AIIMS Tenders - View latest All India Institute Of Medical Sciences eTenders

AIIMS Tenders - Get latest update on All India Institute Of Medical Sciences Tenders. Search AIIMS civil Tenders, Construction Tenders, Supply Tenders, Services Tenders published on All India Institute Of Medical Sciences e-tendering portal & e-Procurement website are available on AIIMS tender page. Many live business opportunities are available in AIIMS Tenders section. All India Institute Of Medical Sciences Tenders are further filtered by Bid Submission Date, Tender Value, Project Location & Product Category. Get daily alert on AIIMS Tenders.

1

Government Departments - patna - Bihar

43191693 tender for re- insulation of hvac pipeline and duct in various ward, corridor in ipd at aiims patna

Due Date : May 7, 2024
Tender Value : rupee 1.32 Crore
View Notice
2

Government Departments - patna - Bihar

43191519 tender for providing and installation of central heating system (hot water) in existing central air conditioning

Due Date : May 7, 2024
Tender Value : rupee 7.17 Lakhs
View Notice
3

Government Departments - Patna - Bihar

43191270 bids are invited for t-piece resuscitator, comprehensive type annual maintenance contract 1st year, comprehensive type annual maintenance contract 2nd year, comprehensive type annual maintenance contract 3rd year, comprehensive type annual maintenance contract 4th year, comprehensive type annual maintenance contract 5th yea total quantity : 9

Due Date : Apr 20, 2024
Tender Value : Ref. Document
View Notice
4

Government Departments - bhopal - Madhya Pradesh

43189679 tender for procurement of accessories for nihon kohden meb-2300k system (electrodes and stimulators) make: “nihon khoden, japan”

Due Date : Apr 27, 2024
Tender Value : Ref. Document
View Notice
5

Government Departments - Jodhpur - Rajasthan

43188588 quotation for consumables and non-consumables -1. primer kras exon 2f (gtgtgacatgttctaatatagtca) 2. primer kras exon 2r (gaatggtcctgcaccagtaa) 3. primer kras exon 3f (tcaagtcctttgcccatttt) 4. primer kras exon 3r (tacacaaagaaagccctcccc) 5. primer kras exon 4f (ttgtggacaggttttgaaaga) 6. primer kras exon 4r (agaagcaatgccctctcaag) 7. 2x platinum superfi pcr pcr master 8. highprep pcr – dx (5ml) 9. highprep dtr-dx (5ml) 10. mymag™ 96x magnetic plate

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
6

Government Departments - Jodhpur - Rajasthan

43188560 quotation for colorado micro dissection needle

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
7

Government Departments - Jodhpur - Rajasthan

43188554 quotation for consumables and non-consumables -1. mannequine (male multi-venous access arm kit) 2. skin and multi vein kit 3. iv bag & tubing kit 4. salsa mlpa reagent kit 5. salsa mlpa probemix (erbb2)

Due Date : Apr 23, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - raipur - Chhattisgarh

43188051 gte for supply and installation of real time pcr system for department of biochemistry at aiims raipur

Due Date : May 15, 2024
Tender Value : Ref. Document
View Notice
9

Government Departments - bhopal - Madhya Pradesh

43188043 supply of gas chromatography with head space , gas chromatography with head space with 5 years warranty (technical specifications will be as per nit) , annual comprehensive maintenance contract for 05 years (6th year to 10th year after warranty) for gas chromatography with head space

Due Date : May 15, 2024
Tender Value : rupee 25 Lakhs
View Notice
10

Government Departments - rishikesh - Uttarakhand

43188034 tender for procurement of video endoscope processor with 4k monitor for the department of gastroenterology in aiims, rishikesh

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
11

Government Departments - Nagpur - Maharashtra

43185015 expression of interest (eoi) to run patient attendant shelter (dharamshala) at all indian institute of medical sciences, nagpur

Due Date : May 13, 2024
Tender Value : Ref. Document
View Notice
12

Government Departments - patna - Bihar

43184992 tender for purchase of consumables for automated sperm quality analyzer at aiims, patna on proprietary basis inviting comments thereon.- sqa v capillary (disposable). 50s pack-150 test sqa v cleaning kit 25s optional consumables qwikcheck beads controls -3x5ml qwikcheck liquefaction kit-100 test qwikcheck dilution kit-50ml qwikcheck wbc/ph strips-100 test qwikcheck vitality 5x1.5ml qwikcheck dfi 10 test qwikcheck morphology pre-stained slide-25 slides qwikcheck morphology quik diff 3x100ml

Due Date : May 2, 2024
Tender Value : Ref. Document
View Notice
13

Government Departments - Samba - Jammu And Kashmir

43184838 bids are invited for multipara monitor - low end ( q2 ) total quantity : 15

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
14

Government Departments - BATHINDA - Punjab

43183645 tender for orthodontic instruments for the department of dentistry band removing plier 01 bird beak style plier 01 hard wire cutter 01 distal end cutter 03 rectangular arch forming plier 01 three prong plier 01 weingart plier 03 bracket tweezer for posterior 02 bracket tweezer for anterior 02 mathieu needle holder 02 mershon band adapter 02 light wire cutter angled 04 bracket positioning gauge 0.022 slot 01 ligature tucker 02 symgrid 02 orthodontic photo metallic reflector biplane: occlusal a...

Due Date : Apr 30, 2024
Tender Value : Ref. Document
View Notice
15

Government Departments - Patna - Bihar

43183132 tender for providing and fixing of floor tiles in private ward bathroom d6a ward ipd at aiims patna.

Due Date : Apr 22, 2024
Tender Value : rupee 2.75 Lakhs
View Notice
16

Government Departments - Patna - Bihar

43183125 tender for providing and fixing ms grill with gate in condemnation zone and ms grating in basement of medical college at aiims patna

Due Date : Apr 22, 2024
Tender Value : rupee 2.50 Lakhs
View Notice
17

Government Departments - Patna - Bihar

43183119 tender for dismentalling and construction of aluminium partition at 1 floor of ayush & pmr building at aiims patna.

Due Date : Apr 22, 2024
Tender Value : rupee 1.28 Lakhs
View Notice
18

Government Departments - Delhi - Delhi

43182810 tender for operation and maintenance of addressable type afas in hostel no 16 and 17 sh ii addition alteration of fire alarm spares in hostel no 16

Due Date : May 8, 2024
Tender Value : rupee 26.28 Lakhs
View Notice
19

Government Departments - Multi State

43182723 tender for annual repair maintenance of burns and plastic surgery block sh replacement of damaged/broken flush door shutters in power grid vishram sadan at aiims

Due Date : Apr 20, 2024
Tender Value : rupee 5.98 Lakhs
View Notice
20

Government Departments - New Delhi - Delhi

43182674 tender for supply , installation, testing and commissioning of split ac units of 2 tr capacity for super specialty division of forensic pathology and 1.5 tr watc for molecular dna laboratory , jpnatc aiims new delhi

Due Date : May 8, 2024
Tender Value : rupee 1.61 Lakhs
View Notice
21

Government Departments - Multi State

43182579 tender for s/r to main hospital sh: renovation of c-5 ward at aiims. civil, electrical and a/c r work composite

Due Date : May 8, 2024
Tender Value : rupee 2.11 Crore
View Notice
22

Government Departments - New Delhi - Delhi

43182563 tender for replacement and pitc new window ac split ac at various locations like mch engineering enauiries mortuary guest house faculty club etc on buy back basis at aiims new delhi

Due Date : May 8, 2024
Tender Value : rupee 8.24 Lakhs
View Notice
23

Government Departments - New Delhi - Delhi

43182542 tender for s/r to c n centre sh: renovation of nsicu-a first floor at aiims, new delhi. composite work

Due Date : May 7, 2024
Tender Value : rupee 56.41 Lakhs
View Notice
24

Government Departments - New Delhi - Delhi

43182526 tender for maintenance of telephone exchange at aiims new delhi. sh- replacement of existing damaged epabx system for computer facility and other related miscellaneous telephone works.

Due Date : May 7, 2024
Tender Value : rupee 15.11 Lakhs
View Notice
25

Government Departments - Multi State

43182510 tender for annual repair and maintenance of to p.c and teaching block. sh: internal finishing work at various locations at aiims.

Due Date : May 7, 2024
Tender Value : rupee 14.28 Lakhs
View Notice
26

Government Departments - New Delhi - Delhi

43182476 tender for supply installation testing commissioning of air curtain at various location of jpnatc at aiims new delhi

Due Date : May 8, 2024
Tender Value : rupee 3.58 Lakhs
View Notice
27

Government Departments - New Delhi - Delhi

43182466 tender for pitc of precision type air conditioners in ups room gf and basement no one in new rak opd at aiims new delhi

Due Date : May 8, 2024
Tender Value : rupee 27.77 Lakhs
View Notice
28

Government Departments - NEW Delhi - Delhi

43182449 tender for s/r to new rak opd at masjid moth sh: - making an endoscopy suits for new rak opd, 7th floor, b block at aiims, new delhi composite work.

Due Date : Apr 24, 2024
Tender Value : rupee 4.82 Crore
View Notice
29

Government Departments - deoghar - Jharkhand

43181390 management of parking areas and control of traffic at hospital complex, aiims deoghar

Due Date : May 9, 2024
Tender Value : Ref. Document
View Notice
30

Government Departments - delhi - Delhi

43181387 purchase of arthroscopy system 1 set as per tender enquiry documents , 3-chip, 4k endoscopic camera system , led light source with 2 fiber optic cable , medical grade 31” 4k led monitor , endocart , recording system , shaver system and radiofrequency ablation system , 4k arthroscope , arthroscopy fluid management pump , hand held instruments

Due Date : May 14, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - delhi - Delhi

43181385 purchase of vats instruments as per tender enquiry documents , vats instruments as required in section vii ( technical specifications )

Due Date : May 14, 2024
Tender Value : Ref. Document
View Notice
32

Government Departments - patna - Bihar

43181340 operation and maintenance of six dg set of 2000 kva set at aiims patna

Due Date : May 6, 2024
Tender Value : rupee 77.23 Lakhs
View Notice
33

Government Departments - raipur - Chhattisgarh

43181262 one year rate contract for the supply of mic colistin kit (2nd call) for microbiology department , consumables items for microbiology department: , mic colistin kit specification:- broth microdilution based kit for testing mic of colistin, single test strips for colistin only, microwells pre-coated with colistin sulphate dilutions from 0.25 to 16 mg/l concentration and growth control well, separated cation adjusted mueller hinton broth be available as ready to use note- the kit provided should ...

Due Date : May 2, 2024
Tender Value : Ref. Document
View Notice
34

Government Departments - patna - Bihar

43181244 tender for operation and comprehensive annual maintenance contract of central hvac plant for hospital building, medical college and auditorium at aiims patna.

Due Date : May 7, 2024
Tender Value : rupee 1.85 Crore
View Notice
35

Government Departments - Raipur - Chhattisgarh

43181173 quotations for purchase of plasma filter adult size for nephrology department at aiims raipur.

Due Date : Apr 24, 2024
Tender Value : Ref. Document
View Notice
36

Government Departments - Raipur - Chhattisgarh

43180992 tender of one year rate contract for supply of mic colistin kit (2nd call) for microbiology department

Due Date : May 2, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - raebareli - Uttar Pradesh

43178560 consumable items for anatomy department ( intramural project-014 ) , consumable items , set of harris mat foot imprinter with ink roller, ink, ink pad and paper. , foot print paper

Due Date : Apr 26, 2024
Tender Value : rupee 2.50 Lakhs
View Notice
38

Government Departments - New Delhi - Delhi

43177010 bids are invited for purchase of dose calibrator total quantity : 3

Due Date : Apr 18, 2024
Tender Value : Ref. Document
View Notice
39

Government Departments - patna - Bihar

43176630 tender for supply and fixing of electrical panel in auditorium at aiims patna

Due Date : May 6, 2024
Tender Value : rupee 3.41 Lakhs
View Notice
40

Government Departments - patna - Bihar

43176628 operation and camc of substation no - 1,2,3,4,5,6 and residential complex at aiims patna

Due Date : May 6, 2024
Tender Value : rupee 2.69 Crore
View Notice
41

Government Departments - patna - Bihar

43176620 internal renovation of old building at residential complex aiims internal renovation of old building at residential complex aiims patna

Due Date : May 6, 2024
Tender Value : rupee 87.16 Lakhs
View Notice
42

Government Departments - new Delhi - Delhi

43175531 auction notice invited for disposal of misc machinery & equipment

Due Date : Apr 26, 2024
Tender Value : Ref. Document
View Notice
43

Government Departments - jodhpur - Rajasthan

43175291 tender for construction of two pradhan mantri bhartiya janaushadi kendra ( pmbjk ) at opd entrance and in front of trauma- emergency block at aiims jodhpur

Due Date : Apr 30, 2024
Tender Value : Ref. Document
View Notice
44

Government Departments - Nagpur - Maharashtra

43175178 tender for supply of computer trolley (computer on wheels) (cow) for taking bedside notes in wards at aiims nagpur. quantity 10

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
45

Government Departments - Multi State

43174951 purchase of intraosseous vascular access needle for department fo emergency medicine, aiims on proprietary basis (agfa)

Due Date : May 1, 2024
Tender Value : Ref. Document
View Notice
46

Government Departments - raipur - Chhattisgarh

43171617 tender for supply of scrub typhus rt pcr kit (3rd call) for molecular laboratory of microbiology department , consumables items for microbiology department: , scrub typhus rt pcr kit pack size : (1 x 96 rxn)

Due Date : May 2, 2024
Tender Value : Ref. Document
View Notice
47

Government Departments - raipur - Chhattisgarh

43171586 procurement of video bronchoscope system for department of pediatrics at aiims raipur ( cg ) , video bronchoscope system ( specification as per annexure-i ) , cmc of equipment1st year , cmc of equipment for 2nd year , cmc of equipment for 3rd year , cmc of equipment for 4th year , cmc of equipment for 5th year

Due Date : May 7, 2024
Tender Value : Ref. Document
View Notice
48

Government Departments - Patna - Bihar

43170766 tender for construction of aluminium partition at main corridor of ot 5th floor near staircase between a & b block for department of anaesthesiology in ipd at aiims patna.

Due Date : Apr 18, 2024
Tender Value : rupee 49138.0
View Notice
49

Government Departments - Patna - Bihar

43170721 tender for construction of wooden counter in ehs pharmacy in basement of ayush pmr at all india institute of medical sciences patna

Due Date : Apr 18, 2024
Tender Value : rupee 49138.0
View Notice
50

Government Departments - Patna - Bihar

43170691 tender for construction of aluminum partition and granite slab in radiotherapy department in opd building at all india institute of medical sciences patna

Due Date : Apr 18, 2024
Tender Value : rupee 3.33 Lakhs
View Notice
    Top
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail