTGCTCCAAATTAC 3’ catalase F 5’GTGTTGAATCTCCGCACTTCTC 3’ catakase R 5q GGACTACACCCAGATGAACGA 3’GPXI F ’ GTTCTCCTGATGCCCAAACTG 3’ GPXI R 5’ CGGCCTTCTGTTCCTGATAAA 3’ MMPI4 F 5’ CGCTCCTTGAAGACAAACATCTC 3’ MMP14 R 5’ ACGCCAGCTAAGCATAGTAAGA 3’ TIMP2 F 5’ (iTCCTGGAGGCTGAGAAAGAA 3’ TIMP2 R HS-miR -873sp MiScript primer assay HS-miR - 223.3p miScript primer assay HS-MiR-517a-3p miScript primer say FTD STD9 kit Trizol Reagent Trizol LS RNA latter 3M Sodium acetate KIMBERLY..CLARK* PURPLE NITRILE * (SmaJlj KJMIIERLY...CLARK* PURPLE N1TRILE * (SmalJ) Glycerol for molecular biology PMSF ART 10 Bulk

Key Value

Document Fees
Refer document
Tender Value
Refer document
Disclaimer :
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tell us about your Product / Services,
We will Find Tenders for you

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail