}

Laboratory Equipment and Supplies, Laboratory Supplies, Test Tubes, Laboratory Glassware, Tissue Culture, Pipette Tips, Laboratory Equipments, Laboratory Equipment, Histology Equipment, Laboratory Electrophoresis and Blotting System, GOVT VICTORIA COLLEGE PALAKKAD-Kerala

Government College-GC has published Laboratory Equipment and Supplies, Laboratory Supplies, Test Tubes, Laboratory Glassware, Tissue Culture, Pipette Tips, Laboratory Equipments, Laboratory Equipment, Histology Equipment, Laboratory Electrophoresis and Blotting System. Submission Date for this Tender is 21-11-2018. Test Tubes Tenders in GOVT VICTORIA COLLEGE PALAKKAD Kerala. Bidders can get complete Tender details and download the document.




Tender Notice

18022148
Laboratory Equipment and Supplies, Laboratory Supplies, Test Tubes, Laboratory Glassware, Tissue Culture, Pipette Tips, Laboratory Equipments, Laboratory Equipment, Histology Equipment, Laboratory Electrophoresis and Blotting System
Open Tender
Indian
Kerala
GOVT VICTORIA COLLEGE PALAKKAD
21-11-2018

Tender Details

Supply Of Laboratory Equipments Chemicals Glasswares Etc-6.2 Blade And Holder For Yorko Microtome ( Pkt ) 6.21 Bacteriological Incubator 6.22 Hot Plate 6.23 Transilluminator 6.24 Micropipette 1-10Ml 6.25 Micropipette 100- 1000Ml 6.26 Pipette Tips And Tip Box 1000Ul ( 1*5 ) 6.27 Pipette Tips And Tip Box 100Ul ( 1*5 ) 6.28 Pipette Tips And Tip Box 1- 10Ml ( 1*5 ) 6.29 Petri Plates ( Autoclavable ) ( 100 Nos ) 6.3 Centrifuge Tubes With Screw Cap 15Ml 6.31 Eppendorf Tubes 6.32 Digital Colony Counter 6.33 Spatula 6.34 Tissue Paper Rolls 6.35 Laboratory Mask ( ( Medium Pkt ) 7 Charts And Maps To Zoology Dept 7.01 Homologous Organs 7.02 Analogous Organs 7.03 Connecting Link 7.04 Vestigial Organ 7.05 Adaptive Radtion 7.06 Zoogeographical Realms 7.07 Archeopteryx 8 Genes , Accession Number And Primers Ton Zoology Dept 8.01 Hsp 70:DQ311189.1,FP 8.02 Hsp 40:-AB206400,FP- CCCGGGCGATATCTTCTAAT 8.03 Hsp 20.4:-AF315318,FP- TTTTGGCCTTGCCTTAACAC,RP- TTCGCTCTGGTCCTTGATCT 8.04 Hsp 20.8:-AF315317,FP- CTAACCCCGAACGACATGCT,RP- GATGTACCCATCGGCAGTCT 8.05 Hsp 90:-AB060275,FP- CACAATGGGATACATGGCTGC,RP- GATGAGCCGATTCAGGTTGAAG 8.06 rp49:-AB048205,FP- GCATCAATCGGATCGCTATGAC,RP- CAAGAAGACCCGTCATATGCT 8.07 Bacterial Universal Primer:-RP- CAAGAAGACCCGTCATATGCT,1492R TACGGYTACCTTGTTACGACTT 8.08 Bm apaf 1:-FP-GGTTTGCTCGTAATGGAC,RP- CAGGACCAGTGGAGGCT 8.09 BmDredd:-FP-AGTGACAGAAATGCTTGGAAC, AGTGACAGAAATGCTTGGAAC 8.1 BmYki:-FP- CGAAGAGTACAAGTAATACGACAA,RP- TACGAGCTGCGTGATTAATG 8.11 BmCreb:-FP-TCTACCCAGTCAGGCTCCC,RP- ACTCCTTTTTCTTTCTGCGG 8.12 BmCaspase 1:-RP-ACTCCTTTTTCTTTCTGCGG, TGTGTTTCTCCAAGAGTAATAA 8.13 Bmspz4:-RP-TGTGTTTCTCCAAGAGTAATAA,RP CGATATTTCAAACGCCACGTCCGC 8.14 Silkworm cytoplasmic actin A3 gene:-FP- AACACCCCGTCCTGCTCACTG,RP- GGGCGAGACGTGTGATTTCCT 8.15 Bcl2:-FP-CCTGTGGATGACTGAGTACC,RP- GAGACAGCCAGGAGAAATCA 8.16 CYP 15A1:-1327966 8.17 BmHR 3 A:- FP-TACGCGCCGAAACTTTCA,RP- CTCCAGCTTGCTCACAGA

Key Value

Document Fees
Refer document
EMD
INR 10000.0 /-
Tender Value
INR 10 Lakhs /-
Disclaimer :
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tell us about your Product / Services,
We will Find Tenders for you

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail