}
  • Home   ›
  •   Indian Tenders   › Tender Notice : 18311312

    • Laboratory Equipment and Supplies, Laboratory Equipments, Libraries and Related Materials, Nucleic Acid Extraction Kits, Laboratory Equipment, Laboratory Filtering Equipment, Laboratory Supplies, Laboratory Plasticware, NEW Delhi-Delhi

    Indian Council Of Medical Research-ICMR has published Laboratory Equipment and Supplies, Laboratory Equipments, Libraries and Related Materials, Nucleic Acid Extraction Kits, Laboratory Equipment, Laboratory Filtering Equipment, Laboratory Supplies, Laboratory Plasticware. Submission Date for this Tender is 12-12-2018. Libraries and Related Materials Tenders in NEW Delhi Delhi. Bidders can get complete Tender details and download the document.




    Tender Notice

    18311312
    Laboratory Equipment and Supplies, Laboratory Equipments, Libraries and Related Materials, Nucleic Acid Extraction Kits, Laboratory Equipment, Laboratory Filtering Equipment, Laboratory Supplies, Laboratory Plasticware
    Open Tender
    Indian
    Delhi
    NEW Delhi
    12-12-2018

    Tender Details

    Tender For Quotation For Supply Of Laboratory Chemicals/ Monoclonal Antibodies/Kits! Primers/ Lab. Plasticware, Etc. - AEC Mountant Connexin 43 Smooth muscle actin Connexin 40 N-cadherin - TNF-alpha Fibronectin Serological pipettes 1 ml Serological pipettes 2 ml Serological pipettes 5 ml Serological pipettes 10 ml , Cell Culture dish. 1OOx2Omm 6-well culture plate, TC treated Microcentrifugc tubes l.7ml DMEM media Antibiotic- Antirnycotic solution PBS. pH7.4 IX Falcon tube 15 ml Falcon tube 50 ml Microtip 1Oul Microtip 200u1 Microtip 1000ul Syringe Filter, 0.22 urn Syringe filter, 0.45urn , immuno Non-sterile 96 Well Plates TaqMan Gene Expression Assay (FAM) Fetal Bovine Serum lrypsin-EDTA Clandin 4 Antibody (Monoclonal) 50X TAF buffer, ultra pure grade lox ViBufferA 50mM MgCI2 10mM dNTP mix GF-1 Tissue DNA extraction kit ViPrime PLUS gPCR master mix with Rox cDNA synthesis kit Ehedium Bromide Hi G9 Tag DNA polymerase 6X gel loading dye 2X RNA gel loading dye Sodium dodecyl sulläte Hi grade nuclease free water 5’ CAGGGTGGTGCTCCAAATTAC 3’ catalase F 5’GTGTTGAATCTCCGCACTTCTC 3’ catakase R 5q GGACTACACCCAGATGAACGA 3’GPXI F ’ GTTCTCCTGATGCCCAAACTG 3’ GPXI R 5’ CGGCCTTCTGTTCCTGATAAA 3’ MMPI4 F 5’ CGCTCCTTGAAGACAAACATCTC 3’ MMP14 R 5’ ACGCCAGCTAAGCATAGTAAGA 3’ TIMP2 F 5’ (iTCCTGGAGGCTGAGAAAGAA 3’ TIMP2 R HS-miR -873sp MiScript primer assay HS-miR - 223.3p miScript primer assay HS-MiR-517a-3p miScript primer say FTD STD9 kit Trizol Reagent Trizol LS RNA latter 3M Sodium acetate KIMBERLY..CLARK* PURPLE NITRILE * (SmaJlj KJMIIERLY...CLARK* PURPLE N1TRILE * (SmalJ) Glycerol for molecular biology PMSF ART 10 Bulk

    Key Value

    Document Fees
    Refer document
    EMD
    Refer document
    Tender Value
    Refer document
    Disclaimer :
    We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
    Tell us about your Product / Services,
    We will Find Tenders for you
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail